Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 5643-5652, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Hemorrhage, Impaired Hematopoiesis, and Lethality in Mouse
Embryos Carrying a Targeted Disruption of the Fli1
Transcription Factor
Demetri D.
Spyropoulos,1,2
Pamela N.
Pharr,3,4
Kim R.
Lavenburg,1
Pascale
Jackers,1
Takis S.
Papas,1,2,3
Makio
Ogawa,2,3,4 and
Dennis K.
Watson1,2,*
Center for Molecular and Structural
Biology,1 Hollings Cancer
Center,2 and Department of
Medicine,3 Medical University of South
Carolina, and Ralph H. Johnson VA Medical
Center,4 Charleston, South Carolina 29425
Received 21 January 2000/Returned for modification 20 March
2000/Accepted 25 April 2000
 |
ABSTRACT |
The Ets family of transcription factors have been suggested to
function as key regulators of hematopoeisis. Here we describe aberrant
hematopoeisis and hemorrhaging in mouse embryos homozygous for a
targeted disruption in the Ets family member, Fli1. Mutant embryos are
found to hemorrhage from the dorsal aorta to the lumen of the neural
tube and ventricles of the brain (hematorrhachis) on embryonic day 11.0 (E11.0) and are dead by E12.5. Histological examinations and in situ
hybridization reveal disorganization of columnar epithelium and the
presence of hematomas within the neuroepithelium and disruption of the
basement membrane lying between this and mesenchymal tissues, both of
which express Fli1 at the time of hemorrhaging. Livers from
mutant embryos contain few pronormoblasts and basophilic normoblasts
and have drastically reduced numbers of colony forming cells. These
defects occur with complete penetrance of phenotype regardless of the
genetic background (inbred B6, hybrid 129/B6, or outbred CD1) or the
targeted embryonic stem cell line used for the generation of knockout
lines. Taken together, these results provide in vivo evidence for the
role of Fli1 in the regulation of hematopoiesis and hemostasis.
 |
INTRODUCTION |
The human FLI1 gene,
which we originally cloned from the leukemia T-cell line, CEM, is a
member of the Ets gene family of transcription factors
(38). As observed with all other members of the
Ets gene family, FLI1 encodes a protein that
retains a region of conserved sequence, the Ets domain (37,
38). This minimal 85-amino-acid region has been shown to be the
DNA-binding domain. Ets proteins bind to DNA sequences that contain a
consensus GGA(A/T) core motif (Ets-binding site) and, in the majority
of cases, function as transcriptional activators. Ets proteins control the expression of genes that are critical for the control of cellular proliferation, differentiation, and programmed cell death. The presence
of multiple Ets family proteins in a variety of cell types and the
overlapping DNA-binding specificity of the Ets proteins have made it
difficult to identify target genes that are specific for individual Ets
factors. The generation and analysis of targeted disruptions in
individual family members, coupled with the identification of such
target genes, however, is one approach to understanding the role of Ets
transcription factors in normal and dysregulated development. A variety
of studies including the analysis of expression of members of the Ets
transcription factor family in hematopoietic tissues and cell lines and
the generation and analysis of targeted mutations in Ets
gene family members in mouse suggest that they play important roles in
the regulation of normal hematopoietic development (13, 14,
29).
FLI1 was found to be highly related to the human
ERG gene, and we originally named it ERGB to
reflect this homology (38). Sequence alignments of the
predicted 452-amino-acid protein product of human FLI1 with
those of the ERG and mouse Fli1 products
(5) demonstrated 80 and 96% similarity, respectively.
FLI1 has been shown to bind specific ETS-binding sites containing
the GGA(A/T) core and transcriptionally activate a number of genes
including those encoding GATA-1 (35, 38), EndoA
(34), glycoprotein IIb (21, 42), and c-Mpl
(thrombopoietin receptor) (10), as well as the human
immunodeficiency virus long terminal repeat (33). The Ets
(DNA-binding) domain of the FLI1 protein is located between amino acids
277 and 361. Deletion analysis has identified two possible
transcriptional activation domains, designated ATA and CTA
(32) (for amino-terminal transcriptional activation and
carboxy-terminal transcriptional activation, respectively).
FLI1 is expressed in hematopoietic lineages, and its
overexpression leads to aberrant hematopoiesis. In vitro
differentiation studies indicate that FLI1 expression
promotes megakaryocytic differentiation from K562 erythroleukemic
cells (1). In mice, three different proviral insertions near
the Fli1 gene cause an increase in Fli1
expression and lead to hematopoietic oncogenesis. Fli1
activation by Friend murine leukemia virus (MuLV) is associated with
erythroleukemia induction (5). Similarly, primitive stem cell tumors with characteristics of early hematopoietic cells and
non-T, non-B lymphomas are induced by integration of the 10A1 isolate
of MuLV (28) or the Cas-Br virus (6),
respectively, near the Fli1 locus. Overexpression of
Fli1 in all tissues of transgenic mice results in death from
progressive immunological renal disease associated with an increased
number of autoreactive T and B lymphocytes (41). The
possible role of FLI1 in autoimmunity is further supported
by our recent observation of elevated expression of FLI1
mRNA in lymphocytes from patients with systemic lupus erythematosus
(12). Overexpression of Fli1 results in an
increased number of mature B cells, which have a reduced
activation-induced apoptotic response compared to B cells from
wild-type animals (41). Taken together, these results
suggest that Fli1 plays a crucial role in normal
hematopoietic differentiation and lineage selection.
In light of these previous reports, it was surprising that in a recent
report on targeted disruption of Fli1, only a nonlethal minor phenotype was observed, consisting of a reduced thymus size and a
reduction in the total number of thymocytes. In this previous construct, investigators placed the neomycin resistance cassette in
exon II, which should have disrupted all but the first 10 amino acids
(23). However, alternate splicing around the neomycin cassette created a truncated Fli1 protein that nonetheless retained all
of the known functional domains. This minimal phenotype strongly contrasts with those associated with the overexpression of
Fli1, mentioned above, and necessitates additional targeting experiments.
We have generated mice carrying a novel targeted disruption of the
Fli1 gene by homologous recombination in embryonic stem cells. Although no detectable phenotype has been detected in
heterozygous embryos, all homozygotes display dramatic hemorrhaging
into the fluid-filled spaces of the central nervous system and brain on embryonic day 11.0 (E11.0) and are dead by E12.5. Abnormal
hematopoiesis within the fetal liver is also clearly detectable at
E11.0, a time that constitutes a critical transition period in
hematopoiesis. Collectively, the results further strengthen the concept
that Fli1 regulates target genes in the regulation of key
aspects of hematopoietic differentiation.
 |
MATERIALS AND METHODS |
Vector construction.
Fli1 genomic clones from an
isogenic library (Stratagene; strain 129/SVJ) were isolated using a
Flil cDNA probe containing the ETS domain (positions 1137 to 1729 [nucleotide positions as in reference 5]). The
intron-exon structure of the mouse clone containing the DNA-binding
domain has been partially determined, and a vector to target the
Fli1 gene (see Fig. 1A) was generated. The targeting vector
contains a selectable "floxed" Neo cassette (containing
the neomycin phosphotransferase gene under the transcriptional control
of the RNA polymerase II [Pol II] promoter and the last exon and
polyadenylation signal of the HPRT gene for termination, all
of which is flanked by the loxP Cre-recombinase recognition sequences). This floxed Neo cassette was inserted into the
unique EcoRV site present in exon IX. Exon IX of
Fli1 contains the ETS DNA-binding domain and the CTA domain.
The Neo cassette is flanked by approximately 9 and 3 kb of
Fli1 sequences at its 5' and 3' ends, respectively. This
disrupted mouse gene has been cloned into the targeting vector, pBSTK9,
which contains two divergent copies of the herpes simplex virus
thymidine kinase gene (for negative selection). The resultant targeted
cells will have a termination signal between the DNA-binding domain and
the CTA domain. Thus, this approach creates mice that lack a regulatory domain of Fli1. Removal of this domain of Fli1 reduces transcriptional activation activity by 40 to 50% (data not shown).
Cell culture and selection.
TC1-10 embryonic stem (ES) cells
were grown on a feeder layer of mouse fibroblasts (STO cells that
express neomycin phosphotransferase and leukocyte inhibition factor) in
knockout Dulbecco's modified Eagle's medium (Gibco/BRL) supplemented
with 15% serum replacement medium (Gibco/BRL) and made complete as
described previously (17). ES cells (2 × 107) were electroporated using a Bio-Rad Gene Pulser at 600 V and 25 µF. Transfected cells were simultaneously treated with G418 (230 µg/ml) and FIAU (1.25 µM) for positive and negative selection, respectively. Drug-resistant ES cell clones were expanded and screened
for homologous recombination by Southern blot analysis of their genomic DNA.
Single-cell suspensions of fetal livers or yolk sac were prepared from
pregnant mice on days E11.0 and E10.0, respectively. The culture was
carried out using permissive growth factor conditions in medium
containing interleukin-3 (IL-3), IL-6, steel factor (SF; c-kit ligand),
and erythropoietin (Epo). Culture medium (1 ml) contained
104 fetal liver cells, alpha-medium (Flow Laboratories,
Rockville, Md.), 1.2% methylcellulose (Shinetsu Chemical Co., Tokyo,
Japan), 30% fetal bovine serum (Atlanta Biologicals, Norcross, Ga.),
1% deionized bovine serum albumin, 10
4 M
2-mercaptoethanol (Sigma Chemical Co., St. Louis, Mo.), and growth
factors as indicated. Cytokine concentrations were 200 U of IL-3 per
ml, 100 ng of SF per ml, 100 ng of IL-6 per ml, and 1 U of Epo per ml.
Murine IL-3 was a gift from Tetsuo Sudo (Biomaterial Research
Institute, Yokohama, Japan). SF was a gift from Immunex, Seattle, Wash.
Recombinant human Epo was provided by Fu-Kuen Lin (Amgen, Thousand
Oaks, Calif.). IL-6 was a gift from M. Naruto (Toray Industries,
Kamakura, Japan).
Chimeric and knockout mice.
Chimeric mice were generated by
ES cell-morula aggregation as described previously (19).
Briefly, mice harboring heterozygous disrupted alleles were generated
by the following strategy. Targeted ES cells were thawed and plated for
2 days before being used in morula aggregation. Clumps of about 12 ES
cells were aggregated with pairs of recipient BL6 morulas in a
sandwich-type configuration, incubated overnight, and implanted as
expanded blastocysts into DBA/BL6 or CD1 F1 foster mothers.
Chimeric males that demonstrated greater than 20% agouti coat color
and derived from TC1 ES cells were mated weekly with two BL6, CD1, or
129SV females to generate heterozygotes that were identified by the
same Southern blot strategy used to identify targeted ES cell lines.
Alternatively, the Fli1 mutant allele was demonstrated by
PCR using a primer specific for the Pol II gene along with two
Fli1 exon IX-specific primers (see below).
Flow cytometric analysis and cell sorting.
The mononuclear
fraction was obtained by sedimentation on Ficoll-Paque (Pharmacia,
Piscataway, N.J.). A fraction enriched for multilineage colony-forming
cells was obtained using a modification of the procedure described
previously (11, 30). Cells were stained with fluorescein
isothiocyanate (FITC)-conjugated anti-Ly6A/E (Sca-1), phycoerythrin
(PE)-conjugated anti-CD43 (S7; PharMingen, San Diego, Calif.), and
propidium iodide as described by Hirayama and Ogawa (16).
CFU-E were obtained by staining with FITC-labeled CD71 (clone C2;
PharMingen) and ACK4 anti-c-kit antibody labeled with biotin followed
by PE-labeled streptavidin. ACK4 antibody was a generous gift from
S.-I. Nishikawa, Kumamoto, Japan. Flow cytometric analysis and cell
sorting were performed on a FACS Vantage cell sorter (Becton Dickinson,
San Jose, Calif.). Single cells were deposited into individual wells of
96-well microtiter plates using a Clone-Cyt integrated deposition
system (Becton Dickinson). Daughter cells were separated by
micromanipulation. One cell was used for single-cell reverse
transcriptase-coupled PCR (RT-PCR), and the other was cultured for 7 to
9 days. Lineage expression was determined by May-Grünwald Giemsa staining.
Analysis of DNA.
For preparation of genomic DNA, ES cells
were lysed with sodium dodecyl sulfate and proteinase K. Genomic DNA (5 µg) was digested with EcoRI, electrophoresed on a 0.8%
agarose gel, and blotted onto a nitrocellulose membrane. Hybridization
was performed using random-primed synthesis and Quick Hyb (Stratagene,
La Jolla, Calif.).
For genotyping of the mice and embryos, we used PCR to detect fragments
of the wild-type
Fli1 and the targeted
Fli1
allele.
The PCR conditions were 1 cycle at 94°C for 2 min followed by
35 cycles at 94°C for 1 min, 68°C for 1 min, and 72°C for 1 min.
A 309-bp fragment indicates the presence of the wild-type allele,
whereas a 406-bp fragment is amplified from the mutated allele.
The
primers were as follows:
Fli1 exon IX/forward primer
(positions
1156 to 1180), GACCAACGGGGAGTTCAAAATGACG;
Fli1 exon IX/reverse
primer (positions 1441 to 1465),
GGAGGATGGGTGAGACGGGACAAAG; and
Pol II/reverse primer,
GGAAGTAGCCGTTATTAGTGGAGAGG.
RT-PCR.
RNA was extracted with Trizol (Gibco/BRL) as
specified by the manufacturer. tRNA was used as a carrier for single
cell samples. cDNA synthesis was carried out with random hexamer
primers and Moloney MuLV reverse transcriptase (Gibco/BRL). Each sample
was divided into two or more portions prior to amplification. cDNA was
amplified in a final volume of 50 µl containing 1.25 U of AmpliTaq
Gold (Perkin-Elmer, Foster City, Calif.), 1 µM sense primer, 1 µM
antisense primer, 10 mM Tris (pH 8.3), 50 mM KCl, and 1.5 mM
MgCl2. Samples were preheated at 94°C for 12 min to activate the enzyme and then subjected to 28 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 2 min. Samples from single cells
were amplified for 50 cycles. Agarose gel electrophoresis was carried
out, and PCR samples were blotted onto Hybond-N+ nylon membranes
(Amersham Life Science, Inc., Arlington Heights, Ill.) and probed with
internal oligonucleotides, as previously described (31),
except that Rapid-hyb (Amersham Life Science, Inc.) was used. For
single-cell PCR, Kodak BioMaxMS film with a BioMax enhancing screen
(Eastman Kodak Co., Rochester, N.Y.) was used. Quantitation was carried
out using a STORM PhosphorImager (Molecular Dynamics, Sunnyvale,
Calif.). The primers were as follows: (i) for Fli1 (exons 6 to 8), sense (positions 899 to 919), AGACCCTTCTTATGACTCTGTCA; antisense (positions 1000 to 1018), GGGCCGCTGCTCAGTGTTC;
and internal probe (positions 970 to 990),
TCTCCTTGGAGGATCACAGAC; and (ii) for actin, sense (positions
198 to 219), CTGAAGTACCCCATTGAACAT; antisense (positions 619 to 642), CTCTTTGATGTCACGCACGATTTC; and internal probe
(positions 244 to 264), ATGGAGAAGATCTGGCAC.
In situ hybridization.
In situ hybridization was performed
by the method of Wilkinson (39). E10 embryos were fixed
overnight in 4% paraformaldehyde in phosphate-buffered saline (PBS).
Dehydration was carried out in increasing concentrations of ethanol in
saline, then absolute ethanol, and finally xylene. Embryos were
embedded in paraffin, and 8-µm sections were processed as follows.
The sections were rehydrated, treated with 1% hydrogen peroxide in PBS
for 15 min, incubated in 30 mg of proteinase K per ml for 12 min at
37°C, postfixed in 4% paraformaldehyde in PBS for 20 min, acetylated in 1 mM triethanolamine-0.25% acetic anhydride for 10 min,
dehydrated, and hybridized overnight at 42°C in hybridization
solution containing 50% formamide, 4× SSC (1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate), 10% dextran sulfate, 1× Denhardt's
solution, 0.5 mg of yeast RNA per ml, and 800 to 1,000 ng of
biotin-labeled riboprobe per ml. Sections were hybridized to either an
antisense probe or a control sense Fli1 probe. The full-length Fli1
cDNA from plasmid PECE-BB4 (5) was recloned in both
orientations into the pGEM7 vector. The plasmids were linearized with
EcoRV, and RNA was synthesized in vitro using a biotin
labeling kit and T7 RNA polymerase (NEN Life Science Products, Boston,
Mass.). The antisense Fli1 probe (333 bp) contains both translated and
3' untranslated sequences, as previously described (23). The
sense Fli1 probe (1,396 bp) contains both 5' untranslated sequences and
translated sequences, including the Ets domain. Following hybridization, washing was performed at 42°C in 4× SSC-50%
formamide and then at 37°C in 2× and 1× SSC, followed by incubation
with 10 µg of RNase A per ml at 37°C 30 min. Sections were blocked for 30 min in blocking buffer (NEN Life Science Products) and incubated
with SA-HRP (NEN Life Science Products) for 30 min. The signal was
amplified using a TSA-Indirect amplification kit (NEN Life Science
Products) and developed with DAB (Vector Laboratories, Burlingame,
Calif.). Slides were counterstained with methyl green, mounted, and
photographed with a Kodak Digital Science DC 120 zoom digital camera.
Hybridization with the sense control probe (1,396 bp) did not yield any
significant signal.
Western blotting.
Homogenates from wild-type and
heterozygous and homozygous mutant Fli1 embryos were
prepared by lysis in radioimmunoprecipitation assay (RIPA) buffer in
the presence of protease inhibitors (Sigma). Sonicated lysates were
clarified by centrifugation, and the protein concentration of
supernatants was determined by the Bio-Rad assay. A 5-µg aliquot of
each protein extract was separated on an SDS-10% polyacrylamide gel
and transferred to nitrocellulose paper. Membranes were incubated for
2 h with FLI1-polyclonal antibody (made against full-length FLI1)
and then with horseradish hydroperoxidase-labeled secondary antibody
(Amersham). Antibody was detected using enhanced chemiluminescence
(Amersham). The presence of equivalent protein loading was verified by
reprobing stripped membranes with
-actin (Sigma) antibody. Lysates
from cells transfected with Fli1 or mutant Fli1 (Fli1-M) expression
vectors and proteins obtained by coupled in vitro
transcription-translation (Promega) were used as positive controls for
mobility and antibody recognition of Fli1 and mutant Fli1 proteins. The
Fli1-M vector was constructed by insertion of the floxed Neo
cassette into the EcoRV site of Fli1 cDNA, the identical
site used in construction of the targeting vector. The targeting vector
and the Fli1-M vector have identical sequences flanking the
EcoRV cloning site; thus, the Fli1-M cDNA directs the
synthesis of mRNA and protein identical to those present in the
targeted cells and mutant mice.
 |
RESULTS |
Design and construction of a novel Fli1 targeting vector.
To
disrupt the Fli1 gene, a genomic targeting vector was
constructed which contains an insertional disruption just upstream of
the CTA domain (Fig. 1A). A
loxP-flanked Neo cassette was inserted into the
unique EcoRV site present in exon IX. Exon IX of
Fli1 contains the ETS DNA-binding domain and the CTA domain.
The resultant targeted allele has a termination signal provided by the
loxP sequence located between the DNA-binding domain and the
CTA domain. The Neo gene cassette is driven by the strong
Pol II promoter and contained exons VIII and IX of the HPRT
gene. The Neo cassette is flanked by approximately 9 and 3 kb of Fli1 sequences at its 5' and 3' ends, respectively,
and extends from the XhoI site upstream of exon VII to the
SpeI site downstream of exon IX (Fig. 1A). These mouse
genomic sequences and inserted Neo cassette were cloned into the
targeting vector, pBSTK9, which contains two divergent copies of the
herpes simplex virus thymidine kinase gene (for negative selection).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1.
Targeted disruption of the mouse Fli1 gene.
(A) Schematic representation of the Fli1 targeting vector
and genomic organization of the wild-type and Fli1 targeted
alleles. The partial restriction map of the mouse Fli1
locus, indicating the positions of exons VII, VIII, and IX, is given.
Triangles on each side of the Neo cassette
(neor) represent loxP sequences. Positions of
diagnostic EcoRI sites and predicted fragment sizes are
indicated. (B) Identification of Fli1 targeted cell lines.
Southern blot analysis of G418-resistant ES cell clones, probed with
the indicated 5' or 3' probe, is shown. Targeted ES cell clones are
identified by the presence of either a 14.8-kbp (5' probe) or 4.8-kbp
(3' probe) fragment in addition to the 16.5-kbp fragment from the
nontargeted allele. (C) Germ line transmission of the targeted
Fli1 allele. Genomic DNA was isolated from wild-type and
heterozygous mutant mice and from a chimeric mouse (C53). Southern blot
analysis of EcoRI-digested DNA from representative wild-type
(+/+) and heterozygous mutant (+/ ) and from chimera 53 (Ch53), probed
with the 3' Fli1 probe (described in the legend to Fig. 1A), is shown.
(D) PCR analysis of tail DNA from the progeny from a heterozygous
intercross. Primers (Fli9F, Fli9R, and Pol IIR) were used to amplify
genomic DNA, and the resultant products were resolved on a 1%
Trevigel. The wild-type allele is identified by the 309-bp PCR product,
and the targeted allele is identified by the 406-bp PCR product.
Heterozygous mice are identified by the presence of both the 309- and
406-bp bands. The wild-type mice are identified by the presence of only
the 309-bp band. No homozygous mutant mice (identified by the presence
of only the 406-bp band) were detected. (E) The Fli1 mRNA transcript
level is reduced in mutant embryos. Total RNA was extracted from
wild-type and heterozygous and homozygous mutant E10 and E11 embryos.
RNA (5 µg/lane) was electrophoresed on 1.2% agarose containing
formaldehyde, transferred to a nylon membrane, and sequentially
hybridized with 32P-labeled Fli1 cDNA (top panel) and S26
rRNA probes (bottom panel). The arrow on the left highlights the
position of the normal Fli1 transcript, and the arrows on the right
indicate the position of the two transcripts from the targeted
Fli1 allele. (F) Presence of a truncated Fli1 protein in
mutant E11 embryos. Total protein (5 µg/lane) prepared from wild-type
and heterozygous and homozygous mutant E11 embryos was separated by
polyacrylamide gel electrophoresis and transferred to filters. The
filters were incubated with a Fli1 polyclonal antibody and visualized
using the enhanced chemiluminescence system. Protein prepared from
cells after transient transfection with vectors expressing Fli1 or
mutant Fli1 (Fli1-M) were used as controls. Stripped membranes were
reprobed with -actin antibody. The 48-kDa protein band in the /
embryos cannot be wild-type protein, because no wild-type Fli1
transcript is made in these / embryos. Furthermore, we did not
observe the larger p51 Fli1 protein, normally encoded by the wild-type
mRNA utilizing an alternative translation start. The identity of this
protein remains unknown but is likely to be a cross-reactive protein.
|
|
Generation and identification of mouse lines carrying the targeted
Fli1 allele.
The resulting targeting vector was
linearized with ScaI and electroporated into a rederivation
of TC-1 ES cells (kindly provided by P. Leder). Electroporated ES cells
were grown on mitotically inactivated and G418-resistant mouse
embryonic fibroblasts in medium containing G418 and FIAU for positive
and negative selection, respectively. Drug-resistant ES cell clones
were expanded, and targeted ES cells were identified by Southern blot
analysis of their genomic DNA. Diagnostic restriction digests were done
using EcoRI, and the resultant Southern blots were
hybridized with a 3' probe (300 bp, SpeI-XbaI
fragment) and 5' probe (800 bp, EcoRV-XhoI fragment) (the probes are shown as hatched boxes in Fig. 1A) that flank
the homologous region used in the targeting construct. Figure 1B shows
representative data for analysis of the ES clones. Two distinct
hybridization patterns were detected. Nontargeted ES cells were
identified by the presence of a single hybridizing band of 16.5 kbp,
representing the expected wild-type genomic fragment. Clones that were
heterozygous for the targeted disruption were recognized by the
presence of an additional band of 14.8 kb (5' probe) (Fig. 1B, top
panel) or 4.8 kb (3' probe) (bottom panel). The targeting vector does
not hybridize with either probe. Sixteen targeted lines were identified
from 100 drug-resistant clones analyzed. Four targeted cell lines were
randomly chosen and found to have normal karyotypes and were
subsequently used for the generation of Fli1 mutant mouse
lines. Two of four targeted cell lines tested (ES53 and ES54) gave rise
to germ line chimeras by morula aggregation using B6 (C57BL/6J) and
CD-1 morulas, respectively. Germ line chimeric males were identified by
the appearance of agouti coat-colored offspring from matings to B6 or
CD1 females, respectively. Germ line transmission of the targeted
allele to subsequent progeny of B6 and CD1 was confirmed by Southern
blot and PCR analyses (Fig. 1C and D).
An intact Fli1 allele is required for normal embryonic
development.
Intercross matings of heterozygous Fli1
mutant F1 offspring were conducted to generate homozygotes.
To determine the nature of this targeted Fli1 mutation,
Fli1 mRNA and protein were prepared from wild-type,
heterozygous, and homozygous embryos and analyzed by Northern and
Western blotting, respectively (Fig. 1E and F). The Northern blot
results demonstrate that the homozygotes express two distinct
transcripts at approximately 10% of the wild-type level. This result
suggests instability of transcripts and/or altered transcription in the
targeted allele. Variable transcript size from the targeted allele may
be due to usage of alternative poly(A) signals in the Neo
cassette. The Fli1 gene encodes two distinct nuclear
proteins of 51 and 48 kDa (2, 43). The Western blot results
demonstrate that very little protein is made in homozygous mutant
embryos (Fig. 1F), showing that the distinct reduction in transcript
levels is further accentuated at the protein level. In extracts
prepared from transient transfections, the mutant protein (Fli1-M) is
slightly smaller than the wild-type Fli1 (Fli1), consistent with the
prediction that the targeted allele would produce a nonsense mutant
that lacks the CTA domain (Fig. 1F). In vitro transcription assays show
that this CTA-less Fli1 mutant protein has only 50 to 60% of the
activity of the wild type (data not shown). Collectively, these results
demonstrate that the targeted mutation generates a severe hypomorphic mutant.
Heterozygous
Fli1 mutant mice and embryos in both genetic
backgrounds (B6 and CD1) appear healthy and fertile, with no apparent
phenotypic abnormalities. However, no viable homozygous animals
were
produced from heterozygous intercrosses (Table
1). The complete
absence of homozygous
mutant progeny suggests that an intact
Fli1 gene is
essential for embryonic development. As expected for a
recessive
embryonic lethal phenotype, heterozygous progeny constitutes
60% of
the total (Mendelian 66.6%). A retrograde genotypic analysis
was
conducted to determine the onset of embryonic lethality. No
viable
Fli1 homozygous embryos were recovered at E18.5, E16.5,
or
E12.5. However, homozygous
Fli1 embryos were identified as
resorptions at E12.5, suggesting that intact Fli1 function is
required
for viability prior to this gestational age (Table
1).
Analysis of
homozygous
Fli1 embryos from earlier gestational ages
demonstrated no overt defects until E11.0, at which time all
homozygotes
were recognized by the absence of red cells in the
otherwise morphologically
normal yolk sac vasculature (Fig.
2A). Upon further dissection,
homozygotes
exhibited a profound hematorrhachitic phenotype in
which the majority
of fetal blood had hemorrhaged into the lumen
of the neural tube and
the linked cephalic ventricles (Fig.
2B).
The continuous open space in
wild-type embryos was found to be
filled with extravasated red blood
cells in homozygotes. Hematorrhachis
thus constituted a potential basis
for the embryonic lethality
observed, since continuous loss of
circulating red blood cells
would result in lasting hypoxia to
embryonic tissues. Strikingly,
this hematorrhachitic phenotype was
100% penetrant and occurred
very precisely at E11 independent of the
genetic background, as
demonstrated on the outbred CD1, the hybrid
129/B6, and the inbred
B6 genetic background (after more than five
backcrosses of the
hybrid into B6). In contrast, no phenotypic
abnormalities were
observed at E10.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2.
Phenotype of Fli1 mutant embryos. (A) Absence
of blood in the yolk sac of Fli1 mutant E11 embryos.
Representative photographs of E11 embryos with intact visceral yolk
sacs are shown. Blood-filled vessels in the yolk sac are seen in the
wild-type littermate (+/+) but not in the homozygous mutant ( / ).
(B) Fli1 mutant E11 embryos hemorrhage. E11 homozygous
mutant embryos dissected free of the yolk sac are easily distinguished
from their wild-type littermates (a) by their smaller overall size and
hemorrhaging of fetal red cells into the cephalic ventricles (b to d)
and the central canal of the neural tube (b, c, and e). (C)
Histological analysis of E11 homozygous mutant embryos. Transverse
sections through E11 embryos demonstrate a disruption in the columnar
neuroepithelium, reduced adjacent extracellular matrix, and a hematoma
at the site of hemorrhage (right panel). A section from a wild-type
embryo is shown on the left for comparison. Note the nucleated red
cells in the lumen of the neural tube (top, right panel). Positions of
neuroepithelial (ne) and mesenchymal (m) cells and basement membrane
(bm) are indicated.
|
|
Histological analyses of E11 homozygous mutant embryos demonstrate a
disruption in the columnar neuroepithelium and a breakdown
of basement
membrane at the site of hemorrhage (Fig.
2C). Hematomas
were also
detected in the neuroepithelium more distal to the
neuroepithelial-mesenchymal
junction (Fig.
2C). It should be noted that
these defects are
localized; i.e., they were not observed throughout
the length
of the embryo in this junction region. Immunostaining with
an
antibody to PECAM demonstrated no obvious defects in vascular
endothelial cell organization in this region (data not shown).
Terminal deoxynucleotidyltransferase-mediated dUTP-biotin
nick
end labeling (TUNEL) demonstrated no apparent increase in the
apoptotic index of cells in this region, which might be predicted
for a
loss-of-function Fli1 mutant (
40) (data not shown).
Furthermore,
comparison of hematoxylin-and-eosin-stained,
PECAM-labeled, and
TUNEL-labeled sections of +/+, +/

, and

/

embryos has detected
no differences in the aortic region. Collectively,
data indicate
that the site of hemorrhaging most probably involves
blood vessels
located in the mesenchyme proximal to the basement
membrane between
the mesenchyme and neuroepithelium (Fig.
2C).
The tissue- and time-specific expression of
Fli1 during
development has been previously determined by in situ hybridization
(
23). Embryonic expression begins around E8, mainly in
mesodermal
cells. Endothelial cell expression is restricted to newly
formed
cells, with no expression detected in adult tissues. These
studies
are consistent with the hypothesis that Fli1 plays a role in
mesoderm
formation and in the development of endothelial and
hematopoietic
lineages (
23). In situ hybridization of Fli1
mRNA was conducted
on wild-type E10 embryos to more carefully analyze
Fli1 expression
within the context of the hematorrhachitic phenotype.
Consistent
with previous observations, our results demonstrated Fli1
mRNA
expression at high levels in the mesenchyme. In addition, high
levels of Fli1 expression were observed in the cellular layer
of the
neuroectoderm (columnar epithelium) immediately adjacent
to the
basement membrane and mesenchyme (Fig.
3). Thus, the spatiotemporal
pattern of
Fli1 expression closely correlates with the neuroectodermal
and
extracellular matrix defects found in the homozygous mutant
(Fig.
2C).

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of Fli1. In situ hybridization
with antisense Fli1 RNA of transverse sections of wild-type E10 embryos
was performed. Embryo sections (8 µm) were processed for in situ
hybridization and counterstained with methyl green. Positions of
neuroepithelial (ne) and mesenchymal (m) cells and basement membrane
(bm) are indicated in the in situ-hybridized section (right panel). A
comparable, hematoxylin-and-eosin-stained section from the same region
of a mutant E11 embryo is shown for comparison (left panel),
demonstrating disruption of the thick basement membrane and columnar
neuroepithelium and pockets of nucleated red cells within these
tissues.
|
|
Fli1 is essential for normal hematopoiesis.
In
addition to its roles in mesodermal and endothelial development,
Fli1 is expressed in fetal liver cells with a megakaryocytic appearance (23). A variety of studies have also demonstrated that overexpression of Fli1 leads to aberrant hematopoiesis
(5, 6, 28, 41). An analysis of hematopoiesis in the
homozygous Fli1 mutants was conducted to determine if mice
carrying greatly reduced levels of a less active Fli1 protein
demonstrate hematopoietic defects. We first observed that the
developing livers of the homozygous mutant embryos appeared to be pale
and small compared to those of wild-type and heterozygous embryos at
the time of hemorrhaging. The cellularity of the mutant livers was
significantly reduced (Table 2). May
Grünwald Giemsa staining of the mutant fetal liver cells
demonstrated severe reduction in the number of pronormoblasts and
basophilic normoblasts (Fig. 4). The
increased number of smudged cells may suggest an increased incidence of
apoptosis. Most of the intact cells from the mutants were
orthochromatic and polychromatophilic normoblasts. Some of the
orthochromatic and polychromatophilic normoblasts of the mutant mice
exhibited more cytoplasm than did those of the wild-type mice,
indicating megaloblastoid changes of the mutant red cells. Whether the
changes are a manifestation of intrinsic phenotypes of the mutant red
cells or an artifact of selective loss of populations by hemorrhaging
is unknown.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 4.
Fetal liver cells from normal and mutant embryos stained
with May Grünwald Giemsa. E11 embryos were collected, and smears
from normal (A) and mutant (B) livers were prepared and stained with
May Grünwald Giemsa. The predominant cells present in the smear
prepared from the mutant embryo were orthochromatic (on) and
polychromatophilic (pon) normoblasts. Note the absence of
pronormoblasts (prn) and basophilic normoblasts (bn) in the mutant
embryo.
|
|
The role of
Fli1 during hematopoiesis was assessed further
by clonal culture of wild-type and heterozygous and homozygous
mutant
E11 embryo livers. Progenitor numbers, i.e., CFU-erythroid
(CFU-E),
burst-forming units-erythroid (BFU-E), CFU-granulocyte-macrophage
(CFU-GM), and CFU-multilineage colonies (CFU-mix), were all drastically
reduced in the fetal livers of the mutants (Fig.
5A; Table
2).
Since E11 approximates the
time when the site of hematopoiesis
changes from the yolk sac to the
liver and is a time when the
hemorrhagic phenotype is clearly visible
in mutant embryos, it
is possible that defective hematopoeisis in
Fli1
/
E11 livers is secondary to
hemorrhaging. Hematopoiesis initiates
within the yolk sac and continues
within the fetal liver. Cells
from the yolk sac of
Fli1
homozygous embryos were isolated, grown
in vitro, and analyzed. Culture
of E10 yolk sac cells demonstrated
a moderate loss in erythroid
progenitors (CFU-E and BFU-E) and
a substantial loss in CFU-mix and
CFU-GM (Fig.
5B; Table
3).
The apparent
increase in the numbers of CFU-E and BFU-E in the
yolk sac cultures
from heterozygous mice relative to wild type
could be correlated to a
partial loss of function of the wild-type
protein and/or a partial gain
of function of the mutant protein.
Whether a correlation exists between
the homozygous knockout hemorrhagic
phenotype and this apparent yolk
sac effect remains to be determined.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
Fli1 mutant mice demonstrate defects in
hematopoietic colony formation. (A) E11 fetal liver cultures
(triplicate cultures using 10,000 fetal liver cells/dish) in medium
containing SF, IL-3, and Epo. CFU-E colonies were counted on day 2, and
other colonies were counted on day 7. Data represent the mean values
from individual fetuses of each genotype. +/+, n = 3; +/ ,
n = 3; / , n = 2. (B) E10 yolk sac cultures
(quadruplicate cultures containing 1/15 yolk sac per dish) in medium
containing SF, IL-3, IL-6, and Epo. CFU-E colonies were scored on day
4, and other colonies were scored on day 7. Data presented represent
the mean values from individual fetuses. +/+, n = 4; +/ ,
n = 2; / , n = 2. The data presented in the figure
represent the average numbers from experiment 1 of two experiments (all
data are provided in Tables 2 and 3). Values are expressed as
percentage of the wild type.
|
|
Fetal liver was collected and dissociated, and the multipotential
progenitor populations were sorted. The
Sca-1
+CD43
+ cell population is composed of the
early progenitors CFU-GM and
CFU-mix. The c-kit
+
CD71
+ cell population contains committed erythroid
progenitors, CFU-E.
RT-PCR (Fig.
6A)
demonstrated that Fli1 expression was 4.5-fold
higher in the
Sca-1
+ CD43
+ cell population than in the
c-kit
+ CD71
+ cell population. RT-PCR analysis
of daughter cells of the Sca-1
+ CD43
+
population demonstrated that the CFU-GM and CFU-mix populations
express
the
Fli1 gene (Fig.
6B). Furthermore, a CFU-meg colony
was
also shown to express Fli1 (Fig.
6B). Since hematopoiesis
initiates
within the yolk sac and continues within the fetal liver,
it is
interesting that the Sca-1
+ CD43
+ cell
population (CFU-mix and CFU-GM) is more strongly affected
than the
c-kit
+ CD71
+ cell population (erythroid
progenitors) in the yolk sac cultures
from the homozygous mutant (Fig.
5B).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 6.
RT-PCR analysis of Fli1 mRNA expression in fetal liver
cell populations. (A) Comparison of Fli1 expression in
Sca-1+ CD43+ fetal liver cells and
c-kit+ CD71+ cells. RT-PCR was carried out as
described in Materials and Methods. Southern blots were hybridized with
the indicated end-labeled probe. Panel 1, Sca-1+
CD43+; panel 2, c-kit+ CD71+. (B)
Analysis of Fli1 expression in daughter cells. Sca-1+
CD43+ fetal liver cells were deposited into individual
wells of a 96-well plate using the CloneCyt integrated deposition
system. Daughter cells were separated. One cell was used for
single-cell RT-PCR, and the other was cultured for 7 to 9 days. Lineage
expression was determined by May Grünwald Giemsa staining. RT-PCR
analysis of Fli1 expression in CFU-mix (lanes 1 to 7), CFU-GM (lanes 9 to 15), CFU-meg (lane 16), and negative control (lane 8) is shown.
|
|
 |
DISCUSSION |
Our Fli1 targeted mutant demonstrates profound
hematorrhachitic and hematopoietic phenotypes. This is in contrast to
the very mild phenotype observed in the previous Fli1 targeted mutant
(23). Neither is a dominant mutant in the sense that no
overt phenotype is observed in heterozygotes. Both mutants produce
greatly reduced amounts of protein. Our mutant Fli1 is a truncated
protein, lacking the functional CTA domain. The previous mutant Fli1 is
a truncated protein, containing 19 unique amino acids in place of 76 amino acids present at the amino-terminal end of wild-type Fli1. This region of Fli1 is not required for transcriptional activation (32). In contrast, mutant Fli1 protein lacking the CTA
domain demonstrates a 40 to 50% reduction in transcriptional
activation by in vitro assay (data not shown). The greatly reduced
expression of a Fli1 protein lacking the CTA domain in vivo may result
in the complete loss of regulation of target genes.
Mechanism of lethality mediated by loss of Fli1
function.
At least three possible mechanisms may collectively
contribute to the death of embryos lacking Fli1 function:
(i) disruption of tissue integrity, resulting in hemorrhage; (ii)
disruption of normal hematopoiesis; and (iii) disruption of normal
hemostasis. The first model is consistent with Fli1 target
genes identified, such as those encoding extracellular matrix proteins
as well as those contributing to proper epithelial-mesenchymal
interactions. For example, it has recently been determined that Fli1
cooperates with Sp1 to activate the human tenascin promoter
(36).
Our results also demonstrate that hematopoiesis is severely impaired in
Fli1 mutant mice at midgestation. The failure of the
liver
to develop normally as a hematopoietic organ at a critical
transition
period in embryonic hematopoiesis could be a contributing
factor to
embryo death. It has been shown that differentiation
of specific
hematopoietic lineages is controlled by specific cytokines
and
transcription factors. Knockout mice for
GATA-1,
GATA-2,
JAK2,
c-
kit,
SCL/
tal-1,
Epo,
Epo
receptor,
Myb, etc. (
25-27), have midgestation
defects in hematopoiesis, and some result in midgestation death.
There
could be an intrinsic defect in the progenitors which makes
them
incapable of the rapid expansion required in fetal development,
a
defect in their migration to the liver, or in the ability of
the liver
to support
hematopoiesis.
Loss of normal
Fli1 function could lead to aberrant
megakaryocytopoiesis, platelet production, and, ultimately,
control of
coagulation. Five observations support this model. (i) In
vitro
differentiation studies indicate that
FLI1 expression
promotes
megakaryocytic differentiation of K562 erythroleukemic
cells (
1).
(ii) We have demonstrated that
Fli1 is
expressed in the CFU-meg
population from fetal liver (Fig.
6B). (iii)
Cultures of progenitors
from mutant yolk sacs have reduced levels of
CFU-mix (Fig.
5B).
(iv) It has recently been demonstrated that Fli1
protein is present
in platelets (
3). (v) Our recent
preliminary data demonstrate
that neutrophils, macrophages, mast cells,
and erythroid cells,
but not megakaryocytes, are present in individual
colonies from
yolk sac cultures of mutant fetuses. Collectively, loss
of megakaryocyte-derived
platelets is one possible cause of the
hemorrhagic phenotype we
observed. Ets factors have been shown to
activate transcription
driven by the megakaryocyte-specific membrane
glycoprotein gpIIb
promoter (
7,
21), the platelet
glycoprotein Iba promoter
(
15), the glycoprotein IX promoter
(
4), the platelet factor
4 promoter (
24), and the
promoter of mpl (
10), the receptor
for thromobopoietin.
These studies support the hypothesis that
one or more ETS transcription
factors play a role in the regulation
of transcription of
megakaryocytic and platelet-specific genes.
Disruption of normal
coagulation alone is sufficient to lead to
hemorrhaging in the embryo
(
9,
18). Notably in humans, severe
disability or death from
bleeding into the central nervous system
and brain are features of both
hemophilia A (factor VIII defect)
and hemophilia B (factor IX defect)
(
20,
22). In addition,
congenital megakaryocytic maturation
defects as well as a mild
hemorrhagic phenotype have been found in
individuals heterozygous
for a chromosomal deletion that removes
FLI1 and
ETS1 (
8).
Future studies of
Fli1 mutant mice and cells will facilitate
the identification of specific target genes that are critical
for
normal development.
Fli1 target genes, either individually
or in combination, that are responsible for embryonic hemorrhaging
and
defective hematopoiesis will be delineated. Furthermore, these
studies
will demonstrate whether hemorrhage and defective hematopoiesis
are
independent or interrelated
events.
 |
ACKNOWLEDGMENTS |
We thank Tina Cooper, Yong Gong, Jill Martin, Kristen Swartout,
Ann Hofbauer, and Juanita Eldgride for technical assistance. We thank
Tien Hsu for helpful discussion, advice, and critical review of the
manuscript. We also thank Alan Bernstein for providing a mouse
Fli1 cDNA clone and Phillip Leder for providing TC1-10 ES cells.
This work was supported in part by a grant from the NCI (PO1 CA78582).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center for
Molecular and Structural Biology, Hollings Cancer Center, Medical
University of South Carolina, Charleston, SC 29425. Phone: (843)
792-3900. Fax: (843) 792-3940. E-mail: watsondk{at}musc.edu.
This paper is dedicated to the memory of Takis S. Papas, a mentor,
scientific colleague, and friend.
 |
REFERENCES |
| 1.
|
Athanasiou, M.,
P. A. Clausen,
G. J. Mavrothalassitis,
X. K. Zhang,
D. K. Watson, and D. G. Blair.
1996.
Increased expression of the ETS-related transcription factor FLI-1/ERGB correlates with and can induce the megakaryocytic phenotype.
Cell Growth Differ.
7:1525-1534[Abstract].
|
| 2.
|
Bailly, R. A.,
R. Bosselut,
J. Zucman,
F. Cormier,
O. Delattre,
M. Roussel,
G. Thomas, and J. Ghysdael.
1994.
DNA-binding and transcriptional activation properties of the EWS-FLI-1 fusion protein resulting from the t(11;22) translocation in Ewing sarcoma.
Mol. Cell. Biol.
14:3230-3241[Abstract/Free Full Text].
|
| 3.
|
Bastian, L. S.,
B. A. Kwiatkowski,
J. Breininger,
S. Danner, and G. Roth.
1999.
Regulation of the megakaryocytic glycoprotein IX promoter by the oncogenic Ets transcription factor Fli-1.
Blood
93:2637-2644[Abstract/Free Full Text].
|
| 4.
|
Bastian, L. S.,
M. Yagi,
C. Chan, and G. J. Roth.
1996.
Analysis of the megakaryocyte glycoprotein IX promoter identifies positive and negative regulatory domains and functional GATA and Ets sites.
J. Biol. Chem.
271:18554-18560[Abstract/Free Full Text].
|
| 5.
|
Ben-David, Y.,
E. B. Giddens,
K. Letwin, and A. Bernstein.
1991.
Erythroleukemia induction by Friend murine leukemia virus: insertional activation of a new member of the ets gene family, Fli-1, closely linked to c-ets-1.
Genes Dev.
5:908-918[Abstract/Free Full Text].
|
| 6.
|
Bergeron, D.,
J. Houde,
L. Poliquin,
B. Barbeau, and E. Rassart.
1993.
Expression and DNA rearrangement of proto-oncogenes in Cas-Br-E-induced non-T-, non-B-cell leukemias.
Leukemia
7:954-962[Medline].
|
| 7.
|
Block, K. L., and M. Poncz.
1995.
Platelet glycoprotein IIb gene expression as a model of megakaryocyte-specific expression.
Stem Cells
13:135-145[Medline].
|
| 8.
|
Breton-Gorius, J.,
R. Favier,
J. Guichard,
D. Cherif,
R. Berger,
N. Debili,
W. Vainchenker, and L. Douay.
1995.
A new congenital dysmegakaryopoietic thrombocytopenia (Paris-Trousseau) associated with giant platelet alpha-granules and chromosome 11 deletion at 11q23.
Blood
85:1805-1814[Abstract/Free Full Text].
|
| 9.
|
Cui, J.,
K. S. O'Shea,
A. Purkayastha,
T. L. Saunders, and D. Ginsburg.
1996.
Fatal haemorrhage and incomplete block to embryogenesis in mice lacking coagulation factor V.
Nature
384:66-68[CrossRef][Medline].
|
| 10.
|
Deveaux, S.,
A. Filipe,
V. Lemarchandel,
J. Ghysdael,
P. H. Romeo, and V. Mignotte.
1996.
Analysis of the thrombopoietin receptor (MPL) promoter implicates GATA and Ets proteins in the coregulation of megakaryocyte-specific genes.
Blood
87:4678-4685[Abstract/Free Full Text].
|
| 11.
|
Fujimoto, K.,
S. D. Lyman,
F. Hiryama, and M. Ogawa.
1996.
Isolation and characterization of primitive hematopoietic progenitors of murine fetal liver.
Exp. Hematol.
24:285-290[Medline].
|
| 12.
|
Georgiou, P.,
I. G. Maroulakou,
J. E. Green,
P. Dantis,
V. Romano-Spica,
S. Kottaridis,
J. A. Lautenberger,
D. K. Watson,
T. S. Papas,
P. J. Fischinger, and N. K. Bhat.
1996.
Expression of ets family of genes in systemic lupus erythematosus and Sjogren's syndrome.
Int. J. Oncol.
9:9-18.
|
| 13.
|
Ghysdael, J., and A. Boureux.
1997.
The ETS family of transcriptional regulators, p. 29-88.
In
M. Yaniv, and J. Ghysdael (ed.), Oncogenes as transcriptional regulators, vol. 1. Birkhauser Verlag, Basel, Switzerland.
|
| 14.
|
Graves, B. J., and J. M. Petersen.
1998.
Specificity within the ets family of transcription factors.
Adv. Cancer Res.
75:1-55[Medline].
|
| 15.
|
Hashimoto, Y., and J. Ware.
1995.
Identification of essential GATA and Ets binding motifs within the promoter of the platelet glycoprotein Ib alpha gene.
J. Biol. Chem.
270:24532-24539[Abstract/Free Full Text].
|
| 16.
|
Hirayama, F., and M. Ogawa.
1994.
CD43 expression by murine lymphohemopoietic progenitors.
Int. J. Hematol.
60:191-196[Medline].
|
| 17.
|
Hogan, B.,
F. Costantini, and E. Lacy.
1986.
Manipulating the mouse embryo: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 18.
|
Huang, Z. F.,
D. Higuchi,
N. Lasky, and G. J. Broze, Jr.
1997.
Tissue factor pathway inhibitor gene disruption produces intrauterine lethality in mice.
Blood
90:944-951[Abstract/Free Full Text].
|
| 19.
|
Joyner, A. L.
1993.
Gene targeting: a practical approach.
Oxford University Press, New York, N.Y.
|
| 20.
|
Kulkarni, R., and J. M. Lusher.
1999.
Intracranial and extracranial hemorrhages in newborns with hemophilia: a review of the literature.
J. Pediatr. Hematol. Oncol.
21:289-295[CrossRef][Medline].
|
| 21.
|
Lemarchandel, V.,
J. Ghysdael,
V. Mignotte,
C. Rahuel, and P. H. Romeo.
1993.
GATA and Ets cis-acting sequences mediate megakaryocyte-specific expression.
Mol. Cell. Biol.
13:668-676[Abstract/Free Full Text].
|
| 22.
|
Levine, P. H.
1987.
Clinical manifestations and therapy of hemophilias A and B, p. 97-111.
In
R. W. Colman, J. Hirsh, V. J. Marder, and E. W. Salzman (ed.), Hemostasis and thrombosis: basic principles and clinical practice, 2nd ed. J. B. Lippincott Co., Philadelphia, Pa.
|
| 23.
|
Melet, F.,
B. Motro,
D. J. Rossi,
L. Zhang, and A. Bernstein.
1996.
Generation of a novel Fli-1 protein by gene targeting leads to a defect in thymus development and a delay in Friend virus-induced erythroleukemia.
Mol. Cell. Biol.
16:2708-2718[Abstract].
|
| 24.
|
Minami, T.,
K. Tachibana,
T. Imanishi, and T. Doi.
1998.
Both Ets-1 and GATA-1 are essential for positive regulation of platelet factor 4 gene expression.
Eur. J. Biochem.
258:879-889[Medline].
|
| 25.
|
Orkin, S. H.
1998.
Embryonic stem cells and transgenic mice in the study of hematopoiesis.
Int. J. Dev. Biol.
42:927-934[Medline].
|
| 26.
|
Orkin, S. H.
1995.
Transcription factors and hematopoietic development.
J. Biol. Chem.
270:4955-4958[Free Full Text].
|
| 27.
|
Orkin, S. H.,
C. Porcher,
Y. Fujiwara,
J. Visvader, and L. C. Wang.
1999.
Intersections between blood cell development and leukemia genes.
Cancer Res.
59:1784s-1788s.
|
| 28.
|
Ott, D. E.,
J. Keller, and A. Rein.
1994.
10A1 MuLV induces a murine leukemia that expresses hematopoietic stem cell markers by a mechanism that includes fli-1 integration.
Virology
205:563-568[CrossRef][Medline].
|
| 29.
|
Papas, T. S.,
N. K. Bhat,
D. D. Spyropoulos,
A. E. Mjaatvedt,
J. Vournakis,
A. Seth, and D. K. Watson.
1997.
Functional relationships among ETS gene family members.
Leukemia
11:557-566.
|
| 30.
|
Pharr, P. N., and A. Hofbauer.
1997.
Loss of flk-2/flt3 expression during commitment of multipotent mouse hematopoietic progenitor cells to the mast cell lineage.
Exp. Hematol.
25:620-628[Medline].
|
| 31.
|
Pharr, P. N.,
M. Ogawa,
A. Hofbauer, and G. D. Longmore.
1994.
Expression of an activated erythropoietin or a colony-stimulating factor 1 receptor by pluripotent progenitors enhances colony formation but does not induce differentiation.
Proc. Natl. Acad. Sci. USA
91:7482-7486[Abstract/Free Full Text].
|
| 32.
|
Rao, V. N.,
T. Ohno,
D. D. Prasad,
G. Bhattacharya, and E. S. Reddy.
1993.
Analysis of the DNA-binding and transcriptional activation functions of human Fli-1 protein.
Oncogene
8:2167-2173[Medline].
|
| 33.
|
Seth, A.,
D. R. Hodge,
D. M. Thompson,
L. Robinson,
A. Panayiotakis,
D. K. Watson, and T. S. Papas.
1993.
ETS family proteins activate transcription from HIV-1 long terminal repeat.
AIDS Res. Hum. Retroviruses
9:1017-1023[Medline].
|
| 34.
|
Seth, A.,
L. Robinson,
A. Panayiotakis,
D. M. Thompson,
D. R. Hodge,
X. K. Zhang,
D. K. Watson,
K. Ozato, and T. S. Papas.
1994.
The EndoA enhancer contains multiple ETS binding site repeats and is regulated by ETS proteins.
Oncogene
9:469-477[Medline].
|
| 35.
|
Seth, A.,
L. Robinson,
D. M. Thompson,
D. K. Watson, and T. S. Papas.
1993.
Transactivation of GATA-1 promoter with ETS1, ETS2 and ERGB/Hu-FLI-1 proteins: stabilization of the ETS1 protein binding on GATA-1 promoter sequences by monoclonal antibody.
Oncogene
8:1783-1790[Medline].
|
| 36.
|
Shirasaki, F.,
H. A. Makhulf,
C. LeRoy,
D. K. Watson, and M. Trojanowska.
1999.
Ets transcription factors cooperate with Sp1 to activate the human tenascin-C promoter.
Oncogene
18:7755-7764[CrossRef][Medline].
|
| 37.
|
Watson, D. K.,
M. J. McWilliams,
P. Lapis,
J. A. Lautenberger,
C. W. Schweinfest, and T. S. Papas.
1988.
Mammalian ets-1 and ets-2 genes encode highly conserved proteins.
Proc. Natl. Acad. Sci. USA
85:7862-7866[Abstract/Free Full Text].
|
| 38.
|
Watson, D. K.,
F. E. Smyth,
D. M. Thompson,
J. Q. Cheng,
J. R. Testa,
T. S. Papas, and A. Seth.
1992.
The ERGB/Fli-1 gene: isolation and characterization of a new member of the family of human ETS transcription factors.
Cell Growth Differ.
3:705-713[Abstract].
|
| 39.
|
Wilkinson, D. G.
1992.
The theory and practice of in situ hybridization. In situ hybridization: a practical approach.
IRL Press at Oxford University Press, New York, N.Y.
|
| 40.
|
Yi, H.,
Y. Fujimura,
M. Ouchida,
D. D. Prasad,
V. N. Rao, and E. S. Reddy.
1997.
Inhibition of apoptosis by normal and aberrant Fli-1 and erg proteins involved in human solid tumors and leukemias.
Oncogene
14:1259-1268[CrossRef][Medline].
|
| 41.
|
Zhang, L.,
A. Eddy,
Y.-T. Teng,
M. Fritzler,
M. Kluppel,
F. Melet, and A. Bernstein.
1995.
An immunological renal disease in transgenic mice that overexpress Fli-1, a member of the ets family of transcription factor genes.
Mol. Cell. Biol.
15:6961-6970[Abstract].
|
| 42.
|
Zhang, L.,
V. Lemarchandel,
P. H. Romeo,
Y. Ben-David,
P. Greer, and A. Bernstein.
1993.
The Fli-1 proto-oncogene, involved in erythroleukemia and Ewing's sarcoma, encodes a transcriptional activator with DNA-binding specificities distinct from other Ets family members.
Oncogene
8:1621-1630[Medline].
|
| 43.
|
Zhang, X.-K.,
T. S. Papas,
N. K. Bhat, and D. K. Watson.
1995.
Generation and characterization of monoclonal antibodies against the ERGB/FLI-1 transcription factor.
Hybridoma
14:563-569[Medline].
|
Molecular and Cellular Biology, August 2000, p. 5643-5652, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kruse, E. A., Loughran, S. J., Baldwin, T. M., Josefsson, E. C., Ellis, S., Watson, D. K., Nurden, P., Metcalf, D., Hilton, D. J., Alexander, W. S., Kile, B. T.
(2009). Dual requirement for the ETS transcription factors Fli-1 and Erg in hematopoietic stem cells and the megakaryocyte lineage. Proc. Natl. Acad. Sci. USA
106: 13814-13819
[Abstract]
[Full Text]
-
Huang, H., Yu, M., Akie, T. E., Moran, T. B., Woo, A. J., Tu, N., Waldon, Z., Lin, Y. Y., Steen, H., Cantor, A. B.
(2009). Differentiation-Dependent Interactions between RUNX-1 and FLI-1 during Megakaryocyte Development. Mol. Cell. Biol.
29: 4103-4115
[Abstract]
[Full Text]
-
Stankiewicz, M. J., Crispino, J. D.
(2009). ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells. Blood
113: 3337-3347
[Abstract]
[Full Text]
-
Asano, Y., Trojanowska, M.
(2009). Phosphorylation of Fli1 at Threonine 312 by Protein Kinase C {delta} Promotes Its Interaction with p300/CREB-Binding Protein-Associated Factor and Subsequent Acetylation in Response to Transforming Growth Factor {beta}. Mol. Cell. Biol.
29: 1882-1894
[Abstract]
[Full Text]
-
Asano, Y., Markiewicz, M., Kubo, M., Szalai, G., Watson, D. K., Trojanowska, M.
(2009). Transcription Factor Fli1 Regulates Collagen Fibrillogenesis in Mouse Skin. Mol. Cell. Biol.
29: 425-434
[Abstract]
[Full Text]
-
Liu, F., Patient, R.
(2008). Genome-Wide Analysis of the Zebrafish ETS Family Identifies Three Genes Required for Hemangioblast Differentiation or Angiogenesis. Circ. Res.
103: 1147-1154
[Abstract]
[Full Text]
-
Zhang, X. K., Moussa, O., LaRue, A., Bradshaw, S., Molano, I., Spyropoulos, D. D., Gilkeson, G. S., Watson, D. K.
(2008). The Transcription Factor Fli-1 Modulates Marginal Zone and Follicular B Cell Development in Mice. J. Immunol.
181: 1644-1654
[Abstract]
[Full Text]
-
Bouilloux, F., Juban, G., Cohet, N., Buet, D., Guyot, B., Vainchenker, W., Louache, F., Morle, F.
(2008). EKLF restricts megakaryocytic differentiation at the benefit of erythrocytic differentiation. Blood
112: 576-584
[Abstract]
[Full Text]
-
Pearson, S., Sroczynska, P., Lacaud, G., Kouskoff, V.
(2008). The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF. Development
135: 1525-1535
[Abstract]
[Full Text]
-
Frontelo, P., Manwani, D., Galdass, M., Karsunky, H., Lohmann, F., Gallagher, P. G., Bieker, J. J.
(2007). Novel role for EKLF in megakaryocyte lineage commitment. Blood
110: 3871-3880
[Abstract]
[Full Text]
-
Asano, Y., Czuwara, J., Trojanowska, M.
(2007). Transforming Growth Factor- Regulates DNA Binding Activity of Transcription Factor Fli1 by p300/CREB-binding Protein-associated Factor-dependent Acetylation. J. Biol. Chem.
282: 34672-34683
[Abstract]
[Full Text]
-
Papadaki, C., Alexiou, M., Cecena, G., Verykokakis, M., Bilitou, A., Cross, J. C., Oshima, R. G., Mavrothalassitis, G.
(2007). Transcriptional Repressor Erf Determines Extraembryonic Ectoderm Differentiation. Mol. Cell. Biol.
27: 5201-5213
[Abstract]
[Full Text]
-
Higuchi, T., Bartel, F. O., Masuya, M., Deguchi, T., Henderson, K. W., Li, R., Muise-Helmericks, R. C., Kern, M. J., Watson, D. K., Spyropoulos, D. D.
(2007). Thymomegaly, Microsplenia, and Defective Homeostatic Proliferation of Peripheral Lymphocytes in p51-Ets1 Isoform-Specific Null Mice. Mol. Cell. Biol.
27: 3353-3366
[Abstract]
[Full Text]
-
Pang, L., Xue, H.-H., Szalai, G., Wang, X., Wang, Y., Watson, D. K., Leonard, W. J., Blobel, G. A., Poncz, M.
(2006). Maturation stage-specific regulation of megakaryopoiesis by pointed-domain Ets proteins. Blood
108: 2198-2206
[Abstract]
[Full Text]
-
Nakerakanti, S. S., Kapanadze, B., Yamasaki, M., Markiewicz, M., Trojanowska, M.
(2006). Fli1 and Ets1 Have Distinct Roles in Connective Tissue Growth Factor/CCN2 Gene Regulation and Induction of the Profibrotic Gene Program. J. Biol. Chem.
281: 25259-25269
[Abstract]
[Full Text]
-
Vegiopoulos, A., Garcia, P., Emambokus, N., Frampton, J.
(2006). Coordination of erythropoiesis by the transcription factor c-Myb. Blood
107: 4703-4710
[Abstract]
[Full Text]
-
Pimanda, J. E., Chan, W.Y. I., Donaldson, I. J., Bowen, M., Green, A. R., Gottgens, B.
(2006). Endoglin expression in the endothelium is regulated by Fli-1, Erg, and Elf-1 acting on the promoter and a -8-kb enhancer. Blood
107: 4737-4745
[Abstract]
[Full Text]
-
van den Akker, E., Ano, S., Shih, H.-M., Wang, L.-C., Pironin, M., Palvimo, J. J., Kotaja, N., Kirsh, O., Dejean, A., Ghysdael, J.
(2005). FLI-1 Functionally Interacts with PIASx{alpha}, a Member of the PIAS E3 SUMO Ligase Family. J. Biol. Chem.
280: 38035-38046
[Abstract]
[Full Text]
-
Hu, W., Philips, A. S., Kwok, J. C., Eisbacher, M., Chong, B. H.
(2005). Identification of Nuclear Import and Export Signals within Fli-1: Roles of the Nuclear Import Signals in Fli-1-Dependent Activation of Megakaryocyte-Specific Promoters. Mol. Cell. Biol.
25: 3087-3108
[Abstract]
[Full Text]
-
Zhang, X. K., Watson, D. K.
(2005). The FLI-1 Transcription Factor Is a Short-Lived Phosphoprotein in T Cells. J Biochem
137: 297-302
[Abstract]
[Full Text]
-
Masuya, M., Moussa, O., Abe, T., Deguchi, T., Higuchi, T., Ebihara, Y., Spyropoulos, D. D., Watson, D. K., Ogawa, M.
(2005). Dysregulation of granulocyte, erythrocyte, and NK cell lineages in Fli-1 gene-targeted mice. Blood
105: 95-102
[Abstract]
[Full Text]
-
Jackers, P., Szalai, G., Moussa, O., Watson, D. K.
(2004). Ets-dependent Regulation of Target Gene Expression during Megakaryopoiesis. J. Biol. Chem.
279: 52183-52190
[Abstract]
[Full Text]
-
Zhang, X. K., Gallant, S., Molano, I., Moussa, O. M., Ruiz, P., Spyropoulos, D. D., Watson, D. K., Gilkeson, G.
(2004). Decreased Expression of the Ets Family Transcription Factor Fli-1 Markedly Prolongs Survival and Significantly Reduces Renal Disease in MRL/lpr Mice. J. Immunol.
173: 6481-6489
[Abstract]
[Full Text]
-
Hollenhorst, P. C., Jones, D. A., Graves, B. J.
(2004). Expression profiles frame the promoter specificity dilemma of the ETS family of transcription factors. Nucleic Acids Res
32: 5693-5702
[Abstract]
[Full Text]
-
Ristevski, S., O'Leary, D. A., Thornell, A. P., Owen, M. J., Kola, I., Hertzog, P. J.
(2004). The ETS Transcription Factor GABP{alpha} Is Essential for Early Embryogenesis. Mol. Cell. Biol.
24: 5844-5849
[Abstract]
[Full Text]
-
Gottgens, B., Broccardo, C., Sanchez, M.-J., Deveaux, S., Murphy, G., Gothert, J. R., Kotsopoulou, E., Kinston, S., Delaney, L., Piltz, S., Barton, L. M., Knezevic, K., Erber, W. N., Begley, C. G., Frampton, J., Green, A. R.
(2004). The scl +18/19 Stem Cell Enhancer Is Not Required for Hematopoiesis: Identification of a 5' Bifunctional Hematopoietic-Endothelial Enhancer Bound by Fli-1 and Elf-1. Mol. Cell. Biol.
24: 1870-1883
[Abstract]
[Full Text]
-
Lebigot, I., Gardellin, P., Lefebvre, L., Beug, H., Ghysdael, J., Quang, C. T.
(2003). Up-regulation of SLAP in FLI-1-transformed erythroblasts interferes with EpoR signaling. Blood
102: 4555-4562
[Abstract]
[Full Text]
-
Kubo, M., Czuwara-Ladykowska, J., Moussa, O., Markiewicz, M., Smith, E., Silver, R. M., Jablonska, S., Blaszczyk, M., Watson, D. K., Trojanowska, M.
(2003). Persistent Down-Regulation of Fli1, a Suppressor of Collagen Transcription, in Fibrotic Scleroderma Skin. Am. J. Pathol.
163: 571-581
[Abstract]
[Full Text]
-
Elagib, K. E., Racke, F. K., Mogass, M., Khetawat, R., Delehanty, L. L., Goldfarb, A. N.
(2003). RUNX1 and GATA-1 coexpression and cooperation in megakaryocytic differentiation. Blood
101: 4333-4341
[Abstract]
[Full Text]
-
Eisbacher, M., Holmes, M. L., Newton, A., Hogg, P. J., Khachigian, L. M., Crossley, M., Chong, B. H.
(2003). Protein-Protein Interaction between Fli-1 and GATA-1 Mediates Synergistic Expression of Megakaryocyte-Specific Genes through Cooperative DNA Binding. Mol. Cell. Biol.
23: 3427-3441
[Abstract]
[Full Text]
-
Zhu, J., Motejlek, K., Wang, D., Zang, K., Schmidt, A., Reichardt, L. F.
(2003). {beta}8 integrins are required for vascular morphogenesis in mouse embryos. Development
129: 2891-2903
[Abstract]
[Full Text]
-
Starck, J., Cohet, N., Gonnet, C., Sarrazin, S., Doubeikovskaia, Z., Doubeikovski, A., Verger, A., Duterque-Coquillaud, M., Morle, F.
(2003). Functional Cross-Antagonism between Transcription Factors FLI-1 and EKLF. Mol. Cell. Biol.
23: 1390-1402
[Abstract]
[Full Text]
-
Raslova, H., Roy, L., Vourc'h, C., Le Couedic, J. P., Brison, O., Metivier, D., Feunteun, J., Kroemer, G., Debili, N., Vainchenker, W.
(2003). Megakaryocyte polyploidization is associated with a functional gene amplification. Blood
101: 541-544
[Abstract]
[Full Text]
-
Holmes, M. L., Bartle, N., Eisbacher, M., Chong, B. H.
(2002). Cloning and Analysis of the Thrombopoietin-induced Megakaryocyte-specific Glycoprotein VI Promoter and Its Regulation by GATA-1, Fli-1, and Sp1. J. Biol. Chem.
277: 48333-48341
[Abstract]
[Full Text]
-
Lelievre, E., Lionneton, F., Mattot, V., Spruyt, N., Soncin, F.
(2002). Ets-1 Regulates fli-1 Expression in Endothelial Cells. IDENTIFICATION OF ETS BINDING SITES IN THE fli-1 GENE PROMOTER. J. Biol. Chem.
277: 25143-25151
[Abstract]
[Full Text]
-
Gaspar, J., Thai, S., Voland, C., Dube, A., Libermann, T. A., Iruela-Arispe, M.L., Oettgen, P.
(2002). Opposing Functions of the Ets Factors NERF and ELF-1 During Chicken Blood Vessel Development. Arterioscler. Thromb. Vasc. Bio.
22: 1106-1112
[Abstract]
[Full Text]
-
Sykes, D. B., Kamps, M. P.
(2001). Estrogen-dependent E2a/Pbx1 myeloid cell lines exhibit conditional differentiation that can be arrested by other leukemic oncoproteins. Blood
98: 2308-2318
[Abstract]
[Full Text]
-
Eisbacher, M., Khachigian, L. M., Khin, T. H., Holmes, M. L., Chong, B. H.
(2001). Inducible Expression of the Megakarocyte-specific Gene Glycoprotein IX Is Mediated through an Ets Binding Site and Involves Upstream Activation of Extracellular Signal-regulated Kinase. Cell Growth Differ.
12: 435-445
[Abstract]
[Full Text]
-
Gilliland, D. G.
(2001). The Diverse Role of the ETS Family of Transcription Factors in Cancer: Commentary re: B. Davidson, Ets-1 Messenger RNA Expression Is a Novel Marker of Poor Survival in Ovarian Carcinoma. Clin. Cancer Res., 7: 551-557, 2001.. Clin. Cancer Res.
7: 451-453
[Full Text]
-
Czuwara-Ladykowska, J., Shirasaki, F., Jackers, P., Watson, D. K., Trojanowska, M.
(2001). Fli-1 Inhibits Collagen Type I Production in Dermal Fibroblasts via an Sp1-dependent Pathway. J. Biol. Chem.
276: 20839-20848
[Abstract]
[Full Text]