Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 5700-5711, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Histone-Histone Interactions and Centromere
Function
Lynn
Glowczewski,
Peirong
Yang,
Tatyana
Kalashnikova,
Maria Soledad
Santisteban, and
M. Mitchell
Smith*
Department of Microbiology and Cancer Center,
University of Virginia, Charlottesville, Virginia 22908
Received 22 February 2000/Returned for modification 18 April
2000/Accepted 26 May 2000
 |
ABSTRACT |
Cse4p is a structural component of the core centromere of
Saccharomyces cerevisiae and is a member of the conserved
CENP-A family of specialized histone H3 variants. The histone H4 allele hhf1-20 confers defects in core centromere chromatin
structure and mitotic chromosome transmission. We have proposed that
Cse4p and histone H4 interact through their respective histone fold domains to assemble a nucleosome-like structure at centromeric DNA. To
test this model, we targeted random mutations to the Cse4p histone fold
domain and isolated three temperature-sensitive cse4 alleles in an unbiased genetic screen. Two of the cse4
alleles contain mutations at the Cse4p-H4 interface. One of these
requires two widely separated mutations demonstrating long-range
cooperative interactions in the structure. The third cse4
allele is mutated at its helix 2-helix 3 interface, a region required
for homotypic H3 fold dimerization. Overexpression of wild-type Cse4p
and histone H4 confer reciprocal allele-specific suppression of
cse4 and hhf1 mutations, providing strong
evidence for Cse4p-H4 protein interaction. Overexpression of histone H3
is dosage lethal in cse4 mutants, suggesting that histone
H3 competes with Cse4p for histone H4 binding. However, the relative
resistance of the Cse4p-H4 pathway to H3 interference argues that
centromere chromatin assembly must be highly regulated.
 |
INTRODUCTION |
The centromere is a specialized
chromatin structure that has evolved to ensure the accurate segregation
of replicated chromosomes during mitosis and meiosis. It is composed of
centromeric DNA (CEN DNA) plus a complex assembly of
chromosomal and kinetochore proteins (12, 13, 22). The
centromere performs at least three essential functions during the
cell division cycle. First, it provides the site of attachment for
spindle microtubules, thus enabling the accurate segregation of
replicated sister chromatids. Second, it serves to prevent premature
sister chromatid separation during segregation (6). Third,
the kinetochore complex monitors the integrity of microtubule
attachment and activates the spindle checkpoint pathway in the presence
of spindle damage (44). Thus, identifying the proteins of
the centromere and defining their functions are critical for
understanding the essential process of chromosome segregation.
The budding yeast Saccharomyces cerevisiae provides a simple
model system for both genetic and biochemical studies of centromere structure and function. The CEN DNA of S. cerevisiae is entirely contained within a sequence of about 125 bp
of DNA present on all 16 chromosomes. Each CEN DNA is made
up of three conserved sequence elements, CDEI, CDEII, and CDEIII, which
are bound by sequence-specific DNA binding proteins and additional
kinetochore proteins (reviewed in references 21, 22,
and 33). This complex centromere assembly produces a
distinctive chromatin structure in vivo. At each centromere, the
CEN DNA region exists as a nuclease-resistant chromatin
domain spanning a total of 180 to 220 bp. This core centromere is
delimited on each side by strong nuclease-hypersensitive sites and is
flanked by arrays of positioned nucleosomes (7, 17). These
mapping experiments led to the hypothesis that the core centromere
contained a nucleosome-like structure (reviewed in reference
41).
Recent evidence suggests that the nuclease resistant core centromere
contains a specialized variant nucleosome particle. Key to this
hypothesis has been the identification of a conserved family of
centromere-specific histone H3 protein variants found in a wide range
of organisms including mammals (35, 48), yeast (45,
47), worms (11), and flies (18). The
founding member of this family is the mammalian centromere-specific
protein CENP-A (35, 48). CENP-A is a 16-kDa protein with
roughly 65% similarity to histone H3 over its histone fold domain. The
results of site-directed mutational studies of CENP-A are consistent
with the properties expected for a histone fold and have shown that
this domain is necessary for localization of the protein to the
kinetochore (35, 42). CENP-A has recently been localized to
the inner plate of the kinetochore, and there is a strong correlation
between the presence of a functional mammalian centromere and CENP-A
protein, although a direct test of the role of CENP-A in centromere
function has not yet been completed (50, 52).
The homologue of CENP-A in S. cerevisiae is encoded by the
gene CSE4. It was first identified in a screen for mutants
defective for chromosome segregation (47) and subsequently
through two independent genetic screens based on the fidelity of
mitotic chromosome transmission (4, 45). CSE4
encodes a 27-kDa protein composed of a N-terminal domain with a unique
sequence and a C-terminal domain consisting of a histone fold motif
with >65% similarity to histone H3. Both the N-terminal and histone
fold domains of Cse4p are essential for function (23, 30).
The histone folds of both Cse4p and CENP-A share distinct sequence
features, including a short peptide insertion and the unusual presence
of a tryptophan residue within the first loop of the fold. Cse4p also
has properties expected of an H3-like histone, since it elutes
biochemically with the major core histones during column chromatography
(47) and it interacts genetically with histone H4
(45).
Several observations indicate that Cse4p is a specific structural
component of the S. cerevisiae centromere (30).
First, core centromere chromatin is disrupted in cse4
mutants when cells are shifted to restrictive temperatures. Second,
Cse4p is physically localized to the CEN DNA as determined
by in vivo cross-linking and chromatin immunoprecipitation. It fails to
cross-link to the DNA located in the nucleosomes surrounding the core
domain or to several other noncentromeric DNA locations examined.
Finally, as visualized by immunofluorescence microscopy, Cse4p is
localized in the nucleus in discrete foci whose number and movements
during the cell division cycle are consistent with those expected for CEN DNA.
Histone H4 is also likely to be a component of the S. cerevisiae core centromere. In a previous genetic screen for
histone H4 mutants specifically defective in mitotic chromosome
transmission, we identified a novel temperature-sensitive H4 mutant,
hhf1-20, which at semipermissive temperatures has a 60-fold
increase in the frequency of chromosome loss. At restrictive
temperatures hhf1-20 cells arrest at medial nuclear
division. Increased CSE4 gene dosage suppresses the
essential defect caused by the hhf1-20 allele
(45). Furthermore, cells expressing hhf1-20 also
show a disruption of core centromere chromatin at restrictive
temperatures, and this defect is suppressed by overexpression of
wild-type Cse4p in the hhf1-20 mutants (30).
These genetic and biochemical results led us to propose a model in
which the core centromere of S. cerevisiae is assembled around a specialized variant nucleosome containing at least Cse4p and
histone H4 (30). This model makes strong predictions
regarding genetic interactions between Cse4p, histone H4, and histone
H3. To investigate these predictions we have constructed a set of cse4 point mutants by both site-directed and random
mutagenesis of the DNA sequence encoding the Cse4p histone fold. Here
we report the characterization of these new cse4 alleles,
their interactions with histone H4, and their effects on centromere
function. The results of these experiments show that Cse4p-histone H4
interactions are essential for centromere function in S. cerevisiae and suggest a highly regulated pathway for the assembly
of the core centromere chromatin.
 |
MATERIALS AND METHODS |
Strains and plasmids.
The relevant plasmid
constructs used in this study are listed in Table
1, and the genotypes of yeast strains are
listed in Table 2. All DNA and bacterial
manipulations were by standard protocols (39). Yeast growth
media, as well as transformation, sporulations, and DNA isolation
protocols were carried out as described previously (1).
Site directed mutagenesis.
All site-directed mutants used in
this study were created using the pAlter system (Promega). The
oligonucleotide sequence used to delete the KDQ insertion in Cse4p was
5' TTGACTGCCAACGTAAATCAGTTGTAAACTCGTCTGTAA 3'.
The underlined letters mark the boundary of the deleted
nucleotides. The oligonucleotide used to change the tryptophan to
phenylalanine was 5' CGCCATTGACTGAAAACGTAAATC 3'.
Oligonucleotides 180 (5'
CAATAATCCTACCTGATACGCTTCG 3') and 179 (5'
CTTGCAAATGGAACTTTGGAGATTA 3') were used to create
cse4-111 and cse4-112. Boldface type indicates change from the wild-type sequence.
Mutagenesis and library construction.
The substrate for
mutagenesis of CSE4 was a 1.8-kb
EcoRI-PstI fragment of pPY12 that contains a
GAL1-CSE4 fusion gene. Oligonucleotides that annealed to the
GAL1 promoter region and approximately 200 bp downstream of
the 3' end of CSE4 were used as primers for the PCR.
Mutagenesis was performed essentially as described (32) to
generate a library of PCR fragments. This library was used to repair
gaps in pPY13 and introduce changes in the histone fold region of
Cse4p. Analysis of the phenotype of the mutants was performed by
plasmid shuffle (8). Five cse4(Ts) alleles were recovered into DH5
bacteria as described (38). Plasmid
DNA was purified from the bacteria and used to transform MSY718. All five plasmids conferred temperature-sensitive growth. Sequence analysis
revealed that two of the plasmids were identical and thus define four
independent mutants.
Western blots.
Wild-type, cse4-102,
cse4-110, and cse4-111 constructs containing an
in-frame hemagglutinin (HA) tag in the N terminus of the protein were
constructed using a KpnI-BstBI fragment from pPM178 (30). These were introduced as the sole source of
Cse4p by plasmid shuffle into MSY1358 and serve to complement the null mutant as assayed by growth. Cultures were grown at a permissive temperature, and then half the cultures were shifted to 37°C for 4 h. Cells were harvested and lysates were prepared by glass bead disruption and 0.3 M ammonium sulfate extraction buffer. A
non-HA-tagged wild-type Cse4p strain served as a negative control.
Proteins were quantitated using the Bio-Rad microassay, and a total of 100 µg of protein from each lysate was run on a sodium dodecyl sulfate-12.5% polyacrylamide gel. The proteins were electroblotted onto nitrocellulose and blocked with 10% dry milk in Tris-buffered saline overnight. Enhanced chemiluminescence was performed essentially as described by the manufacturer (Amersham Life Science) using the
HA.11 antibody (1:1,000; BAbCO) as the primary antibody against the HA
tag and goat anti-mouse coupled to horseradish peroxidase (Amersham) as
the secondary antibody.
Flow cytometry and immunofluorescence.
Flow cytometry and
cell cycle analysis were carried out as described previously
(28). Overnight cultures were diluted to 5 × 106 cells/ml and incubated at either 28 and 33°C or 28 and 37°C. These cultures were maintained for 3 or 5 h at those
temperatures. One-milliliter samples for flow cytometry were taken
every hour and analyzed on a FACScan fluorescence-activated cell sorter
(Becton Dickinson). At the termination of the time course, 5 to 10 ml of each culture was prepared for immunofluorescence as described (37). Indirect immunofluorescence was performed using YOL34 (rat
-tubulin) as the primary antibody and goat
-rat conjugated to Texas Red as the secondary antibody. Nuclear DNA was visualized by
the addition of DAPI (4',6'-diamidino-2-phenylindole) (0.4 µg/ml;
Boehringer Manheim).
Checkpoint analysis.
Strains containing either
HHF1, hhf1-20, CSE4,
GAL1::CSE4, or the cse4 point mutants
alone or in combination with a rad9
, bub2
,
mad1-1, or mad1
mutation were grown to mid-log
phase (5 × 106 to 1 × 107) at
28°C. The cultures were shifted to 37°C, and aliquots were plated
on yeast-peptone-dextrose plates and grown at 28°C. Plating efficiency was determined from the number of colonies formed at 28°C
after 3 days of growth divided by the total number of cells plated.
Cell cycle arrest was monitored by microscopy and flow cytometry.
Chromatin Immunoprecipitations.
In vivo cross-linking,
chromatin immunoprecipitation, and DNA fragment mapping were performed
as described (29, 30). Cultures were grown to a
concentration of 2 × 107 cells/ml at 28°C and then
shifted to 37°C for 4 h before cross-linking. Strains MSY1517
through MSY1520 were grown in yeast-peptone-dextrose and the histone
overexpression strains MSY1475 through MSY1482 were grown in SC-URA
medium with galactose as the carbon source (1). Cross-linked
chromatin was precipitated with purified anti-HA immunoglobulin G
monoclonal antibody (12CA5) at a final concentration of 4 µg/ml per
reaction mixture.
Transcriptional read-through assays.
pKF71 was obtained from
the Spencer laboratory and was described previously (15).
The plasmid was digested with BamHI and used to transform
MSY1358 or MX1-4C. Strains were maintained in galactose-containing
medium to ensure the test centromere remained inactive. The level of
transcription off the GAL1 promoter in wild-type,
cse4-110, and cse4-111 was determined using
pJK101 (10).
o-Nitrophenyl-
-D-galactopyranoside assays
were performed essentially as described (1). The protein
concentration of the lysates was determined by the Bio-Rad protein
microassay using bovine serum albumin as the standard. The specific
activity was calculated as follows: optical density at 420 nm × 0.850/ (0.0045 × protein concentration × extract
volume × time).
Molecular modeling.
The structures of the S. cerevisiae Cse4p and histone H4 proteins were modeled on the X-ray
crystal structures of the nucleosome using Sybyl (Tripos). Identical
interpretations were obtained using either the histone octamer data set
(Protein Data Bank entry 1HIO [2]) or the nucleosome
data set (Protein Data Bank entry 1AOI [26]). The
amino acid differences present in the yeast proteins were introduced
into the crystal structures and optimized by local energy minimization
around the set of yeast-specific residues.
 |
RESULTS |
Site-directed cse4 mutations.
The first loop in
the histone fold domain of Cse4p has two obvious features that
distinguish it from histone H3: (i) a three-amino-acid insertion and
(ii) the substitution of tryptophan (W178) for the corresponding
phenylalanine found in H3. Both of these alterations are characteristic
of the CENP-A family of H3 variants, occurring in Cse4p in S. cerevisiae, several variants in Caenorhabditis elegans,
and mammalian CENP-A. The position of the short amino acid loop
insertion is conserved in all family members, but its exact length and
sequence vary. In Cse4p the insertion comprises the three amino acids
lysine, aspartate, and glutamine (KDQ) at positions 171 to 173. Tryptophan is an unusual amino acid in histone proteins and is not
present in the major core histones. Thus, given its location in loop 1, it could potentially play a role in the centromere-specific functions
of the family. The roles of these features in directing the
localization of CENP-A to human centromeres have been tested, and
neither deleting the extra loop residues nor replacing the CENP-A
tryptophan with phenylalanine affected CENP-A localization to the
centromere (42). We were able to test the full biological
function of these same features in Cse4p by site-directed mutagenesis
and gene replacement in S. cerevisiae.
To determine whether the KDQ insertion was required for protein
function, the codons for the insertion were deleted from the
gene to
create the allele
cse4-106. To determine if the tryptophan
was required for function, it was changed to its H3 equivalent
phenylalanine (W178F) to create the allele
cse4-109. These
alleles
were subcloned into pRS314 and introduced into MSY1358 by
plasmid
shuffle as the only source of Cse4p protein. Cells expressing
cse4-106 or
cse4-109 were wild type in a variety
of assays, including
growth, temperature sensitivity (Fig.
1A),
hhf1-20 suppression,
and
centromere transcriptional read-through (see below and Fig.
4A). These
results are entirely consistent with those reported
for CENP-A and show
that neither the KDQ insertion nor the conservative
W178 substitution
is essential for Cse4p function in mitotic growth.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
Conditional growth and protein levels of Cse4p point
mutants. (A) The growth phenotypes of the wild-type plasmid shuffle
strain and the histone fold Cse4p mutants at the permissive (28°C)
and restrictive (37°C) temperature are shown. Tenfold serial
dilutions of each strain were spotted onto synthetic complete medium
minus tryptophan and grown for 2 days at the indicated temperatures.
The location of the point changes in the mutants can be found in Table
1. (B) Mutant Cse4 proteins are stable at the restrictive temperature.
Crude lysates were made from the indicated strains grown at 28°C and
then shifted to 37°C for 4 h. Equal amounts of protein were run
on a sodium dodecyl sulfate-12.5% polyacrylamide gel and
electroblotted to nitrocellulose. Western blot analyses were performed
using and anti-HA antibody (HA.11).
|
|
Isolation of cse4 histone fold mutations.
To
identify essential functional residues in Cse4p, we carried out an
unbiased genetic screen for temperature-sensitive cse4 mutants. A library of cse4 mutants was constructed by
targeting random mutations to the DNA sequence encoding the histone
fold domain using PCR misincorporation. The fold domain mutations were then recovered by gap repair into the full-length CSE4
sequence to generate a mutant library in yeast (see Materials and
Methods). The final constructs also carried a triple-HA epitope tag
in the unique N-terminal domain of Cse4p to facilitate assays of
protein expression.
Four independent temperature-sensitive mutants were recovered from a
screen of 3,200 library colonies and designated
cse4-101,
-
102, -
103, and -
104 (Fig.
1A). The
library plasmid was recovered
from each isolate and sequenced to
determine its amino acid sequence
(Table
3). Each of these initial alleles carried
mutations producing
two amino acid substitutions. Since both
cse4-101 and
cse4-104 shared the amino acid
substitution L196S, we constructed the single
L196S substitution allele
cse4-110. As shown in Fig.
1A, the L196S
substitution is
sufficient to confer the temperature-sensitive
phenotype. Next, the two
substitutions in the
cse4-102 allele
were separated into the
single substitution alleles
cse4-107 and
cse4-108. As shown in Fig.
1A, neither of these single point
mutations
produced a tight temperature-sensitive lethal phenotype. A
slight
growth defect is evident in
cse4-108, but this allele
has little
effect on centromere integrity (see Fig.
4A below). Thus,
the
essential defect in
cse4-102 requires both
substitutions. Finally,
the two substitutions in
cse4-103,
I156V and L193Q, were separated
into the single point mutant alleles
cse4-111 and
cse4-112. As
shown in Fig.
1A, the
single L193Q substitution in
cse4-111 is
sufficient to
confer the temperature-sensitive phenotype, whereas
the I156V
substitution in
cse4-112 gives wild-type growth.
Mutant Cse4p proteins are stable.
Since Cse4p is an essential
gene product, rapid degradation of the mutant proteins at restrictive
temperatures would provide a trivial explanation for the temperature
sensitivity of the mutants. Therefore, we determined the relative
levels of Cse4p present in the wild-type and mutant strains at
permissive and restrictive temperatures. Lysates were prepared from
cultures grown at 28°C or shifted to 37°C for 4 h, and the
expression of Cse4p was assayed by Western blotting using the anti-HA
antibody, HA.11. As shown in Fig. 1B, Cse4p from the cse4
mutants was not degraded at restrictive temperatures. On the contrary,
the mutants contain more protein than wild-type cells at both
permissive and restrictive temperatures. At present we do not know the
reasons for this increased accumulation, but in any case the
temperature-sensitive phenotypes of cse4-102, -110, and -111 cannot be due to the simple
absence of protein.
The cse4 histone fold mutants are impaired for nuclear
division.
Several lines of evidence indicate that these new
cse4 histone fold mutants are defective for centromere
function. First, they have a cell division cycle defect at mitosis. As
shown in the DNA histograms of Fig. 2A,
cse4 mutants show a marked accumulation of cells with a 2C
DNA content even at permissive temperatures, reflecting a delay in cell
cycle progressions through G2/M (Fig. 2A and B). This
arrest is exacerbated at the restrictive temperature (Table
4). The most abundant class of aberrant
cells found in the mutant strains is a large budded cell with a single
nucleus and a bipolar spindle (Fig. 2C). This type of cell is rarely
found in the wild-type strain but can range up to 36% in the mutants (Table 4). Often the mitotic spindle in mutant cells is not properly aligned with respect to the bud. These results are similar to those
reported previously for cse4-1 and hhf1-20
(45, 47).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
G2/M arrest in cse4 mutants. (A)
Flow cytometry of cse4 strains in exponential cultures grown
at 28°C. Wild-type and cse4 mutant strains were stained
for DNA content with propidium idodide and analyzed by flow cytometry.
Representative histograms of cell number versus relative fluorescence
are shown. In each panel the circles show the channel data points and
the solid line shows the overall fit of the data to a model of
G1, S, and G2/M phase cell populations. Below
each plot the individual G1, S, and G2/M model
fits are shown at half scale. (B) Cell division cycle profiles. The
relative lengths of the cell cycle phases were approximated using
culture doubling times and the percentage of cells in each phase as
estimated from the flow cytometry histograms. The estimates are the
mean of six independent measurements for each mutant. The profiles are
aligned at the S/G2/M boundary for comparison of the
relative lengths of the G2/M cell cycle phase. (C)
Morphology of cse4 cells accumulated at restrictive
temperature. The nuclear and spindle morphology are shown for the class
of cse4-102, cse4-110, and cse4-111
mutant cells that accumulate following arrest at the restrictive
temperature (Table 2). Each pair of micrographs illustrates the nuclear
staining (DAPI) and the spindle staining (tubulin) visualized with an
antitubulin antibody.
|
|
cse4 and hhf1-20 mutants engage the spindle
checkpoint pathway.
The second line of evidence suggesting that
the cse4 and hhf1-20 mutants are impaired for
centromere function is that they specifically activate the
spindle-kinetochore checkpoint pathway. The integrity of spindle
attachment to the kinetochore is monitored by a checkpoint pathway
which includes the product of the BUB and MAD
genes (20, 24, 36, 51). In the presence of spindle or
kinetochore damage, the checkpoint pathway serves to negatively regulate cell cycle progression at G2/M until the damage is
repaired. The consequence of disrupting the checkpoint pathway in the
presence of an incomplete kinetochore or spindle is that cells fail to arrest division and lose viability as a result of the damage. As shown
in Fig. 3 both hhf1-20 and a
conditional GAL1::CSE4 null allele are
hypersensitive to disruption of the kinetochore-spindle checkpoint
pathway, but not to disruption of the DNA damage checkpoint pathway.
Flow cytometry and analysis of cell morphology confirmed that the
decreased viability in the double mutants was accompanied by a loss of
cell cycle checkpoint arrest (data not shown). The cse4
point mutants were difficult to examine in temperature shift experiments because of their constitutive G2/M defect even
at permissive temperatures. However, cse4 mad1
double
mutants showed reduced viabilities consistent with an activation of the
spindle checkpoint in the cse4 single mutant cells.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
hhf1-20 and cse4 mutants activate
the spindle-kinetochore checkpoint pathway. (A) Checkpoint control in
hhf1-20 mutants. Cultures were grown to mid-log phase at
28°C and then shifted to 37°C, the restrictive temperature for
hhf1-20 cells. The kinetics of cell viability are shown
following the shift to the restrictive temperature. Open circle, MSY559
(HHF1); open square, MSY554 (hhf1-20); open
diamond, MSY556 (hhf1-20 rad9::URA3); filled
circle, MSY713 (hhf1-20 bub2::URA3). (B)
Checkpoint control in GAL1::CSE4 conditional null
mutants. Cultures were grown to mid-log phase in galactose medium and
then shifted to raffinose medium to turn off CSE4
expression. The kinetics of cell viability are shown following the
shift to raffinose medium. Open square, MSY753
(GAL1::CSE4); open diamond, MSY824
(GAL1::CSE4 rad9::URA3); filled diamond,
MSY819 (GAL1::CSE4 mad1).
|
|
cse4 and hhf1-20 mutants disrupt core
centromere structure in vivo.
The third line of evidence for a
kinetochore defect in the cse4 histone fold mutants comes
from an in vivo assay of kinetochore function (15). The
rationale for this assay is that placement of a CEN DNA
sequence within the intron of an artificial
GAL1::lacZ reporter reduces the expression of
-galactosidase by assembling a kinetochore complex and blocking the
transcribing polymerase. Mutations in CEN DNA, or in known
kinetochore proteins, disrupt this complex giving increased
transcriptional read-through and expression of lacZ
(15). Therefore, to assay kinetochore function in vivo, we
integrated this reporter construct into the set of cse4 and
hhf1-20 mutants and measured
-galactosidase activities in
cells grown at semipermissive temperatures. The results of these assays
are shown in Fig. 4. The known
kinetochore mutant ctf13-30 serves as a positive control in
these assays (15) and routinely expressed levels of
-galactosidase activity two- to threefold higher than wild-type
control cultures. All of the cse4(Ts) mutants produced
increased expression of lacZ, consistent with a disruption
of the kinetochore complex. Furthermore, cse4 mutants that
were not temperature-sensitive did not give increased transcriptional read-through (Fig. 4A). We also found that the histone H4 mutant hhf1-20 gave increased lacZ expression in cells
grown at semipermissive temperatures (Fig. 4B).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
Transcriptional read-through of CEN DNA in
cse4 and hhf1-20 mutants. For each panel the
indicated strains were grown in synthetic complete galactose medium
lacking histidine, and cell extracts were prepared after 18 h of
growth at the semipermissive temperature. The units for levels of
-galactosidase activity (LacZ Activity) are nanomoles of ONPG
cleaved per milligram of lysate protein per minute. (A) LacZ
expression was determined in wild-type, ctf13-30, and
isogenic cse4 mutant strains grown at 33°C. In these
strains GAL1::LacZ expression requires
transcription through a CEN DNA insert located in an intron
of the reporter gene. The CEN DNA insert partially blocks
transcription in wild-type cells, giving low levels of expression. In
ctf13-30 mutants this block is compromised, giving increased
expression (14). The values represent the average of two to
three independent cultures. (B) Transcription through CEN
DNA was determined for isogenic HHF1 and hhf1-20
strains as described above. Cells were grown at a semipermissive
temperature of 34°C, and the values represent the average of three to
four independent cultures. (C) LacZ expression was
determined for wild-type and two cse4 mutant strains as
described above. However, in these strains the
GAL1::LacZ reporter gene is carried on a 2µ
plasmid and lacks the CEN DNA insert. In all panels, error
bars show standard deviations.
|
|
Since
cse4 and
hhf1-20 mutations affect proteins
of the histone family, the increased expression of
lacZ in
the read-through
assay could have been the result of alterations in
GAL1 promoter
activity and not the centromere complex.
Therefore, we assayed
the expression of a
GAL1::lacZ construct lacking
CEN DNA.
As shown
in Fig.
4C, there was no change in the level of expression of

-galactosidase among mutant and wild-type strains. Therefore,
we
conclude that
cse4 and
hhf1-20 affect the
integrity of the
CEN DNA kinetochore complex directly and
not the basal transcription
of the reporter. Based on their nuclear and
spindle morphologies,
their activation of the spindle-kinetochore
checkpoint arrest,
and their disruption of a
CEN DNA block
to transcription, we conclude
that the lethal defect in these
cse4(Ts) mutants is in centromere
structure and
function.
The locations of cse4 mutations are at sites of
histone-histone interaction.
To begin to understand how the
cse4 mutations disrupt centromere function, we mapped the
locations of the amino acid substitutions in the mutants onto a
molecular model of the Cse4p-H4 dimer based on the crystal structure of
the nucleosome (Fig. 5). The histone fold
motif (2) consists of two short alpha-helical segments (helix 1 and helix 3) connected to a long central alpha-helix (helix 2)
by two loop and beta-strand segments (loop 1 and loop 2). Two histone
fold domains pair head-to-tail across their long central helical
regions, forming paired-element motifs where loop 1 from one chain runs
antiparallel to loop 2 from the other chain (Fig. 5A).

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 5.
Model of the locations of cse4 amino acid
substitutions. The protein structures of the Cse4p-H4 dimer were
modeled based on the X-ray crystal structures of histones H3 and H4 in
the nucleosome (Materials and Methods). In each panel structures and
labels referring to Cse4p are shown in green and those referring to
histone H4 are shown in white. The wild-type residue that is mutated in
each cse4 allele is shown in red. Atoms that are within 5 Å of the side chain of the mutated residue are colored yellow. (A) A
partial nucleosome structure depicting a Cse4p-H4 dimer and one turn of
DNA is shown. The view is down the superhelical axis of the DNA,
perpendicular to the pseudodyad axis of the nucleosome which is within
the plane of the illustration extending from left to right. Approximate
vectors for the points of view shown in panels B, C, D, and E are
indicated by the red arrows. (B) The region surrounding L175, one of
the two amino acids mutated in cse4-102, is shown. The view
is looking down between loop 1 of Cse4p and loop 2 of histone H4. (C)
The region around M217, the second amino acid mutated in
cse4-102, is shown. The view is looking down just behind
loop 1 of histone H4 onto helix 3 of Cse4p. Foreground residues in
helix 1 of histone H4 have been clipped to expose the interior region.
(D) The region around L196, the residue mutated in cse4-110,
is shown. The view is looking up towards the dyad axis along helix 3 of
Cse4p. (E) The region around L193, the residue mutated in
cse4-111, is shown. The view looks down through the dimer
where helix 2 of Cse4p and helix 2 of histone H4 cross.
|
|
The three amino acid substitutions in
cse4-102 and
cse4-111 all involve residues in Cse4p that are predicted to
be in close
association with the histone fold domain of H4. Residue
L175 in
loop 1 of Cse4p resides in a hydrophobic environment created by
residues V70, T73, and V81 from histone H4 (Fig.
5B). Residue
M217 in
helix 3 of Cse4p is in close proximity to amino acids
I50, E53, V54,
and V57 from helix 2 of histone H4 (Fig.
5C). Thus,
both the L175F and
M217T mutations in
cse4-102 are predicted to
affect its
interaction with histone H4 and perhaps the binding
of the Cse4p-H4
dimer to DNA (
3,
26). Residue L193 of Cse4p
is located near
the middle of the long helix 2 domain where it
meets with helix 2 of
histone H4. L193 projects into a hydrophobic
region formed by
neighboring Cse4p residues plus amino acids L37,
V54, V57, and L58 from
histone H4 (Fig.
5E). Thus, the L193Q substitution
in
cse4-111 would also be predicted to disrupt the Cse4p-H4
interface.
The mutation in
cse4-110 is different. Residue L196 is
located on helix 2 of Cse4p and participates in interactions
stabilizing
the packing of helix 2 and helix 3 of Cse4p. It is close to
neighboring
residues on helix 2 but also to amino acids M217, A220,
R221,
and R224 from helix 3 of Cse4p. Only V57 from histone H4 is
nearby
this region (Fig.
5D). The helix 2-helix 3 structure is critical
for the homotypic dimerization of H3 fold domains through the
assembly
of a stable four-helix bundle (
2,
26). Thus, the
major
defect caused by the L196S mutation in
cse4-110 is predicted
to be primarily a disruption of Cse4p dimerization and not its
interaction with histone
H4.
Mutant Cse4p protein remains bound to CEN DNA at
restrictive temperatures.
The locations of the amino acid
substitutions in Cse4p suggest that at restrictive temperatures
H4-Cse4p and Cse4p-Cse4p interactions are defective. Thus, the
most-aggressive hypothesis for the temperature-sensitive lethal
phenotype of the cse4 mutants was that the centromere
nucleosome becomes unstable and physically dissociates from the
CEN DNA at elevated temperatures. To test this hypothesis,
we analyzed the association of Cse4p with CEN DNA by in vivo
cross-linking and chromatin immunoprecipitation (ChIP). Cells
expressing either wild-type or mutant HA-tagged Cse4p were grown at
28°C, shifted to 37°C for 4 h, and then analyzed by ChIP.
Cse4p remained specifically bound to CEN DNA at restrictive
temperatures whether mutant or wild type (data not shown). Furthermore,
the distribution of cross-linked Cse4p within the CEN3
region was unaltered. As shown in Fig. 6, both wild-type Cse4-HAp and mutant Cse4-111-HAp continue to localize to
the core CEN3 DNA fragment following growth at restrictive temperatures. Similar results were obtained with cse4-102
and cse4-110 (data not shown). These results show that
preexisting centromeres do not suffer a major loss of Cse4p from the
core region when mutants are shifted to restrictive temperatures.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6.
Chromatin immunoprecipitation of CEN3 DNA
with wild-type and mutant Cse4 protein. The region of chromosome III
from approximately bp 112,800 to 115,200 is illustrated in the diagram.
The location of CEN3, containing the CDEI, CDEII, and CDEIII
sequences, is indicated by the open box in the center of the region
separating the left (L) and right (R) arms of chromosome III. Cells
expressing epitope-tagged Cse4 protein from either the wild-type gene
(CSE4-HA) or the mutant cse4-111 allele
(cse4-111-HA) were grown at the restrictive temperature for
4 h. Formaldehyde cross-linked chromatin was prepared and
immunoprecipitated with anti-HA antibody specific for Cse4-HAp ( -HA)
or mock treated (No Ab). The coimmunoprecipitated DNAs and total input
DNA (Total) were analyzed by PCR with primers corresponding to short,
overlapping intervals flanking CEN3. A map of the amplified
intervals is provided by location of the boxes shown below the
chromosome III diagram. The sets of PCR products from these reactions
are shown in the images located below the corresponding sequence
interval. Mutant Cse4-111p remains specifically associated with
CEN3 DNA at the restrictive temperature. Similar results
were obtained for cse4-102 and cse4-110.
|
|
CSE4 suppression of hhf1-20.
A second way in
which defects in H4-Cse4p and Cse4p-Cse4p protein-protein interactions
might be lethal is during the assembly of new centromeres when these
interactions are first established. In that case, we reasoned that
overexpression of wild-type Cse4p should suppress the mutation in
hhf1-20 by driving the assembly of H4-Cse4p dimers. To test
this prediction, high-copy CSE4 was introduced into
hhf1-20 cells and two unrelated temperature-sensitive histone H4 mutants, hhf1-36 and hhf1-10, as
controls. The hhf1-36 allele encodes a Y72G substitution
within the histone fold domain of H4, altering its interaction with
H2A-H2B dimers. Mutants expressing hhf1-36 are temperature
sensitive and arrest at restrictive temperatures in G1 due
to a failure to transcribe the G1 cyclin genes
(40). The hhf1-10 allele encodes a histone H4
protein with four substitutions within the N-terminal domain, K5Q, K8Q,
K12Q, and K16Q. Cells expressing hhf1-10 are temperature
sensitive, and they delay in the cell cycle at G2/M due to
activation of the DNA damage checkpoint pathway (28). As
shown in Fig. 7A, high-copy
CSE4 is able to suppress hhf1-20 but is unable to
suppress the temperature-sensitive lethality of either
hhf1-10 or hhf1-36.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 7.
Cse4p suppression of hhf1 mutations. (A)
Cse4p is a specific suppressor of hhf1-20. The individual
hhf1 mutant yeast strains indicated on the left of each row
were transformed with a high-copy plasmid expressing CSE4.
Tenfold serial dilutions of each strain were spotted on synthetic
complete medium lacking uracil and grown at permissive (28°C) and
restrictive (37°C) temperatures. (B) High-copy expression of mutant
cse4 alleles does not suppress hhf1-20.
hhf1-20 cells were transformed with five different plasmids
containing the CSE4 alleles indicated to the left of each
row: vector (pRS425), CSE4 (pLG8), cse4-102
(pLG50), cse4-110 (pLG48), or cse4-111 (pLG49).
Tenfold serial dilutions were spotted onto synthetic complete medium
lacking leucine and grown at permissive (28°C) and restrictive
(37°C) temperatures.
|
|
The structures of the
cse4(Ts) alleles described above
suggest defects in either Cse4p-H4 interactions or Cse4p-Cse4p
dimerization.
Either defect would be predicted to compromise the
ability of
the mutant
cse4 allele to suppress
hhf1-20, provided that suppression
is relevant to centromere
function. As shown in Fig.
7B this is
the case; none of the
cse4 alleles were able to suppress
hhf1-20,
nor
did they show any synthetic dosage
lethality.
Histone H4 suppression of cse4.
The simplest
interpretation of the suppression of hhf1-20 by high-copy
CSE4 is that an increased concentration of Cse4p drives its
interaction with the mutant histone H4 protein. This model predicts
that the reciprocal should also be true: cse4 alleles should
be suppressed by increased expression of histone H4. To test this
hypothesis we placed expression of HHF1 under the control of
the GAL1 promoter and introduced this construct into
isogenic wild-type and cse4 mutant strains on a multicopy
plasmid. When these strains were grown on glucose, where the
GAL1::HHF1 gene is repressed, there was no change
in the temperature sensitivity of the cse4 mutants (not
shown). However, on galactose, where histone H4 is overexpressed, we
observed an allele-specific pattern of suppression. As illustrated in
Fig. 8A, overexpression of histone H4 was
able to suppress the temperature-sensitive lethality of cse4-102 and cse4-111, but not
cse4-110. This pattern of suppression matches precisely that
predicted from the structures of the individual cse4
alleles. The mutations in both cse4-102 and
cse4-111 are within the Cse4p-histone H4 interface, while
the mutation in cse4-110 is not in a position to greatly
impair the interaction of Cse4p with histone H4. Thus, this
allele-specific suppression of cse4 by histone H4 provides
compelling genetic evidence for the interaction of these two histone
proteins as an essential part of centromere function in vivo.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 8.
Genetic interactions of histones H3 and H4 with
cse4 alleles. (A) Overexpression of histone H4 suppresses
cse4-102 and cse4-111 but not
cse4-110. The histone H4 gene HHF1 was placed
under control of the GAL1 promoter in plasmid pLG39. The
CSE4 wild-type, cse4 mutant, and
ctf13-30 strains indicated on the left of each row were
transformed with either vector alone (pRS426) or pLG39 carrying the
GAL1::HHF1 construct (2µ HHF1). Strains were
grown on synthetic complete galactose medium at either permissive
(28°C) or minimal restrictive (35, 37, or 37.5°C) temperatures. (B)
Overexpression of histone H3 is dosage lethal in cse4
mutants. The histone H3 gene HHT1 was placed under control
of the GAL1 promoter in plasmid pLG41. The CSE4
wild-type, cse4 mutant, and ctf13-30 strains were
transformed with vector (pRS426) or pLG41 (2µ HHT1) and grown at
either permissive (28°C) or semipermissive (33 or 32°C)
temperatures.
|
|
Histone H3 is dosage lethal in cse4 mutants.
An
important implication of the variant nucleosome model of the centromere
is that Cse4p should be in competition with histone H3 for binding to
histone H4. If Cse4p and histone H4 interact through their respective
histone fold domains, then the association of histone H3 with histone
H4 must block the binding of Cse4p. We reasoned that overexpression of
histone H3 might titrate available histone H4 molecules and enhance its
competition with Cse4p. To test this hypothesis, we placed the histone
H3 gene HHT1 under control of the GAL1 promoter
and introduced the construct into isogenic wild-type and
cse4 mutant cells. As shown in Fig. 8B, induction of
GAL1::HHT1 has no effect on the growth of
wild-type strains at a variety of temperatures. In contrast,
overexpression of histone H3 has a strong dominant-negative effect on
all three of the cse4 mutants. Impaired growth is evident
even at 28°C, and the mutant cells overexpressing histone H3 die at
30 to 33°C instead of 37°C. Overexpression of HHT1 was
not generally dosage lethal with centromere mutations, as it did not
affect the growth profile of ctf13-30 mutants (Fig. 8B).
Finally, we used ChIP to ask whether overexpression of H3 or H4
disrupts the binding of Cse4p to
CEN3 DNA. If overexpression
of histone H3 partially blocks the assembly of new centromeres,
we
reasoned that the
CEN3 signal would be altered by less than
twofold, a difference that is below the current resolution of
our
assays. However, if overexpression disrupted preexisting centromeres,
then the change in
CEN3 immunoprecipitation might be
significantly
larger. As shown in Fig.
9,
neither the dosage lethality of
HHT1 overexpression nor the
dosage suppression of
HHF1 over-expression
caused any major
change in the association of Cse4p protein with
CEN3 DNA in
cse4 mutants. Thus, the most likely target of H3 and
H4
overexpression is the centromere nucleosome assembly pathway.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 9.
ChIP of CEN3 DNA with Cse4 protein following
overexpression of histones H3 or H4. Strains expressing epitope-tagged
Cse4 protein from wild-type, cse4-102, and
cse4-110 alleles were grown on galactose medium to induce
overexpression of either histone H3 (top panel) or histone H4 (bottom
panel) from the GAL1 promoter carried on 2µ multicopy
plasmids (+). Control cells contained the 2µ vector only ( ).
Cultures were grown for 4 h at the temperatures indicated, and the
in vivo cross-linking of Cse4 protein with the core CEN3 DNA
fragment was determined by ChIP as described in the legend to Fig. 6.
The cse4-102 and cse4-110 mutants are able to
form colonies at 33°C on galactose medium with vector alone but are
inviable at that temperature when histone H3 is overexpressed.
Conversely, cse4-102 cells are inviable at 35°C on
galactose medium but can form colonies at that temperature when histone
H4 is overexpressed. The cse4-110 mutant is poorly
suppressed by histone H4 overexpression and fails to give colonies at
37°C with either vector or histone H4 overexpression. The association
of Cse4 protein with CEN3 DNA was unaffected by
overexpression of either histone H3 or histone H4 in the mutant
strains.
|
|
 |
DISCUSSION |
Several lines of evidence argue that histones H4 and Cse4p play
important roles in the assembly and function of the core centromere of
S. cerevisiae. First, both cse4 and
hhf1-20 mutants are defective for mitotic chromosome
transmission and arrest with a characteristic G2/M
phenotype (4, 45, 47), a phenotype shared by the new cse4(Ts) mutants described above. Also, as shown here, this
arrest phenotype is imposed by activation of the spindle-kinetochore checkpoint pathway in the mutants, implying that histone H4 and Cse4p
are required for normal kinetochore function. Furthermore, both
cse4 and hhf1-20 mutants disrupt the ability of
the centromere complex to block transcriptional elongation, suggesting
a direct role in centromere chromatin structure in vivo. Finally, in
vivo crosslinking experiments showed that Cse4p is physically located at CEN DNA within the core centromere (30).
Taken together, these results lead to the simple hypothesis that Cse4p
and histone H4 interact through their respective histone fold domains
to form a nucleosome-like structure at the centromere. We undertook an
unbiased genetic screen for Cse4p histone fold mutations to challenge
this hypothesis directly, and the results of the experiments reported
here provide strong support for the model. First, dosage suppression by
CSE4 is allele specific and has no effect on
temperature-sensitive alleles of histone H4 that do not affect the
centromere pathway. Second, point mutations within the histone fold
domain of Cse4p are defective for centromere function in vivo. Third,
overexpression of wild-type histone H4 was able to suppress the
lethality of cse4 mutations and this suppression was also
allele specific, affecting only those cse4 alleles in which
the amino acid substitutions were at the Cse4p-H4 interface. This
reciprocal allele-specific suppression argues that Cse4p and histone H4
interact through their histone fold domains to accomplish one or more
essential steps in centromere structure and function in vivo.
Site-directed mutations targeted to the CENP-A gene first highlighted
the importance of cooperative interactions across the histone fold
domain (42). The cse4-102 allele provides a
striking example of such a long-range cooperative interaction. This
allele encodes two amino acid substitutions located at opposite ends of
the Cse4p histone fold. Either mutation alone has little or no effect
on growth or centromere integrity, but together they result in a
temperature-sensitive lethal phenotype and a loss of the block to
transcriptional read-through of CEN DNA. A second important
conclusion from the CENP-A analysis was that the helix 2-helix 3 region
of the fold is important in the assembly of CENP-A at the centromere
(42). The cse4-110 allele confirms this
conclusion for Cse4p. In the nucleosome, the helix 2-helix 3 structure
of the H3 fold is critical for the homotypic dimerization of H3 in the
(H3-H4)2 tetramer (2, 26). The L196S mutation in
cse4-110 is located at the center of the interactions
stabilizing the helix 2-helix 3 structures. This substitution
presumably disturbs the integrity of Cse4p dimerization and formation
of the (Cse4p-H4)2 tetramer in the centromere
nucleosome-like complex.
Surprisingly, none of the mutations in the cse4(Ts) alleles
altered codons for Cse4p-specific residues. The mutations at L175, L193, and L196 all affect invariant leucines conserved throughout the
histone H3 family of proteins. Residue M217 in Cse4p differs from the
corresponding I124 in S. cerevisiae histone H3; however, methionine occurs at this position in the major histone H3 proteins of
other organisms and it is not characteristic of the CENP-A variant
proteins. Interestingly, Keith et al. found that no individual Cse4p-specific residue was essential for centromere function using chimeric gene constructs that substituted portions of the histone H3
gene for the corresponding region of CSE4 (23).
Thus, as the Cse4p/CENP-A family evolved to assume a specialized role
in centromere chromatin, it accumulated multiple cooperative
substitutions spread across the protein while continuing to maintain
highly conserved properties of the H3 histone fold.
The dominant-negative phenotype of histone H3 overexpression in
cse4 mutants has important implications for the assembly
pathway of the centromere. The simplest interpretation of this
interference is that histone H3 competes with Cse4p for binding to
histone H4 (Fig. 10A). In this model,
cse4 mutations that impair formation of the
(Cse4p-H4)2 tetramer would shift the equilibrium to the histone H3 pathway, leading to a defect in centromere function. Overexpression of histone H3 would further antagonize Cse4p-H4 assembly
by competing for histone H4, exacerbating the centromere defect of the
cse4 mutants. Although this simple model provides a useful
framework, it fails to explain the remarkable buffering capacity of the
Cse4p branch of the pathway. Histone H3 is an abundant nuclear protein
and must be highly expressed to provide two molecules for each of the
roughly 100,000 nucleosomes that package the yeast genome. Currently,
the exact stoichiometry of Cse4p in the cell is not known, but it is
not abundant (T. Kalashnikov and M. M. Smith, unpublished data),
perhaps on the order of two molecules at the centromere of each of the
16 yeast chromosomes. Despite this low abundance, high-copy
overexpression of histone H3 from the GAL1 promoter is not
deleterious in CSE4 wild-type cells (Fig. 8B) (see also
reference 27), and in cse4 cells its expression only reduces the maximal permissive temperature of the
mutants. How, then, does the Cse4p assembly pathway withstand the
competition of excess histone H3?

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 10.
A model of the Cse4p-H4 assembly pathway. (A) A simple
model for the interactions of histones H3 and H4 with Cse4p is shown.
In this model, histones Cse4p and H3 compete for the binding of histone
H4. The structural and genetic results reported here suggest that the
formation of the H4-Cse4p dimer is impaired in hhf1-20,
cse4-102, and cse4-111 mutants, while formation
of the (H4-Cse4p)2 tetramer is impaired in the
cse4-110 mutant. In those mutants, overexpression of histone
H3 further antagonizes the formation of the centromere variant
nucleosome, leading to dosage lethality. (B) Cooperative downstream
interactions would favor the assembly of a CEN variant
nucleosome in the face of histone H3 competition for histone H4.
Additional known centromere components are illustrated. It is not known
whether histone H2A-H2B dimers participate in the structure, or whether
specialized chromatin assembly factors (CAFs) may be required.
|
|
One attractive mechanism for buffering Cse4p would be to separate H3-H4
assembly from Cse4p-H4 assembly in either time or space (for a recent
summary, see reference 18). Both the transcription and the translation of histone H3 and H4 in S. cerevisiae
are cell cycle regulated, and their expression decreases rapidly
outside of early S phase (14, 19, 25; reviewed in
reference 34). Currently nothing is known about
Cse4p translation; however, its mRNA is present constitutively at low
abundance throughout the cell division cycle (P. Yang and M. M. Smith, unpublished data). Thus, once out of S phase, the concentrations
of free histone H3 and H4 may fall to levels comparable to the
concentration of free Cse4p. Consistent with this idea, if CENP-A is
expressed in mammalian cells under the cell cycle regulation of the
major histone H4 genes, it is incorporated generally into the chromatin (42).
Highly cooperative downstream binding interactions would provide
another potential mechanism for driving the Cse4p-H4 assembly pathway
(Fig. 10B). Centromere assembly is known to be dependent on
CEN DNA and multiple protein complexes, consistent with
strong cooperative binding among these components and CEN
DNA (16, 29, 33, 46). Thus, cooperative binding of the
(Cse4p-H4)2 tetramer with CEN DNA and other
centromere proteins would serve to drive the H4-Cse4p branch of the
pathway against a concentration of histone H3. Finally, there may be
novel chromatin assembly factors or structural arrangements in the cell
that have evolved to specifically catalyze the assembly of the
centromere nucleosome (5, 9, 18, 49). We anticipate that
further genetic and biochemical studies designed to test the
predictions of these models will provide important insights into the
mechanisms by which centromeres are specified and assembled.
 |
ACKNOWLEDGMENTS |
We thank Forrest Spencer and Daniel Burke for plasmids and
strains; Pamela Meluh, David Auble, Michael Christman, David Allis, Daniel Burke, and Van Moudrianakis for helpful discussions; and William
Ross for expert technical assistance with the flow cytometry.
This work was supported by NIH grant GM28920 to M.M.S.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Cancer Center, University of Virginia, 1300 Jefferson Park Ave., Charlottesville, VA 22908. Phone: (804) 924-2669. Fax: (804)
982-1071. E-mail: mms7r{at}virginia.edu.
 |
REFERENCES |
| 1.
|
Adams, A.,
D. E. Gottschling,
C. Kaiser, and T. Stearns.
1998.
Methods in yeast genetics: a laboratory course manual.
Cold Spring Harbor Laboratory Press, Cold Spring HarborNew York, N.Y.
|
| 2.
|
Arents, G.,
R. W. Burlingame,
B. C. Wang,
W. E. Love, and E. N. Moudrianakis.
1991.
The nucleosomal core histone octamer at 3.1 Å resolution: a tripartite protein assembly and a left-handed superhelix.
Proc. Natl. Acad. Sci. USA
88:10148-10152[Abstract/Free Full Text].
|
| 3.
|
Arents, G., and E. N. Moudrianakis.
1993.
Topography of the histone octamer surface: repeating structural motifs utilized in the docking of nucleosomal DNA.
Proc. Natl. Acad. Sci. USA
90:10489-10493[Abstract/Free Full Text].
|
| 4.
|
Baker, R. E.,
K. Harris, and K. Zhang.
1998.
Mutations synthetically lethal with cep1 target S. cerevisiae kinetochore components.
Genetics
149:73-85[Abstract/Free Full Text].
|
| 5.
|
Basrai, M. A.,
J. Kingsbury,
D. Koshland,
F. Spencer, and P. Hieter.
1996.
Faithful chromosome transmission requires Spt4p, a putative regulator of chromatin structure in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:2838-2847[Abstract].
|
| 6.
|
Biggins, S., and A. W. Murray.
1998.
Sister chromatid cohesion in mitosis.
Curr. Opin. Cell Biol.
10:769-775[CrossRef][Medline].
|
| 7.
|
Bloom, K. S., and J. Carbon.
1982.
Yeast centromere DNA is in a unique and highly ordered structure in chromosomes and small circular minichromosomes.
Cell
29:305-317[CrossRef][Medline].
|
| 8.
|
Boeke, J. D.,
J. Trueheart,
B. Natsoulis, and G. R. Fink.
1987.
5-Fluoroorotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol.
154:164-175[Medline].
|
| 9.
|
Bortvin, A., and F. Winston.
1996.
Evidence that Spt6p controls chromatin structure by a direct interaction with histones.
Science
272:1473-1476[Abstract].
|
| 10.
|
Brent, R., and M. Ptashne.
1984.
A bacterial repressor protein or a yeast transcriptional terminator can block upstream activation of a yeast gene.
Nature
312:612-615[CrossRef][Medline].
|
| 11.
|
Buchwitz, B. J.,
K. Ahmad,
L. L. Moore,
M. B. Roth, and S. Henikoff.
1999.
A histone-H3-like protein in C. elegans.
Nature
401:547-548[CrossRef][Medline].
|
| 12.
|
Clarke, L.
1998.
Centromeres: proteins, protein complexes, and repeated domains at centromeres of simple eukaryotes.
Curr. Opin. Genet. Dev.
8:212-218[CrossRef][Medline].
|
| 13.
|
Craig, J. M.,
W. C. Earnshaw, and P. Vagnarelli.
1999.
Mammalian centromeres: DNA sequence, protein composition, and role in cell cycle progression.
Exp. Cell Res.
246:249-262[CrossRef][Medline].
|
| 14.
|
Cross, S. L., and M. M. Smith.
1988.
Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:945-954[Abstract/Free Full Text].
|
| 15.
|
Doheny, K. F.,
P. K. Sorger,
A. A. Hyman,
S. Tugendreich,
F. Spencer, and P. Hieter.
1993.
Identification of essential components of the S. cerevisiae kinetochore.
Cell
73:761-774[CrossRef][Medline].
|
| 16.
|
Espelin, C. W.,
K. B. Kaplan, and P. K. Sorger.
1997.
Probing the architecture of a simple kinetochore using DNA-protein crosslinking.
J. Cell Biol.
139:1383-1396[Abstract/Free Full Text].
|
| 17.
|
Funk, M.,
J. H. Hegemann, and P. Philippsen.
1989.
Chromatin digestion with restriction endonucleases reveals 150-160 bp of protected DNA in the centromere of chromosome XIV in Saccharomyces cerevisiae.
Mol. Gen. Genet.
219:153-160[Medline].
|
| 18.
|
Henikoff, S.,
K. Ahmad,
J. S. Platero, and B. van Steensel.
2000.
Heterochromatic deposition of centromeric histone H3-like proteins.
Proc. Natl. Acad. Sci. USA
97:716-721[Abstract/Free Full Text].
|
| 19.
|
Hereford, L. M.,
M. A. Osley,
I. J. R. Ludwig, and C. S. McLaughlin.
1981.
Cell-cycle regulation of yeast histone mRNA.
Cell
24:367-375[CrossRef][Medline].
|
| 20.
|
Hoyt, M. A.,
L. Totis, and B. T. Roberts.
1991.
S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function.
Cell
66:507-517[CrossRef][Medline].
|
| 21.
|
Hyland, K. M.,
J. Kingsbury,
D. Koshland, and P. Hieter.
1999.
Ctf19p: a novel kinetochore protein in Saccharomyces cerevisiae and a potential link between the kinetochore and mitotic spindle.
J. Cell Biol.
145:15-28[Abstract/Free Full Text].
|
| 22.
|
Hyman, A. A., and P. K. Sorger.
1995.
Structure and function of kinetochores in budding yeast.
Annu. Rev. Cell Dev. Biol.
11:471-495[CrossRef][Medline].
|
| 23.
|
Keith, K. C.,
R. E. Baker,
Y. Chen,
K. Harris,
S. Stoler, and M. Fitzgerald-Hayes.
1999.
Analysis of primary structural determinants that distinguish the centromere-specific function of histone variant Cse4p from histone H3.
Mol. Cell. Biol.
19:6130-6139[Abstract/Free Full Text].
|
| 24.
|
Li, R., and A. W. Murray.
1991.
Feedback control of mitosis in budding yeast.
Cell
66:519-531[CrossRef][Medline].
|
| 25.
|
Ludwig, J. R., II, and C. S. McLaughlin.
1982.
Periodic synthesis of histone proteins through the cell cycle of Saccharomyces cerevisiae as determined by centrifugal elutriation, p. 113-121.
In
Proceedings of the Berkeley Workshop on Recent Advances in Yeast Molecular Biology: Recombinant DNA. University of California, Berkeley.
|
| 26.
|
Luger, K.,
A. W. Mader,
R. K. Richmond,
D. F. Sargent, and T. J. Richmond.
1997.
Crystal structure of the nucleosome core particle at 2.8 Å resolution.
Nature
389:251-260[CrossRef][Medline].
|
| 27.
|
Meeks-Wagner, D.,
J. S. Wood,
B. Garvik, and L. H. Hartwell.
1986.
Isolation of two genes that affect mitotic chromosome transmission in S. cerevisiae.
Cell
44:53-63[CrossRef][Medline].
|
| 28.
|
Megee, P. C.,
B. A. Morgan, and M. M. Smith.
1995.
Histone H4 and the maintenance of genome integrity.
Genes Dev.
9:1716-1727[Abstract/Free Full Text].
|
| 29.
|
Meluh, P. B., and D. Koshland.
1997.
Budding yeast centromere composition and assembly as revealed by in vivo crosslinking.
Genes Dev.
11:3401-3412[Abstract/Free Full Text].
|
| 30.
|
Meluh, P. B.,
P. Yang,
L. Glowczewski,
D. Koshland, and M. M. Smith.
1998.
Cse4p is a component of the core centromere of Saccharomyces cerevisiae.
Cell
94:607-613[CrossRef][Medline].
|
| 31.
|
Morgan, B. A.,
B. A. Mittman, and M. M. Smith.
1991.
The highly conserved N-terminal domains of histones H3 and H4 are required for normal cell cycle progression.
Mol. Cell. Biol.
11:4111-4120[Abstract/Free Full Text].
|
| 32.
|
Muhlrad, D.,
R. Hunter, and R. Parker.
1992.
A rapid method for localized mutagenesis of yeast genes.
Yeast
8:79-82[CrossRef][Medline].
|
| 33.
|
Ortiz, J.,
O. Stemmann,
S. Rank, and J. Lechner.
1999.
A putative protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore.
Genes Dev.
13:1140-1155[Abstract/Free Full Text].
|
| 34.
|
Osley, M. A.
1991.
The regulation of histone synthesis in the cell cycle.
Annu. Rev. Biochem.
60:827-861[CrossRef][Medline].
|
| 35.
|
Palmer, D. K.,
K. O'Day,
M. H. Wener,
B. S. Andrews, and R. L. Margolis.
1987.
A 17-kD centromere protein (CENP-A) copurifies with nucleosome core particles and with histones.
J. Cell Biol.
104:805-815[Abstract/Free Full Text].
|
| 36.
|
Pangilinan, F., and F. Spencer.
1996.
Abnormal kinetochore structure activates the spindle assembly checkpoint in budding yeast.
Mol. Biol. Cell
7:1195-1208[Abstract].
|
| 37.
|
Pringle, J. R.,
A. E. M. Adams,
D. G. Drubin, and B. K. Haarer.
1991.
Immunofluorescence methods for yeast.
Methods Enzymol.
194:565-602[Medline].
|
| 38.
|
Robzyk, K., and Y. Kassir.
1992.
A simple and highly efficient procedure for rescuing autonomous plasmids from yeast.
Nucleic Acids Res.
20:3790[Free Full Text].
|
| 39.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 40.
|
Santisteban, M. S.,
G. Arents,
E. N. Moudrianakis, and M. M. Smith.
1997.
Histone octamer function in vivo: mutations in the dimer-tetramer interfaces disrupt both gene activation and repression.
EMBO J.
16:2493-2506[CrossRef][Medline].
|
| 41.
|
Schulman, I., and K. S. Bloom.
1991.
Centromeres: an integrated protein/DNA complex required for chromosome movement.
Annu. Rev. Cell Biol.
7:311-336[CrossRef].
|
| 42.
|
Shelby, R. D.,
O. Vafa, and K. F. Sullivan.
1997.
Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites.
J. Cell Biol.
136:501-513[Abstract/Free Full Text].
|
| 43.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 44.
|
Skibbens, R. V., and P. Hieter.
1998.
Kinetochores and the checkpoint mechanism that monitors for defects in the chromosome segregation machinery.
Annu. Rev. Genet.
32:307-337[CrossRef][Medline].
|
| 45.
|
Smith, M. M.,
P. Yang,
M. S. Santisteban,
P. W. Boone,
A. T. Goldstein, and P. C. Megee.
1996.
A novel histone H4 mutant defective for nuclear division and mitotic chromosome transmission.
Mol. Cell. Biol.
16:1017-1026[Abstract].
|
| 46.
|
Sorger, P. K.,
F. F. Severin, and A. A. Hyman.
1994.
Factors required for the binding of reassembled yeast kinetochores to microtubules in vitro.
J. Cell Biol.
127:995-1008[Abstract/Free Full Text].
|
| 47.
|
Stoler, S.,
K. C. Keith,
K. E. Curnick, and M. Fitzgerald-Hayes.
1995.
A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis.
Genes Dev.
9:573-586[Abstract/Free Full Text].
|
| 48.
|
Sullivan, K. F.,
M. Hechenberger, and K. Masri.
1994.
Human CENP-A contains a histone H3 related histone fold domain that is required for targeting to the centromere.
J. Cell Biol.
127:581-592[Abstract/Free Full Text].
|
| 49.
|
Tsuchiya, E.,
T. Hosotani, and T. Miyakawa.
1998.
A mutation in NPS1/STH1, an essential gene encoding a component of a novel chromatin-remodeling complex RSC, alters the chromatin structure of Saccharomyces cerevisiae centromeres.
Nucleic Acids Res.
26:3286-3292[Abstract/Free Full Text].
|
| 50.
|
Vafa, O., and K. F. Sullivan.
1997.
Chromatin containing CENP-A and alpha-satellite DNA is a major component of the inner kinetochore plate.
Curr. Biol.
7:897-900[CrossRef][Medline].
|
| 51.
|
Wang, Y., and D. J. Burke.
1995.
Checkpoint genes required to delay cell division in response to nocodazole respond to impaired kinetochore function in the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
15:6838-6844[Abstract].
|
| 52.
|
Warburton, P. E.,
C. A. Cooke,
S. Bourassa,
O. Vafa,
B. A. Sullivan,
G. Stetten,
G. Gimelli,
D. Warburton,
C. Tyler-Smith,
K. F. Sullivan,
G. G. Poirier, and W. C. Earnshaw.
1997.
Immunolocalization of CENP-A suggests a distinct nucleosome structure at the inner kinetochore plate of active centromeres.
Curr. Biol.
7:901-904[CrossRef][Medline].
|
Molecular and Cellular Biology, August 2000, p. 5700-5711, Vol. 20, No. 15
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ransom, M., Williams, S. K., Dechassa, M. L., Das, C., Linger, J., Adkins, M., Liu, C., Bartholomew, B., Tyler, J. K.
(2009). FACT and the Proteasome Promote Promoter Chromatin Disassembly and Transcriptional Initiation. J. Biol. Chem.
284: 23461-23471
[Abstract]
[Full Text]
-
Au, W.-C., Crisp, M. J., DeLuca, S. Z., Rando, O. J., Basrai, M. A.
(2008). Altered Dosage and Mislocalization of Histone H3 and Cse4p Lead to Chromosome Loss in Saccharomyces cerevisiae. Genetics
179: 263-275
[Abstract]
[Full Text]
-
Vernarecci, S., Ornaghi, P., Bagu, A., Cundari, E., Ballario, P., Filetici, P.
(2008). Gcn5p Plays an Important Role in Centromere Kinetochore Function in Budding Yeast. Mol. Cell. Biol.
28: 988-996
[Abstract]
[Full Text]
-
Dalal, Y., Furuyama, T., Vermaak, D., Henikoff, S.
(2007). Inaugural Article: Structure, dynamics, and evolution of centromeric nucleosomes. Proc. Natl. Acad. Sci. USA
104: 15974-15981
[Abstract]
[Full Text]
-
Takayama, Y., Takahashi, K.
(2007). Differential regulation of repeated histone genes during the fission yeast cell cycle. Nucleic Acids Res
35: 3223-3237
[Abstract]
[Full Text]
-
Collins, K. A., Camahort, R., Seidel, C., Gerton, J. L., Biggins, S.
(2007). The Overexpression of a Saccharomyces cerevisiae Centromeric Histone H3 Variant Mutant Protein Leads to a Defect in Kinetochore Biorientation. Genetics
175: 513-525
[Abstract]
[Full Text]
-
Baker, R. E., Rogers, K.
(2006). Phylogenetic Analysis of Fungal Centromere H3 Proteins. Genetics
174: 1481-1492
[Abstract]
[Full Text]
-
Hajra, S., Ghosh, S. K., Jayaram, M.
(2006). The centromere-specific histone variant Cse4p (CENP-A) is essential for functional chromatin architecture at the yeast 2-{micro}m circle partitioning locus and promotes equal plasmid segregation. JCB
174: 779-790
[Abstract]
[Full Text]
-
Keogh, M.-C., Mennella, T. A., Sawa, C., Berthelet, S., Krogan, N. J., Wolek, A., Podolny, V., Carpenter, L. R., Greenblatt, J. F., Baetz, K., Buratowski, S.
(2006). The Saccharomyces cerevisiae histone H2A variant Htz1 is acetylated by NuA4.. Genes Dev.
20: 660-665
[Abstract]
[Full Text]
-
Collins, K. A., Castillo, A. R., Tatsutani, S. Y., Biggins, S.
(2005). De Novo Kinetochore Assembly Requires the Centromeric Histone H3 Variant. Mol. Biol. Cell
16: 5649-5660
[Abstract]
[Full Text]
-
Hyland, E. M., Cosgrove, M. S., Molina, H., Wang, D., Pandey, A., Cottee, R. J., Boeke, J. D.
(2005). Insights into the Role of Histone H3 and Histone H4 Core Modifiable Residues in Saccharomyces cerevisiae. Mol. Cell. Biol.
25: 10060-10070
[Abstract]
[Full Text]
-
Kamakaka, R. T., Biggins, S.
(2005). Histone variants: deviants?. Genes Dev.
19: 295-316
[Abstract]
[Full Text]
-
Morey, L., Barnes, K., Chen, Y., Fitzgerald-Hayes, M., Baker, R. E.
(2004). The Histone Fold Domain of Cse4 Is Sufficient for CEN Targeting and Propagation of Active Centromeres in Budding Yeast. Eukaryot Cell
3: 1533-1543
[Abstract]
[Full Text]
-
Stoyan, T., Carbon, J.
(2004). Inner Kinetochore of the Pathogenic Yeast Candida glabrata. Eukaryot Cell
3: 1154-1163
[Abstract]
[Full Text]
-
Wieland, G., Orthaus, S., Ohndorf, S., Diekmann, S., Hemmerich, P.
(2004). Functional Complementation of Human Centromere Protein A (CENP-A) by Cse4p from Saccharomyces cerevisiae. Mol. Cell. Biol.
24: 6620-6630
[Abstract]
[Full Text]
-
Hsu, J.-m., Huang, J., Meluh, P. B., Laurent, B. C.
(2003). The Yeast RSC Chromatin-Remodeling Complex Is Required for Kinetochore Function in Chromosome Segregation. Mol. Cell. Biol.
23: 3202-3215
[Abstract]
[Full Text]
-
Vermaak, D., Hayden, H. S., Henikoff, S.
(2002). Centromere Targeting Element within the Histone Fold Domain of Cid. Mol. Cell. Biol.
22: 7553-7561
[Abstract]
[Full Text]
-
Marc, F., Sandman, K., Lurz, R., Reeve, J. N.
(2002). Archaeal Histone Tetramerization Determines DNA Affinity and the Direction of DNA Supercoiling. J. Biol. Chem.
277: 30879-30886
[Abstract]
[Full Text]
-
Ando, S., Yang, H., Nozaki, N., Okazaki, T., Yoda, K.
(2002). CENP-A, -B, and -C Chromatin Complex That Contains the I-Type {alpha}-Satellite Array Constitutes the Prekinetochore in HeLa Cells. Mol. Cell. Biol.
22: 2229-2241
[Abstract]
[Full Text]
-
Sharp, J. A., Franco, A. A., Osley, M. A., Kaufman, P. D.
(2002). Chromatin assembly factor I and Hir proteins contribute to building functional kinetochores in S. cerevisiae. Genes Dev.
16: 85-100
[Abstract]
[Full Text]
-
Van Hooser, A. A., Ouspenski, I. I., Gregson, H. C., Starr, D. A., Yen, T. J., Goldberg, M. L., Yokomori, K., Earnshaw, W. C., Sullivan, K. F., Brinkley, B. R.
(2001). Specification of kinetochore-forming chromatin by the histone H3 variant CENP-A. J. Cell Sci.
114: 3529-3542
[Abstract]
[Full Text]