Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 5858-5864, Vol. 20, No. 16
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cks1 Is Required for G1
Cyclin-Cyclin-Dependent Kinase Activity in Budding Yeast
Gregory J.
Reynard,
William
Reynolds,
Rati
Verma, and
Raymond J.
Deshaies*
Division of Biology, California Institute of
Technology, Pasadena, California 91125
Received 17 March 2000/Returned for modification 26 April
2000/Accepted 19 May 2000
 |
ABSTRACT |
p13suc1 (Cks) proteins have been implicated in the
regulation of cyclin-dependent kinase (CDK) activity. However, the
mechanism by which Cks influences the function of cyclin-CDK complexes
has remained elusive. We show here that Cks1 is required for the
protein kinase activity of budding yeast G1 cyclin-CDK
complexes. Cln2 and Cdc28 subunits coexpressed in baculovirus-infected
insect cells fail to exhibit protein kinase activity towards multiple substrates in the absence of Cks1. Cks1 can both stabilize Cln2-Cdc28 complexes and activate intact complexes in vitro, suggesting that it
plays multiple roles in the biogenesis of active G1
cyclin-CDK complexes. In contrast, Cdc28 forms stable, active complexes
with the B-type cyclins Clb4 and Clb5 regardless of whether Cks1 is present. The levels of Cln2-Cdc28 and Cln3-Cdc28 protein kinase activity are severely reduced in cks1-38 cell extracts.
Moreover, phosphorylation of G1 cyclins, which depends on
Cdc28 activity, is reduced in cks1-38 cells. The role of
Cks1 in promoting G1 cyclin-CDK protein kinase activity
both in vitro and in vivo provides a simple molecular rationale for the
essential role of CKS1 in progression through
G1 phase in budding yeast.
 |
INTRODUCTION |
Cyclin-dependent kinases (CDKs)
trigger a variety of events in the division cycle of eukaryotic cells
(28). Multiple regulatory mechanisms conspire to ensure that
CDKs are switched on at the right time and in the right place as cells
proceed through the cell division program. At least four distinct
posttranslational mechanisms positively regulate CDK function,
including binding of cyclins, binding of p13suc1 (Cks)
proteins, phosphorylation of a threonine within the T-loop of CDKs by
the CDK-activating kinase (CAK), and dephosphorylation of threonine and
tyrosine residues within the ATP-binding site by Cdc25 (27).
Of these mechanisms, the least well understood is how binding of Cks
proteins promote the function of CDKs.
The gene encoding p13suc1 was originally identified as a
multicopy suppressor of cdc2ts mutations in
Schizosaccharomyces pombe (15) and was
subsequently isolated as a multicopy suppressor (named CKS1)
of cdc28ts mutations in Saccharomyces
cerevisiae (14). Characterization of budding yeast
cks1 thermosensitive mutants revealed that Cks1 function is
required at two points in the cell cycle: prior to start in
G1 and at some point in mitosis (42). As was
observed in p13suc1-depleted fission yeast (26),
G2-arrested cks1ts mutants
accumulate high levels of CDK activity.
The role of Cks proteins in progression through mitosis has been the
subject of numerous recent studies. Xenopus extracts depleted of the Cks1 homolog p9 fail to enter mitosis due to
accumulation of inhibitory phosphate on the Y15 residue of
p34cdc2 (29), perhaps because p9 promotes
CDK-dependent phosphorylation of the Y15 kinase Wee1 and the Y15
phosphatase Cdc25 (31). p9-depleted cycling extracts
programmed with a p34cdc2 mutant that cannot be
phosphorylated on Y15 no longer arrest at the G2/M
transition but instead fail to initiate cyclin B destruction and
consequently remain arrested in mitosis (29). These results suggest that p9 also promotes activation of cyclin B proteolysis by the
anaphase-promoting complex-cyclosome (APC/C)-26S proteasome pathways
(22). p9 is thought to activate cyclin B proteolysis by
directly facilitating the phosphorylation of components of the APC/C,
including Cdc27, by mitotic CDK (30, 36). However, there is
some controversy on this point, since budding yeast Cks1 is dispensable
for cyclin B ubiquitination but appears instead to promote degradation
of ubiquitinated cyclin B by the 26S proteasome (19).
Despite these recent advances in our understanding of how Cks proteins
promote mitosis, it remains unclear why Cks1 is required for
progression through Start.
Structural insights into the function of Cks proteins have emerged from
X-ray crystallography of human Cks1-Cdk2 complexes (2). The
binding of Cks1 does not cause significant conformational changes in
either the active site or the cyclin-binding interface of Cdk2. A
comparison of the Cks1-Cdk2 and cyclin A-Cdk2 (17) structures reveals that Cks1 and cyclin A bind to opposite sides of
Cdk2 flanking the active site (2). The structure of the ternary complex suggests that Cks1 may help position substrates for
phosphorylation by Cdk2.
In this report, we provide evidence that Cks1 is required both in vitro
and in vivo for the protein kinase activity of G1 cyclin-CDK complexes from budding yeast. These findings suggest a
simple explanation for why Cks1 activity is required for budding yeast
cells to traverse Start.
 |
MATERIALS AND METHODS |
Preparation of cell lysates from baculovirus-infected cells.
Sf9 or Hi-5 cells were grown in suspension in supplemented Grace's
insect media. For infection, 107 cells were plated per
10-cm-diameter dish and overlayed with working stocks of viruses at a
multiplicity of infection of ~10. After incubation for 40 to 44 h, cells were harvested in a clinical centrifuge at 4°C, washed once
in 1× phosphate-buffered saline, and resuspended in ice-cold lysis
buffer (10 mM HEPES-KOH [pH 7.4], 150 mM NaCl, 0.2% Triton X-100, 1 mM
-mercaptoethanol, 5 µg of pepstatin and 5 µg of leupeptin/ml,
2 mM phenylmethylsulfonyl fluoride (PMSF), 2 mM benzamidine, 50 mM
-glycerophosphate, 50 mM NaF, and 0.2 mM sodium orthovanadate).
After a 10-min incubation on ice, lysates were sonicated three times
for 10-s intervals at a setting of 4 (Branson sonifier 450) and then
clarified by centrifugation at 4°C (35,000 rpm for 10 min; Sorvall
RP100AT4 rotor). Supernatant fractions (typically 4 to 10 mg of
protein/ml) were frozen in liquid N2 and stored at
80°C.
Activation of Cln2-Cdc28HA, immunoprecipitations,
protein kinase assays, and immunoblots.
Clarified lysates from
baculovirus-infected Sf9 cells were incubated in a reaction mixture
consisting of activation buffer (1/10 volume of 40 mM magnesium
acetate, 5 mM PMSF, 50 mM benzamidine, 10 mM dithiothreitol (DTT), 50 µg of pepstatin and 50 µg of leupeptin/ml), with or without yeast
extract, Cks1, and ATP-regenerating system (1/10 volume of 500-µg/ml
creatine phosphokinase, 10 mM ATP, 20 mM HEPES [pH 7.2], 10 mM
magnesium acetate, 300 mM creatine phosphate). Activation mixtures were
incubated for 15 min at 24°C and then chilled on ice.
For immunoprecipitation and histone H1 kinase assays, 3 to 10 µl of a
10-µl activation reaction mixture was diluted with 200 µl of
immunoprecipitation buffer (IPB; 50 mM
-glycerophosphate [pH 7.5],
100 mM NaCl, 50 mM NaF, 5 mM EDTA, 2 mM sodium orthovanadate, 0.2%
Triton X-100, 1 mM DTT, 0.5 mM PMSF, 5 µg of pepstatin and 5 µg of
leupeptin/ml) and supplemented with 0.75 µl of 12CA5
antihemagglutinin (anti-HA) ascites fluid. After a 45-min incubation on
ice, 20 µl of a 50% slurry of protein A-Sepharose beads was added,
and tubes were incubated on a rotating wheel for 1 h at 4°C.
Immune complexes were washed twice with 1 ml of IPB (minus protease
inhibitors, NaF, and sodium orthovanadate). All samples were then
washed twice with 1 ml of kinase assay buffer (KAB; 10 mM HEPES [pH
7.2], 10 mM MgCl2, 50 mM NaCl, 2 mM EDTA, 1 mM DTT, 0.02%
Triton X-100) and supplemented with 10 µl of KAB adjusted to 150 µg
of histone H1/ml, 11 µM ATP, and 1.5 µCi of
[
-32P]ATP (4,500 Ci/mmol)/µl. Following a 15-min
incubation at room temperature, kinase reactions were terminated by
addition of 7 µl of 3× sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) loading buffer and heated for 3 min at
95°C. Boiled samples were subjected to SDS-PAGE, and the
32P radiolabel was quantitated by imaging dried gels with a
Molecular Dynamics PhosphorImager.
Immunoblotting was performed with either anti-myc monoclonal antibody
9E10 (9) or anti-HA monoclonal antibody 12CA5
(11) ascites fluids (purchased from BabCo) used at a
dilution of 1/1,000 or affinity-purified anti-Cdc28 polyclonal
antibodies. Filter-bound antibodies were visualized using horseradish
peroxidase-conjugated secondary antibodies and Amersham's enhanced
chemiluminescence (ECL) kit. For the experiment shown in Fig. 6C,
Cln33×HA immunoreactivity was quantitated using a
Molecular Dynamics STORM system.
Preparation of yeast extracts.
Yeast extracts used as a
source of Cln2-Cdc28 activator were prepared as described previously
(5) from RJD875 (trp1 ura3 his2 ade1 bar1 cln1
cln2
cln3
leu2::GAL-CLN3::LEU2 cdc28-4 pep4::URA3 MAT
) cells arrested in
G1 by growth in yeast extract-peptone-dextrose (YPD) medium
for 5.5 h at 24°C.
To examine the effect of mutant Cks1 on Cln2-Cdc28 activity, we assayed
the level of Cln2-Cdc28 activity in extracts prepared from isogenic
CKS1 and cks1-38 strains as follows. Yeast
strains RJD1091 (BF264-15D; ade1 his2 leu2-3,112,
trp1-1a cks1::LEU2
cln2::CLN23×HA::LEU2
MATa plus pSE271/cks1-38 [TRP1 CEN1 ARS
cks1-ts38]) and RJD1093 (BF264-15D; ade1 his2
leu2-3,112 trp1-1a
cks1::LEU2
cln2::CLN23×HA::LEU2
MATa plus pSE271/CKS1 [TRP1 CEN1 ARS
CKS1]) were grown in 1 liter of YPD at 24°C to an optical
density at 600 nm (OD600) of ~0.5. Each 1-liter culture
was split into two 500-ml cultures, one of which was placed at 24°C
and the other at 38.5°C, for 3.5 h. Cultures were harvested by
centrifugation (7 min at 7,000 rpm; Sorvall GSA rotor), and cell
pellets were washed once with 50 ml of ice-cold 100 mM NaCl, frozen in
liquid nitrogen, thawed, and resuspended in 3 ml of glass bead lysis
buffer (GBLB; 18 mM Tris [pH 8.0], 8.8 mM MgCl2, 0.9 mM
EDTA, 4.5% glycerol, 260 mM ammonium sulfate, 88 mM NaCl, 50 mM NaF,
50 mM
-glycerophosphate, 0.2 mM sodium orthovanadate, 1 mM DTT, 2 mM
PMSF, 2 mM benzamidine, 5 µg of pepstatin and 5 µg of
leupeptin/ml). The cell suspension was vortexed with 2 ml of glass
beads (0.5 mm in diameter), and the resulting lysate was collected from
the beads and centrifuged at 4°C for 10 min in a microcentrifuge,
followed by 10 min at 40,000 rpm in a Sorvall microultracentrifuge
(RP100AT4 rotor). Clarified lysates were used for immunoprecipitation
and immunoblotting of Cln23×HA as described in the legend
to Fig. 5. Cln3-Cdc28 activities in untagged (RJD539; ade1 his2
leu2 trp1 ura3 MATa), CKS1 CLN33×HA
(RJD1280;
cln3::LEU2::GAL1::CLN33×HA
cks1::LEU2 ade1 leu2 his2 trp1 ura3
MATa pSE271-CKS1), and cks1-38
CLN33×HA (RJD1279;
cln3::LEU2::GAL1::CLN33×HA
cks1::LEU2 ade1 leu2 his2 trp1 ura3
MATa pSE271-cks1-38) cells were evaluated as
described previously (18). RJD539, -1279, and -1280 are
isogenic to each other and to BF264-15d.
Cell extracts for the
-factor block-release experiment depicted in
Fig. 5C and D were prepared as follows. Yeast strains RJD1091 and
RJD1093 were grown in 500 ml of YPD at 24°C to an OD600
of ~0.5, supplemented with 5 µg of
-factor/ml, and incubated an
additional 3 h at 24°C, followed by 1.5 h at 38.5°C.
G1-arrested cells were collected by filtration, washed with
500 ml of yeast extract-peptone, and resuspended in 500 ml of YPD
prewarmed to 38.5°C. At 15-min intervals following release from
-factor, 45-ml aliquots of the culture were harvested by
centrifugation, and cell pellets were washed with 10 ml of 100 mM NaCl
and frozen in liquid nitrogen. Once aliquots at all time points were
collected, cell pellets were thawed, resuspended in 1 ml of GBLB, and
lysed by vortexing with 1 ml of glass beads (0.5 mm in diameter). Cell lysates were clarified by centrifugation in a Sorvall
microultracentrifuge (10 min at 35,000 rpm; RP100AT4 rotor) and used
for immunoprecipitation and immunoblotting of Cln23×HA as
described in the legend of Fig. 5.
Recombinant proteins. (i) Cks1.
A 4-ml overnight culture of
BL21(DE3) plus pLysS transformed with the plasmid pCKS1-1, which
expressed Cks1 from the T7 promoter, was inoculated into 1 liter of
Luria broth-100 µg of ampicillin/ml and grown at 37°C to an
OD600 of 0.5. The culture was then cooled to 24°C in an
ice water bath, and IPTG
(isopropyl-
-D-thiogalactopyranoside) was added to 0.3 mM
to induce synthesis of Cks1. After a 4-h induction at 24°C, cells
were harvested (Sorvall GSA rotor; 7,000 rpm for 7 min), washed once
with 250 ml of 50 mM Tris (pH 7.6)-100 mM NaCl, and resuspended in 10 ml of 1× phosphate-buffered saline. To prepare a lysate, the cell
suspension was frozen in liquid nitrogen, thawed on ice, and sonicated
for 30 s at setting 5 (Branson sonifier 450). The resulting lysate
was clarified by centrifugation in an IEC clinical centrifuge, and the
supernatant was incubated in a boiling-water bath for 5 min and then
centrifuged for 10 min at 40,000 rpm (Beckman 60Ti rotor). The
supernatant fraction was supplemented with ammonium sulfate (1 g per
6.1 ml of supernatant), incubated for 30 min at 4°C, and centrifuged
at 40,000 rpm for 10 min (Beckman 60Ti rotor). Precipitated proteins
were redissolved in 10 ml of 50 mM Tris (pH 7.6)-100 mM NaCl-2 mM
EDTA and dialyzed against three changes of 50 mM Tris (pH 7.6)-100 mM
NaCl. The dialysate was chromatographed on a Sepharose CL-6B column
(107 cm by 16-mm diameter), and fractions containing Cks1 were pooled and concentrated in a 15-ml Millipore centrifugal concentrator (nominal
molecular mass cutoff = 10 kDa).
(ii) Cdc28HA.
A recombinant baculovirus that
expresses Cdc28HA was generated by cloning a blunted,
CDC28HA-containing
BstBI/XbaI fragment from pSF19 (39a)
into the SmaI site of pVL1392.
(iii) Cln2mycHis6.
Epitope-tagged Cln2 was
generated by PCR amplification of CLN2 from a pAS101
template (provided by A. Sil) using the oligonucleotides RDO53
(GGGGGATCCCATATGGCTAGTGCTGAACC) and RDO54
(GGGCTGCAGCTATATTACTTGCGGCCGCTGGGTATTGCCCATACC). The
resulting PCR fragment, which contains a unique NotI site at
the 3' end of the CLN2 coding sequence, was digested with
BamHI plus PstI and subcloned into the
corresponding sites of pUC119 to generate pUC119-Cln2(NotI).
Complementary oligonucleotides (RDO59:
GGCCTCTAGAGGAGCAGAAATTAATCAGCGAAGAGGACCTCCTCAGGCATCATCACCATCATCACG; RDO60:
GGCCCGTGATGATGGTGATGATGCCTGAGGAGGTCCTCTTCGCTGATTAATTTCTGCTCCTCTAGA) encoding the bipartite mycHis6 epitope were hybridized, kinased, and ligated into the unique NotI site of pUC119-CLN2(NotI)
to yield pUC119-CLN2mycHis6. Finally, the
BamHI/PstI fragment of
pUC119-CLN2mycHis6 was cloned into the
BamHI/PstI sites of pVL1393. All PCR-amplified coding sequences were validated by DNA sequencing.
(iv) MBP-Clb2.
CLB2 was amplified by PCR from a pC2408
template (provided by K. Nasmyth) using oligonucleotides RDO70
(GAACGGTCGACTCAGAATTCTTCATGCAAGGTCATTATATCATAGCC) and RDO71
(GAACGGCTAGCATATGTCGCGGCCGCTATCCAACCCAATAGAAAACAC). The resulting fragment was digested with SalI
plus NheI and cloned into the
XbaI/SalI sites of pRS306 (37), which
had been previously modified by filling in the unique NotI
site (pRS306
NotI). All PCR-amplified coding sequences were validated
by DNA sequencing. CLB2 coding sequences were excised from
this plasmid by digestion with NdeI (filled in with Klenow
fragment) and SalI and inserted into the EcoRI
(filled in with Klenow fragment) and SalI sites of pMAL-c1
(New England BioLabs). Maltose-binding protein (MBP)-Clb2 was
expressed and purified on amylose resin by standard methods (New
England BioLabs).
MBP-Sic1 was prepared as described previously (45). The Far1
fragment used for kinase assays in Fig. 3 contained the 60 N-terminal
amino acids of Far1 followed by a hexahistidine tag (provided by F. Cross). Far1(1-60)His6 was expressed and purified by
nitrilotriacetic acid affinity chromatography as described previously (Qiagen).
 |
RESULTS |
Activation of baculovirus-expressed Cln2-Cdc28 complexes requires a
factor from yeast extract.
Cyclin-CDK subunits that have been
expressed from recombinant baculoviruses typically assemble into active
protein kinase complexes (4, 23, 25). Thus, to characterize
the budding yeast Cln2-Cdc28 complex, we constructed recombinant
baculoviruses to express Cln2 and Cdc28 either singly or in combination
in insect Sf9 cells. The Cln2 and Cdc28 subunits were tagged at their C termini with a dual myc-hexahistidine epitope (Cln2MH6) and
an HA epitope (Cdc28HA), respectively, to facilitate the
recovery of Cln2-Cdc28 complexes from cell lysates. Following
immunoprecipitation with the anti-HA monoclonal antibody 12CA5, immune
complexes were assayed for histone H1 protein kinase activity and
evaluated by SDS-PAGE (see Materials and Methods). Unexpectedly, Sf9
cells coinfected with recombinant baculoviruses encoding
Cln2MH6 and Cdc28HA failed to express histone
H1 protein kinase activity (Fig. 1, lane
5), even though both subunits were produced as judged by immunoblotting
(data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Yeast extract activates baculovirus-expressed Cln2-Cdc28
protein kinase. Lysates from Sf9 cells (5 µg) coinfected with
recombinant baculoviruses encoding Cln2MH6 and
Cdc28HA were incubated either alone (lane 5) or in the
presence of 18, 54, and 180 µg of extract from Cln-depleted
cdc28ts cells (lanes 6 to 8, respectively;
relevant genotype: cdc28ts cln1 cln2 cln3
GAL-CLN3). In a parallel experiment, 180 µg of yeast extract was
incubated alone (lane 1) or in the presence of 2.5, 5, and 7.5 µg of
lysate from baculovirus-infected Sf9 cells expressing
Cln2MH6 plus Cdc28HA (lanes 2 to 4, respectively). Following incubation for 15 min at 24°C in the
presence of an ATP-regenerating system, all reaction mixtures were
immunoprecipitated with anti-HA monoclonal antibody 12CA5, assayed for
histone H1 kinase activity, fractionated on an SDS-polyacrylamide gel,
and quantitated with a PhosphorImager. Relative kinase activities in
lanes 1 to 8 are 1, 9, 14, 15, 2, 4, 7, and 17, respectively.
|
|
Recombinant glutathione S-transferase (GST)-Cln2 isolated
from Escherichia coli can activate Cdc28HA in
crude yeast extract (5). Thus, we examined whether yeast extract contains a factor that is required for the production of active
Cln2-Cdc28 protein kinase. Yeast extract prepared from a
cdc28ts mutant strain depleted of G1
cyclins was added to lysates prepared from Sf9 insect cells coinfected
with recombinant baculoviruses encoding Cln2MH6 and
Cdc28HA. Following a brief incubation at 24°C in the
presence of an ATP-regenerating system, Cdc28HA and
associated proteins were recovered and assayed for histone H1 kinase
activity as described above. Whereas the yeast extract itself had no
12CA5-precipitable histone H1 kinase activity (Fig. 1, lane 1), it
promoted the recovery of active Cln2MH6-Cdc28HA
from insect cell lysates (lanes 6 to 8). No histone H1 kinase activity
was recovered upon incubation of yeast extract with Sf9 lysates
containing only Cdc28HA or Cln2MH6 (data not shown).
Budding yeast Cdc28 can potentially be activated by CAK, which
phosphorylates T169 (8, 20, 44), and by Mih1 phosphatase (35), which dephosphorylates the Y19 residue of Cdc28 that
is phosphorylated by Swe1 protein kinase (1). Neither of
these factors was responsible for the activation of recombinant
Cln2MH6-Cdc28HA because yeast extract
efficiently promoted Cln2MH6-Cdc28HA activation
even in the absence of ATP and in the presence of the potent
phosphatase inhibitors sodium fluoride and sodium orthovanadate (data
not shown). Moreover, immunopurified
Cln2MH6-Cdc28HA complexes could be activated in
the absence of crude lysate (see Fig. 3C).
The yeast extract Cln2-Cdc28 activator is Cks1.
In preliminary
attempts to characterize the Cln2MH6-Cdc28HA
activator in yeast extract, we tested its sensitivity to heat.
Surprisingly, boiled yeast extract fully retained its ability to
activate baculovirus-expressed Cln2MH6-Cdc28HA
(Fig. 2A). Eukaryotic cells express a
small protein that binds tightly to the CDK subunit of cyclin-CDK
complexes and that is known by a variety of names including p13, suc1,
and Cks (3, 14, 33). Depending on the species,
p13suc1 or Cks1 ranges in size from 9 to 19 kDa. Given that
the S. pombe p13suc1 protein is heat stable
(39), we tested whether the
Cln2MH6-Cdc28HA activator might correspond to
Cks1, which is the budding yeast homolog of p13suc1
(14). Untreated or boiled E. coli extract that
contained Cks1 could substitute for yeast extract to activate
Cln2MH6-Cdc28HA complexes in insect cell lysate
(Fig. 2A), whereas control E. coli extract had no effect
(not shown). Half-maximal activation of
Cln2MH6-Cdc28HA complexes in crude Sf9 cell
extracts (Fig. 2C) was obtained with ~100 nM purified Cks1 (Fig. 2B).
Based on these observations, we conclude that the heat-stable
Cln2MH6-Cdc28HA activator present in yeast
extract is Cks1.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Cks1 activates Cln2-Cdc28 protein kinase. (A) Cks1
substitutes for yeast extract in the activation of
Cln2MH6-Cdc28HA. Extracts prepared from Sf9
cells coinfected with Cln2MH6- and
Cdc28HA-expressing baculoviruses were mixed with the
indicated components, incubated at 24°C for 15 min,
immunoprecipitated with anti-HA monoclonal antibody 12CA5, and assayed
for histone H1 protein kinase activity. Relative kinase activities in
lanes 1 to 5 are 1, 11, 14, 12, and 14, respectively. U and B, E. coli lysate (40 µg) containing Cks1 or yeast extract (100 µg)
that was either untreated (U) or boiled for 5 min (B). (B) Purified
Cks1. Cks1 (10 µg) purified from E. coli was fractionated
on an SDS-15% polyacrylamide gel and stained with Coomassie blue. (C)
Titration of Cks1. The indicated amounts of Cks1 were mixed with lysate
(5 µg) prepared from Sf9 cells coinfected with recombinant
baculoviruses encoding Cln2MH6 and Cdc28HA, and
the mixtures were processed as described for panel A. Relative kinase
activities in lanes 1 to 4 are 22, 16, 2, and 1, respectively.
|
|
Cks1 assembles with and activates the ability of Cln2-Cdc28 to
phosphorylate multiple substrates.
Cks proteins are well known for
binding tightly to cyclin B-CDK complexes. To test if Cks1 likewise
assembles with Cln2-Cdc28, all three proteins were expressed from
baculovirus vectors in insect cells. Coomassie blue staining and
immunoblot analysis confirmed that Cln2-Cdc28 complexes bound to Cks1
beads (data not shown) and that both Cln2 and Cks1His6 were
recovered along with GST-Cdc28HA on glutathione resin (Fig.
3A; these complexes exhibited high histone H1 kinase activity [data not shown]). These results confirm a
previous report that Cdc28 and Cks1 copurify with Cln2 from yeast cells
(46).


View larger version (77K):
[in this window]
[in a new window]
|
FIG. 3.
Cks1 binds to Cln2-Cdc28 and activates phosphorylation
of multiple substrates. (A) Lysates from insect cells coinfected with
baculovirus vectors encoding Cln2, GST-Cdc28HA, and
Cks1His6 were adsorbed to glutathione resin, and
specifically bound proteins were revealed by staining with Coomassie
blue (CB) or immunoblotting with anti-His6 antibodies (IB). Arrowheads,
migration of molecular mass markers (from top to bottom, 68, 46, 30, and 21.5 kDa). (B) Lysates (40 µg) of Sf9 cells infected with
recombinant baculoviruses encoding Cln2MH6 or
Cdc28HA, as indicated, were either mock treated or mixed
with 390 ng of purified Cks1 for 15 min at 24°C. Reaction mixtures
were immunoprecipitated (I.P.) with anti-HA monoclonal antibody 12CA5,
and immunoprecipitates were divided in thirds and assayed for their
quantity of histone H1 kinase (top), Cln2MH6 kinase
(middle), or Cln2MH6 antigen (bottom; detected by
immunoblotting with affinity-purified anti-Cln2 polyclonal antibody).
(C) Lanes 1 to 4, immunoprecipitates prepared as described for panel B
were directly assayed for Far1 or MBP-Sic1 or histone H1 kinase
activity. Lanes 5 to 8, Cks1-free immunoprecipitates prepared from Sf9
lysates were subdivided into aliquots which were then either mock
treated or supplemented with 390 ng of Cks1. After a brief incubation,
kinase complexes were washed and assayed for Far1, MBP-Sic1, or histone
H1 kinase activity as indicated. All samples were also evaluated by
immunoblotting with an antimyc monoclonal antibody (bottom).
|
|
Histone H1 is a convenient reporter for CDK activity but is most likely
not a physiological substrate for most CDKs. Cln2 (24), Sic1
(45), and Far1 (16) have been implicated as
authentic substrates of Cln2-Cdc28 complexes. Thus, we tested whether
recombinant Cln2MH6-Cdc28HA complexes were able
to phosphorylate these substrates and whether phosphorylation was
dependent on Cks1. Cln2MH6-Cdc28HA
immunoprecipitated from Cks1-treated Sf9 lysates phosphorylated both
histone H1 and the associated Cln2MH6 subunit (Fig. 3B,
lane 6, top and middle). In contrast, neither substrate was
phosphorylated by immunoprecipitates prepared from lysates containing
only Cln2MH6 or Cdc28HA (lanes 1 to 4) or from
coinfected lysates that were not supplemented with Cks1 (lane 5).
Similar results were obtained with Far1 and MBP-Sic1 (Fig. 3C, lanes 1 to 4). Thus, Cks1 activates the ability of
Cln2MH6-Cdc28HA to phosphorylate multiple substrates.
Cks1-dependent activation of Cdc28 is Cln specific.
Since
expression of many different cyclin-CDK combinations in Sf9 cells has
yielded active protein kinase complexes in the absence of added Cks
proteins, we examined whether the Cks1-dependent activation of
Cln2MH6-Cdc28HA was a peculiarity of the
budding yeast CDK or of the G1 cyclin. Whereas coinfection
of Sf9 cells with baculoviruses encoding Cln2MH6 and
Cdc28HA yielded little precipitable protein kinase activity
unless Cks1 was added prior to immunoprecipitation with anti-HA
antibodies, Sf9 lysates containing Clb4 plus Cdc28HA or
Clb5 plus Cdc28HA yielded substantial histone H1 kinase
activity even in the absence of added Cks1 (Fig.
4). Besides Cln2-Cdc28 complexes,
Cln1-Cdc28 complexes expressed in insect cells require Cks1 for protein
kinase activity (38; J. W. Harper, personal communication).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Cks1 is not required for protein kinase activity of
Clb-Cdc28HA complexes. Sf9 cells were coinfected with a
recombinant baculovirus encoding Cdc28HA plus an additional
virus encoding either Cln2MH6, Clb4, or Clb5, as indicated.
Lysates of infected cells were either mock treated or supplemented with
390 ng of purified Cks1, incubated at 24°C for 10 min, and
immunoprecipitated with anti-HA monoclonal antibody 12CA5.
Immunoprecipitates were assayed for their content of histone H1 kinase
activity, which was assessed by SDS-PAGE followed by phosphorimaging.
In this experiment, the relative maximal H1 kinase activities obtained
were 1.0 for Clb4-Cdc28, 0.69 for Cln2-Cdc28, and 0.42 for
Clb5-Cdc28.
|
|
Cks1 stabilizes Cln2-Cdc28 complexes and can activate preexisting
complexes.
To determine how Cks1 influences the activity of
Cln2MH6-Cdc28HA, we first examined whether Cks1
influences the assembly of the complex. Immunoblotting revealed that
greater amounts of Cln2MH6 consistently
coimmunoprecipitated with Cdc28HA from insect cell lysates
that were supplemented with Cks1 (Fig. 3B, bottom, lane 5 versus lane
6; Fig. 3C, bottom, lane 3 versus lane 4). Although Cks1 enhanced the
stability of the Cln2MH6-Cdc28HA complex, there
was substantial Cln2MH6 antigen in Cdc28HA
precipitates prepared in the absence of Cks1, even though these precipitates had little or no protein kinase activity (Fig. 3B and C).
The addition of Cks1 to Cln2MH6-Cdc28HA
immunoprecipitates prepared in the absence of Cks1 led to the appearance of Cln2MH6-dependent protein kinase activity
towards multiple substrates (Fig. 3C, lanes 5 to 8; note that although
the level of protein kinase activity is higher in lane 4 than in lane
8, there is significantly less Cln2MH6 in the latter
samples). Thus, activation of Cln2MH6-Cdc28HA
by Cks1 can proceed in the absence of insect cell lysate proteins and
ATP. Taken together, these data suggest that Cks1 has two functions: it
can promote the assembly of Cln2MH6 with
Cdc28HA and it can activate preassembled
Cln2MH6-Cdc28HA complexes.
Cks1 is required for Cln2-Cdc28 activity in vivo.
Temperature-sensitive mutant cks1-38 cells arrest cell
division in both G1 and M phases at the nonpermissive
temperature (42). To determine whether Cks1 function is
required for the appearance of active Cln2-Cdc28 complexes in vivo, we
examined the level of histone H1 kinase activity associated with
epitope-tagged Cln2 (Cln23×HA) in asynchronous and
G1-synchronized populations of CKS1 and cks1-38 cells (Fig. 5). Both
histone H1 kinase activity and Cdc28 antigen were recovered in anti-HA
immunoprecipitates prepared from asynchronous populations of CKS1
CLN2HA cells (Fig. 5A, lanes 5 and 7) but not from
CKS1 cells that did not express tagged Cln23×HA
(lanes 1 and 3). In contrast, little or no histone H1 kinase activity
and Cdc28 antigen were detected in anti-HA precipitates prepared from
asynchronous cultures of cks1-38 cells maintained at the
permissive temperature (24°C; lane 9) or shifted to the restrictive
temperature (38.5°C; lane 11). Immunoblot analysis confirmed that
these cks1-38 cultures contained normal levels of Cdc28 and
Cln23×HA antigens (data not shown). Moreover, recovery of
both Cln23×HA-associated protein kinase activity and Cdc28
antigen was restored by the addition of purified Cks1 to the
cks1-38 lysate prior to the immunoprecipitation step (Fig.
5A, lanes 10 and 12), indicating that the Cdc28 and
Cln23×HA subunits present in cks1-38 cell
extracts were competent to form an active kinase complex.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
Mutant cks1-38 cells fail to assemble active
Cln2-Cdc28 protein kinase complexes. (A) Absence of active
Cln23×HA-Cdc28 complexes in cks1-38 cell
extract. Total cell extract proteins (3 mg) prepared from CLN2
CKS1, CLN23×HA CKS1, and
CLN23×HA cks1-38 cells grown at either the
permissive (P; 24°C) or restrictive (R; 38.5°C) temperature were
immunoprecipitated (IP) with anti-HA monoclonal antibody 12CA5, and
immunoprecipitates were divided in half and assayed for their content
of histone H1 kinase activity (top) or Cdc28 antigen (bottom). Samples
in even-numbered lanes were supplemented with 3.9 µg of purified Cks1
prior to the immunoprecipitation step. Relative kinase activities in
lanes 1 to 12 (top) are 1, 1, 2, 1, 25, 29, 15, 23, 2, 20, 2, and 8, respectively. (B) cks1-38 extracts contain high levels of
Clb2-Cdc28 kinase activity. Total cell extract proteins (1 mg) from the
experiment described for panel A were incubated with anti-Clb2
affinity-purified polyclonal antibodies, and immunoprecipitates were
assayed for their content of histone H1 kinase activity. MBP-Clb2, same
as sample shown in lane 1, except 20 µg of purified MBP-Clb2 was
added prior to the immunoprecipitation step; 3× -Clb2, same as
sample shown in lane 1, except threefold more antibody was used. These
two controls indicate that immunoprecipitation was specific and that
the antibody was used at saturating levels for the assays depicted in
lanes 1 to 4. The relative protein kinase activities in lanes 1 to 6 are 18, 6, 24, 36, 1, and 13, respectively. (C) Accumulation of
phosphorylated Cln23×HA is strongly delayed in
cks1-38 cells released from a pheromone arrest.
CKS1 (odd-numbered lanes) and cks1-38
(even-numbered lanes) cultures were arrested in G1 phase
with -factor, shifted to 38.5°C for 1 h, and then released by
being washed into medium lacking -factor at 38.5°C. Lysates (100 µg) prepared from cells withdrawn at the indicated times were
fractionated by SDS-PAGE and immunoblotted with anti-HA monoclonal
antibody 12CA5 to detect Cln23×HA. Note that both the
level and phosphorylation state of Cln2 are diminished in
cks1-38 cells. (D) Cln23×HA-Cdc28 activity
fails to accumulate in cks1-38 cells released from a
pheromone arrest. Samples (3 mg) from the experiment shown in panel C
were immunoprecipitated with 12CA5. Immunoprecipitates were assayed for
their content of histone H1 kinase activity, which was evaluated by
SDS-PAGE followed by phosphorimaging.
|
|
Defective assembly of active Cln2-Cdc28 complexes was also observed in
synchronous G1 phase cultures of cks1-38 cells
(Fig. 5C and D), suggesting that the results observed in Fig. 5A are not an artifact due to arrest of cks1-38 cells in
G2 phase. Cln23×HA expressed in synchronous
cultures of G1 phase cks1-38 cells at 38.5°C
migrated upon SDS-PAGE largely as a hypophosphorylated species relative
to the migration seen in CKS1 cells (Fig. 5C). Given that
Cln2 assembled into active complexes is hyperphosphorylated by Cdc28
(24), this observation provides further evidence that Cln2-Cdc28 protein kinase activity was dramatically reduced in intact
cks1-38 cells.
Although Cln2-Cdc28 protein kinase activity was severely reduced in
cks1-38 cells, precipitation of the same extracts used above
with anti-Clb2 antibodies revealed that these cells contained elevated
levels of Clb-associated histone H1 kinase (Fig. 5B, lane 2 versus lane
4). The elevated level of Clb2-Cdc28 activity seen in
cks1-38 cells is consistent with the observation that Cks1
is required for Clb2 turnover (19).
Cks1 is required for Cln3-Cdc28 activity in vivo.
Cks1 is
important for activation of recombinant Cln1-Cdc28 and Cln2-Cdc28
complexes, and cks1ts cells fail to transit from
G1 to S phase. Given that either Cln1, Cln2, or Cln3 is
able to sustain progression through G1 phase in budding
yeast cells (34), we reasoned that Cks1 might also be
important for Cln3-Cdc28 activity. To test this, we examined the
formation of active Cln3-Cdc28 complexes in cks1-38 strains. GAL-CLN33×HA CKS1 and
GAL-CLN33×HA cks1-38 cells were grown in
galactose medium at 25°C and one-half of each culture was shifted to
38.5°C for 3 h. Cln33×HA-Cdc28 activity and
Cln33×HA plus Cdc28 antigens were evaluated by protein
kinase assay and immunoblotting of anti-HA immunoprecipitates.
Cln33×HA-associated histone H1 kinase activity was
substantially diminished in cks1-38 cells grown at either
the permissive or restrictive temperature (Fig.
6A). As was observed for Cln2, little
Cdc28 was recovered in Cln3HA precipitates prepared from
cks1-38 cells incubated at the nonpermissive temperature
(Fig. 6B). Interestingly, Cdc28 was recovered in association with Cln3
from cks1-38 cells grown at the permissive temperature (Fig.
6B), even though these complexes had little protein kinase activity
(Fig. 6A). Taken together with the data shown in Fig. 3C and 5A, this
observation suggests that Cks1 stimulates both the assembly of Cln
proteins with Cdc28 and the activity of preformed Cln-Cdc28 complexes.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Mutant cks1-38 cells fail to assemble active
Cln3-Cdc28 protein kinase complexes. (A)
GAL-CLN33×HA CKS1 and
GAL-CLN33×HA cks1-38 cultures grown in
galactose medium at 25°C were split, and half of each culture was
shifted to 38.5°C for 3 h. Total cell extract proteins (10 mg)
prepared from cells maintained at 25°C (P) or shifted to 37°C (R)
were immunoprecipitated with anti-HA monoclonal antibody 12CA5, and
immunoprecipitates were divided in thirds and assayed for their content
of Cdc28 (B) and Cln33×HA antigens (not shown) by
immunoblotting and for histone H1 kinase activity (A). Kinase activity
shown in panel A is normalized to Cln33×HA levels. (C)
Cln33×HA present in total cell lysate of untagged controls
(lanes 1 and 4), GAL-CLN33×HA CKS1 cells (lanes
2 and 3), and GAL-CLN33×HA cks1-38 cells (lanes
5 and 6) was evaluated by immunoblotting with anti-HA.
|
|
The accumulation of Cln3 is negatively regulated by its Cdc28-dependent
phosphorylation (48). Consistent with the reduced Cln3-associated Cdc28 protein kinase activity detected in vitro, Cln33×HA accumulated to high levels, but primarily as
hypophosphorylated forms, in cks1-38 cells (Fig. 6C).
 |
DISCUSSION |
Cks1 activates budding yeast G1 cyclin-CDK
complexes.
We provide evidence that Cks1 is required for the
protein kinase activity of Cln2-Cdc28 and Cln3-Cdc28 protein kinase
complexes. Cks1 potently activates the ability of immunoisolated
Cln2-Cdc28 complexes to phosphorylate multiple substrates but has only
a modest effect on the activity of Clb-Cdc28 complexes.
Immunoprecipitation experiments suggest that Cks1 promotes the assembly
of active Cln2-Cdc28 complexes in vivo and in vitro. However, intact
Cln2-Cdc28 complexes recovered from insect cells in the absence of
yeast Cks1 are nonetheless activated by added Cks1, suggesting that Cks1 may promote Cln2-Cdc28 protein kinase activity by an additional mechanism besides complex formation.
A previous analysis of the phenotype of cks1-38 mutants
failed to reveal the defect in G1 cyclin-Cdc28 protein
kinase activity reported here (42). This discrepancy is
probably due to the fact that, in the prior work, Cdc28 protein kinase
activity was monitored using an antibody directed against Cdc28.
G1 cyclins account for only a small fraction of total Cdc28
protein kinase activity (47), and Cks1 is not required for
the protein kinase activity of the more abundant Clb-Cdc28 complexes
(Fig. 4 and 5B; the small contribution of Cks1 to Clb-Cdc28 protein
kinase activity is probably obscured by the accumulation of Clb2 in
cks1-38 cells). Thus, since anti-Cdc28 antibodies are
expected to retrieve both Cln-Cdc28 and Clb-Cdc28 complexes, it is not
surprising that Tang and Reed (42) failed to detect the
effect reported here.
Mechanism of Cln2-Cdc28 activation by Cks1.
How does Cks1
promote Cln2-Cdc28 protein kinase activity? First, Cks1 appears to
enhance the interaction between Cln2 and Cdc28. It is difficult to
envision how Cks1 stabilizes the interaction of Cln2 with Cdc28 since
Cks1 and cyclin A bind to opposite sides of Cdk2 and since the binding
of Cks1 to the C-terminal lobe of Cdk2 has little effect on the
conformation of the cyclin-binding interface (2). However,
the binding of cyclin B to p34cdc2 enhances the binding of human Cks2
(7), suggesting that cyclin and Cks proteins may interact
cooperatively with CDKs. Another possibility is that the long
C-terminal tail following the cyclin box of Cln2 may form stabilizing
contacts with Cks1 bound to the carboxy-terminal lobe of Cdc28.
Although Cks1 strongly stabilizes the interaction between Cln2 and
Cdc28 in yeast extract, it has a far less dramatic effect on the
assembly of stable Cln2-Cdc28 complexes in insect cell extract. We do
not understand the reason for this discrepancy. Perhaps the far greater
concentration of Cln2 and Cdc28 subunits expressed in insect cells
favors complex assembly even if Cks1 is absent. Alternatively, insect
cells may contain a factor (insect Cks1-like protein?) that stabilizes
Cln2-Cdc28 association but that is insufficient to sustain protein
kinase activity. Although it is unclear how the binding of Cks1
activates preformed Cln2-Cdc28 complexes isolated from insect cells, it
seems unlikely that this effect is brought about through conformational
changes propagated from the Cks1 binding site to the active site of
Cdc28, because binding of Cks1 does not evoke substantial
rearrangements within the catalytic site of Cdk2 (2) and
because Cks1 has little effect on the activity of Clb-Cdc28 complexes.
We suggest four alternative hypotheses to explain how Cks1 selectively
activates Cln2-Cdc28 complexes. First, Cln2 may exert both positive and
negative effects on Cdc28. Positive regulation would presumably be
accomplished in the same manner as is observed for cyclin A: binding of
Cln2 rearranges key residues in the active site of Cdc28, favoring a
geometry that permits transfer of the
phosphate of ATP to bound
substrate (17). In contrast, other domains within Cln2
(e.g., the C-terminal tail) might act negatively on Cdc28 unless
displaced via binding of Cks1. A second possibility is that Cln
proteins may bind Cdc28 more weakly than do Clb proteins and that Cks1
may be required to stabilize the Cln-Cdc28 complex. Third, Cks1 may
provide substrate interaction sites that are normally provided by the
cyclin in Clb-Cdc28 complexes (21) but that are otherwise
absent from Cln-Cdc28 complexes. Last, Cks1 may promote Cln2-Cdc28
activity by acting directly on Cln2. Although it seems likely that the
target of action of Cks1 is the
5 helix-L14 loop within the
C-terminal lobe of Cdc28, this last possibility is suggested by the
observation that a Cdc28 mutant (Cdc28-1N) that binds Cks1 poorly
(2) nonetheless proceeds through Start and arrests at
G2/M instead (32, 41).
Cdc37 has also been reported to promote interactions between Cln2 and
Cdc28 (13). Unlike cdc37-1 mutants,
cks1-38 cells contain normal levels of Cdc28 and accumulate
high levels of Clb-Cdc28 activity. Cdc37 is thought to promote the
assembly of cyclin-CDK complexes by promoting conformational
maturation of the CDK subunit (10, 40). Thus, Cdc37 and Cks1
probably promote Cln2-Cdc28 activity by different means.
Is Cks1 required for the activity of other cyclin-CDK
complexes?
To date, all cyclin-CDK complexes that have been
expressed in insect cells (including cyclin A-Cdc2, cyclin B-Cdc2,
cyclin D-Cdk4, and cyclin E-Cdk2) are active in the absence of any
added proteins (4, 23, 25). Thus, the role of Cks1 in
Cln2-Cdc28 activation may be unique to this particular combination.
However, because mammalian cyclin-Cdk complexes may recruit endogenous Cks1-like proteins in insect cells, it is possible that mammalian G1 cyclins also require Cks proteins to activate their
cognate CDKs. It is unclear whether insect cell Cks1-like proteins bind to Cln2-Cdc28, but if they do they are not sufficient to sustain protein kinase activity in vitro.
There is precedent for assembly factors contributing to the formation
of active cyclin-CDK complexes in animal cells. Besides the Cdc37
example noted above, Mat1 is required for the assembly of cyclin H-Cdk7
(CAK) complexes (6, 12, 43). Further work will be required
to test the generality of the observations we report here and to deduce
the exact mechanism by which Cks1 promotes the activation of Cln2-Cdc28 complexes.
 |
ACKNOWLEDGMENTS |
We acknowledge M. Weinreich and B. Stillman for providing
recombinant baculoviruses encoding Clb4 and Clb5. We also thank M. Olson for MBP-Clb2 and anti-Clb2 serum, R. Booher for Cks1 plasmids, S. Reed for cks1-38, F. Cross for the Far1 fragment and
Cln33×HA strains, Wade Harper for baculoviruses encoding
Cks1 and GST-Cdc28HA, members of W. Dunphy's laboratory
for advice on baculovirus expression, and W. Dunphy, R. Feldman, G. Turner, R. Verma, and D. Patra for discussions and comments on the manuscript.
R.J.D. is a Searle and Markey Scholar, and this work was supported by
the Searle Program/The Chicago Community Trust, The Lucille P. Markey
Charitable Trust, and the National Institutes of Health (NIH RO1 GM52466).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Biology, 156-29, California Institute of Technology, Pasadena, CA
91125. Phone: (626) 395-3162. Fax: (626) 449-0756. E-mail:
deshaies{at}its.caltech.edu.
 |
REFERENCES |
| 1.
|
Booher, R. N.,
R. J. Deshaies, and M. Kirschner.
1993.
Properties of Saccharomyces cerevisiae wee1 and its differential regulation of p34CDC28 in response to G1 and G2 cyclins.
EMBO J.
12:3417-3426[Medline].
|
| 2.
|
Bourne, Y.,
M. H. Watson,
M. J. Hickey,
W. Holmes,
W. Rocque,
S. I. Reed, and J. A. Tainer.
1996.
Crystal structure and mutational analysis of the human CDK2 kinase complex with cell cycle-regulatory protein CksHs1.
Cell
84:863-874[CrossRef][Medline].
|
| 3.
|
Brizuela, L.,
G. Draetta, and D. Beach.
1987.
p13suc1 acts in the fission yeast cell division cycle as a component of the p34cdc2 protein kinase.
Eur. Mol. Biol. Org. J.
6:3507-3514[Medline].
|
| 4.
|
Desai, D.,
Y. Gu, and D. O. Morgan.
1992.
Activation of human cyclin-dependent kinases in vitro.
Mol. Biol. Cell
3:571-582[Abstract].
|
| 5.
|
Deshaies, R. J., and M. Kirschner.
1995.
Reconstitution of p34CDC28 activity with G1 and mitotic cyclins.
Proc. Natl. Acad. Sci. USA
92:1182-1186[Abstract/Free Full Text].
|
| 6.
|
Devault, A.,
A.-M. Martinez,
D. Fesquet,
J.-C. Labbe,
N. Morin,
J.-P. Tassan,
E. Nigg,
J. Cavadore, and M. Doree.
1995.
MAT1 (menage a trois), a new RING finger protein subunit stabilizing cyclin H-cdk7 complexes in starfish and Xenopus CAK.
EMBO J.
14:5027-5036[Medline].
|
| 7.
|
Egan, E. A., and M. J. Solomon.
1998.
Cyclin-stimulated binding of Cks proteins to cyclin-dependent kinases.
Mol. Cell. Biol.
18:3659-3667[Abstract/Free Full Text].
|
| 8.
|
Espinoza, F. H.,
A. Farrell,
H. Erdjument-Bromage,
P. Tempst, and D. O. Morgan.
1996.
A cyclin-dependent kinase-activating kinase (CAK) in budding yeast unrelated to vertebrate CAK.
Science
273:1714-1717[Abstract/Free Full Text].
|
| 9.
|
Evan, G. J.,
G. K. Lewis,
G. Ramsay, and J. M. Bishop.
1985.
Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product.
Mol. Cellular Biology
5:3610-3616.
|
| 10.
|
Farrell, A., and D. Morgan.
2000.
Cdc37 promotes the stability of protein kinases Cdc28 and Cak1.
Mol. Cell. Biol.
20:749-754[Abstract/Free Full Text].
|
| 11.
|
Field, J.,
J. I. Nikawa,
D. Broek,
B. MacDonald,
L. Rodgers,
I. A. Wilson,
R. A. Lerner, and M. Wigler.
1988.
Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method.
Mol. Cell. Biol.
8:2159-2165[Abstract/Free Full Text].
|
| 12.
|
Fisher, R. P.,
P. Jin,
H. M. Chamberlin, and D. O. Morgan.
1995.
Alternative mechanisms of CAK assembly require an assembly factor or an activating kinase.
Cell
83:47-57[CrossRef][Medline].
|
| 13.
|
Gerber, M. R.,
R. J. Deshaies,
I. Herskowitz, and D. O. Morgan.
1995.
Cdc37 is required for association of the protein kinase Cdc28 with G1 and mitotic cyclins.
Proc. Natl. Acad. Sci. USA
92:4651-4655[Abstract/Free Full Text].
|
| 14.
|
Hadwiger, J. A.,
C. Wittenberg,
M. D. Mendenhall, and S. I. Reed.
1989.
The Saccharomyces cerevisiae CKS1 gene, a homolog of the Schizosaccharomyces pombe suc1+ gene, encodes a subunit of the Cdc28 protein kinase complex.
Mol. Cell. Biol.
9:2034-2041[Abstract/Free Full Text].
|
| 15.
|
Hayles, J.,
D. Beach,
B. Durkacz, and P. Nurse.
1986.
The fission yeast cell cycle control gene cdc2+: isolation of a sequence suc1 that suppresses cdc2 mutant function.
Mol. Gen. Genet.
202:291-293[CrossRef][Medline].
|
| 16.
|
Henchoz, S.,
Y. Chi,
B. Catarin,
I. Herskowitz,
R. J. Deshaies, and M. Peter.
1997.
Phosphorylation- and ubiquitin-dependent degradation of the cyclin-dependent kinase inhibitor Far1p in budding yeast.
Genes Dev.
11:3046-3060[Abstract/Free Full Text].
|
| 17.
|
Jeffrey, P. D.,
A. A. Russo,
K. Polyak,
E. Gibbs,
J. Hurwitz,
J. Massague, and N. P. Pavletich.
1995.
Mechanism of CDK activation revealed by the structure of a cyclin A-CDK2 complex.
Nature
376:313-320[CrossRef][Medline].
|
| 18.
|
Jeoung, D.-I.,
L. Oehlen, and F. Cross.
1998.
Cln3-associated kinase activity in Saccharomyces cerevisiae is regulated by the mating factor pathway.
Mol. Cell. Biol.
18:433-441[Abstract/Free Full Text].
|
| 19.
|
Kaiser, P.,
V. Moncollin,
D. J. Clarke,
M. H. Watson,
B. L. Bertolaet,
S. I. Reed, and E. Bailly.
1999.
Cyclin-dependent kinase and Cks/Suc1 interact with the proteasome in yeast to control proteolysis of M-phase targets.
Genes Dev.
13:1190-1202[Abstract/Free Full Text].
|
| 20.
|
Kaldis, P.,
A. Sutton, and M. J. Solomon.
1996.
The CDK-activating kinase (CAK) from budding yeast.
Cell
86:553-564[CrossRef][Medline].
|
| 21.
|
Kellogg, D. R.,
A. Kikuchi,
T. Fuji-Nakata,
C. W. Turck, and A. W. Murray.
1995.
Members of the NAP/SET family of proteins interact specifically with B-type cyclins.
J. Cell Biol.
130:661-673[Abstract/Free Full Text].
|
| 22.
|
King, R. W.,
R. J. Deshaies,
J. M. Peter, and M. Kirschner.
1996.
How proteolysis controls cell division.
Science
274:1652-1659[Abstract/Free Full Text].
|
| 23.
|
Koff, A.,
A. Giordano,
D. Desai,
K. Yamashita,
J. W. Harper,
S. Elledge,
T. Nishimoto,
D. O. Morgan,
B. R. Franza, and J. M. Roberts.
1992.
Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle.
Science
257:1689-1694[Abstract/Free Full Text].
|
| 24.
|
Lanker, S.,
M. H. Valdivieso, and C. Wittenberg.
1996.
Rapid degradation of the G1 cyclin Cln2 induced by CDK-dependent phosphorylation.
Science
271:1597-1601[Abstract].
|
| 25.
|
Matsushime, H.,
M. E. Ewen,
D. K. Strom,
J. Y. Kato,
S. K. Hanks,
M. F. Roussel, and C. J. Sherr.
1992.
Identification and properties of an atypical catalytic subunit (p34PSK-J3/cdk4) for mammalian D type G1 cyclins.
Cell
71:323-334[CrossRef][Medline].
|
| 26.
|
Moreno, S.,
J. Hayles, and P. Nurse.
1989.
Regulation of p34cdc2 protein kinase during mitosis.
Cell
58:361-372[CrossRef][Medline].
|
| 27.
|
Morgan, D. O.
1995.
Principles of CDK regulation.
Nature
374:131-134[CrossRef][Medline].
|
| 28.
|
Murray, A., and T. Hunt.
1993.
The cell cycle, an introduction.
Oxford University Press, Oxford, United Kingdom.
|
| 29.
|
Patra, D., and W. G. Dunphy.
1996.
Xe-p9, a Xenopus Suc1/Cks homolog, has multiple essential roles in cell cycle control.
Genes Dev.
10:1503-1515[Abstract/Free Full Text].
|
| 30.
|
Patra, D., and W. G. Dunphy.
1998.
Xe-p9, a Xenopus Suc1/Cks protein, is essential for the Cdc2-dependent phosphorylation of the anaphase-promoting complex at mitosis.
Genes Dev.
12:2549-2559[Abstract/Free Full Text].
|
| 31.
|
Patra, D.,
S. X. Wang,
A. Kumagai, and W. G. Dunphy.
1999.
The Xenopus Suc1/Cks protein promotes the phosphorylation of G(2)/M regulators.
J. Biol. Chem.
274:36839-36842[Abstract/Free Full Text].
|
| 32.
|
Piggott, J. R.,
R. Rai, and B. L. A. Carter.
1982.
A bifunctional gene involved in two phases of the yeast cell cycle.
Nature
298:391-394[CrossRef][Medline].
|
| 33.
|
Richardson, H. E.,
C. S. Stueland,
J. Thomas,
P. Russell, and S. I. Reed.
1990.
Human cDNAs encoding homologs of the small p34Cdc28/Cdc2-associated protein of Saccharomyces cerevisiae and Schizosaccharomyces pombe.
Genes Dev.
4:1332-1344[Abstract/Free Full Text].
|
| 34.
|
Richardson, H. E.,
C. Wittenberg,
F. Cross, and S. I. Reed.
1989.
An essential G1 function for cyclin-like proteins in yeast.
Cell
59:1127-1133[CrossRef][Medline].
|
| 35.
|
Russell, P.,
S. Moreno, and S. I. Reed.
1989.
Conservation of mitotic controls in fission and budding yeasts.
Cell
57:295-303[CrossRef][Medline].
|
| 36.
|
Shteinberg, M., and A. Hershko.
1999.
Role of Suc1 in the activation of the cyclosome by protein kinase Cdk1/cyclin B.
Biochem. Biophys. Res. Commun.
257:12-18[CrossRef][Medline].
|
| 37.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 38.
|
Skowyra, D.,
K. Craig,
M. Tyers,
S. Elledge, and J. Harper.
1997.
F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex.
Cell
91:209-219[CrossRef][Medline].
|
| 39.
|
Solomon, M. J.,
M. Glotzer,
T. Lee,
M. Philippe, and M. W. Kirschner.
1990.
Cyclin activation of p34cdc2.
Cell
63:1013-1024[CrossRef][Medline].
|
| 39a.
|
Sorger, P., and A. W. Murray.
1992.
S-phase feedback control in budding yeast independent of tyrosine phosphorylation of p34cdc2.
Nature
355:365-368[CrossRef][Medline].
|
| 40.
|
Stepanova, L.,
X. H. Leng,
S. B. Parker, and J. W. Harper.
1996.
Mammalian p50(CDC37) is a protein kinase-targeting subunit of HSP90 that binds and stabilizes CDK4.
Genes Dev.
10:1491-1502[Abstract/Free Full Text].
|
| 41.
|
Surana, U.,
H. Robitsch,
C. Price,
T. Schuster,
I. Fitch,
A. B. Futcher, and K. Nasmyth.
1991.
The role of CDC28 and cyclins during mitosis in the budding yeast S. cerevisiae.
Cell
65:145-161[CrossRef][Medline].
|
| 42.
|
Tang, Y., and S. I. Reed.
1993.
The Cdk-associated protein Cks1 functions both in G1 and G2 in Saccharomyces cerevisiae.
Genes Dev.
7:822-832[Abstract/Free Full Text].
|
| 43.
|
Tassan, J.-P.,
M. Jaquenoud,
A. M. Fry,
S. Frutiger,
G. Hughes, and E. A. Nigg.
1995.
In vitro assembly of a functional human cdk7/cyclin H complex requires MAT1, a novel 36 kD RING finger protein.
Eur. Mol. Biol. Org. J.
14:5608-5617[Medline].
|
| 44.
|
Thuret, J. Y.,
J. G. Valay,
G. Faye, and C. Mann.
1996.
CIV1 (CAK in vivo), a novel CDK-activating kinase.
Cell
86:565-576[CrossRef][Medline].
|
| 45.
|
Verma, R.,
R. S. Annan,
M. J. Huddleston,
S. A. Carr,
G. Reynard, and R. J. Deshaies.
1997.
Phosphorylation of Sic1p by G1 Cdk required for its degradation and entry into S phase.
Science
278:455-460[Abstract/Free Full Text].
|
| 46.
|
Willems, A. R.,
S. Lanker,
E. E. Patton,
K. L. Craig,
T. F. Nason,
R. Kobayashi,
C. Wittenberg, and M. Tyers.
1996.
Cdc53 targets phosphorylated G1 cyclins for degradation by the ubiquitin proteolytic pathway.
Cell
86:453-463[CrossRef][Medline].
|
| 47.
|
Wittenberg, C.,
K. Sugimoto, and S. I. Reed.
1990.
G1-specific cyclins of S. cerevisiae: cell cycle periodicity, regulation by mating pheromone, and association with the p34cdc2 kinase.
Cell
62:225-237[CrossRef][Medline].
|
| 48.
|
Yaglom, J.,
M. H. K. Linskens,
S. Sadis,
D. M. Rubin,
B. Futcher, and D. Finley.
1995.
p34Cdc28-mediated control of CLN3 cyclin degradation.
Mol. Cell. Biol.
15:731-741[Abstract].
|
Molecular and Cellular Biology, August 2000, p. 5858-5864, Vol. 20, No. 16
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Geymonat, M., Spanos, A., Wells, G. P., Smerdon, S. J., Sedgwick, S. G.
(2004). Clb6/Cdc28 and Cdc14 Regulate Phosphorylation Status and Cellular Localization of Swi6. Mol. Cell. Biol.
24: 2277-2285
[Abstract]
[Full Text]
-
Wang, W., Ungermannova, D., Chen, L., Liu, X.
(2003). A Negatively Charged Amino Acid in Skp2 Is Required for Skp2-Cks1 Interaction and Ubiquitination of p27Kip1. J. Biol. Chem.
278: 32390-32396
[Abstract]
[Full Text]
-
Hertzberg, M., Aspeborg, H., Schrader, J., Andersson, A., Erlandsson, R., Blomqvist, K., Bhalerao, R., Uhlen, M., Teeri, T. T., Lundeberg, J., Sundberg, B., Nilsson, P., Sandberg, G.
(2001). A transcriptional roadmap to wood formation. Proc. Natl. Acad. Sci. USA
10.1073/pnas.261293398v1
[Abstract]
[Full Text]
-
Ceccarelli, E., Mann, C.
(2001). A Cdc28 Mutant Uncouples G1 Cyclin Phosphorylation and Ubiquitination from G1 Cyclin Proteolysis. J. Biol. Chem.
276: 41725-41732
[Abstract]
[Full Text]
-
Miller, M., Cross, F.
(2001). Cyclin specificity: how many wheels do you need on a unicycle?. J. Cell Sci.
114: 1811-1820
[Abstract]
-
Pike, B. L., Hammet, A., Heierhorst, J.
(2001). Role of the N-terminal Forkhead-associated Domain in the Cell Cycle Checkpoint Function of the Rad53 Kinase. J. Biol. Chem.
276: 14019-14026
[Abstract]
[Full Text]
-
Mongay, L., Plaza, S., Vigorito, E., Serra-Pages, C., Vives, J.
(2001). Association of the Cell Cycle Regulatory Proteins p45SKP2 and CksHs1. FUNCTIONAL EFFECT ON CDK2 COMPLEX FORMATION AND KINASE ACTIVITY. J. Biol. Chem.
276: 25030-25036
[Abstract]
[Full Text]
-
Hertzberg, M., Aspeborg, H., Schrader, J., Andersson, A., Erlandsson, R., Blomqvist, K., Bhalerao, R., Uhlen, M., Teeri, T. T., Lundeberg, J., Sundberg, B., Nilsson, P., Sandberg, G.
(2001). A transcriptional roadmap to wood formation. Proc. Natl. Acad. Sci. USA
98: 14732-14737
[Abstract]
[Full Text]
