Previous Article | Next Article ![]()
Molecular and Cellular Biology, August 2000, p. 5947-5959, Vol. 20, No. 16
Graduate Program in Cell Biology and
Genetics, Weill Graduate School of Medical Sciences, Cornell
University,1 and Program in Molecular
Biology, Memorial Sloan-Kettering Cancer
Center,2 New York, New York 10021
Received 31 March 2000/Returned for modification 4 May
2000/Accepted 18 May 2000
Increased translation of p27 mRNA correlates with withdrawal of
cells from the cell cycle. This raised the possibility that antimitogenic signals might mediate their effects on p27 expression by
altering complexes that formed on p27 mRNA, regulating its translation.
In this report, we identify a U-rich sequence in the 5' untranslated
region (5'UTR) of p27 mRNA that is necessary for efficient translation
in proliferating and nonproliferating cells. We show that a number of
factors bind to the 5'UTR in vitro in a manner dependent on the U-rich
element, and their availability in the cytosol is controlled in a
growth- and cell cycle-dependent fashion. One of these factors is HuR,
a protein previously implicated in mRNA stability, transport, and
translation. Another is hnRNP C1 and C2, proteins implicated in mRNA
processing and the translation of a specific subset of mRNAs expressed
in differentiated cells. In lovastatin-treated MDA468 cells, the
mobility of the associated hnRNP C1 and C2 proteins changed, and this
correlated with increased p27 expression. Together, these data suggest
that the U-rich dependent RNP complex on the 5'UTR may regulate the
translation of p27 mRNA and may be a target of antimitogenic signals.
The amount of p27 is a critical
determinant for the decision of cells in G1 to either
withdraw from or commit to the cell cycle and enter S phase. p27
inhibits cyclin E-cdk2 (56). This kinase is both necessary
and rate limiting for S-phase entry (42, 43, 50) and
increases threefold as G1 cells commit to DNA replication
(11, 28). Once activated in mid-G1, it triggers a positive feedback loop, both inactivating Rb (22, 26) and promoting p27 degradation (41, 55, 61), ultimately
culminating in the transition to S phase.
Small changes in the amount of p27 protein can have dramatic phenotypic
consequences: mice heterozygous for p27 have half the wild-type amount
of protein and display intermediate growth phenotypes (27).
Furthermore, carcinogen-induced tumor development is similar in p27
heterozygous mice and in animals completely lacking p27
(16). These consequences can be attributed to the role of
p27 as a mediator of antimitogenic signals (7, 9, 12, 45,
59). In the absence of p27, cells exposed to signals that induce
growth arrest fail to withdraw from the cell cycle in a timely fashion,
undergoing more mitotic divisions until other pathways mediate their
withdrawal from the cell cycle (7, 12, 59). The nature of
these collaborating or redundant pathways is not always clear; however,
other cdk inhibitors and the Rb-like protein p130 have been implicated
in fibroblasts, at least with regard to inactivation of cyclin E-cdk2
(9).
Regardless of the potential for redundancy, the failure of
p27 p27 protein is most abundant in G1 cells and decreases
precipitously as cells enter S phase, remaining low throughout the remainder of the cell cycle (35). The expression of p27 can be controlled at the levels of gene transcription (29),
translation (1, 23, 35), sequestration (57),
nuclear localization (58), and proteolysis (41,
44). Proteolysis of p27 is dependent on cdk2 (41, 55,
61) and possibly skp2 (6, 50, 60), which conspire to
regulate ubiquitin-dependent proteolytic degradation of p27, a
phenomenon that might insure irreversibility of the commitment
decision, as these proteins are activated or produced just prior to or
contemporaneously with the G1/S transition. A number of
groups have suggested that signals promoting growth arrest may act by
directly interfering with p27 proteolysis; however, the
cause-and-effect relationship is not entirely clear because p27
proteolysis is dependent on proteins and activities that occur once
cells are committed to S phase.
On the other hand, growth arrest is accompanied by an increase in the
translation of p27 mRNA above a basal state observed in asynchronous
cells. In quiescent tetradecanoyl phorbolacetate (TPA)-treated HL-60
cells, the synthesis of p27 protein is increased, correlating with an
increase in the amount of p27 mRNA associated with polysomes
(35). Likewise, the rate of p27 synthesis is increased in
cells arrested in mid-G1 by lovastatin (23).
Additionally, translation of p27 mRNA continues into S phase (and
presumably G2 phase), but proteolysis of the protein
prevents its accumulation (35). Thus, the translation rate
of p27 mRNA can vary in a signal-dependent manner: a basal rate in
growing cells and an elevated rate (induced) in growth-arrested cells.
The following observations prompted us to look at the translational
regulation of p27 mRNA as a mechanism contributing to growth arrest in
G1 cells. First, the steady-state amount of p27 is critical
to the commitment process, and this is the sum of the synthesis and
degradation rates. Second, since proteolysis is dependent on cdk2
activity and skp2, both of which appear following commitment to the
cell cycle, it would seem that they could not effectively control p27
accumulation in the early G1 cell, which is deciding
between proliferation and growth arrest. However, if translation could
be induced in a cell cycle phase-dependent manner, one would expect
that the change in synthesis rate might overcome the proteolytic
barrier and p27 would accumulate. In this report, we demonstrate that
p27 mRNA translation in both basal (proliferating) and induced
(nonproliferating) states requires a U-rich sequence in the 5'
untranslated region (5'UTR) of p27 mRNA. This sequence promotes
polysome association of the mRNA. Two proteins, designated p33 and
p40/41, in cytosolic extracts from asynchronous cells could be
cross-linked to the 5'UTR. These factors were enriched in
nocadazole-treated cells (G2/M arrest) and
lovastatin-treated cells (G1 arrest) compared to
hydroxyurea-treated cells (G1/S-phase arrest). We identify
p33 as HuR, which binds to the U-rich element independently of other
proteins, and p40/41 as hnRNP C1/C2. We discuss the cell
cycle-regulated formation of these RNPs in light of the role that
translational regulation of p27 may have in the response to
antimitogenic signals.
Cell culture and drug treatments.
HeLa S3 cells were
maintained in suspension culture in minimal Eagle's medium (MEM)
without Ca2+ and supplemented with 10% enriched calf serum
(Gemini). 293T cells were maintained in Dulbecco's modified Eagle's
medium (DME) supplemented with 4.5 g of glucose per liter (DME
HG), 2 mM glutamine, and 10% fetal bovine serum (FBS; Gemini). MDA468
cells were grown in a 1:1 mixture of DME HG and F12 plus nonessential
amino acids supplemented with 10% FBS and 2 mM glutamine. Nocodazole
(Sigma) and hydroxyurea (Sigma) were used at 2 µM for 12 h and 2 mM for 24 h, respectively, in all cell lines. Lovastatin (Merck)
was used at 30 µM for 48 h. Actinomycin D (Sigma) was used at 5 µg/ml.
Oligonucleotides.
The oligonucleotides used were SSM16
(5'GCTGTCCTTAAGAGCTATGGAAGTTTTCTT3'), SSM17
(5'CATTCAGCGGCCGCACAGCTCGAATTAAGAAT3'), SSM23 (5'GCTGTCGAATTCTCCTAGAGCTCGGGCCGT3'), T7SSM23
(5'TCCTAATACGACTCACTATAGGTCCTAGAGCTCGGGCCGT3'), SSM30
(5'CATTCAGGATCCCTTTCTCCCGGGTCTGCA3'), SSM31
(5'GCTGTCGGATCCATGGAAGACGCCAAAAAC3'), SSM32
(5'CATTCAGTATGCGGCCGCTTACAATTTGGACTTTCCGCC3'), SSM40
(5'GCGGTTCCATCCTCTAGAGGAT3'), SSM45
(5'GGACTCAGATCTTCGAGAT3'), SSM46
(5'CATTCAGCTAGCCCGAACAAAACAAAGCGC3'), SSM47
(5'CATTCAGCTAGCTGCAGACCCGGGAGAAAG3'), SSM48
(5'GTATTCCGCGTACGTGATGTTCA3'), SSM51
(5'CAGCGCAAGTGGAATGCCGATGCTCAGAATCACAAACCC3'), SSM52
(5'GGGTTTGTGATTCTGAGCATCGGCATTCCACTTGCGCTG3'), SSM53
(5'GCTGTCGGATCCATGTCAAACGTGCGAGTG3'), and SSM55
(5'CATTCAGTATGCGGCCGCTCAGTGGTGGTGGTGGTG3').
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A U-Rich Element in the 5' Untranslated Region Is
Necessary for the Translation of p27 mRNA
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
/
cells to respond appropriately to growth arrest
signals leads to disease. In luteal cells, the lack of p27 leads to a
perturbation of estradiol signaling following conception and prevents
embryo implantation (59). The organization of the ear,
specifically the ability to hear, also becomes compromised (8,
31), and p27-deficient animals develop tumors (10, 17, 27,
40, 45). Thus, an understanding of how the availability of p27 is controlled would impact our understanding of how tissue organization occurs and how cells communicate with each other.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(a gift from Henry Furneaux) linearized with
Sau3AI. It contains 80 nucleotides of coding sequence and 85 nucleotides of 3'UTR.
Isolation of human p27 5'UTR. Primers SSM23 and SSM30 were used to amplify sequences containing the 5'UTR from a genomic clone isolated from an EMBL3 SP6/T7 genomic library (Clontech). This PCR product was then cloned into the green fluorescent protein (GFP) and luciferase expression vectors as described below and sequenced using primers SSM40, SSM45, and SSM48 and GL primer 2 (Promega).
Antibodies.
Western blotting was performed as described
(57). The affinity-purified anti-p27 antibody has been
described (57). The 19F12 anti-HuR monoclonal antibody has
been described (H. Furneaux, submitted for publication). Antibodies to
cdk2 (M2; Santa Cruz Biotechnology),
-tubulin (T9026; Sigma), and
-galactosidase (Z378A; Promega) are commercially available.
Isolation of nuclear and cytoplasmic RNA and protein. Nuclear and cytoplasmic RNA was obtained as described (53). Nuclear and cytoplasmic protein extracts were prepared as described (62).
Construction of p27ck reporters.
The cyclin binding domain
mutant of human p27 PV
KK (32) was further mutated by
site-directed mutagenesis using SSM51 and SSM52 with the Quickchange
system (Stratagene). This generated an FDF
ADA mutation in the cdk
binding domain. The p27ck
mutant was then amplified by PCR using
primers SSM53 and SSM55 and directionally cloned into BamHI-
and NotI-digested pSVL vectors. All clones were confirmed by
direct sequencing.
Construction of luciferase reporters.
The reporters were
generated by subcloning the simian virus 40 (SV40) promoter
(nucleotides 22 to 239) from the pGL-2 promoter (Promega) directly into
the XhoI and HindIII sites of pEGFP-1 (Clontech) to create pSVG. The p27 5'UTR was amplified from a human
genomic clone by PCR using primers SSM23 and SSM30. The p27 3'UTR was
amplified from pB
5' p27 with primers SSM16 and SSM17. These products
were directionally cloned into pSVG. GFP sequences in the pSVG series
were replaced with a luciferase PCR product using primers SSM31 and
SSM32 and the pGL2 promoter vector. This created the pSVL series of
constructs. To generate clones with an SV40 polyadenylation signal, an
XhoI-NotI-digested pEGFP-1 vector was ligated to
and XhoI-AflII-digested pSVL insert.
Transfection assay.
For the transfection of HeLa cells, we
combined 8 × 106 cells with 10 µg of pSVL
construct, 5 µg of pCMV-
, and 5 µg of pCDNA3 (Invitrogen) in a
final volume of 800 µl in a 0.4-cm cuvette. Cells were electroporated
at 0.28 kV and 960 µF using a Bio-Rad electroporator and then plated
for 24 h before harvesting. 293T and MDA468 cells were transfected
using CaPO4 (Gibco-BRL) according to the manufacturer's
instructions. 293T cells were harvested 24 h after the
CaPO4 precipitate was washed off, and MDA468 were used
48 h afterwards.
RNase protection assay.
To generate a luciferase probe for
the RNase protection assay, we subcloned a
BamHI-NotI PCR product from pGL-2 promoter into pBluescript II (Clontech). This clone (pB-LUC) was digested with PacI and transcribed with T7 RNA polymerase (Gibco-BRL),
resulting in a 375-nucleotide antisense probe. For
-galactosidase,
we subcloned an AccI-NdeI (blunt) fragment of
pCMV-
(Clontech) to AccI- and SmaI-digested
pBluescript II. This clone (pB-
Acc-Nde) was digested with
AccI and transcribed with T7 RNA polymerase, resulting in a
249-nucleotide antisense transcript. The sizes of the protected luciferase and
-galactosidase transcripts detected in RNA from transfected cells were 325 and 193 nucleotides, respectively. RNase
protection was performed as described (51).
Polysome gradients. Continuous sucrose gradients (10 ml, 15 to 40%) were prepared and run as described previously (35), except for the following modifications. Each 1-ml fraction was collected directly into 120 µl of 8.3% sodium dodecyl sulfate (SDS) and 83 mM EDTA. Then 200 µg of proteinase K was added, and samples were incubated at 37°C for 15 min and extracted with phenol-chloroform.
EMSA and UV cross-linking assay. For the electrophoretic mobility shift assay (EMSA), 5'UTR RNA transcripts were prepared by PCR amplification of the appropriate pSVL template using T7SSM23 and SSM30 and transcribed using T7 RNA polymerase. Radiolabeled probes and glutathione S-transferase (GST)-HuR were prepared as described (24). The specific activity of each probe was 1 × 104 to 5 × 104 cpm/pmol.
Binding reactions using extracts as a source of protein were performed in a 20-µl volume containing 20 fmol of transcript, 15 µg of protein extract, 50 µg of tRNA, 50 mM Tris (pH 7.0), and 5 µg of bovine serum albumin. Reactions were performed essentially as described (24). For UV cross-linking experiments, following the incubation the binding reaction was irradiated at 1,200 µJ/cm2 in a Stratalinker (Stratagene). RNase A (Sigma) and RNase T1 (Calbiotech) were then added to 500 µg/ml and 250 U/ml, respectively, and incubated at 30°C for 15 min prior to SDS-polyacrylamide gel electrophoresis (PAGE).Purification of hnRNP C1/C2. HeLa nuclear extract (60 mg) was loaded onto a 5-ml HiTrap Q-Sepharose column and eluted with a 0.25 to 0.5 M linear KCl gradient. p40/41 activity eluted after the major protein peak at 0.4 M KCl. Pooled fractions from the Q column were loaded on a 1-ml methyl-Sepharose column and eluted with a linear gradient of 1 to 0 M (NH4)2SO4. p40/41 activity eluted at 0.45 M (NH4)2SO4. These fractions were pooled, loaded on a 1-ml HiTrap SP-Sepharose column, and eluted with a 0.05 to 1 M KCl gradient; the peak activity eluted at 0.45 M KCl. The Coomassie-stained p40 and p41 bands were excised for analysis by mass spectrometry fingerprinting (13).
| |
RESULTS |
|---|
|
|
|---|
A U-rich element in the 5'UTR of p27 mRNA facilitates polysome
association.
To better understand the translational regulation of
p27 and the role it plays during the cell cycle and growth arrest, we needed to first isolate the 5' and 3' UTRs of human p27. We obtained the 3'UTR sequence by defining a contig in the GenBank dbest database and sequenced overlapping clones on both strands (Fig.
1A). We obtained 5'UTR sequence by sequencing a genomic clone encoding the p27
locus (unpublished data). This sequence largely agreed with that
published by Minami and colleagues (36); the only exceptions
(indicated in Fig. 1A) are a T-to-C change and the absence of a G
nucleotide at positions 37 and 66/67, respectively. These differences could be due to polymorphisms or
sequencing errors. We reasoned that cis-acting regulatory
sequences might be in either the 5'UTR, the 3'UTR, or the open reading
frame (ORF) or any combination of these elements.
|
) (61). Transfection of 293T cells with
these constructs did not lead to an alteration in cell cycle
distribution (data not shown). Cells were cotransfected with a
-galactosidase expression vector to allow for normalization of p27
expression, and we examined the accumulation of p27 by immunoblotting
(Fig. 1B). Expression of protein from a construct containing both the
5' and 3' UTRs was nearly equivalent to that observed in the control
construct without any additional UTR sequences. From this point, we use
the phrase no UTR to represent the basal construct which contains the
UTR sequences provided by the expression vector but not additional p27
mRNA sequences. However, expression of p27ck
was greatly diminished
when the 3'UTR was present alone, and the 5'UTR alone could promote
expression. Thus, the 5'UTR can suppress or overcome the negative
effect of the 3'UTR on accumulation of p27ck
. This suggests that
there is a positive regulatory element in the 5'UTR. To determine if
the UTR-dependent effects required sequences in the ORF, we replaced
the p27 coding sequence with luciferase and repeated the analysis.
Similar UTR-dependent changes in luciferase expression were detected
when normalized for
-galactosidase. The 5'UTR was able to increase
luciferase expression 2- to 3-fold, whereas the 3'UTR inhibited
luciferase expression more than 10-fold. When both UTRs were present on
the luciferase reporter, the 5'UTR was able to suppress many of the
negative effects of the 3'UTR (Fig. 1C). The yield of each transcript
as measured by RNase protection was equivalent in all samples,
suggesting that the activity measurements do not reflect differences in
steady-state mRNA levels (Fig. 1C). This eliminated the possibility
that the sequences within the p27 ORF contributed to the UTR-dependent effects.
The steady-state amount of protein can be affected by a number of
factors: the rate of mRNA synthesis and export from the nucleus, the
stability of the mRNA in the cytosol, and the incorporation of the mRNA
into polysomes. To determine how the 5'UTR sequences affected the
accumulation and utilization of luciferase mRNA, we examined the amount
of mRNA in the cytosol, the half-life of cytosolic mRNA, and the
association of the mRNA in polysomes using the 5'-plus-3' UTR construct
and the 3'UTR construct alone (Fig. 2).
When normalized for the amount of
cotransfected
-galactosidase mRNA, the amount of mRNA in the cytosol
of transfected cells was equivalent for the two constructs (Fig. 2A),
suggesting that the accumulation of mRNA in the cytosol was not
affected in a UTR-dependent manner. We also did not observe any
significant UTR-dependent changes in the half-life of these messages in
the presence of actinomycin D. Endogenous c-myc mRNA had a
half-life of approximately 40 min in the same samples, confirming that
the drug treatment was effective (Fig. 2B). Actinomycin D incubations
as long as 12 h were also performed and revealed no UTR-specific
differences in mRNA half-life (data not shown). Thus, the accumulation
of luciferase as controlled by the 5' and 3' UTRs was likely due to
translational affects.
|
-galactosidase mRNA,
however, was not significantly different between these two populations
of cells (Fig. 2C). This firmly established that the 5'UTR contained
sequences that facilitated polysome association in cycling cells.
Next, we wanted to identify sequences in the 5'UTR that were
responsible for this positive effect and determine if they interact with proteins in a cell cycle phase-specific manner. Sequence comparisons of the 5'UTR from mouse, human, and rat (Fig.
3A) showed the presence of a highly
conserved U-rich element. Other conserved regions, notably those
between this element and the initiating methionine, were noted as well.
Inspection of the secondary structure of the 5'UTR (Fig. 3B) revealed
that the U-rich element could form into a loop surrounded by a stable
stem structure. Similar stem-loop structures have been implicated in
the regulation of translation initiation in ferritin and other mRNAs
(37, 38, 52). To test the significance of the U-rich loop,
we deleted the nucleotides that comprise the loop and a number of
additional nucleotides at the 3' end (underlined in Fig. 3A). The
removal of the 3' stem nucleotides was done to ensure complete
disruption of the stem-loop structure. In constructs either containing
or lacking the 3'UTR, deletion of the 5'UTR U-rich element reduced luciferase expression, even below that observed in the parental vector
(Fig. 3C). In all cases, the amount of mRNA and the half-life of the
mRNA were not significantly affected (data not shown). This indicated
that the U-rich element was required for effective translation of this
message, and in its absence either the sequence of the 5'UTR or the
structure formed by it was capable of inhibiting translation. From
these studies we concluded that the 5'UTR contained a U-rich element
that participated in the incorporation of p27 mRNA into polysomes in
cycling cells.
|
5'UTR binds complexes in a cell cycle phase-dependent manner.
Having defined a role for the 5'UTR in translation of p27 mRNA and
noting that the U-rich element participated, we next wanted to
determine if we could identify proteins that would interact with the
5'UTR in a U-rich element-dependent manner. We used an RNA EMSA to
determine whether protein complexes could form on the 5'UTR. We made
cytosolic extract from asynchronous cultures of 293T cells and
incubated them with a uniformly labeled 5'UTR transcript in the
presence of a 100,000-fold molar excess of nonspecific tRNA. A
slower-migrating complex was detected in asynchronous extracts (Fig.
4A). Under the conditions used,
approximately 50% of the RNA remains free (when binding is maximal,
i.e., with the G2-M extract), as determined by EMSA (Fig.
4A). As expected, increasing the amount of protein increased the amount
of RNA bound, but the specificity of interaction was compromised at
higher ratios of protein to transcript (data not shown).
|
p33 protein is HuR.
We next wanted to identify the proteins
that interacted with the U-rich element. Members of the ELAV family of
RNA binding proteins were candidates for a number of reasons. The size
of the cross-linked species was similar to the reported 36-kDa size of
HuR. There is evidence that the localization of HuR changes during the
cell cycle, becoming more cytosolic in G2 cells (Fig. 5A) (3), and that HuR can
shuttle between the nucleus and cytosol (14, 15, 46). In
addition, HuR has been implicated in regulating mRNA stability and
transport (18, 25, 30, 33, 39, 46) as well as translation
(2).
|
-globin transcript, whereas GST did not (Fig. 5C). Using deletion
analysis and binding assays, we identified a 42-nucleotide region
overlapping the U-rich element which was required for HuR binding (Fig.
5D, and unpublished data). An RNA encoding this 42-nucleotide region
effectively competed for HuR binding, whereas an irrelevant
oligoribonucleotide of similar base composition did not (Fig. 5E). This
indicated that HuR alone could bind to the U-rich sequences in the
5'UTR of p27. Together these data indicate that the 33-kDa species
associated with the p27 mRNA in a G2/M-phase-specific
manner is HuR. Furthermore, HuR binding to the 5'UTR site is not
dependent on other factors present in the cell extract. To our
knowledge, this is the first time a binding site for a mammalian ELAV
protein has been defined in the 5'UTR of an mRNA.
p40/41 is hnRNP C1/C2. To identify the p40/41 binding activity, we used ion-exchange chromatography and the UV cross-linking assay described above to purify these proteins. After determining the linear range of the assay, we defined 1 unit as 200 counts of cross-linking activity on a phosphorimager screen.
We were able to detect p40/41 binding activity in the cytoplasm of nocadozole-treated cells, but using EMSA and cross-linking we found that a 1 M NaCl extraction of HeLa nuclei had the highest specific activity (data not shown). Therefore, we used this as the starting material for purification. Preliminary binding studies suggested that p40/41 could be absorbed to and eluted from Q, methyl, and SP matrices; thus, we used these three columns to purify p40/41 binding activity from 60 mg of HeLa nuclear extract (Fig. 6A). This purification scheme resulted in a 141-fold purification of p40/41 (Fig. 6B). The SP fractions were run on SDS-PAGE gels and stained with silver (Fig. 6A) and Coomassie. A doublet migrating at 40 kDa cofractionated with p40/41 5'UTR binding activity. The Coomassie-stained p40 and p41 bands were excised for analysis by mass spectrometry fingerprinting (13).
|
Translation and formation of RNP complexes in growth-arrested
cells.
Having established above that RNP complexes containing HuR
and/or hnRNP C1/C2 would form on the 5'UTR, we next wanted to determine if these proteins were cytosolic and accessible to the p27 mRNA in
cells where translation of p27 mRNA is enhanced. We and others had
previously shown that the rate of p27 synthesis was increased in
growth-arrested cells compared to asynchronous populations or cells in
S phase (1, 23, 35). Using MDA468 cells, we observed
lovastatin-induced accumulation of G1 cells and a reduction in S-phase cells, correlating with accumulation of p27 (Fig. 7A and
B). this increase could be due to both
suppression of proteolysis (49) and increased translation
(23). To focus on the translational control mechanism, we
first examined the expression of luciferase from the UTR-dependent
reporters. Lovastatin enhanced expression from the 5'UTR in a manner
dependent on the U-rich element, indicating that this element was
required for expression in growth-arrested cells (Fig. 7C).
|
| |
DISCUSSION |
|---|
|
|
|---|
Since its first description by three independent groups in late 1996 and early 1997, remarkably little attention has been paid to the translational regulation of p27. This is surprising since this mode of regulation corresponds best with the role of p27 in growth arrest. In lovastatin-treated cells (23), confluence-arrested BALB/c 3T3 cells (1), and TPA-treated HL-60 cells (35), the accumulation of p27 was attributed to changes in the rate of synthesis, not to changes in the rate of degradation. From studies of PDGF-induced cell cycle reentry of BALB/c 3T3 cells, it appeared that translation was inhibited as cells acquired competence to enter the cell cycle, but that the further reduction in p27 as cells entered S phase was due to proteolysis. This was consistent with the findings in HL-60 cells: there was an increase in the amount of p27 mRNA associated with polysomes in G0 cells compared to G1 cells. The rate of p27 proteolysis was the same in G0 and G1 cells but increased as cells entered S phase.
Three major conclusions can be drawn from this work. First, the U-rich element located in the 5'UTR of p27 mRNA is necessary in both cycling and noncycling cells for efficient translation. Second, this element interacts with HuR and hnRNP C1/C2 in a cell cycle phase-specific manner. Third, an induction of modified hnRNP C1/C2 complexes on the 5'UTR correlates with an induction of p27 translation.
The U-rich element in the 5'UTR of p27 provides a high-affinity binding site for HuR (Kd, ~10 nM; data not shown). This is the first report of a mammalian ELAV protein binding to the 5'UTR of an mRNA; however, similar interactions have been observed in lower metazoans. In Drosophila melanogaster, sex-lethal (sxl), another ELAV family member, binds to the 5'UTR of the male-specific lethal (msl2) transcript in female flies (4). In this system, sxl negatively regulates translation of the msl2 transcript (4, 19). In mammalian cells, HuR has been implicated in regulating mRNA stability through 3'UTR AU-rich sequences (46). Antic and colleagues have also shown that Hel-N1, a neuron-specific ELAV family member, regulates translation of neurofilament M mRNA, presumably through a 3'UTR binding site (2). These data together suggest that cytoplasmic HuR may regulate translation of specific mRNAs. Attempts to modulate HuR expression and correlate this to p27 expression have not been successful. However, we have never been able to completely eliminate the expression of HuR in cells (unpublished data). This indicates that HuR might not be a limiting component of the complex. An attractive possibility is that HuR binding might facilitate changes in the UTR structure that may allow recruitment of other proteins.
We have also identified hnRNP C1/C2 as p27 5'UTR binding proteins. These proteins are abundant nuclear factors that are thought to be involved in mRNA processing (21). The C proteins have also been implicated in translational regulation of c-sis mRNA, which contains an internal ribosome entry site that is induced in differentiated cells (54). Thus, these proteins may have signal-dependent cytoplasmic roles that modulate translation of specific mRNAs. We detect C-protein binding activity in G2/M-arrested cells and a modified form of this activity in cells that have induced p27 translation. The binding of these factors to the 5'UTR is dependent on the U-rich element, providing a strong link between binding and translation. However, until we develop a cell-free cell cycle phase-specific translation extract, not dependent on rabbit reticulocyte lysate, we are unable to directly examine the role of hnRNP C1/C2 or HuR in the translation of p27 mRNA.
Furthermore, it should be noted that the proteins that we observed cross-linked to the 5'UTR are likely to be only a subset of proteins in a larger RNP complex, most of which may not even contact the RNA in a manner allowing radiolabel transfer. The exact phase of the cell cycle during which these binding activities become cytoplasmic is unclear. We could detect these activities in asynchronous cell extracts as well as in extracts from G2/M cells isolated by centrifugal elutriation (data not shown). However, the magnitude of the 5'UTR binding activities in these extracts was reduced compared to that of nocodazole-treated cells. This suggests that there may be a very specific window of time in which these interactions could occur. We propose that these 5'UTR binding activities may persist, perhaps due to nuclear membrane breakdown, from G2/M through early G1. This would be an ideal time frame for p27 mRNA to be receptive to signals that induce its translation.
Finally, with the exception of ferritin mRNA (52), there is very little information on how UTR binding proteins can affect induced translation. Further studies on the p27 mRNA will provide a counterpoint to that experimental system. In contrast, there is extensive knowledge of proteins involved in the basal translation machinery and how these interact to regulate translation. Our previous work and the results presented here identified cell cycle-regulated changes in p27 translation, mapped sequences involved in this to the 5'UTR, and begun to identify some of the proteins which interact with these sequences. This should provide the foundation for developing appropriate in vitro systems that will allow further mechanistic analysis of induced translation and the roles of these proteins in that process and, importantly, as a function of cell cycle status.
| |
ACKNOWLEDGMENTS |
|---|
We thank James Roberts (FHCRC, Seattle, Wash.), Ken Marians
(MSKCC), and Gino Vairo (AMRAD, Australia) and members of the laboratory for discussions during completion of these studies and
comments on the manuscript. We thank Henry Furneaux (MSKCC) and Myriam
Gorospe (National Institute of Aging, NIH) for sharing unpublished data
and results with HuR reduction experiments. We thank Serafin
Pinol-Roma (Mt. Sinai, New York, N.Y.), Stacy Blain (MSKCC), and
Merck for their generosity with the 4F4 hnRNP C1/C2 antibody, the
p27ck
construct, and lovastatin, respectively. We thank Paul Tempst
(MSKCC) and the protein sequencing facility for mass fingerprinting
p40/41.
This work was supported by funds from the National Institutes of Health (GM52597, A.K.) and the National Cancer Institute (Cancer Center grant CA08748 to Memorial Sloan-Kettering Cancer Center). A.V. is supported by an FPI fellowship of the Spanish Ministry for Education and Culture. A.K. is a Pew Scholar in Biomedical Sciences, an Irma T. Hirschl Scholar, and the incumbent of the Frederick R. Adler Chair for Junior Faculty at Memorial Sloan-Kettering Cancer Center.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: RRL917D, Box 207, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. Phone: (212) 639-2354. Fax: (212) 639-2861. E-mail: a-koff{at}ski.mskcc.org.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Agrawal, D., P. Hauser, F. McPherson, F. Dong, A. Garcia, and W. J. Pledger. 1996. Repression of p27kip1 synthesis by platelet-derived growth factor in BALB/c 3T3 cells. Mol. Cell. Biol. 16:4327-4336[Abstract]. |
| 2. |
Antic, D.,
N. Lu, and J. D. Keene.
1999.
ELAV tumor antigen, Hel-N1, increases translation of neurofilament M mRNA and induces formation of neurites in human teratocarcinoma cells.
Genes Dev.
13:449-461 |
| 3. | Atasoy, U., J. Watson, D. Patel, and J. D. Keene. 1998. ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and is upregulated during serum stimulation and T cell activation. J. Cell Sci. 111:3145-3156[Abstract]. |
| 4. | Bashaw, G. J., and B. S. Baker. 1997. The regulation of the Drosophila msl-2 gene reveals a function for Sex-lethal in translational control. Cell 89:789-798[CrossRef][Medline]. |
| 5. |
Burd, C. G.,
M. S. Swanson,
M. Gorlach, and G. Dreyfuss.
1989.
Primary structures of the heterogeneous nuclear ribonucleoprotein A2, B1, and C2 proteins: a diversity of RNA binding proteins is generated by small peptide inserts.
Proc. Natl. Acad. Sci. USA
86:9788-9792 |
| 6. | Carrano, A. C., E. Eytan, A. Hershko, and M. Pagano. 1999. SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat. Cell Biol. 1:193-199[CrossRef][Medline]. |
| 7. |
Casaccia-Bonnefil, P.,
R. Tikoo,
H. Kiyokawa,
V. Friedrich, Jr.,
M. V. Chao, and A. Koff.
1997.
Oligodendrocyte precursor differentiation is perturbed in the absence of the cyclin-dependent kinase inhibitor p27Kip1.
Genes Dev.
11:2335-2346 |
| 8. | Chen, P., and N. Segil. 1999. p27(Kip1) links cell proliferation to morphogenesis in the developing organ of Corti. Development 126:1581-1590[Abstract]. |
| 9. | Coats, S., P. Whyte, M. L. Fero, S. Lacy, G. Chung, E. Randel, E. Firpo, and J. M. Roberts. 1999. A new pathway for mitogen-dependent cdk2 regulation uncovered in p27(Kip1)-deficient cells. Curr. Biol. 9:163-173[CrossRef][Medline]. |
| 10. |
Cordon-Cardo, C.,
A. Koff,
M. Drobnjak,
P. Capodieci,
I. Osman,
S. S. Millard,
P. B. Gaudin,
M. Fazzari,
Z. F. Zhang,
J. Massague, and H. I. Scher.
1998.
Distinct altered patterns of p27KIP1 gene expression in benign prostatic hyperplasia and prostatic carcinoma.
J. Natl. Cancer Inst.
90:1284-1291 |
| 11. |
Dulic, V.,
E. Lees, and S. I. Reed.
1992.
Association of human cyclin E with a periodic G1-S phase protein kinase.
Science
257:1958-1961 |
| 12. | Durand, B., M. L. Fero, J. M. Roberts, and M. C. Raff. 1998. p27Kip1 alters the response of cells to mitogen and is part of a cell-intrinsic timer that arrests the cell cycle and initiates differentiation. Curr. Biol. 8:431-440[CrossRef][Medline]. |
| 13. | Erdjument-Bromage, H. L. M., A. Grewal, R. S. Annan, D. E. McNulty, S. A. Carr, and P. Tempst. 1998. Examination of micro-tip reversed-phase liquid chromatographic extraction of peptide pools for mass spectrometric analysis. J. Chromatogr. A 826:167-181[CrossRef][Medline]. |
| 14. |
Fan, X. C., and J. A. Steitz.
1998.
HNS, a nuclear-cytoplasmic shuttling sequence in HuR.
Proc. Natl. Acad. Sci. USA
95:15293-15298 |
| 15. | Fan, X. C., and J. A. Steitz. 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17:3448-3460[CrossRef][Medline]. |
| 16. | Fero, M. L., E. Randel, K. E. Gurley, J. M. Roberts, and C. J. Kemp. 1998. The murine gene p27Kip1 is haplo-insufficient for tumour suppression. Nature 396:177-180[CrossRef][Medline]. |
| 17. | Fero, M. L., M. Rivkin, M. Tasch, P. Porter, C. E. Carow, E. Firpo, K. Polyak, L. H. Tsai, V. Broudy, R. M. Perlmutter, K. Kaushansky, and J. M. Roberts. 1996. A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell 85:733-744[CrossRef][Medline]. |
| 18. |
Ford, L. P.,
J. Watson,
J. D. Keene, and J. Wilusz.
1999.
ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system.
Genes Dev.
13:188-201 |
| 19. | Gebauer, F., L. Merendino, M. W. Hentze, and J. Valcarcel. 1998. The Drosophila splicing regulator sex-lethal directly inhibits translation of male-specific-lethal 2 mRNA. RNA 4:142-150[Abstract]. |
| 20. | Ghosh, P. M., M. L. Moyer, G. E. Mott, and J. I. Kreisberg. 1999. Effect of cyclin E overexpression on lovastatin-induced G1 arrest and RhoA inactivation in NIH3T3 cells. J. Cell Biochem. 74:532-543[CrossRef][Medline]. |
| 21. |
Gorlach, M.,
C. G. Burd, and G. Dreyfuss.
1994.
The determinants of RNA-binding specificity of the heterogeneous nuclear ribonucleoprotein C proteins.
J. Biol. Chem.
269:23074-23078 |
| 22. | Hatakeyama, M., and R. A. Weinberg. 1995. The role of RB in cell cycle control. Prog. Cell Cycle Res. 1:9-19[Medline]. |
| 23. | Hengst, L., and S. I. Reed. 1996. Translational control of p27Kip1 accumulation during the cell cycle. Science 271:1861-1864[Abstract]. |
| 24. |
Joseph, B.,
M. Orlian, and H. Furneaux.
1998.
p21(waf1) mRNA contains a conserved element in its 3'-untranslated region that is bound by the Elav-like mRNA-stabilizing proteins.
J. Biol. Chem.
273:20511-20516 |
| 25. |
Keene, J. D.
1999.
Why is Hu where? Shuttling of early-response-gene messenger RNA subsets.
Proc. Natl. Acad. Sci. USA
96:5-7 |
| 26. |
Kelly, B. L.,
K. G. Wolfe, and J. M. Roberts.
1998.
Identification of a substrate-targeting domain in cyclin E necessary for phosphorylation of the retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
95:2535-2540 |
| 27. | Kiyokawa, H. K. R., K. O. Manova-Todorova, V. C. Soares, E. Hoffman, M. Ono, D. Khanam, A. C. Hayday, L. A. Frohman, and A. Koff. 1996. Enhanced growth of mice lacking the cyclin-dependent kinase inhibitor function of p27Kip1. Cell 85:721-732[CrossRef][Medline]. |
| 28. |
Koff, A.,
A. Giordano,
D. Desai,
K. Yamashita,
J. W. Harper,
S. Elledge,
T. Nishimoto,
D. O. Morgan,
B. R. Franza, and J. M. Roberts.
1992.
Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle.
Science
257:1689-1694 |
| 29. |
Kolluri, S. K.,
C. Weiss,
A. Koff, and M. Gottlicher.
1999.
p27(Kip1) induction and inhibition of proliferation by the intracellular Ah receptor in developing thymus and hepatoma cells.
Genes Dev.
13:1742-1753 |
| 30. |
Levy, N. S.,
S. Chung,
H. Furneaux, and A. P. Levy.
1998.
Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR.
J. Biol. Chem.
273:6417-6423 |
| 31. |
Lowenheim, H.,
D. N. Furness,
J. Kil,
C. Zinn,
K. Gultig,
M. L. Fero,
D. Frost,
A. W. Gummer,
J. M. Roberts,
E. W. Rubel,
C. M. Hackney, and H. P. Zenner.
1999.
Gene disruption of p27(Kip1) allows cell proliferation in the postnatal and adult organ of corti.
Proc. Natl. Acad. Sci. USA
96:4084-4088 |
| 32. | Luo, Y., J. Hurwitz, and J. Massague. 1995. Cell-cycle inhibition by independent CDK and PCNA binding domains in p21Cip1. Nature 375:159-161[CrossRef][Medline]. |
| 33. |
Ma, W. J.,
S. Cheng,
C. Campbell,
A. Wright, and H. Furneaux.
1996.
Cloning and characterization of HuR, a ubiquitously expressed Elav-like protein.
J. Biol. Chem.
271:8144-8151 |
| 34. | Mathews, D. H., J. Sabina, M. Zuker, and D. H. Turner. 1999. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288:911-940[CrossRef][Medline]. |
| 35. |
Millard, S. S.,
J. S. Yan,
H. Nguyen,
M. Pagano,
H. Kiyokawa, and A. Koff.
1997.
Enhanced ribosomal association of p27(Kip1) mRNA is a mechanism contributing to accumulation during growth arrest.
J. Biol. Chem.
272:7093-7098 |
| 36. | Minami, S., N. Ohtani-Fujita, E. Igata, T. Tamaki, and T. Sakai. 1997. Molecular cloning and characterization of the human p27Kip1 gene promoter. FEBS Lett. 411:1-6[CrossRef][Medline]. |
| 37. |
Mizokami, A., and C. Chang.
1994.
Induction of translation by the 5'-untranslated region of human androgen receptor mRNA.
J. Biol. Chem.
269:25655-25659 |
| 38. | Mosner, J., T. Mummenbrauer, C. Bauer, G. Sczakiel, F. Grosse, and W. Deppert. 1995. Negative feedback regulation of wild-type p53 biosynthesis. EMBO J. 14:4442-4449[Medline]. |
| 39. | Myer, V. E., X. C. Fan, and J. A. Steitz. 1997. Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J. 16:2130-2139[CrossRef][Medline]. |
| 40. | Nakayama, K. I. N., M. Shirane, A. Inomata, T. Inoue, N. Shishido, I. Horii, D. Y. Loh, and K. I. Nakayama. 1996. Mice lacking p27Kip1 display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell 85:707-720[CrossRef][Medline]. |
| 41. |
Nguyen, H.,
D. M. Gitig, and A. Koff.
1999.
Cell-free degradation of p27kip1, a G1 cyclin-dependent kinase inhibitor, is dependent on CDK2 activity and the proteasome.
Mol. Cell. Biol.
19:1190-1201 |
| 42. |
Ohtsubo, M., and J. M. Roberts.
1993.
Cyclin-dependent regulation of G1 in mammalian fibroblasts.
Science
259:1908-1912 |
| 43. | Ohtsubo, M., A. M. Theodoras, J. Schumacher, J. M. Roberts, and M. Pagano. 1995. Human cyclin E, a nuclear protein essential for the G1-to-S phase transition. Mol. Cell. Biol. 15:2612-2624[Abstract]. |
| 44. |
Pagano, M.,
S. W. Tam,
A. M. Theodoras,
P. Beer-Romero,
G. Del Sal,
V. Chau,
P. R. Yew,
G. F. Draetta, and M. Rolfe.
1995.
Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27.
Science
269:682-685 |
| 45. |
Park, M. S.,
J. Rosai,
H. T. Nguyen,
P. Capodieci,
C. Cordon-Cardo, and A. Koff.
1999.
p27 and Rb are on overlapping pathways suppressing tumorigenesis in mice.
Proc. Natl. Acad. Sci. USA
96:6382-6387 |
| 46. | Peng, S. S., C. Y. Chen, N. Xu, and A. B. Shyu. 1998. RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 17:3461-3470[CrossRef][Medline]. |
| 47. |
Pinol-Roma, S., and G. Dreyfuss.
1993.
Cell cycle-regulated phosphorylation of the pre-mRNA-binding (heterogeneous nuclear ribonucleoprotein) C proteins.
Mol. Cell. Biol.
13:5762-5770 |
| 48. | Portman, D. S., and G. Dreyfuss. 1994. RNA annealing activities in HeLa nuclei. EMBO J. 13:213-221[Medline]. |
| 49. |
Rao, S.,
D. C. Porter,
X. Chen,
T. Herliczek,
M. Lowe, and K. Keyomarsi.
1999.
Lovastatin-mediated G1 arrest is through inhibition of the proteasome, independent of hydroxymethyl glutaryl-CoA reductase.
Proc. Natl. Acad. Sci. USA
96:7797-7802 |
| 50. |
Resnitzky, D.,
M. Gossen,
H. Bujard, and S. I. Reed.
1994.
Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system.
Mol. Cell. Biol.
14:1669-1679 |
| 51. | Richon, V. M., and G. Venta-Perez. 1996. Changes in E2F DNA-binding activity during induced erythroid differentiation. Cell Growth Differ. 7:31-42[Abstract]. |
| 52. | Rouault, T. A., R. D. Klausner, and J. B. Harford. 1996. Translational control of ferritin, p. 335-362. In Translational control monograph. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 53. |
Rousseau, D.,
R. Kaspar,
I. Rosenwald,
L. Gehrke, and N. Sonenberg.
1996.
Translation initiation of ornithine decarboxylase and nucleocytoplasmic transport of cyclin D1 mRNA are increased in cells overexpressing eukaryotic initiation factor 4E.
Proc. Natl. Acad. Sci. USA
93:1065-1070 |
| 54. |
Sella, O.,
G. Gerlitz,
S. Y. Le, and O. Elroy-Stein.
1999.
Differentiation-induced internal translation of c-sis mRNA: analysis of the cis elements and their differentiation-linked binding to the hnRNP C protein.
Mol. Cell. Biol.
19:5429-5440 |
| 55. |
Sheaff, R. J.,
M. Groudine,
M. Gordon,
J. M. Roberts, and B. E. Clurman.
1997.
Cyclin E-CDK2 is a regulator of p27Kip1.
Genes Dev.
11:1464-1478 |
| 56. |
Sherr, C. J., and J. M. Roberts.
1999.
CDK inhibitors: positive and negative regulators of G1-phase progression.
Genes Dev.
13:1501-1512 |
| 57. | Soos, T. J., H. Kiyokawa, J. S. Yan, M. S. Rubin, A. Giordano, A. DeBlasio, S. Bottega, B. Wong, J. Mendelsohn, and A. Koff. 1996. Formation of p27-CDK complexes during the human mitotic cell cycle. Cell Growth Differ. 7:135-146[Abstract]. |
| 58. | Soucek, T., G. Holzl, G. Bernaschek, and M. Hengstschlager. 1998. A role of the tuberous sclerosis gene-2 product during neuronal differentiation. Oncogene 16:2197-2204[CrossRef][Medline]. |
| 59. | Tong, W., H. Kiyokawa, T. J. Soos, M. S. Park, V. C. Soares, K. Manova, J. W. Pollard, and A. Koff. 1998. The absence of p27Kip1, an inhibitor of G1 cyclin-dependent kinases, uncouples differentiation and growth arrest during the granulosa->luteal transition. Cell Growth Differ. 9:787-794[Abstract]. |
| 60. | Tsvetkov, L. M., K. H. Yeh, S. J. Lee, H. Sun, and H. Zhang. 1999. p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr. Biol. 9:661-664[CrossRef][Medline]. |
| 61. | Vlach, J., S. Hennecke, and B. Amati. 1997. Phosphorylation-dependent degradation of the cyclin-dependent kinase inhibitor p27Kip1. EMBO J. 16:5334-5344[CrossRef][Medline]. |
| 62. |
Wang, W.,
H. Furneaux,
H. Cheng,
M. C. Caldwell,
D. Hutter,
Y. Liu,
N. Holbrook, and M. Gorospe.
2000.
HuR regulates p21 mRNA stabilization by UV light.
Mol. Cell. Biol.
20:760-769 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»