Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 5998-6007, Vol. 20, No. 16
0270-7306/00/$04.00+0
Separation of Membrane Trafficking and Actin
Remodeling Functions of ARF6 with an Effector Domain Mutant
Omayma
Al-Awar,
Harish
Radhakrishna,
Natasha N.
Powell, and
Julie G.
Donaldson*
Laboratory of Cell Biology, National Heart,
Lung, and Blood Institute, National Institutes of Health, Bethesda,
Maryland 20892
Received 21 December 1999/Returned for modification 9 February
2000/Accepted 15 May 2000
 |
ABSTRACT |
The ADP-ribosylation factor 6 (ARF6) GTPase has a dual function in
cells, regulating membrane traffic and organizing cortical actin. ARF6
activation is required for recycling of the endosomal membrane back
to the plasma membrane (PM) and also for ruffling at the
PM induced by Rac. Additionally, ARF6 at the PM induces the formation
of actin-containing protrusions. To identify sequences in ARF6 that are
necessary for these distinct functions, we examined the behavior of a
chimeric protein of ARF1 and ARF6. The 1-6 chimera (with the amino half
of ARF1 and the carboxyl half of ARF6) localized like ARF6 in HeLa
cells and moved between the endosome and PM, but it did not form
protrusions, an ARF6 effector function. Two residues in the
amino-terminal half of ARF6, Q37 and S38, when substituted into the
1-6 chimera allowed protrusion formation, whereas removal of these
residues from ARF6 resulted in an inability to form protrusions.
Interestingly, expression of 1-6 in cells selectively inhibited
protrusions induced by wild-type ARF6 but had no effect on
ARF6-regulated membrane movement or Rac-induced ruffling. Thus, we have
uncoupled two functions of ARF6, one involved in membrane trafficking,
which is necessary for Rac ruffling, and another involved in protrusion formation.
 |
INTRODUCTION |
The ADP-ribosylation factor (ARF)
family of proteins is a subgroup of the Ras superfamily of small
GTP-binding proteins. Originally identified and named for
their ability to serve as cofactors in the cholera
toxin-catalyzed ADP-ribosylation of the alpha subunit of Gs
(25), ARFs have been shown to function in various
membrane trafficking events and in the maintenance of organelle
structure (8, 33). ARFs have been identified in numerous
eukaryotic organisms, and ARF proteins are divided into three classes
based on size, amino acid sequence (deduced from cDNA sequences),
phylogenetic analysis, and gene structure (34, 44). Class I
contains mammalian ARF1, -2, and -3 and yeast yArf1 and -2, class II
includes mammalian ARF4 and ARF5, and class III includes
mammalian ARF6, yeast yArf3, and Drosophila ARF3. Like all
GTPases, ARFs exist in either an active, GTP-bound
form or an inactive, GDP-bound form. Conversion between these two forms
is mediated by guanine nucleotide exchange factors (GEFs) and
GTPase-activating proteins (GAPs), which facilitate GTP exchange and hydrolysis, respectively. Although numerous
ARF GEFs and GAPs have been identified in recent years, in many cases their specificity for a particular ARF and their cellular localization remain to be elucidated (34, 39).
Mammalian ARF1 and ARF6 are the least similar in amino acid sequence
and the best-characterized members of the ARF family. They have been
found to be expressed in all tissues and cell types examined (6,
42, 44, 46). Although both ARF1 and ARF6 have been shown to
activate phospholipase D (PLD) in vitro (5, 9, 30), the
localizations and functions of these ARFs in vivo are distinct (6,
35, 42). ARF1 is primarily localized to the Golgi complex, where
it regulates the assembly of cytosolic coat proteins (COPI and AP
adapters) and serves to regulate membrane traffic in the endoplasmic
reticulum-Golgi system (29). ARF6, by contrast, localizes to
a novel, membrane recycling system at the cell periphery. ARF6 is
associated with a tubular endosomal compartment in its inactive
GDP-bound form and with the plasma membrane (PM) in its active,
GTP-bound form, and it regulates the membrane movement
between these two compartments through its GTPase cycle
(12, 14, 35, 37). ARF6 has also been implicated in the
regulation of exocytosis of chromaffin granules (19) and
recently in insulin stimulation of Glut 4 translocation
(32). In HeLa cells, the endosomal recycling pathway is
involved in the internalization and recycling of PM-associated proteins
that are not taken up into cells by clathrin-mediated mechanisms; among the proteins that traffic through this pathway are major
histocompatibility complex class I antigens (37) and Rac1
(38). In addition to this trafficking function,
ARF6-GTP at the PM is associated with the formation of
actin-containing protrusions (36). Furthermore, ARF6
activation is required for various processes that involve actin
rearrangements such as cell spreading (41),
Rac-mediated membrane ruffling (38), and Fc-mediated
phagocytosis (48). Whether these actin
rearrangements require the membrane trafficking function of ARF6 or
the actin remodeling function of ARF6 is not clear.
We have been studying the function of ARF6 in whole cells by modulating
its GTPase cycle through expression of mutant forms of ARF6
and also through the use of pharmacological reagents that induce mutant
phenotypes in cells expressing wild-type ARF6. Expression of the
dominant negative mutant of ARF6, T27N, in cells inhibits the
ARF6-dependent movement of membrane from the endosomal compartment to
the PM (37) and also inhibits cell spreading (42)
and Rac-mediated ruffling (38). This phenotype is mimicked
by treatment of cells expressing wild-type ARF6 with inhibitors of
actin polymerization, such as cytochalasin D (CD). As with ARF1
(15, 31), treatment of cells overexpressing ARF6 with
aluminum fluoride (AlF), a known activator of heterotrimeric G
proteins, appears to maintain the protein in the active
GTP-bound form. This results in the accumulation of
ARF6-GTP at the PM, and the formation of actin-rich
protrusions (36). Although this is an overexpression
phenotype observed acutely with AlF treatment, these protrusions
resemble those formed in untransfected HeLa cells during cell
spreading, a process that requires ARF6 function (42).
Studies with the ARF nucleotide binding site opener and the exchange
factor for ARF6, candidate GEFs for ARF6, also report alterations of
cortical actin after recruitment of these GEFs and ARF6 to the PM
(16, 17).
In this study we were interested in identifying sequences in ARF6 that
determine its specificity and distinguish it from other ARF proteins.
Previous studies of ARF1 have identified regions in the amino-terminal
half of the protein required for coat protein binding (28)
and PLD activation (23, 28, 33). Interestingly, an amino
acid residue (N52) in the switch I region, shown to be critical for
activation of PLD (23), is conserved in all ARF proteins. To
begin to understand the mechanism whereby ARF6 carries out cellular
roles that are distinct from those of other ARFs, we set out to map
sequences in ARF6 that confer on the molecule the ability to couple to
effector functions. Following an approach that has been used by
investigators studying Rab and Rho functions (7, 11, 18), we
made chimeric ARFs by exchanging the amino- and carboxy-terminal halves
of ARF1 and ARF6 and expressed them in HeLa cells. Here we report that
the 1-6 chimera has sufficient information for targeting to ARF6
compartments and interacting with ARF6 GEFs, and yet it cannot form
protrusions. Studies with this chimera have enabled us to identify
residues in ARF6 near the ARF equivalent of the Ras effector loop that
are required for protrusion formation but not for ARF6 regulation of
membrane trafficking.
 |
MATERIALS AND METHODS |
Cells and reagents.
HeLa cells were maintained in
Dulbecco's modified Eagle's medium supplemented with 10% fetal
bovine serum (FBS), 100 IU of penicillin/ml, and 100 mg of
streptomycin/ml at 37°C with 5% CO2. Brefeldin A (BFA)
was obtained from Epicentre Technologies (Madison, Wis.), stored at
20°C as a stock solution of 2 mg/ml in methanol, and used at a
final concentration of 2 µg/ml. Rhodamine-phalloidin was obtained
from Molecular Probes, Inc. (Eugene, Oreg.) and Sigma Chemical Co. (St.
Louis, Mo.). All other reagents were purchased from Sigma Chemical Co.
Antibodies.
For immunofluorescence localization of untagged
ARF6, the 1-6 chimera, and their mutants, we used rabbit polyclonal
antisera raised against a C-terminal peptide of ARF6, as described
previously (42). ARF6 fused to the influenza hemagglutinin
(HA) epitope at its C-terminal end was localized using a mouse antibody
(12CA5) against the HA epitope, purchased from BAbCo (Berkeley,
Calif.). For immunofluorescence localization of Rac1, we used a mouse
antibody against the nine-amino-acid epitope tag (MEYMPMEHM), which was the gift of C. J. Der (University of North Carolina, Chapel Hill). The mouse anti-Tac antibody used was the 7G7 hybridoma (40). Rhodamine- and fluorescein-labeled donkey anti-mouse and donkey anti-rabbit immunoglobulin G (IgG) were purchased from Jackson ImmunoResearch Laboratories (West Grove, Pa.).
DNA manipulations.
The cDNAs of wild-type, chimera, and
mutant genes were subcloned into the modified pCDL-SR
expression
vector (pXS) (43). In HeLa cells, this expression vector
results in protein expression levels for ARF6 that are between 20- and
50-fold higher than endogenous protein expression (35).
The 1-6 chimera and site-specific mutations of it and of ARF6 were
created by a two-step PCR procedure (2). For all PCRs, AmpliTaq DNA polymerase (Perkin-Elmer, Branchburg, N.J.) was used. PCR
products and restriction fragments were purified by excising the
appropriate bands from an agarose gel and recovering them with the
QIAquick gel extraction kit (Qiagen, Santa Clarita, Calif.). Restriction enzymes and T4 DNA ligase were obtained from New England Biolabs (Beverly, Mass.).
The following oligonucleotides were used as primers (those in plain
type are ARF1 sequences, those in boldface type are ARF6 sequences,
underlined residues are mutation sites, and restriction sites are
italicized): A1-5', 5'AACAGAATTCATGGGGAACATCTTCGC3'; A6-5', 5'AACAGAATTCATGGGGAAGGTGCTATCC3';
A6-3',
5'CCCAGATCTTCAAGATTTGTAGTTAGAGGTTAAC3'; 1/6-A, 5'CTCCTGGCGAGCCTCATCCACACGCTCTCTGTCATTG3';
1/6-B, 5'GCCGACCGCGACCGCATCAACGAGGCCCGTGAGGAG3';
A1QS-A,
5'GGGAATGGTGGTCACGCTTTGACCCAGCTTCAG3'; A1QS-B,
5'AAACTGAAGCTGGGTCAAAGCGTGACCACCATTC3';
A6EI-A,
5'GGGAATGGTGGTCACGATCTCGCCCAGCTTCAA3'; and A6EI-B,
5'AAGTTGAAGCTGGGCGAGATCGTGACCACCATTCCC3'.
The 1-6 chimera was constructed by fusing the N-terminal 300 bp of ARF1
to the C-terminal 237 bp of ARF6. The N-terminal portion of ARF1 was
amplified using primers A1-5' and 1/6-A, and the C-terminal portion of
ARF6 was amplified using primers 1/6-B and A6-3'. The EcoRI-BglII fragment of the final PCR product was
cloned into pXS.
The 1-6(T31N) chimera was constructed by fusing the N-terminal 300 bp
of ARF1(T31N) to the C-terminal 237 bp of ARF6. The N-terminal portion
of ARF1(T31N) was amplified using primers A1-5' and 1/6-A, and the
C-terminal portion of ARF6 was amplified using primers 1/6-B and A6-3'.
The EcoRI-BglII fragment of the final PCR product
was cloned into pXS.
ARF6(EI) was constructed by site-directed mutagenesis using primers
A6-5', A6EI-A, A6EI-B, and A6-3'. The EcoRI-BglII
fragment of the final PCR product was cloned into pXS.
1-6(QS) was constructed by site-directed mutagenesis using primers
A1-5', A1QS-A, A1QS-B, and A6-3'. The EcoRI-BglII
fragment of the final PCR product was cloned into pXS.
Sequences of all DNA constructs originating from PCR products were
confirmed through the services of SeqWright (Houston, Tex.) or Veritas,
Inc. (Rockville, Md.).
Transient transfection of cells.
Cells grown on coverslips
were transfected in six-well dishes using the calcium phosphate
procedure as previously described (4). A total of 5 µg of
DNA per well was used in single-transfection experiments, such that 2.5 µg of the required plasmid was used plus 2.5 µg of pXS vector. In
cotransfection experiments, 2 µg of either the ARF6-HA or Rac plasmid
and 10 µg of the coexpressed plasmid were used to obtain a 1:5 ratio.
Drug treatments were performed in the presence of complete medium. AlF
treatment of cells was performed by supplementing the culture medium
with 30 mM NaF and 50 µM AlCl3. CD was stored in dimethyl
sulfoxide as a stock solution of 1 mM and used at a final concentration
of 1 µM.
Immunofluorescence.
Thirty hours after transfection, the
cells were treated as described above, fixed in 2% formaldehyde in
phosphate-buffered saline (PBS) for 10 min, and rinsed with 10% FBS
and 0.02% azide in PBS (PBS-serum). The cells were incubated with
primary antibodies diluted in PBS-serum plus 0.2% saponin for 1 h, then washed (three times, 5 min each) with PBS-serum. The cells were
then incubated in secondary antibodies diluted in PBS-serum plus 0.2%
saponin for 1 h, washed with PBS-serum (three times, 5 min each)
and once with PBS, and mounted on glass slides. A Zeiss Axioplan
epifluorescence microscope and 63× Plan-Apochromat lens were used for
all fluorescence microscopy, and photomicrographs were prepared using
TMAX 400 film (Eastman Kodak, Rochester, N.Y.).
Internalization and recycling of anti-Tac antibodies.
Detection of anti-Tac antibody recycling was performed as described
previously (37). Cells grown on coverslips were
cotransfected with Tac and either 1-6 or 1-6(T31N). Thirty hours later,
cells were chilled to 4°C and incubated for 30 min in an ice-water
bath with mouse anti-Tac antibodies in the absence of permeabilization to label surface Tac. Cells were rinsed with ice-cold Dulbecco's modified Eagle's medium supplemented with 10% FBS (complete medium) and prewarmed for 30 min at 37°C in the presence of CD to allow for
antibody internalization. To remove anti-Tac antibodies remaining at
the surface, cells were next rinsed quickly three times with a low-pH
buffer (26) containing 0.5% acetic acid and 0.5 M NaCl (pH
3.0) and then three times with complete medium. Some coverslips were
fixed to detect internalization, and the rest were first warmed for 30 min at 37°C to allow for antibody recycling to the surface and then fixed.
To detect antibody internalization, cells were processed for
immunofluorescence as described above, using rabbit anti-ARF6 antiserum, fluorescently labeled donkey anti-rabbit IgG (to detect anti-ARF6 antibodies), and donkey anti-mouse IgG (to detect anti-Tac antibodies).
To detect Tac antibody recycled to the surface, cells were incubated
with fluorescently labeled donkey anti-mouse IgG in the absence of
saponin. To label ARF6, cells were incubated with anti-ARF6 antibodies
and the appropriate secondary antibodies in the presence of saponin.
 |
RESULTS |
The 1-6 chimera localizes and traffics like wild-type ARF6 yet
cannot form protrusions.
We constructed a 1-6 chimera of ARF
consisting of the amino half of ARF1 (residues 1 to 100) and the
carboxyl half of ARF6 (residues 97 to 175). HeLa cells transiently
transfected with a plasmid encoding either ARF6 or the 1-6 chimera were
left untreated or were treated with either CD, BFA, or AlF and then
fixed and processed for indirect immunofluorescence localization of
ARF6 or the 1-6 chimera using a polyclonal antibody raised to the
C-terminal end of ARF6 (42). In untreated cells, the 1-6 chimera localized to the PM and associated with a tubular endosomal
compartment, similar to the localization of ARF6 (Fig.
1A). CD treatment shifted the
distribution of the 1-6 chimera and ARF6 from the PM to the tubular
endosomal compartment, and BFA treatment did not affect the
distribution of either the chimera or ARF6 (Fig. 1A). In cells expressing ARF6, AlF treatment resulted in the formation of protrusions at the PM (Fig. 1A), a manifestation of the actin rearrangement effector function for ARF6 (38, 42). In contrast, the 1-6 chimera did not form protrusive structures at the PM upon treatment with AlF (Fig. 1A). The failure to make protrusions was not due to
differences in expression levels, as all constructs were expressed in a
vector using the same promoter and similar elevated levels of ARF
expression were observed (Fig. 1B). Furthermore, looking at individual
cells under the microscope, we found that individual cells expressing
very high levels of the 1-6 chimera still did not make protrusions.
Thus, the carboxyl half of ARF6 contains sufficient information for
localization both at the PM and on the endosomal compartment.
Furthermore, the information for protrusion formation is in the
amino-terminal half of ARF6, but this information is absent from the
same region in ARF1.


View larger version (123K):
[in this window]
[in a new window]
|
FIG. 1.
The ARF1-6 chimera localizes like ARF6 yet cannot form
protrusions. (A) HeLa cells were transfected with plasmids encoding
either ARF6 or the ARF1-6 chimera and were untreated (Unt) or incubated
in the presence of either 1 µM CD for 30 min (CD), 2 µg of BFA/ml
for 10 min (BFA), or 30 mM NaF and 50 µM AlCl3 for 30 min
(AlF). Cells were fixed and immunolabeled with polyclonal anti-ARF6
antibodies that recognize a C-terminal peptide of the protein. Bar, 15 µm. (B) Expression levels of ARF6 in untransfected and transfected
HeLa cells. HeLa cells were not transfected (Endog.) or were
transfected with 2.5 µg of plasmid encoding ARF6, 1-6, 1-6(T31N),
or 1-6(QS). Cell extracts were loaded onto sodium dodecyl
sulfate-13% polyacrylamide gel electrophoresis, transferred to
nitrocellulose, blotted with rabbit anti-ARF6 antiserum, and visualized
by enhanced chemiluminescence as described previously (42).
For untransfected HeLa cells, 10 µg of protein was loaded per lane,
whereas for transfected HeLa lysates, 2 µg of protein was loaded per
lane.
|
|
One possible explanation for the inability of the 1-6 chimera to form
protrusions is that it is unable to interact effectively with the GEF
that activates ARF6. Although the ARF6-specific GEF is not known in
HeLa cells, GTP-binding-defective mutants of
GTPases can be generated that result in an inhibitory
phenotype in cells by sequestering the GEFs (3). Such an
ARF6 mutant, ARF6(T27N), when overexpressed in HeLa cells
accumulates on the tubular endosomal compartment and inhibits recycling
of membrane to the PM (37), Rac-induced membrane ruffling
(38), and cell spreading (42). To test
whether the 1-6 chimera can interact with the ARF6 GEF, we mutated
the threonine at position 31 to an asparagine and asked whether the
resulting mutant chimera, 1-6(T31N), can exert inhibitory effects
similar to those generated by expression of ARF6(T27N). We first
tested whether 1-6(T31N) could inhibit Rac-mediated ruffling. HeLa
cells were either transfected with plasmids encoding epitope-tagged Rac1 alone or cotransfected with 1-6(T31N) or ARF6(T27N).
Following treatment with AlF, cells were fixed and immunolabeled with
monoclonal anti-EE antibodies to detect Rac1 and polyclonal anti-ARF6
antibodies to detect 1-6(T31N) or ARF6(T27N). Cells expressing
Rac1 alone exhibited extensive PM ruffles along the edges of the cells
(Fig. 2A), as previously observed
(38). Coexpression of 1-6(T31N) with Rac1 inhibited
ruffling similarly to coexpression of ARF6(T27N) with Rac1 (Fig.
2A) (38). The inhibition of ruffling was quantitated by
scoring the fraction of ruffling cells in the total transfected pool
for each treatment (see the legend to Fig.
3). Both ARF6(T27N) and 1-6(T31N)
were effective at inhibiting Rac ruffling to approximately 8 and 12%,
respectively, of that of cells expressing Rac1 alone (Fig. 3A). Similar
to ARF6(T27N), the 1-6(T31N) chimera was localized to the
endosomal compartment and was also observed to inhibit recycling of
membrane to the PM (see Fig. 6) and cell spreading (data not shown).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
The GTP-binding-defective mutant of 1-6 acts
like a dominant negative ARF6 mutant, inhibiting ARF6 protrusions and
Rac ruffling. (A) HeLa cells were transfected with wild-type Rac1 (Rac)
or with Rac and either 1-6(T31N) or ARF6(T27N) (1:5 ratio) and
then incubated in the presence of AlF for 30 min. (B) HeLa cells were
transfected with either wild-type HA-tagged ARF6 (ARF6-HA) or with
ARF6-HA and either 1-6(T31N) or ARF6(T27N) (1:5 ratio) and then
incubated in the presence of AlF for 30 min. The overexpressed proteins
were then localized by immunofluorescence. Bar, 15 µm.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Quantitation of Rac ruffling and ARF6 protrusion
formation. (A) HeLa cells were transfected with either plasmids
encoding Rac1 alone or those encoding Rac1 and either ARF6(T27N),
1-6(T31N), or 1-6 (1:5 ratio). (B) HeLa cells were transfected with
either ARF6-HA alone or with ARF6-HA and either ARF6(T27N),
1-6(T31N), or 1-6 (1:5 ratio). Cells were incubated for 30 min in
the presence of AlF and fixed, and the overexpressed proteins
were labeled by immunofluorescence. For each condition, over 500 transfected cells were counted, and the fraction of Rac- or
ARF6-transfected cells that were ruffling or forming protrusions,
respectively, was noted. For cells overexpressing only Rac1 or ARF6,
the fraction of ruffling or protruding cells was normalized to 1.0, and
the other conditions were then expressed as a fraction of 1.0. Data
shown are the means and standard errors of three independent
experiments.
|
|
An additional test for the effectiveness of a
GTP-binding-defective mutant is to assess whether the
mutant is able to inhibit directly a function of the wild-type protein.
We therefore analyzed the ability of 1-6(T31N) and ARF6(T27N)
to inhibit protrusions formed by cells overexpressing wild-type ARF6.
HeLa cells were either transfected with plasmids encoding influenza HA
epitope-tagged ARF6 (ARF6-HA) alone or cotransfected with the
1-6(T31N) or ARF6(T27N) mutant. Following AlF treatment, cells
were fixed and immunolabeled with both monoclonal anti-HA antibodies to
detect overexpressed, wild-type ARF6 and with polyclonal anti-ARF6
antibodies to additionally detect 1-6(T31N) or ARF6(T27N).
Cells expressing ARF6-HA alone formed protrusions upon addition of AlF,
whereas coexpression with either 1-6(T31N) or ARF6(T27N)
inhibited protrusion formation (Fig. 2B). The inhibition of
ARF6-induced protrusions was quantitated by scoring the fraction of
protruding cells in the total transfected pool (see the legend to Fig.
3). ARF6(T27N) and 1-6(T31N) inhibited protrusions to
approximately 27 and 40%, respectively, of that of cells expressing
ARF6-HA alone (Fig. 3B).
The experiments described above demonstrate that the 1-6(T31N)
chimera displays all the inhibitory effects of ARF6(T27N) and behaves like an effective dominant negative ARF6 mutant. By
contrast, expression of the dominant negative ARF1 mutant, T31N,
which disassembles the Golgi complex and blocks secretion
(10), had no appreciable effect on any of these ARF6
functions (data not shown). These observations suggest that 1-6, like
ARF6, cycles between the endosome and the PM and is capable of
effective interaction with the ARF6 GEF. Therefore, the inability of
1-6 to induce protrusions (an ARF6 effector function at the PM) is
likely due to the absence of an ARF6 effector domain in the 1-6 chimera.
The effector domain in ARF6 includes residues Q37 and S38.
The
failure of the 1-6 chimera to form protrusions suggests that residues
in the amino-terminal half of ARF6 are required for protrusion
formation. Interestingly, we have observed that the Saccharomyces
cerevisiae protein yArf3 localizes in HeLa cells in a manner
similar to ARF6, but like the 1-6 chimera it does not form protrusions
in response to AlF (O. Al-Awar et al., unpublished data) (Fig. 1).
These observations suggest that both yArf3 and the 1-6 chimera lack
information in their amino-terminal halves that is required for this
ARF6 effector function. We therefore searched for a unique
sequence in the amino-terminal half of ARF6 that is not present
in either ARF1 or yArf3. Residues Q37 and S38 in ARF6 fit this
criterion (Fig. 4, top).

View larger version (105K):
[in this window]
[in a new window]
|
FIG. 4.
ARF6 effector domain includes residues Q37 and S38.
(Top) Amino acid sequence comparison between human ARF1 and ARF6 from
amino acid 24 in ARF1 (20 in ARF6) to amino acid 56 in ARF1 (52 in
ARF6). Asterisks indicate identity. Note the conservation in the switch
I region encompassing residues 45 to 54. (Bottom) HeLa cells were
transfected with plasmids encoding either the 1-6 chimera,
1-6(EI QS), ARF6, or ARF6(QS EI). Cells were then left
untreated or incubated for 30 min with AlF. The expressed proteins were
labeled with ARF6-specific antiserum followed by rhodamine-conjugated
phalloidin to visualize F-actin. Bar, 15 µm.
|
|
To assess whether residues Q37 and S38 are critical for the formation
of protrusions, we replaced the equivalent amino acids in the 1-6 chimera, E41 and I42, with QS. The resulting mutant, 1-6(QS), was
transiently transfected into HeLa cells. 1-6(QS) localized
similarly to ARF6 and to 1-6 in cells. In untreated cells,
1-6(QS), like 1-6 and ARF6, was present at the PM and on the
tubular juxtanuclear compartment (Fig. 4). CD treatment shifted both 1-6 and 1-6(QS) to the tubular compartment, as
observed in Fig. 1 (and data not shown). In contrast to cells
expressing 1-6, cells expressing 1-6(QS) did form protrusions
enriched in F-actin upon the addition of AlF, similar to protrusions
seen in cells expressing wild-type ARF6 (Fig. 4). We next mutated
residues Q37 and S38 in the full-length ARF6 to EI, their ARF1
equivalents. Cells expressing the resulting mutant, ARF6(EI),
did not form protrusions upon AlF treatment (Fig. 4), although ARF(EI)
did at times accumulate at sites along the PM. The gain of function by
1-6(QS) and the loss of function by ARF6(EI) demonstrated that residues Q37 and S38 are critical for the ARF6 effector function of
protrusion formation.
The 1-6 chimera antagonizes selected ARF6 functions.
The
observation that the 1-6 chimera localized like ARF6 in the cells yet
could not form protrusions upon AlF addition led us to investigate
whether the expression of this effector function-negative chimera would
interfere with the ability of wild-type ARF6 to induce protrusions. To
test this possibility, we examined whether coexpression of 1-6 with
ARF6-HA would inhibit protrusions formed in the presence of AlF. As
shown in Fig. 5, cells expressing ARF6-HA alone formed protrusions after addition of AlF, whereas cells coexpressing 1-6 with ARF6-HA did not. Inhibition of protrusion formation was also observed in cell coexpressing ARF6(EI) and ARF6-HA (data not shown). As expected, cells coexpressing ARF6-HA and
1-6(QS) formed protrusions. We quantitated the inhibitory effect of 1-6, and remarkably, the extent of inhibition observed with 1-6 was comparable to that observed with the
GTP-binding-defective mutants, 1-6(T31N) and
ARF6(T27N) (Fig. 3B). However, the mechanism by which the 1-6 chimera inhibits protrusion formation is distinct from that observed
with these mutants (see below).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
The 1-6 chimera inhibits protrusion formation. HeLa
cells were transfected with plasmids encoding either ARF6-HA alone
(ARF6-HA), or with ARF6-HA and either 1-6 or 1-6(QS) (1:5 ratio).
Cells were treated with AlF for 30 min, fixed, and processed for
immunofluorescence. Bar, 15 µm.
|
|
The ability of the 1-6 chimera to inhibit protrusion formation led us
to ask whether it also inhibited two other ARF6 functions: membrane
trafficking (37) and Rac-mediated ruffling (38). To assess the effect of the 1-6 chimera on the recycling of endosomal membrane back to the PM, we followed the internalization and recycling of Tac, the interleukin-2 receptor
subunit, a membrane marker for
the ARF6 endosomal compartment (37). We have previously demonstrated that expression of ARF6(T27N) blocks the
ARF6-regulated recycling of Tac from the endosomal compartment back out
to the PM (37); we predicted that 1-6(T31N) would act
similarly. Cells coexpressing Tac and either 1-6 or 1-6(T31N) were
treated as described in Materials and Methods. Cells expressing the 1-6 chimera internalized and accumulated anti-Tac antibodies into the
ARF6-labeled endosomal compartment during the internalization period,
similar to Tac internalization in cells expressing 1-6(T31N) (Fig.
6, Uptake). Tac was recycled back to the PM after removal of CD, as
detected by surface reappearance of anti-Tac antibodies, in cells
expressing 1-6 (Fig. 6, Surface
Reappearance) in a pattern and time course similar to that
previously observed for cells expressing ARF6 (37).
By contrast, 1-6(T31N) expression inhibited the recycling step
(Fig. 6, Surface Reappearance). Thus, expression of the 1-6 chimera
does not perturb the functioning of the ARF6-regulated membrane
recycling pathway.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 6.
The 1-6 chimera does not block internalization or
recycling of surface Tac into the tubular compartment. HeLa cells
expressing Tac and either the 1-6 chimera or 1-6(T31N) were
incubated with anti-Tac antibodies (7G7) at 4°C to bind to surface
Tac. Excess antibodies were washed off, and the cells were then
incubated at 37°C for 30 min in the presence of CD to allow
internalization of the Tac antibodies into the endosomal compartment.
Cells were then rinsed to remove remaining surface anti-Tac antibodies
and either fixed immediately and assessed for Tac antibody internalized
by immunofluorescence (Uptake) or warmed to 37°C for 30 min in the
absence of CD before fixation. Tac antibody that reappeared on the cell
surface was detected by incubation with fluorescently labeled secondary
antibodies in the absence of detergent permeabilization
(Surface Reappearance). The 1-6 chimera or 1-6(T31N) was
subsequently localized in these cells after permeabilization. Bar,
15 µm.
|
|
Since both the trafficking of Rac and the ability of Rac to form PM
ruffles is dependent upon ARF6 in HeLa cells (38), we next
asked whether the 1-6 chimera would interfere with the ability of
wild-type Rac to induce PM ruffles in response to AlF treatment. Cells
were transfected with either Rac1 alone or with the 1-6 chimera and
Rac1. Following treatment with AlF, cells were fixed and immunolabeled
to detect 1-6 and Rac1. PM ruffling was readily observed around the
edges of cells expressing Rac1 either alone or with 1-6 (Fig.
7). Similarly, coexpression of
ARF6(EI) with Rac also did not inhibit ruffling (data not shown).
We next quantitated the ruffling response in cells coexpressing Rac1
and 1-6 and found that the fraction of cells showing PM ruffling was
nearly identical to that observed in cells expressing Rac1 alone (Fig.
3A). Thus, expression of the 1-6 chimera selectively inhibits
protrusion formation but does not interfere with the ARF6-regulated
membrane-trafficking events, namely the recycling of membrane back to
the PM. By contrast, 1-6(T31N) behaves like the ARF6 dominant
negative mutant, ARF6(T27N), inhibiting all known ARF6 activities
including both membrane trafficking and formation of actin-containing
protrusions at the PM (Fig. 3 and 8).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 7.
The 1-6 chimera does not inhibit Rac-induced ruffling.
HeLa cells were transfected with plasmids encoding either Rac1 alone or
Rac and the 1-6 chimera (1:5 ratio). Cells were incubated in the
presence of AlF for 30 min and fixed, and the expressed proteins were
localized by immunofluorescence. Bar, 15 µm.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 8.
Working model for ARF6 action on trafficking and
cortical actin structures. ARF6-GTP (asterisks) at the PM is
involved in the generation of actin filament-containing protrusions
(left side) or in the presence of Rac, actin-containing PM ruffles
(right side). 1-6(QS) can generate protrusions whereas 1-6 cannot.
Both ARF6(T27N) and 1-6(T31N) inhibit activation of ARF6 and
therefore the recycling of endosomal membrane back to the PM.
Expression of 1-6 inhibits ARF6-mediated protrusions but not
Rac-mediated ruffling or membrane recycling back to the PM.
|
|
 |
DISCUSSION |
All of the human ARF family members are expressed, to various
extents, in all cell types. Although the different ARFs share sequence
similarity and common biochemical activities, in cells they likely have
distinct functions. Their specificity in vivo may be mediated through
targeting to distinct membrane compartments and through coupling to
specific effectors. In this study, we analyzed the localization and
activities of 1-6, a chimeric ARF molecule containing the
amino-terminal half of ARF1 and carboxyl-terminal half of ARF6. 1-6 contained sufficient information from the carboxyl-terminal half to
target it like ARF6 i.e., to the PM and endosomal compartment and not
to the Golgi complex where ARF1 localizes. This molecule behaved
similarly to ARF6 in its ability to cycle between the endosomal
compartment and the PM, and it appeared to interact with an
ARF6-specific GEF. Yet unlike ARF6, the 1-6 chimera could not induce
protrusion formation upon AlF treatment, an ARF6 effector function at
the PM. Thus, we concluded that the sequences in ARF6 that are
necessary for induction of protrusion formation are present in the
amino-terminal half of the protein, and that the amino-terminal half of
ARF1 could not substitute for ARF6 in this regard.
The overall similarity between ARF1 and ARF6 in their amino-terminal
halves led us to attempt to identify unique sequences in ARF6 necessary
for this effector function. The identification of sequences critical
for specific effector functions and the subsequent generation of
various effector mutants has aided in the understanding of
GTPases with multiple effector functions, in particular for
Rho proteins (18, 24, 27, 45). We searched for a sequence in
ARF6 that is missing in the amino-terminal half of the 1-6 chimera
which would be necessary for formation of protrusions. We found that
two residues in ARF6, Q37 and S38, were critical for this ARF6 effector
function. Substitution of residues QS for residues EI in the analogous
position in the 1-6 chimera was sufficient to result in a gain of
function, allowing the chimera to form protrusions in response to AlF.
We have recently identified the target of AlF in our cells as the
heterotrimeric G protein alpha subunit, G
q. Coexpression of
constitutively active Gq(Q209L) with ARF6 induces protrusions in the
absence of AlF (H. Radhakrishna and J. G. Donaldson,
unpublished data). We have observed that coexpression of Gq(Q209L)
with 1-6, like AlF treatment of cells expressing 1-6 alone, also did
not result in protrusion formation, whereas coexpression of Gq(Q209L)
with 1-6(QS) did form protrusions (O. Awar, unpublished
observations). Taken together, these data indicate that residues Q37
and S38 in ARF6 represent a site of interaction with effector molecules
which is necessary for protrusion formation. A recent study suggests
that ARF6 may influence cortical actin through activation of
phosphatidylinositol 4-phosphate 5-kinase
(22). It will
be interesting to examine whether residues Q37 and S38 are required for
this activity.
The crystal structures of both the GDP- and GTP-bound
forms of ARF1 have been solved (1, 20, 21). A
comparison of these structures reveals that, like Ras, upon
GTP binding ARF1 undergoes a conformational change that
involves significant shifts in the positioning of the switch I and
switch II regions. In ARF1, switch I encompasses residues 45 to 54 and
switch II encompasses residues 70 to 80 (20). Assuming
similarity in structure, for ARF6 the switch I and switch II regions
would encompass residues 41 to 50 and 66 to 76, respectively. It is
noteworthy that there is high conservation in the amino acid sequence
among all ARFs in the switch I and switch II regions (see Fig. 4 for
residues in the switch I region in ARF1 and ARF6). Intriguingly,
residues Q37 and S38, which result in a gain of function when
substituted into the 1-6 chimera, are positioned a few residues prior
to the predicted switch I region. Significantly, all the ARF proteins in class I and class II, in all organisms, contain residues EI at this
site. Only mammalian ARF6 and its class III homologues in
Drosophila (accession no. P40946), Caenorhabditis
elegans (accession no. CAB55153), Schizosaccharomyces
pombe (accession no. CAB51340), and Xenopus (accession
no. P51645) contain residues QS at this site. The S. cerevisiae yArf3 protein (accession no. P40994), a class III
member that localizes like ARF6 when expressed in mammalian cells, does
not contain these residues and, consistent with the data in this paper,
cannot induce protrusion formation (O. Al-Awar et al., unpublished
data). These observations further suggest that residues QS are critical
for ARF6-specific functions involved in actin reorganization at the PM,
and that conserved ARF sequences in the switch I and switch II regions
may be used for regulation of membrane trafficking, a function common
to all ARFs. Future investigations will focus on testing whether
antibodies or peptides specific to the QS region of ARF6 interfere with
its functioning and on identifying target molecules that interact with
ARF6 in this region.
Studies in a variety of systems have highlighted a dual function for
ARF6 as a regulator of membrane traffic and as a modulator of actin
dynamics at the PM (34). Separating these two effector functions for ARF6 has proven difficult since the
GTP-binding-defective mutant of ARF6, ARF6(T27N),
inhibits both trafficking (12, 37) and cortical actin
functions (13, 36). The phenotype of the expressed 1-6 chimera appears to separate these two activities of ARF6, because the
1-6 chimera selectively inhibits protrusion formation while not
affecting the membrane trafficking function of ARF6 (Fig. 8). One
explanation for these observations is that in cells, the 1-6 chimera is
targeted correctly to the ARF6 compartment, interacts with the ARF6
GEFs and GAPs, and carries out the ARF6 trafficking functions via
shared effector domains between ARF1 and ARF6 in their amino halves.
However, the 1-6 chimera cannot induce protrusion formation, and it
inhibits the ability of wild-type ARF6 to form protrusions due to the
absence of residues QS near the switch I region. Similar observations
have been made for Rac effector domain mutants. An effector domain
mutant of Rac that activates p21-activated kinase but does not induce
ruffling also functions as a dominant negative for Rac ruffling
(41).
The failure of the 1-6 chimera to affect Rac ruffling in HeLa cells
partially resolves the issue of the role of ARF6 in Rac-mediated ruffling. We previously demonstrated that Rac colocalizes with ARF6 on
the endosome and at the PM, that ARF6 regulates the trafficking of Rac
to the PM, and that ARF6 activity was required for Rac-mediated PM
ruffling (38). At that time, we could not determine whether the ARF6 requirement for Rac ruffling was due to ARF6 regulation of
trafficking or due to an ARF6-dependent effect on cortical actin at the
PM, since we were inhibiting both functions with ARF6(T27N). The
lack of inhibition of Rac ruffling by the 1-6 chimera suggests that it
may be the trafficking function of ARF6, and not the specific actin
remodeling function, that is necessary for the formation of Rac
ruffles. This trafficking function may extend beyond that of the
trafficking of Rac itself to include trafficking or recruitment of
components required for Rac ruffling. This was recently suggested for
ARF6 and Rac functions in macrophages (47).
Like 1-6, ARF6(EI) does not form protrusions, blocks protrusions
induced by ARF6, and does not block Rac ruffling. Selective inhibition
of certain ARF6 functions by the 1-6 chimera and ARF6(EI) suggests
that these molecules are acting as dominant-negative ARF6 mutants by a
mechanism different from that of ARF6(T27N). Although 1-6 and
ARF6(EI) lack residues that allow protrusion formation, they might
act as inhibitors by sequestering factors that wild-type ARF6 requires
for protrusions. These factors are presumably not required for Rac
ruffling. Identification of these limiting factors and also the
molecules that specifically interact with the QS residues in ARF6
should provide us with insight into how ARF6 alters actin dynamics at
the PM.
 |
ACKNOWLEDGMENTS |
We thank C. Der for reagents and F. Brown, E. Korn, and P. Randazzo for discussions and critical reading of the manuscript.
N. N. Powell was supported by the Biomedical Research Training
Program for Underrepresented Minorities, NHLBI, NIH.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Center Dr. MSC
0301, Bldg. 3, Room B1-22, Bethesda, MD 20892. Phone: (301) 402-2907. Fax: (301) 402-1519. E-mail: jdonalds{at}helix.nih.gov.
Present address: School of Biology, Georgia Institute of
Technology, Atlanta, GA 30332-0363.
 |
REFERENCES |
| 1.
|
Amor, J. C.,
D. H. Harrison,
R. A. Kahn, and D. Ringe.
1994.
Structure of the human ADP ribosylation factor 1 complexed with GDP.
Nature
372:704-708[CrossRef][Medline].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1995.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 3.
|
Boguski, M. S., and F. McCormick.
1993.
Proteins regulating Ras and its relatives.
Nature
366:643-654[CrossRef][Medline].
|
| 4.
|
Bonifacino, J. S.,
C. K. Suzuki,
J. Lippincott-Schwartz,
A. M. Weissman, and R. D. Klausner.
1989.
Pre-Golgi degradation of newly synthesized T cell antigen receptor chains: intrinsic sensitivity and the role of subunit assembly.
J. Cell Biol.
10:73-83.
|
| 5.
|
Brown, H. A.,
S. Gutowski,
C. R. Moomaw,
C. Slaughter, and P. C. Sternweis.
1993.
ADP ribosylation factor, a small GTP-dependent regulatory protein, stimulates phospholipase D activity.
Cell
75:1137-1144[CrossRef][Medline].
|
| 6.
|
Cavenagh, M. M.,
J. A. Whitney,
K. Carroll,
C.-J. Zhang,
A. L. Boman,
A. G. Rosenwald,
I. Mellman, and R. A. Kahn.
1996.
Intracellular distribution of Arf proteins in mammalian cells.
J. Biol. Chem.
271:21767-21774[Abstract/Free Full Text].
|
| 7.
|
Chavrier, P.,
J. P. Gorvel,
E. Stelzer,
K. Simons,
J. Gruenberg, and M. Zerial.
1991.
Hypervariable C-terminal domain of rab proteins acts as a targeting signal.
Nature
353:769-772[CrossRef][Medline].
|
| 8.
|
Chavrier, P., and B. Goud.
1999.
The role of ARF and Rab GTPases in membrane transport.
Curr. Opin. Cell Biol.
11:466-475[CrossRef][Medline].
|
| 9.
|
Cockroft, S.,
G. M. H. Thomas,
A. Fensome,
B. Geny,
E. Cunningham,
I. Gout,
I. Hiles,
N. F. Totty,
O. Truong, and J. J. Hsuan.
1994.
Phospholipase D: a downstream effector of ARF in granulocytes.
Science
263:523-526[Abstract/Free Full Text].
|
| 10.
|
Dascher, C., and W. E. Balch.
1994.
Dominant inhibitory mutants of ARF1 block endoplasmic reticulum to Golgi transport and trigger disassembly of the Golgi apparatus.
J. Biol. Chem.
269:1437-1448[Abstract/Free Full Text].
|
| 11.
|
Diekmann, D.,
C. D. Nobes,
P. D. Burbelo,
A. Abo, and A. Hall.
1995.
Rac GTPase interacts with GAPs and target proteins through multiple effector sites.
EMBO J.
14:5297-5305[Medline].
|
| 12.
|
D'Souza-Schorey, C.,
G. Li,
M. I. Colombo, and P. D. Stahl.
1995.
A regulatory role for ARF6 in receptor-mediated endocytosis.
Science
267:1175-1178[Abstract/Free Full Text].
|
| 13.
|
D'Souza-Schorey, C.,
R. L. Boshans,
M. McDonough,
P. D. Stahl, and L. Van Aelst.
1997.
A role for POR1, a Rac1-interacting protein, in ARF6-mediated cytoskeletal rearrangements.
EMBO J.
16:5445-5454[CrossRef][Medline].
|
| 14.
|
D'Souza-Schorey, C.,
E. van Donselaar,
V. W. Hsu,
C. Yang,
P. D. Stahl, and P. J. Peters.
1998.
ARF6 targets recycling vesicles to the plasma membrane: insights from an ultrastructural investigation.
J. Cell Biol.
140:603-616[Abstract/Free Full Text].
|
| 15.
|
Finazzi, D.,
D. Cassel,
J. G. Donaldson, and R. D. Klausner.
1994.
Aluminum fluoride acts on the reversibility of ARF-dependent coat protein binding to Golgi membranes.
J. Biol. Chem.
269:13325-13330[Abstract/Free Full Text].
|
| 16.
|
Franco, M.,
P. J. Peters,
J. Boretto,
E. van Donselaar,
A. Neri,
C. D'Souza-Schorey, and P. Chavrier.
1999.
EFA6, a sec7 domain-containing exchange factor for ARF6, coordinates membrane recycling and actin cytoskeleton organization.
EMBO J.
18:1480-1491[CrossRef][Medline].
|
| 17.
|
Frank, S. R.,
J. C. Hatfield, and J. E. Casanova.
1998.
Remodeling of the actin cytoskeleton is coordinately regulated by protein kinase C and the ADP-ribosylation factor nucleotide exchange factor ARNO.
Mol. Biol. Cell
9:3133-3146[Abstract/Free Full Text].
|
| 18.
|
Fujisawa, K.,
P. Madaule,
T. Ishizaki,
G. Watanabe,
H. Bito,
Y. Saito,
A. Hall, and S. Narumiya.
1998.
Different regions of Rho determine Rho-selective binding of different classes of Rho target molecules.
J. Biol. Chem.
273:18943-18949[Abstract/Free Full Text].
|
| 19.
|
Galas, M.-C.,
J. B. Helms,
N. Vitale,
D. Thierse,
D. Aunis, and M.-F. Bader.
1997.
Regulated exocytosis in chromaffin cells: a potential role for a secretory granule-associated ARF6 protein.
J. Biol. Chem.
272:2788-2793[Abstract/Free Full Text].
|
| 20.
|
Goldberg, J.
1998.
Structural basis for activation of ARF GTPase: mechanisms of guanine nucleotide exchange and GTP-myristoyl switching.
Cell
95:237-248[CrossRef][Medline].
|
| 21.
|
Greasley, S.,
H. Jhoti,
A. C. Fensome,
S. Cockcroft,
G. M. Thomas, and B. Bax.
1994.
Crystallization and preliminary X-ray diffraction studies on ADP-ribosylation factor 1.
J. Mol. Biol.
244:651-653[CrossRef][Medline].
|
| 22.
|
Honda, A.,
M. Nogami,
T. Yokozeki,
M. Yamazaki,
H. Nakamura,
H. Watanabe,
K. Kawamoto,
K. Nakayama,
A. J. Morris,
M. A. Frohman, and Y. Kanaho.
1999.
Phosphatidylinositol 4-phosphate 5-kinase is a downstream effector of the small G protein ARF6 in membrane ruffle formation.
Cell
99:521-532[CrossRef][Medline].
|
| 23.
|
Jones, D. H.,
B. Bax,
A. Fensome, and S. Cockcroft.
1999.
ADP ribosylation factor 1 mutants identify a phospholipase D effector region and reveal that phospholipase D participates in lysosomal secretion but is not sufficient for recruitment of coatomer I.
Biochem. J.
341:185-192.
|
| 24.
|
Joneson, T.,
M. McDonough,
D. Bar-Sagi, and L. Van Aelst.
1996.
Rac regulation of actin polymerization and proliferation by a pathway distinct from Jun kinase.
Science
274:1374-1376[Abstract/Free Full Text].
|
| 25.
|
Kahn, R. A., and A. G. Gilman.
1986.
The protein cofactor necessary for ADP-ribosylation of Gs by cholera toxin is itself a GTP-binding protein.
J. Biol. Chem.
261:7906-7911[Abstract/Free Full Text].
|
| 26.
|
Klausner, R. D.,
J. Van Renswoude,
G. Ashwell,
C. Kempf,
A. N. Schechter,
A. Dean, and K. R. Bridges.
1983.
Receptor-mediated endocytosis of transferrin in K562 cells.
J. Biol. Chem.
258:4715-4724[Abstract/Free Full Text].
|
| 27.
|
Lamarche, N.,
N. Tapon,
L. Stowers,
P. D. Burbelo,
P. Aspenstrom,
T. Bridges,
J. Chant, and A. Hall.
1996.
Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and junk/SAPK MAP kinase cascade.
Cell
87:519-529[CrossRef][Medline].
|
| 28.
|
Liang, J. O.,
T. C. Sung,
A. J. Morris,
M. A. Frohman, and S. Kornfeld.
1997.
Different domains of mammalian ADP-ribosylation factor 1 mediate interaction with selected target proteins.
J. Biol. Chem.
272:33001-33008[Abstract/Free Full Text].
|
| 29.
|
Lippincott-Schwartz, J.,
N. B. Cole, and J. G. Donaldson.
1998.
Building a secretory apparatus: role of ARF1/COPI in Golgi biogenesis and maintenance.
Histochem. Cell Biol.
109:449-462[CrossRef][Medline].
|
| 30.
|
Massenburg, D.,
J.-S. Han,
M. Liyanage,
W. A. Patton,
S. G. Rhee,
J. Moss, and M. Vaughan.
1994.
Activation of rat brain phospholipase D by ADP-ribosylation factors 1, 5, and 6: separation of ADP-ribosylation factor-dependent and oleate-dependent enzymes.
Proc. Natl. Acad. Sci. USA
91:11718-11722[Abstract/Free Full Text].
|
| 31.
|
Melançon, P.,
B. S. Glick,
V. Malhotra,
P. J. Weidman,
T. Serafini,
M. L. Gleason,
L. Orci, and J. E. Rothman.
1987.
Involvement of the GTP-binding "G" proteins in transport through the Golgi stack.
Cell
58:329-336.
|
| 32.
|
Millar, C. A.,
K. A. Powell,
G. R. X. Hickson,
M.-F. Bader, and G. W. Gould.
1999.
Evidence for a role for ADP-ribosylation factor 6 in insulin-stimulated glucose transporter-4 (GLUT4) trafficking in 3T3-L1 adipocytes.
J. Biol. Chem.
274:17619-17625[Abstract/Free Full Text].
|
| 33.
|
Moss, J., and M. Vaughan.
1995.
Structure and function of ARF proteins: activators of cholera toxin and critical components of intracellular vesicular transport processes.
J. Biol. Chem.
270:12327-12330[Free Full Text].
|
| 34.
|
Moss, J., and M. Vaughan.
1998.
Molecules in the ARF orbit.
J. Biol. Chem.
273:21431-21434[Free Full Text].
|
| 35.
|
Peters, P. J.,
V. W. Hsu,
C. E. Ooi,
D. Finazzi,
S. B. Teal,
V. Oorschot,
J. G. Donaldson, and R. D. Klausner.
1995.
Overexpression of wild-type and mutant ARF1 and ARF6: distinct perturbations of nonoverlapping membrane compartments.
J. Cell Biol.
128:1003-1017[Abstract/Free Full Text].
|
| 36.
|
Radhakrishna, H.,
R. D. Klausner, and J. G. Donaldson.
1996.
Aluminum fluoride stimulates surface protrusions in cells overexpressing the ARF6 GTPase.
J. Cell Biol.
134:935-947[Abstract/Free Full Text].
|
| 37.
|
Radhakrishna, H., and J. G. Donaldson.
1997.
ADP-ribosylation factor 6 regulates a novel plasma membrane recycling pathway.
J. Cell Biol.
139:49-61[Abstract/Free Full Text].
|
| 38.
|
Radhakrishna, H.,
O. Al-Awar,
Z. Khatchikian, and J. G. Donaldson.
1999.
ARF6 requirement for Rac ruffling suggests a role for membrane trafficking in cortical actin rearrangements.
J. Cell Sci.
112:855-866[Abstract].
|
| 39.
|
Roth, M. G.
1999.
Snapshots of ARF1: implications for mechanisms of activation and inactivation.
Cell
97:149-152[CrossRef][Medline].
|
| 40.
|
Rubin, L. A.,
C. C. Kurman,
W. E. Biddison,
N. D. Goldman, and D. L. Nelson.
1985.
A monoclonal antibody 7G7/B6 binds to an epitope of the human interleukin-2 (IL-2) receptor that is distinct from that recognized by IL-2 or anti-Tac.
Hybridoma
4:91-102[Medline].
|
| 41.
|
Schwartz, M. A.,
J. E. Meredith, and W. B. Kiosses.
1998.
An activated Rac mutant functions as a dominant negative for membrane ruffling.
Oncogene
17:625-629[CrossRef][Medline].
|
| 42.
|
Song, J.,
Z. Khachikian,
H. Radhakrishna, and J. G. Donaldson.
1998.
Localization of endogenous ARF6 to sites of cortical actin rearrangement and involvement of ARF6 in cell spreading.
J. Cell Sci.
111:2257-2267[Abstract].
|
| 43.
|
Takebe, Y.,
M. Seiki,
J.-I. Fujisawa,
P. Hoy,
K. Yokota,
K.-I. Arai,
M. Yoshida, and N. Arai.
1988.
SR promoter: an efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat.
Mol. Cell. Biol.
8:466-472[Abstract/Free Full Text].
|
| 44.
|
Tsuchiya, M.,
S. R. Price,
S.-C. Tsai,
J. Moss, and M. Vaughan.
1991.
Molecular identification of ADP-ribosylation factor mRNAs and their expression in mammalian cells.
J. Biol. Chem.
266:2772-2777[Abstract/Free Full Text].
|
| 45.
|
Westwick, J. K.,
Q. T. Lambert,
G. J. Clark,
M. Symons,
L. van Aelst,
R. G. Pestell, and C. J. Der.
1997.
Rac regulation of transformation, gene expression, and actin organization by multiple, PAK-independent pathways.
Mol. Cell. Biol.
17:1324-1335[Abstract].
|
| 46.
|
Yang, C. Z.,
H. Heimberg,
C. D'Souza-Schorey,
M. M. Mueckler, and P. D. Stahl.
1998.
Subcellular distribution and differential expression of endogenous ADP-ribosylation factor 6 in mammalian cells.
J. Biol. Chem.
273:4006-4011[Abstract/Free Full Text].
|
| 47.
|
Zhang, Q.,
J. Calafat,
H. Janssen, and S. Greenberg.
1999.
ARF6 is required for growth factor- and Rac-mediated membrane ruffling in macrophages at a stage distal to Rac membrane targeting.
Mol. Cell. Biol.
19:8158-8168[Abstract/Free Full Text].
|
| 48.
|
Zhang, Q.,
D. Cox,
C.-C. Tseng,
J. G. Donaldson, and S. Greenberg.
1998.
A requirement for ARF6 in Fc receptor-mediated phagocytosis in macrophages.
J. Biol. Chem.
273:19977-19981[Abstract/Free Full Text].
|
Molecular and Cellular Biology, August 2000, p. 5998-6007, Vol. 20, No. 16
0270-7306/00/$04.00+0
This article has been cited by other articles:
-
Price, H. P., Stark, M., Smith, D. F.
(2007). Trypanosoma brucei ARF1 Plays a Central Role in Endocytosis and Golgi-Lysosome Trafficking. Mol. Biol. Cell
18: 864-873
[Abstract]
[Full Text]
-
Goldfinger, L. E., Ptak, C., Jeffery, E. D., Shabanowitz, J., Hunt, D. F., Ginsberg, M. H.
(2006). RLIP76 (RalBP1) is an R-Ras effector that mediates adhesion-dependent Rac activation and cell migration. J. Cell Biol.
174: 877-888
[Abstract]
[Full Text]
-
Klein, S., Franco, M., Chardin, P., Luton, F.
(2006). Role of the Arf6 GDP/GTP Cycle and Arf6 GTPase-activating Proteins in Actin Remodeling and Intracellular Transport. J. Biol. Chem.
281: 12352-12361
[Abstract]
[Full Text]
-
Li, M., Ng, S. S.-m., Wang, J., Lai, L., Yi Leung, S., Franco, M., Peng, Y., He, M.-l., Kung, H.-f., Lin, M. C.-m.
(2006). EFA6A Enhances Glioma Cell Invasion through ADP Ribosylation Factor 6/Extracellular Signal-Regulated Kinase Signaling. Cancer Res.
66: 1583-1590
[Abstract]
[Full Text]
-
Robertson, S. E., Setty, S. R. G., Sitaram, A., Marks, M. S., Lewis, R. E., Chou, M. M.
(2006). Extracellular Signal-regulated Kinase Regulates Clathrin-independent Endosomal Trafficking. Mol. Biol. Cell
17: 645-657
[Abstract]
[Full Text]
-
Balana, M. E., Niedergang, F., Subtil, A., Alcover, A., Chavrier, P., Dautry-Varsat, A.
(2005). ARF6 GTPase controls bacterial invasion by actin remodelling. J. Cell Sci.
118: 2201-2210
[Abstract]
[Full Text]
-
Tanabe, K., Torii, T., Natsume, W., Braesch-Andersen, S., Watanabe, T., Satake, M.
(2005). A Novel GTPase-activating Protein for ARF6 Directly Interacts with Clathrin and Regulates Clathrin-dependent Endocytosis. Mol. Biol. Cell
16: 1617-1628
[Abstract]
[Full Text]
-
Honda, A., Al-Awar, O. S., Hay, J. C., Donaldson, J. G.
(2005). Targeting of Arf-1 to the early Golgi by membrin, an ER-Golgi SNARE. J. Cell Biol.
168: 1039-1051
[Abstract]
[Full Text]
-
LI, Y., KELLY, W. G., LOGSDON, J. M. JR, SCHURKO, A. M., HARFE, B. D., HILL-HARFE, K. L., KAHN, R. A.
(2004). Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans. FASEB J.
18: 1834-1850
[Abstract]
[Full Text]
-
Hashimoto, S., Hashimoto, A., Yamada, A., Kojima, C., Yamamoto, H., Tsutsumi, T., Higashi, M., Mizoguchi, A., Yagi, R., Sabe, H.
(2004). A Novel Mode of Action of an ArfGAP, AMAP2/PAG3/Pap{alpha}, in Arf6 Function. J. Biol. Chem.
279: 37677-37684
[Abstract]
[Full Text]
-
Prigent, M., Dubois, T., Raposo, G., Derrien, V., Tenza, D., Rosse, C., Camonis, J., Chavrier, P.
(2003). ARF6 controls post-endocytic recycling through its downstream exocyst complex effector. J. Cell Biol.
163: 1111-1121
[Abstract]
[Full Text]
-
Donaldson, J. G.
(2003). Multiple Roles for Arf6: Sorting, Structuring, and Signaling at the Plasma Membrane. J. Biol. Chem.
278: 41573-41576
[Full Text]
-
Sabe, H.
(2003). Requirement for Arf6 in Cell Adhesion, Migration, and Cancer Cell Invasion. J Biochem
134: 485-489
[Abstract]
[Full Text]
-
Kim, S., Ko, J., Shin, H., Lee, J.-R., Lim, C., Han, J.-H., Altrock, W. D., Garner, C. C., Gundelfinger, E. D., Premont, R. T., Kaang, B.-K., Kim, E.
(2003). The GIT Family of Proteins Forms Multimers and Associates with the Presynaptic Cytomatrix Protein Piccolo. J. Biol. Chem.
278: 6291-6300
[Abstract]
[Full Text]
-
Lee, M. H., Min, M. K., Lee, Y. J., Jin, J. B., Shin, D. H., Kim, D. H., Lee, K.-H., Hwang, I.
(2002). ADP-Ribosylation Factor 1 of Arabidopsis Plays a Critical Role in Intracellular Trafficking and Maintenance of Endoplasmic Reticulum Morphology in Arabidopsis. Plant Physiol.
129: 1507-1520
[Abstract]
[Full Text]
-
Schweitzer, J. K., D'Souza-Schorey, C.
(2002). Localization and Activation of the ARF6 GTPase during Cleavage Furrow Ingression and Cytokinesis. J. Biol. Chem.
277: 27210-27216
[Abstract]
[Full Text]
-
Brown, M. C., West, K. A., Turner, C. E.
(2002). Paxillin-dependent Paxillin Kinase Linker and p21-Activated Kinase Localization to Focal Adhesions Involves a Multistep Activation Pathway. Mol. Biol. Cell
13: 1550-1565
[Abstract]
[Full Text]
-
Lu, L., Horstmann, H., Ng, C., Hong, W.
(2002). Regulation of Golgi structure and function by ARF-like protein 1 (Arl1). J. Cell Sci.
114: 4543-4555
[Abstract]
[Full Text]
-
Shinotsuka, C., Yoshida, Y., Kawamoto, K., Takatsu, H., Nakayama, K.
(2002). Overexpression of an ADP-ribosylation Factor-Guanine Nucleotide Exchange Factor, BIG2, Uncouples Brefeldin A-induced Adaptor Protein-1 Coat Dissociation and Membrane Tubulation. J. Biol. Chem.
277: 9468-9473
[Abstract]
[Full Text]
-
Laporte, J., Blondeau, F., Gansmuller, A., Lutz, Y., Vonesch, J.-L., Mandel, J.-L.
(2002). The PtdIns3P phosphatase myotubularin is a cytoplasmic protein that also localizes to Rac1-inducible plasma membrane ruffles. J. Cell Sci.
115: 3105-3117
[Abstract]
[Full Text]
-
Bose, A., Cherniack, A. D., Langille, S. E., Nicoloro, S. M. C., Buxton, J. M., Park, J. G., Chawla, A., Czech, M. P.
(2001). G{alpha}11 Signaling through ARF6 Regulates F-Actin Mobilization and GLUT4 Glucose Transporter Translocation to the Plasma Membrane. Mol. Cell. Biol.
21: 5262-5275
[Abstract]
[Full Text]
-
Lawrence, J. T. R., Birnbaum, M. J.
(2001). ADP-Ribosylation Factor 6 Delineates Separate Pathways Used by Endothelin 1 and Insulin for Stimulating Glucose Uptake in 3T3-L1 Adipocytes. Mol. Cell. Biol.
21: 5276-5285
[Abstract]
[Full Text]
-
West, K. A., Zhang, H., Brown, M. C., Nikolopoulos, S. N., Riedy, M.C., Horwitz, A. F., Turner, C. E.
(2001). The LD4 motif of paxillin regulates cell spreading and motility through an interaction with paxillin kinase linker (PKL). J. Cell Biol.
154: 161-176
[Abstract]
[Full Text]
-
Uchida, H., Kondo, A., Yoshimura, Y., Mazaki, Y., Sabe, H.
(2001). PAG3/Pap{{alpha}}/KIAA0400, a GTPase-activating Protein for ADP-Ribosylation Factor (ARF), Regulates ARF6 in Fc{{gamma}} Receptor-mediated Phagocytosis of Macrophages. J. Exp. Med.
193: 955-966
[Abstract]
[Full Text]
-
Yahara, N., Ueda, T., Sato, K., Nakano, A.
(2001). Multiple Roles of Arf1 GTPase in the Yeast Exocytic and Endocytic Pathways. Mol. Biol. Cell
12: 221-238
[Abstract]
[Full Text]
-
Jobling, M. G., Holmes, R. K.
(2000). Identification of motifs in cholera toxin A1 polypeptide that are required for its interaction with human ADP-ribosylation factor 6 in a bacterial two-hybrid system. Proc. Natl. Acad. Sci. USA
10.1073/pnas.011442598v1
[Abstract]
[Full Text]
-
Vitale, N., Ferrans, V. J., Moss, J., Vaughan, M.
(2000). Identification of Lysosomal and Golgi Localization Signals in GAP and ARF Domains of ARF Domain Protein 1. Mol. Cell. Biol.
20: 7342-7352
[Abstract]
[Full Text]
-
Jobling, M. G., Holmes, R. K.
(2000). Identification of motifs in cholera toxin A1 polypeptide that are required for its interaction with human ADP-ribosylation factor 6 in a bacterial two-hybrid system. Proc. Natl. Acad. Sci. USA
97: 14662-14667
[Abstract]
[Full Text]