Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 6040-6050, Vol. 20, No. 16
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Common Motif within the Negative Regulatory
Regions of Multiple Factors Inhibits Their Transcriptional
Synergy
Jorge A.
Iñiguez-Lluhí1,* and
David
Pearce2
Department of Pharmacology, The University of
Michigan Medical School, Ann Arbor, Michigan
48109-0632,1 and Departments of Cellular
and Molecular Pharmacology and Medicine, University of California, San
Francisco, San Francisco, California
94143-04502
Received 27 March 2000/Returned for modification 5 May
2000/Accepted 23 May 2000
 |
ABSTRACT |
DNA regulatory elements frequently harbor multiple recognition
sites for several transcriptional activators. The response mounted from
such compound response elements is often more pronounced than the
simple sum of effects observed at single binding sites. The
determinants of such transcriptional synergy and its control, however,
are poorly understood. Through a genetic approach, we have uncovered a
novel protein motif that limits the transcriptional synergy of multiple
DNA-binding regulators. Disruption of these conserved synergy control
motifs (SC motifs) selectively increases activity at compound, but not
single, response elements. Although isolated SC motifs do not regulate
transcription when tethered to DNA, their transfer to an activator
lacking them is sufficient to impose limits on synergy. Mechanistic
analysis of the two SC motifs found in the glucocorticoid receptor
N-terminal region reveals that they function irrespective of the
arrangement of the receptor binding sites or their distance from the
transcription start site. Proper function, however, requires the
receptor's ligand-binding domain and an engaged dimer interface.
Notably, the motifs are not functional in yeast and do not alter the
effect of p160 coactivators, suggesting that they require other
nonconserved components to operate. Many activators across multiple
classes harbor seemingly unrelated negative regulatory regions. The
presence of SC motifs within them, however, suggests a common function and identifies SC motifs as critical elements of a general mechanism to
modulate higher-order interactions among transcriptional regulators.
 |
INTRODUCTION |
The development and physiology of
higher eukaryotes rely on the accurate transcription of a large array
of independent genes in response to specific temporal, spatial, and
physiological cues. The information to establish such a complex program
of gene expression is ultimately encoded in the regulatory DNA elements
of each gene. Invariably, such cis-regulatory elements
consist of clusters of recognition sites for various factors, often in
multiple copies or partially overlapping each other (2).
These units nucleate the cooperative assembly of multiprotein complexes
or enhanceosomes (4). The final transcriptional output,
however, is not the simple arithmetic addition of the independent
effects of individual regulators. On the contrary, the integrated
response of the gene is the result of a complex set of logical and
quantitative operations that rely on the combinatorial coordination of
multiple regulatory sites, factors, and signals (56-58).
A central element of this regulatory logic that serves as both an
amplification and specificity mechanism is the more-than-additive, i.e., synergistic, response resulting from the recruitment of a given
activator to multiple copies of a recognition site. This general form
of interaction is observed even with artificial activators and thus may
be an intrinsic consequence of the combinatorial design of eukaryotic
transcription systems (25). The mechanisms and determinants
that enable or control such synergy are poorly understood, yet they are
likely to be important targets of regulation.
Steroid receptors such as the glucocorticoid receptor (GR) are useful
models for studying this form of synergy, since many of their target
cis-regulatory regions harbor multiple receptor binding
sites (6, 21). Furthermore, different receptors display various degrees of synergy at such compound hormone response elements (HREs). Steroid receptors share a common architecture consisting of the
following three major regions. (i) The first is a highly variable
N-terminal domain that harbors transcriptional regulatory functions. In
the case of GR, a transcriptional activation function (AF1, or
enh2) (15, 20) and determinants involved in
repression (36) lie within this domain. (ii) The second is a
central region that harbors dual zinc fingers responsible for specific
DNA recognition and DNA-induced dimerization (DNA binding domain
[DBD]). Critical residues in this domain play a pivotal role in
determining the regulatory outcome of interactions with other
regulators (47). (iii) Finally, the third is a C-terminal
ligand-binding domain (LBD) harboring a second activation function
(AF2) that operates as a ligand-dependent surface for interaction with
coactivators (7, 45).
Both the N- and C-terminal transcriptional activation functions of
steroid receptors contribute to synergy, but it is unclear whether
effects on synergy can be dissociated from effects on activation per se
(31, 42, 55). The mechanism of synergy is not fully
understood, but in several instances, cooperative binding to compound
sites correlates with synergistic activation (49, 55). In
the case of the androgen receptor (AR), interactions between the N- and
C-terminal domains contribute to this effect (19, 42). For
GR derivatives lacking the LBD, synergy and cooperative binding appear
to depend on sequences within the N-terminal activation function
(55). In certain promoter contexts, however, synergy occurs
in the apparent absence of cooperative DNA binding (3, 38).
A number of observations suggest that steroid receptors harbor
additional determinants that limit or control the extent of synergy.
Recently, Liu et al. (27) discovered an important role for
the DBD dimer interface in restraining steroid receptor synergy. Disruption of this interface, although deleterious for receptor activity at a single site, leads to a marked enhancement of activity at
compound HREs (27). In addition, N-terminal determinants may
also participate to restrain synergy. In contrast to GR, the closely
related mineralocorticoid receptor (MR) displays weak synergy, and this
difference maps to the N-terminal region. Moreover, deletion of the
N-terminal regions of GR and MR produces equally strong and highly
synergistic activators. This suggests that the N-terminal regions of MR
(and to a lesser extent of GR) interfere with synergy (27,
40).
The characterization of many different transcription factor families
indicates that in addition to DBDs and transcriptional activation
regions, many regulators harbor "negative" regulatory functions.
Deletion of such silencing, attenuator, or negative domains enhances
transcriptional activation. Although some do function as bona fide
repression domains by actively repressing transcription, the mode of
action of these seemingly disparate regions remains obscure. Through
our analysis of the N-terminal transcriptional regulatory region (AF1)
of GR, we have now identified a novel synergy control motif (SC motif)
that underlies the function of the negative regulatory regions of
multiple transcription factors. These motifs operate not by affecting
the intrinsic activity of an activator, but by regulating their ability
to synergize at compound response elements. We define here the
functional determinants of these SC motifs and explore their mechanism
of action.
 |
MATERIALS AND METHODS |
Mammalian expression plasmids.
The plasmids p6RGR and
p6RGRN525 (14) allow the expression of full-length rat GR
and a deletion lacking amino acids 526 to 795, respectively. The
original collection of multiply substituted AF1 mutants has been
described previously (20). Digestion of a pBluescript
derivative harboring an 860-bp BglII-PstI GR
fragment with SmaI and Bsp120I, blunting, and
religation produced a precise deletion of amino acids 310 to 317 that
was then transferred as a 681-bp BstXI-PstI
fragment into the same sites of p6RGR. Some individual amino acid
changes were introduced by site-directed mutagenesis (23)
and confirmed by sequencing. The K297E/I312T double mutant was
transferred to the DBD dimer interface mutants p6RGR R479D and p6RGR
D481R (27) as a 634-bp NcoI-ApaI
fragment. The above plasmids as well as the empty (pS6R) and control
-galactosidase (p6R-
gal) (36) expression vectors are
Rous sarcoma virus promoter-driven derivatives of p65. The human AR
K385E, K518E, and K385E/K518E mutants were engineered into the pCMV5
derivative p5HBhAR-A (a kind gift of D. Merry, University of
Pennsylvania) by PCR and confirmed by sequencing. The human ETS-1 K15E,
K227E, and K15E/K227E mutants were obtained in a similar manner from
pSG5hETS-1 (44).
To generate the Gal4 DBD fusion constructs, p6RGR was PCR amplified
with oligonucleotides 5'cgcgaagcttggatccagcagtgtggcactgcccc3' and
5'ctcggaattcgcggccgcttaagatctaaagcttgcctgacaataaactgggcc3', and the product was digested with enzyme pairs BamHI
and BglII or BamHI and NotI (filled
in). The resulting fragments were ligated to pGal4(VP16)2
(11) that had been digested with BamHI or
BamHI and XbaI (filled in). This yielded
pGal4(SC)2(VP16)2 and pGal4(SC)2, respectively. In these constructs, rat GR amino acids 287 to 327 are
placed between the Gal4 DBD and the tandem VP16 activation domains or
fused to the Gal4 DBD alone, respectively. The corresponding derivatives with mutant SC motifs were constructed identically. Coactivator expression plasmids pSG5.HA-GRIP1 and pSG5.HA-SRC-1a have
been described previously (5).
Reporter plasmids.
Reporter plasmids were constructed by
inserting double-stranded oligonucleotides or PCR products harboring
response elements at the indicated site(s) (in parentheses) of the
basal reporter p
ODLO. This positions the elements upstream of the
minimal Drosophila distal alcohol dehydrogenase promoter
(
33 to +55) and the luciferase gene. The inserts for the different
reporters are as follows: p
TAT1-Luc,
gtcgagcTGTACAGGATGTTCTAGCTACgtcgac;
p
TAT2-Luc,
gtcgacatcagaatacagacctcAGAACATCCTGTACAgacctcAGAACATCCTGTACAacctcgtcgac; p
TAT3-Luc,
gtcgacGTAGCTAGAACATCCTGTACAGctcgacCTGTACAGGATGTTCTAGCTACgtcgagCTGTACAGGATGTTCTAGCTACcagctc; p
TAT2-16,
gtcgacgacgtcTGTACAGGATGTTCTaTGTACAGGATGTTCTgtcgag; p
TAT2-21,
gtcgacgacTGTACAGGATGTTCTactagtTGTACAGGATGTTCTaacgactgtcgac; p
TAT2-26,
gtcgacgacTGTACAGGATGTTCTactagtaacgaTGTACAGGATGTTCTaacgatgtcgac; p
TAT1/4S,
gtcgacggaggtcTGTACAGGAaTGTTCTgatgtcgac;
p
TAT3/4S, gtcgacggaggtcTGTACAGGAaTGTTCTgaggtcTGTACAGGAaTGTTCTgaggtcTGTA CAGGAaTGTTCTgatgtcgac; and p
TAT2-SpeI,NheI,
gtcgacgaggtcTGTACAGGATGTTCTgaggtcTGTACAGGATGTTCTactagtgctagcgtcgac. The SalI site of p
ODLO was used for the above
inserts, and the rat TAT gene and HRE half-site sequences within them
are in uppercase and underlined, respectively.
p
(ETS-1)1DLO
aagcttcggccaagccGGAagtgagtgcctgcag (HindIII-PstI)
was also used, as was
p
ENDOA-Luc, the 259-bp PCR product from mouse genomic DNA with
primers cagctaagcttcctctgAGGCTTTTGCTGTT and
gctagctgcagAAGTCAGGGGACTGGGAGAT
(HindIII-PstI). The genomic sequences
are shown in uppercase. Finally, we constructed
p
(Gal4)1DLO (aagcttctcgagCGGAGGACTGTCCTCCGttgtcgac
[HindIII-SalI] and
p
(Gal4)2DLO (agctCGGAGGACTGTCCTCCGttctcgagaaCGGAGGACAGTCCTCCG
[HindIII]).
Ligation of the 67- and 118-bp HpaII fragments from
pBluescript KS(
) at the filled-in SpeI and NheI
sites of p
TAT2-SpeI,NheI generated
p
TAT2 US100 and p
TAT2 US150,
respectively. In the reporter pG5E1b-Luc, five Gal4 sites upstream of
the E1b promoter drive expression of the luciferase gene.
Mammalian cell culture and transfections.
Monkey CV-1 cells
were maintained in Dulbecco's modified Eagle medium (DME H16; GIBCO
BRL) supplemented with 7.5% fetal bovine serum. Cells were transfected
by the calcium phosphate precipitation method (Fig. 2 only)
(20) or by liposome-mediated transfection as follows: 3 × 104 cells were seeded in 24-well plates (0.4 ml) 24 h prior to transfection. At a 1:1 L-
-dioleoyl
phosphatidylethanolamine (DOPE)/1,2-dioleoyl-3-trimethylammonium propane (DOTAP) ratio, liposomes (16) were incubated with
0.45 µg of total plasmid DNA (15 nmol of DOTAP/µg of plasmid) for
15 min at room temperature and added to the cells (50 µl). After overnight incubation, cells were washed with phosphate-buffered saline
and further incubated for 24 h in medium supplemented with 7.5%
charcoal-stripped serum in the presence of agonist or vehicle (0.1%
ethanol). Where indicated, Lipofectamine (2 µl) and Plus reagent (2 µl) (GIBCO BRL) were used instead of DOPE and DOTAP liposomes.
Luciferase and
-galactosidase activities were determined as
described previously (20). In addition to the plasmids
indicated in the figure legends, all transfections included 0.25 µg
(Ca-PO) or 0.05 µg (lipofection) of the p6R
-gal control plasmid
and sufficient carrier DNA (pBluescript) to achieve a total of 4.25 µg (Ca-PO) or 0.45 µg (lipofection) of DNA. For all of the mutants
described, no effect was observed in the absence of agonist, and in
some cases, only the data in its presence are shown.
Electrophoretic mobility shift assays.
In vitro
transcription and translation reactions (SP6; Promega TNT) were
programmed at a 1-mg/ml final concentration with empty pSP64T [a pSP64
derivative harboring 5' and 3' untranslated
-globin sequences,
including a 23-bp poly(A) tract, downstream of the SP6 promoter],
pSP64T-N795, or pSP64T-N795 K297E/K313E. These plasmids were
constructed by inserting a 2,541-bp BamHI fragment from the
corresponding p6RGR derivatives at the BglII site between
the 5' and 3'
-globin sequences of pSP64T. Expression was confirmed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and
immunoblotting with the antibody BuGR-2 (12). For binding reactions, reticulocyte lysates (4 µl) were mixed with 3 µl of reaction mix [40 mM HEPES (pH 7.9), 140 mM KCl, 33.3% glycerol, 14.7 mM MgCl2, 10 mM dithiothreitol, 33.3 µg of poly(dI-dC)
per ml, 1 µM the double-stranded blunt-ended nonspecific
oligonucleotide (5'ctctcgccctcgtcgcccacgtggcgtcggc3')] and
preincubated for 20 min at 4°C. Reactions (20 min, 24°C) were
initiated by the addition of 3 µl of DNA mixture containing
approximately 1 nM 32P-labeled double-stranded
TAT1 oligonucleotide at 3 × 106 cpm/pmol
and the indicated concentrations of unlabeled TAT1 or TAT2 competitor DNA. The reactions were then resolved at
room temperature on a prerun (20 min) 0.5× Tris-borate-EDTA-4%
(37.5:1 acrylamide-bisacrylamide) polyacrylamide gel at 200 V. Bound
and free species were quantitated without drying with a PhosphorImager (Molecular Dynamics). The TAT1 probe was prepared by
annealing oligonucleotides
5'ccgggcgttgcCTGTACAGGATGTTCTAatctgag3'
and
5'gatcctcagatTAGAACATCCTGTACAGgcaacgc3' and radiolabeling (
-[32P]dCTP) with the Klenow
fragment of RNA polymerase. The TAT2 competitor, an 87-bp
HindIII-XbaI fragment of
p
TAT2-Luc
(5'aagcttgcatgcctgcaggtcgacatcagaatacagacctcAGAACATCCTGTACAgacctcAGAACATCCTGTACAacctcgtcgactctaga3') was purified from a 15% preparative polyacrylamide gel.
TAT2 DNA concentrations were determined by fluorometry in
the presence of Hoechst 33258 with calf thymus DNA as a standard.
Yeast strains and plasmids.
The Saccharomyces
cerevisiae strain W303-1a (MATa ade2-1 trp1-1
ura3-1 leu2-3,112; his3-11,15 can1-100) was grown in minimal
medium with amino acids and 2% glucose. Plasmid selection was
maintained by culture in medium lacking the appropriate nutrients. The
K297E/I312T mutations were transferred as 1,163-bp
NcoI-SphI fragments from the p6RGR version into
pRS314 G-N795 (Trp1, CEN/ARS) putting them under the control of the
constitutive yeast glyceraldehyde-3-phosphate dehydrogenase promoter
(24). The 2µm Ura3 reporter plasmids pUC
SS,
pUC
S1Gs3, pUC
S2X3S, and p
S26X (59) consist of a
minimal CYC-1 promoter linked to no HREs, a single perfectly
palindromic HRE, two perfectly palindromic HREs, or three copies of the
HRE from the TAT gene, respectively, and drive the expression of the Escherichia coli lacZ gene. The 2µm Leu2 GRIP1 expression
plasmid pGAD424-GRIP1 has been described previously (10).
Cells were cultured for 16 h in the presence or absence of the
indicated amounts of deoxycorticosterone and assayed as described
previously (20).
 |
RESULTS |
GR N-terminal mutants with enhanced activity.
One of us
previously generated a library of mutants designed to contain multiple
random substitutions (12 on average) throughout the AF1 region (amino
acids 108 to 317) of rat GR and through a genetic screen identified
critical residues within a small central subregion (amino acids 219 to
234) essential for transcriptional activation (20).
Unexpectedly, during the characterization of mutants with substitutions
outside of the critical activation region, we identified two with
enhanced activity (Fig. 1). Mutants AF1-27III and AF1-30III are 12- and 3-fold more active than the wild-type (WT) receptor at a compound HRE (three copies of a tyrosine aminotransferase gene HRE, TAT3). These mutants harbor
eight and four substitutions, respectively, C terminal to the
previously defined activation function. Notably, for both mutants, the
effect is recapitulated by three (K297E/F303S/I312T; AF1-27IIIB) or two (Q295H/K313E; AF1-30IIIB) substitutions present within the last 24 residues of AF1 (Fig. 1).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
AF1 mutants that enhance activity map C terminal to the
activation function. CV-1 cells were transfected with the reporter
plasmid p TAT3-Luc (0.2 µg) and vectors for the
expression of full-length GR (0.02 µg), either WT or containing
segments (in black) from mutants 27 (top) or 30 (bottom) in an
otherwise WT background. Cells were treated with vehicle (Veh.) or 10 nM dexamethasone (DEX). Left, diagram of the constructs used. The
number of substitutions in each construct is shown in parentheses. The
critical region for transcriptional activation is boxed in gray. The
boundary between regions IIIA and IIIB lies at amino acid 289. Right,
activity relative to that of the WT. Data are the averages of three to
four independent transfections performed in triplicate and are
normalized to the WT activity in the presence of dexamethasone
(2.0 × 105 U). In this and other figures, the measure
of dispersion used is the standard error of the mean.
|
|
The enhanced activity is due to an increase in synergy at compound
HREs.
At a compound HRE, both the intrinsic receptor activity and
the ability of adjacently bound receptors to synergize contribute to
the final response. To explore whether the mutations affect either
property, we generated agonist dose response curves for either single
(TAT1) or compound (TAT3) HREs. At the compound HRE (Fig. 2, right), the AF1-27IIIB
mutant displayed enhanced activity compared to the WT throughout the
dose response. Half-maximal stimulation, however, occurred at the same
agonist concentration. Thus, it is likely that the mutations render GR
a more effective activator without altering ligand binding. If this
were due to a higher intrinsic activation potential, the activity at a
single HRE should also be enhanced. On the contrary, the mutant was
indistinguishable from the WT at the TAT1 reporter (Fig. 2,
left). These surprising results indicate that rather than increasing
the expression or intrinsic activity of the receptor, the mutations
enhance the ability of individual receptors to engage in synergy. Thus,
the ratio of activities at TAT3 and TAT1, an
index of synergy, is 9.7 for the WT receptor, whereas for the mutant,
it reaches 61.5. This effect was preserved across a wide concentration
range of expression plasmid, suggesting that it is unlikely to be due
to a relief of squelching (data not shown).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Enhanced activity mutations cause increased agonist
efficacy at a compound, but not at a single HRE. CV-1 cells were
transfected by the calcium phosphate method with 2 µg of reporter
plasmid p TAT3-Luc (right) or p TAT1-Luc
(left) and 0.2 µg of pS6R (Vector), p6RGR (WT), or p6RGR 27IIIB (27 IIIB) and treated with the indicated concentrations of dexamethasone
(DEX). Data represent the averages of three independent transfections
performed in duplicate and are expressed as a percentage of the maximal
WT activity: 9.6 × 104 U for TAT1 and
9.4 × 105 U for TAT3.
|
|
A short motif defines a synergy control domain.
To define the
determinants responsible for the enhanced synergy phenotype, we
characterized the individual substitutions present in mutants
AF1-27IIIB and AF1-30IIIB as well as additional mutations in this
region. The analysis at single or compound HREs (Fig. 3) coupled with sequence comparison
across species revealed that the substitutions that enhance synergy lie
within two copies of a conserved motif. This short SC motif has the
form (I/V)K(T/Q)E and is preceded within three residues by a Pro
residue (Fig. 3). For the second motif, replacement of Ile 312 at the
first position with Val, which is found in other species and in the
first motif, has no consequences. Thr or Asn substitutions, however,
cause a two- to threefold enhancement in activity. At the second
position, replacing Lys with Glu in either the first or second motif
yields a more pronounced four- to fivefold effect. Interestingly, Lys features other than charge are important, since Arg substitutions at
this position are equally disruptive (see below). A Glu315Gly substitution at the fourth position of the second motif causes a
twofold increase, whereas deletion of the entire motif enhances activity threefold. Other substitutions outside of the motifs (Q295H
and F303S) are without effect. The two motifs cooperate functionally,
since double mutants lead to a much more pronounced 8- to 12-fold
effect. This is why the original AF1-27III mutant (K297E/I312T) has a
more dramatic effect than AF1-30III (K313E). None of the alterations
influenced receptor activity at a single site (Fig. 3) or in the
absence of hormone (not shown). Taken together, these results indicate
that many different substitutions are effective, implying that the
normal role of the motifs is to restrain synergy and that the mutations
disable their function.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
SC mutants identify two copies of a short amino acid
motif. CV-1 cells were transfected with 0.2 µg of reporter plasmid
p TAT1-Luc (black bars) or p TAT3-Luc
(hatched bars) and 0.02 µg of expression plasmids for WT full-length
GR or the indicated mutants. Cells were treated with 10 nM
dexamethasone and assayed as described in Materials and Methods. At
left is a diagram of the location and sequence of the relevant region
with the motifs boxed. The mutations tested are shown below. Data
represent averages of three to four independent transfections performed
in triplicate and are expressed as a percentage of the WT activity:
7.6 × 104 U for TAT1 and 2.7 × 105 U for TAT3.
|
|
SC motifs are functional in other factors and operate at natural
response elements.
By examining other steroid receptors, we
identified several SC motifs throughout their otherwise very divergent
N-terminal regions: four in MR, two in AR, a single one in the
progesterone receptor (PR), and none in the estrogen receptors
and
(see Fig. 5A). In the case of AR, disruption of either motif led to a two- to threefold enhancement at TAT3 and together
yielded a fivefold increase in activity (Fig.
4A). As for GR, the mutations had no
significant effect at a single HRE. Similarly, when analyzed in the
context of an MR construct lacking motifs 1 and 4, Lys-to-Glu substitutions in motifs 2 and 3 enhanced receptor activity at compound
HREs (not shown). Interestingly, the motif in PR lies within and is
likely to be responsible for the function of a recently proposed
negative modulation domain (307 to 427 in human PR). Deletion of this
region enhances activity, whereas its duplication renders PR a very
poor activator at compound HREs (18).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of SC mutations in various activators. CV-1 cells
were transfected with the indicated plasmids and assayed as described
in Materials and Methods. (A) AR. Cells were transfected with 0.2 µg
of p TAT1-Luc (black bars) or p TAT3-Luc
(hatched bars) and 0.2 µg of either p5HBhAR expression plasmid or the
indicated mutants and treated with vehicle (Veh.) or 100 nM
dihydrotestosterone (DHT). Data from four to eight independent
transfections performed in triplicate are expressed as a percentage of
the activity of the WT at TAT3 in the presence of DHT
(4.5 × 104 U). (B) ETS-1. Cells were transfected
(Lipofectamine) with the indicated amounts of pSG5 ETS-1 or the
indicated mutants and 0.1 µg of p (ETS-1)1DLO (left) or
p ENDOA-Luc (right). Data are expressed as fold induction over
reporter alone (1.6 × 103 and 5.3 × 103 U, respectively) and represent three independent
transfections performed in quadruplicate. (C) Gal4-VP16 fusions. Cells
were transfected with 0.1 ng of the indicated Gal4 DBD fusion proteins
and 0.1 µg of reporter plasmids harboring either one,
[p (GAL4)1DLO], two [p (GAL4)2DLO], or
five (pG5E1b) Gal4 sites. Data are the average of four replicates from
a representative experiment. Similar results were obtained in three
other transfections using other amounts of the activators. (D) GR N525
derivatives. Cells were transfected with 0.2 µg of reporter plasmid
p TAT1-Luc or p TAT3-Luc and 0.1 µg of
expression plasmid p6RGR N525 derivatives. Data represent the average
of three independent transfections performed in quadruplicate.
|
|
Initial database searching revealed that transcription factors from
other families harbor conserved SC motifs. We identified two of them in
the ETS-1 proto-oncogene: one near the extreme N terminus and another
upstream of the DBD, but outside of the "autoinhibitory" domain
(46) (Fig. 5A). To our
knowledge, no function has been assigned to these regions. To examine
their role, we disrupted the motifs individually and in combination and
assayed the mutants at a single high-affinity binding site (33) or at a natural compound response element from the
Endo-A cytokeratin gene that harbors seven tandem ETS-1 binding sites (44). As shown in Fig. 4B, the mutations did not alter the
activity of ETS-1 significantly at a single site. In contrast, either
mutation increased the activity at the Endo-A enhancer and, when
combined, yielded a fourfold enhancement. These results indicate that
SC motifs limit synergy in multiple classes of regulators and that they
function at natural compound elements.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
SC motifs in various transcription factors. (A) Solid
vertical bars indicate SC motifs, whereas a bracket indicates regions
of demonstrated negative function. (B) Sequence alignment of functional
SC motifs. For each entry, core motif residues are boxed, flanking Pro
residues are underlined, and residues absolutely conserved in different
species or that match the consensus (lower left) are in uppercase.
Motifs found in negative regulatory regions are at right, and other
selected conserved motifs are shown below. r, rat; h, human.
|
|
Based on the eight SC motifs we have defined functionally and by
comparing their across-species conservation, we obtained a more refined
definition for SC motifs (Fig. 5B). The core of the motif is composed
of an Ile or Val residue at the first position followed by invariant
Lys and Glu residues at positions 2 and 4. At the third position, a
small subset of amino acids can be accommodated. In addition, a Pro
residue is usually present within the four or five residues preceding
or following the core of the motif. In fact, in most cases both
upstream and downstream, Pro residues are present. The additional
motifs in MR and PR (Fig. 5B) match the consensus and hence are likely
to be functional.
A search for the occurrence of SC motifs in the SwissProt database
revealed that it appears at a frequency of 3.1% of protein sequences
(SwissProt release 38). This value is marginally higher than the
predicted random occurrence (2.7%). Notably ~20% of them are
transcriptional regulatory factors. This fraction reaches 63% (38 of
60 matches) if the search is restricted to human proteins with motifs
having both upstream and downstream prolines. Furthermore, in many
cases, the motifs, but not the adjacent sequences, are conserved in
different species, suggesting a selective pressure for their
maintenance. For example, several orphan intracellular receptors
(ERR
, -
and -
, OR-1, TR-2, ROR
, and SF-1), as well as other
factors, like SREBP-1 and multiple members of the SOX family of
developmental regulators (SOX 1, 2, 3, 9, 10, and 11), harbor conserved
SC motifs (Fig. 5A). Notably, for several factors across multiple
activator classes, like PR, Sp3, C/EBP
, and c-Myb, the motifs reside
in demonstrated negative regulatory regions (1, 9, 18, 54).
Since these negative regions were defined at compound response elements
and share several properties (addressed in Discussion) with the motifs
we have described, it is likely that rather than being conventional
repression domains, they represent examples of synergy control. Taken
together, these results suggest that SC motifs are critical elements of
a general mechanism to control the synergy of regulators at compound
response elements. By using GR as a paradigm, we have begun to define
the features of both the regulator and the response element required
for appropriate control of synergy and to dissect the underlying mechanisms.
SC motifs limit synergy autonomously without altering intrinsic DNA
binding.
Our analysis of multiple activators indicates that SC
motifs function in different contexts and are required for appropriate synergy control. For a sufficiency test, we incorporated a small region
of GR encompassing both SC motifs into the synthetic activator Gal4(VP16)2. As shown in Fig. 4C and observed previously
(11), Gal4(VP16)2 displays a high degree of
synergy. Introduction of the WT SC motifs, however, is sufficient to
selectively reduce activity at compound but not single Gal4 sites. This
effect requires functional SC motifs, since disabling mutations in them
restore synergy (Fig. 4C). Notably, when fused to the Gal4 DBD alone, both the WT and mutant motifs failed to activate or repress
transcription directly (not shown). These fusions, however, retained
DNA binding, since they were able to displace Gal4(VP16)2
(not shown). Furthermore, in contexts in which GR functions as a
repressor of other factors, like AP-1 or NF-
B, disruption of the SC
motifs has no consequences (20; data not shown).
Thus, SC motifs are transcription regulatory sequences that operate
unlike conventional repression regions; they are silent on their own,
but limit the degree of synergy mediated by an independent activation function.
Two such functions (AF1 and AF2) have been identified in GR. Removal of
the LBD and its associated AF2 function by truncation at position 525 generates a ligand-independent activator that relies on AF1 for
function. Although this derivative displays substantial synergy
(TAT3/TAT1 ratio of ~20), it is insensitive to disruption of the SC motifs (Fig. 4D). On the other hand, although disruption of AF1 by three clustered substitutions reduces full-length receptor activity (20), inactivation of the SC motifs in
this context still enhances synergy (not shown). Hence, it appears that
the SC motifs limit synergy emanating from activation functions other
than AF1. Together with the data presented above, this implies that the
effect of SC motifs may be restricted to a subset of activation
functions that include VP16, one or more activation functions in ETS-1,
and, likely, the AF2 (but not AF1) of steroid receptors.
One of the proposed mechanisms for synergy is cooperative binding to
compound sites (49, 55). In fact, GR displays a
substantially higher apparent binding affinity for a pair versus a
single binding site, especially when the sites are closely positions on
the same side of the DNA helix (43). We therefore examined
the effect of SC motif mutations on the ability of GR to bind to single
or compound response elements. As shown in Fig.
6, the apparent affinity of the receptor
to a pair of sites spaced by 21 bp is substantially higher than the
affinity for a single copy. Notably, disruption of the SC motifs did
not significantly alter this behavior, even though it enhanced activity
at this specific compound element (see below). These results suggest
that the mutations do not alter the intrinsic DNA binding properties of
the receptor, and therefore SC motif function is likely to involve
events subsequent to DNA recognition.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 6.
DNA binding by GR is not affected by SC mutations. (A)
In vitro transcription-translation reactions (3 µl) programmed with
empty vector or vectors for the expression of either WT or K297E/K313E
full-length GR were analyzed for receptor expression by immunoblotting
with the monoclonal antibody BuGR-2. (B) Electrophoretic mobility shift
assays were performed as described in Materials and Methods in the
absence (Probe) or presence of reticulocyte lysates harboring no
receptor (Vector), full-length WT GR, or the K297E/K313E mutant. The
positions of the free TAT1 probe and GR-DNA complex are
shown to the left. (C) Electrophoretic mobility shift assays were
carried out with lysates containing WT receptor (squares) or the
K297E/K313E mutant (circles) as in panel B in the presence of the
indicated concentrations of unlabeled DNA harboring one
(TAT1 [open symbols]) or two (TAT2 [solid
symbols]) receptor binding sites (21-bp spacing). No competition was
observed with a nonspecific oligonucleotide. Data represent the average
of three to four independent experiments and are expressed as a
percentage of the maximal binding observed. This value did not exceed
5% of the total amount of labeled probe and was comparable to the
binding observed in the absence of cold specific competitor.
|
|
Synergy control is functional at various compound HRE
configurations.
For both natural and synthetic enhancers, the
extent and direction of functional interactions between regulators can
depend strongly on specific spatial relationships between their binding sites (13, 22, 35). We thus explored the consequences of varying a number of binding site parameters on the activity of GR
bearing either WT or mutant (K297E/I312T) SC motifs. As seen in Fig.
7A, the phenotype of the mutant requires
more than one binding site and becomes more prominent as the number of
sites is increased. This confirms that GR's potential to synergize is restricted and that the mutations relieve such constraints. We observed
similar effects when using a perfectly palindromic site or an HRE
derived from the phosphofructokinase gene instead of the TAT sequence
(not shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the effects of SC mutations on GR activity
at reporters with various numbers, spacings, and locations of GR
binding sites. GRE, GR element. CV-1 cells were transfected with 0.02 µg of the expression plasmid p6RGR (WT) or p6RGR K297E/I312T (Mutant)
and 0.2 µg of the following reporter plasmids: p ODLO,
p TAT1-Luc, p TAT2-Luc, and
p TAT3-Luc (A); p TAT2-16,
p TAT2-21, and p TAT2-26 (B);
p TAT2-Luc, p TAT2-US100, and
p TAT2-US150 (C); and p TAT1-Luc,
p TAT3-Luc, p TAT1/4S, and
p TAT3/4S (D). Cells were treated with vehicle or 10 nM
dexamethasone and assayed as described in Materials and Methods. Data
represent averages of 3 to 11 independent transfections performed in
triplicate. The ratio of mutant over WT activity is indicated above
each set of bars.
|
|
The spacing between two adjacent HREs alters their phasing along the
DNA and influences receptor binding and activity (43). In
keeping with previous results, when two HREs are presented on the same
face of the DNA (center-to-center distance of 21 bp), the receptor
activity was highest (Fig. 7B). When the sites are brought closer or
separated by a half-turn of B-DNA (16- and 26-bp spacing,
respectively), and thus put out of register, receptor activity was
reduced. In all cases, however, disruption of the SC motifs led to
enhanced activity (Fig. 7B). Like for other regulators, the distance
between HREs and the transcription start site influences steroid
receptor activity (32, 41). As a pair of HREs is separated from the TATA box, receptor activity is reduced. Nevertheless, the
mutant receptor invariably displayed enhanced activity (Fig. 7C). Taken
together, these results indicate that within the range examined, the
effect of the SC motifs depends neither on the spacing between binding
sites nor on the distance to the TATA box.
Individual steroid receptor binding sites are composed of two
half-sites separated by 3 bp. DNA recognition involves the cooperative binding of receptor monomers to each half-site via a DNA-induced dimerization interface in the DBD. Increasing the spacing to 4 bp
severely compromises WT and mutant receptor activities at a single
site, presumably by disfavoring the dimer interface (Fig. 7D). When
this site is present in multiple copies, however, receptor activity is
surprisingly high and approaches that of the receptor at the compound
HRE with the appropriate 3-bp spacing (Fig. 7D). This is consistent
with the observation that disruption of the DBD dimer interface via
receptor mutations strongly compromises activity at a single site but
leads to an enhanced receptor synergy at compound HREs (27).
Interestingly, in the context of a 4-bp spacing, mutation of the SC
motifs has no enhancing effect. These results suggest that at certain
compound HREs that disfavor dimerization, a relief from SC may
compensate for the loss in DNA binding. A natural example of this may
be the mouse mammary tumor virus compound HRE. This element harbors
multiple receptor binding sites, but in each case, one of the
half-sites diverges substantially from the consensus. GR activity at
this element is highly synergistic, and SC mutations are ineffectual in
this context (not shown). Taken together, these results suggest that in
steroid receptors, both the SC motifs and the DBD dimer interface play
critical roles in restraining synergy.
Functional relationship between the synergy control domain and the
DBD dimer interface.
The results presented above indicate that
disruption of the DBD dimer interface, like mutations in the SC motifs,
leads to increased activity at compound HREs. In contrast to the dimer mutants, however, disruption of the SC motifs does not affect activity
at a single site. To explore the interaction of both types of
mutations, we examined the effect of DBD dimer interface mutants in the
context of WT or mutant SC motifs. Both crystallographic (28) and genetic (27) data revealed that
complementary salt bridges between Arg 479 of each monomer with Asp 481 of the opposite partner are integral parts of the dimer interface. As
seen in Fig. 8, disruption of this
interface by replacement of Arg 479 with Asp or Asp 481 with Arg leads
to a dramatic loss of activity at a single site. The response of these
mutants at a compound HRE, however, is enhanced compared to that of the
WT receptor (Fig. 8, top) (27). Although each substitution
disfavors homodimerization, the reciprocal nature of the salt bridges
suggests that the two mutant receptors could reestablish a dimer
interface through heterodimerization. In fact, when both mutant
receptors are coexpressed, receptor activity is restored at a single
site and synergy is reduced to WT levels at the compound HRE (Fig. 8,
top) (27). These results show that, like for the SC motifs,
disruption of the dimer interface leads to a loss of synergy control.
The same series of experiments, but in the context of mutant SC motifs
(Fig. 8, bottom), indicated that at a single site, the SC motifs have
no effect on their own and they do not affect the behavior of the dimer
mutants (Fig. 8, bottom left). At the compound HRE, and similar to the
dimer mutants, disruption of the SC motifs causes an enhancement of activity. Combination of both types of mutations, however, does not
lead to any additional enhancement (Fig. 8, bottom right).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 8.
Functional interaction between the DBD dimer interface
and SC motifs. CV-1 cells were transfected with 0.2 µg of reporter
plasmid p TAT1-Luc (left) or p TAT3-Luc
(right) and 0.02 µg of expression plasmids for WT full-length GR or
the indicated mutants (Mut). Coexpression was performed with 0.01 µg
of each mutant expression plasmid. The top and bottom panels represent
the effect of dimer mutants in the context of WT and the K297E/I312T
mutant, respectively. Cells were treated with 10 nM dexamethasone and
assayed as described in Materials and Methods. Data represent averages
of three to seven independent transfections performed in triplicate and
are expressed as a percentage of the corresponding WT activity:
4.7 × 104 U for TAT1 and 2.6 × 105 U for TAT3.
|
|
Thus, it appears that appropriate synergy control requires both the SC
motifs and a WT dimer interface. Moreover, since the SC motif and dimer
interface effects are not additive, it is likely that they involve
common or converging mechanisms.
Synergy control requires additional factor(s), but does not alter
receptor sensitivity to p160 coactivators.
Reconstitution of a
regulatory pathway in a heterologous system is a powerful approach to
the identification and characterization of its components. We therefore
examined whether the function of the SC motifs can be recapitulated in
S. cerevisiae. In contrast to their behavior in mammalian
cells, disruption of the SC motifs has no detectable phenotype in yeast
(Fig. 9A). Given that the SC motifs in GR
appear to target synergy afforded by the LBD, we examined whether
sensitivity to the SC motifs in yeast could be restored by coexpression
of the AF2 coactivator GRIP-1. As shown in Fig. 9B, however, this is
not the case, suggesting that additional components may be required for
SC motif function. Consistent with this idea, the activity of both the
WT and mutant receptors was enhanced in mammalian cells by coexpression
of GRIP-1 (Fig. 9C) and SRC-1a (not shown), suggesting that the motifs
do not alter the sensitivity of the receptor to these p160
coactivators. Taken together, these results suggest that the effect of
SC motifs is not an intrinsic property of the receptor, but rather, the expression of this regulatory feature requires an appropriate cellular
environment.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 9.
SC motifs are silent in yeast and do not alter the
effect of p160 coactivators. (A) Yeast cells harboring Trp1-based
expression plasmids for either full-length WT GR or the K297E/K313E
mutant were transformed with Ura3-based reporter plasmid harboring no
HREs (pUC SS), a single palindromic HRE (pUC S1Gs3), two
palindromic HREs (pUC S2X3S), or three TAT HREs (p s26X). (B) Yeast
cells harboring the above receptor plasmids and the p s26X reporter
were transformed with the GRIP1 expression vector pGAD424-GRIP1 or a
control plasmid. Cells were grown in the presence of 10 µM (A) or the
indicated amounts (B) of deoxycorticosterone (DOC) and assayed as
described in Materials and Methods. The data represent averages of four
to six independent transformants. (C) CV-1 cells were transfected by
lipofection with 0.2 µg of p TAT3-Luc, 0.02 µg of
p6RGR WT or K297E/K313E, and 0.1 µg of a mixture of pSG5 vector and
the indicated amounts of pSG5.HA-GRIP1. Cells were treated with vehicle
(Veh.) or 10 nM dexamethasone (DEX) and assayed as described in
Materials and Methods. Data represent averages of three independent
transfections performed in triplicate.
|
|
 |
DISCUSSION |
Synergy as a target for regulation.
We have uncovered a novel
functional region defined by one or more copies of a short amino acid
motif that restrains the ability of regulators to engage in synergy.
Importantly, these SC motifs influence neither the intrinsic
transcriptional activation nor the DNA binding properties of the
activator. SC motifs appear to be devoid of intrinsic activation or
repression properties and map to regions other than activation
functions. This reveals that features involved in controlling synergy
are distinct from transcriptional activation per se. Like activation
functions, however, these motifs cooperate functionally and can be
transplanted to heterologous proteins. These features, coupled with
their ability to operate in many compound response element
configurations, make SC motifs well suited for the general control of
transcription factor synergy.
SC motifs as a common feature of many negative regions.
SC
motifs occur frequently within documented negative regulatory regions
of numerous transcription factors and may account for a number of
functional differences among members of individual families. In the
cases we have explored and describe below, several common features
point toward the importance of SC motifs and suggest that a common
synergy control mechanism participates in the function of these
seemingly disparate regions.
(i) Steroid receptors.
To our knowledge, SC motifs are the
first example of a regulatory function that can be assigned to a common
primary structure feature within the otherwise highly divergent
N-terminal regions of steroid receptors and may account for some of
their distinct properties. For example, the presence of four SC motifs
in MR versus only two in GR correlates with the considerably weaker synergy of MR (27, 40). For genes in which receptor synergy plays a major role, this difference may contribute to receptor selectivity. Similarly, the single motif found in PR lies within and is
likely to be responsible for the function of a recently proposed
negative modulation domain (307 to 427 in the human PR). Deletion of
this region enhances activity, whereas its duplication renders PR a
very poor activator at compound HREs (18).
(ii) Sp1 family.
Sp1 and Sp3 are related factors that
recognize similar DNA sequences and harbor glutamine-rich activation
domains. Curiously, although Sp3 displays activity at a single site, it
fails to activate at compound response elements, suggesting a
compromised ability to engage in synergy. Dennig et al. (9)
demonstrated that a negative regulatory region unique to Sp3 restricts
its activation domains. A single SC motif resides in this region, and
deletions or mutations within the SC motif relieve inhibition and
render Sp3 a potent activator at compound Sp1 sites (9).
(iii) Myb family.
Several parallels can also be established in
the case of the Myb family. The two SC motifs in c-Myb map to the
C-terminal region and lie within a negative regulatory domain absent in
the viral oncogenic forms and in certain tumor-derived cell lines (48, 52). Deletion of this region leads to enhanced
transactivation at compound response elements and is sufficient for
oncogenic transformation (17). As in the case of GR, these
effects are not observed in yeast. Similar negative effects of the
C-terminal region have been observed for the related A-Myb but not
B-Myb proteins (34). Strikingly, the SC motifs in A- and
c-Myb are evolutionarily conserved across multiple vertebrates, but are absent in B-Myb.
(iv) C/EBP family.
Similarly, within the C/EBP family, an
attenuator domain in C/EBP
has been mapped to a region between two
N-terminal transcription activation functions (37). This
region decreases transactivation in multiple compound promoter contexts
and, consistent with our results, does so without affecting DNA
binding. Notably, this region includes a highly conserved SC motif. In
the case of C/EBP
, an SC motif is located in a similar functional
region. Importantly, mutations within this region that enhance activity
(1) map to the SC motif.
The predictive value of SC motifs is exemplified in our analysis of
ETS-1, since a negative function for the regions harboring the SC
motifs was, to our knowledge, previously unrecognized. It is unlikely,
however, that all matches to the consensus constitute functional SC
motifs. In fact, so far, we have not detected a functional role for the
SC motif in SF-1 (not shown).
For the cases described above, the effects of these seemingly unrelated
negative regions have been examined at both natural and artificial
compound response elements, attesting to the generality and relevance
of this mechanism. Although effects at a single site have not been
examined in all cases, the striking similarities strongly suggest that
the SC motifs contribute to the function of these regions, likely by
limiting synergy. We are expanding our analysis to some of these
factors and to the more complex and prevalent functional interactions
involving synergy between different classes of regulators.
Activator functions involved in synergy control.
Our analysis
indicates that SC motifs can influence synergy afforded by the
activation functions of multiple factors from diverse families. SC
motif influence is not totally promiscuous, however, since the
N-terminal AF1 function of GR appears to be insensitive. This is not
simply due to its moderately acidic character, since other "acidic"
activators such as VP16 are regulated by SC motifs, and likely reflects
either a different mechanism of synergy or an intrinsic property of AF1.
The SC motifs identified here can limit synergy when embedded in
synthetic activators. Within their natural context, however, additional
features of the specific activator can influence synergy control. In
the case of steroid receptors, the DBD dimer interface plays an
important role, since specific receptor mutations or noncanonical
spacing of half-sites that disfavor this dimer interface lead to
enhanced synergy. Furthermore, simultaneous disruption of the SC motifs
and the DBD dimer interface produces an effect no greater than that
resulting from altering either one alone. Hence, it is likely that a
common SC mechanism requires both the SC motifs and an engaged DBD
dimer interface for function. These properties would therefore
constrain the effect of SC motifs to multiple, properly dimerized
receptor pairs bound to compound HREs. A relationship between SC motifs
and DBDs is also present in the case of c-Myb, since N-terminal
deletions adjacent to the DBD have phenotypes similar to deletion of
the C-terminal negative region. Furthermore, the DBD and regions
adjacent to one of the SC motifs can interact (8). Whether
dimerization per se is an obligate requirement for SC function,
however, awaits further examination in other activators.
An SC motif.
We have identified eight examples of functional
SC motifs in different activators. Sequence comparison across different
species coupled with mutational analysis revealed that a branched
aliphatic residue at the first position followed by invariant Lys and
Glu residues at positions 2 and 4 are critical features for SC motif function. Several features suggest that these motifs are likely to be
solvent exposed and accessible to interactions. First, the SC motif is
highly charged. Second, limited proteolytic cleavage indicates that Glu
295, within the second motif of human GR, is a preferred V8 cleavage
site (B. Darimont, personal communication). Third, the motif is
preceded and/or followed by a Pro residue, and the sequence in the
vicinity of the upstream Pro often varies in size by a few residues in
different species. This suggests that the motif may lie near the end of
secondary structure elements or within a loop that can tolerate
insertions. Fourth, a search of the PDB structure database revealed
that, in seven of the nine intracellular proteins of known
three-dimensional structure that harbor a match to the motif, it lies
within an extended loop or a
-sheet strand with the conserved
charged residues of the motif exposed to solvent. The propensity of
these sequences to adopt such an exposed configuration is consistent
with the view that these motifs could operate as protein-protein
interaction surfaces.
A model for synergy control.
Our characterization indicates
that SC motifs do not alter intrinsic DNA binding and that they fail to
function in S. cerevisiae. In addition, they are functional
in a wide variety of contexts and affect multiple activation domains.
These observations and similar ones from other negative regulatory
regions harboring SC motifs suggest that SC is unlikely to be due to a
direct intramolecular interaction. Rather, they suggest that additional
cellular factors are involved. One possibility is that a synergy
control factor (SCF) is recruited to compound HREs by recognizing SC
motifs when presented in the appropriate context of compound response
elements (Fig. 10). The selective
effect of such a factor at compound sites could be the result of its
multivalent binding to adjacently bound regulators. In this model,
mutations in the SC motifs would prevent interaction with SCF and thus
lead to constitutive high levels of synergy (Fig. 10). Consistent with
this idea, overexpression of the C-terminal Myb domain (50)
and C/EBP
negative region (1) enhances the activity of
the respective proteins at compound sites, possibly by titrating SCF or
other components. Successful competition, however, has not been
achieved with Sp3 (9) or GR (not shown). We are currently
searching for SC motif interacting factors.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 10.
Model for the mechanism of action of SC motifs.
Selective recruitment of SCF to compound response elements through
interactions with the SC motifs limits transcriptional activity. See
text for details.
|
|
The mechanisms involved in synergy, especially those involving steps
subsequent to DNA binding, are not well understood, but effects beyond
DNA binding imply the alteration of the transcription complex
(53). An SCF could thus interfere with or favor the disassembly of an active transcription complex. SC motif function, however, does not appear to involve an alteration in the sensitivity to
certain coactivators. Both GRIP1 and SRC-1 enhance the activity of the
WT and mutant GR. Similarly, disruption of the SC motif in Sp3 does not
alter the interaction of the glutamine-rich regions with TAF 110 (9).
The recruitment of cofactors to sequence-specific regulators via short
amino acid motifs has already been observed in the case of the
interaction of the p160 class of coactivators with the LBD of steroid
receptors (7) or CREB and CREB-binding protein (39). Furthermore, the function of SC motifs could also be
regulated through specific posttranslational modifications. The
critical Lys at position 2 could be the target of acetylation or
ubiquitination, especially since Arg is not functional at this
position. These regulatory modifications have been recently detected in
a number of transcription factors (26, 30, 60). Similarly,
phosphorylation of Ser 532 immediately downstream of the second SC
motif of human c-Myb attenuates the function of the negative regulatory
domain and enhances activity at compound response elements (29,
51). To date, however, we have not detected these modifications
within the SC motifs of GR.
According to this general model, synergy control through SC motifs may
permit the selective deployment or utilization of functional synergy
surfaces of transcription factors at the appropriate promoter context
or developmental stage. Synergy could thus be controlled through the
regulation of the activity of SC motifs or through the expression
and/or function of SCF. For example, as part of a developmental
program, selective loss of SCF only when a specific tissue reaches a
terminally differentiated state would permit the characteristic
high-level expression of the appropriate set of regulated genes. A
similar effect could be achieved if a given factor harboring SC motifs
is developmentally replaced by a close relative lacking them.
The presence of multiple binding sites for many transcription factors
at natural regulatory DNA elements coupled with the combinatorial
nature of transcriptional control makes the potential number of
interactions enormous. The SC motifs described here may constitute an
example of cellular regulatory devices that, by following simple rules,
could limit functional interactions to a more tractable number.
Clearly, defining the rules that govern such higher-order interactions
will be essential to understand and manipulate the regulatory logic of
complex transcriptional systems.
 |
ACKNOWLEDGMENTS |
We thank Keith R. Yamamoto and the members of his laboratory for
their support; Beatrice Darimont for unpublished results; Michael
Stallcup, A. Seth, Dianne Merry, and Alex Lange for kindly providing
expression and reporter plasmids; and Marc Diamond, Carol Gross, Holly
Ingraham, Inez Rogatsky, and Keith R. Yamamoto for insightful
discussions and comments on the manuscript.
J. A. Iñiguez-Lluhí is a Special Fellow of the
Leukemia Society of America, and D. Pearce acknowledges NIH support
through grant DK-R29-51151.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pharmacology, The University of Michigan Medical School, 1150 West
Medical Center Dr., Ann Arbor, MI 48109-0632. Phone: (734) 515-6565. Fax: (734) 763-4450. E-mail: iniguez{at}umich.edu.
 |
REFERENCES |
| 1.
|
Angerer, N. D.,
Y. Du,
D. Nalbant, and S. C. Williams.
1999.
A short conserved motif is required for repressor domain function in the myeloid-specific transcription factor CCAAT/enhancer-binding protein epsilon.
J. Biol. Chem.
274:4147-4154[Abstract/Free Full Text].
|
| 2.
|
Arnone, M. I., and E. H. Davidson.
1997.
The hardwiring of development: organization and function of genomic regulatory systems.
Development
124:1851-1864[Abstract].
|
| 3.
|
Bailly, A.,
C. Rauch,
A. C. Cato, and E. Milgrom.
1991.
In two genes, synergism of steroid hormone action is not mediated by cooperative binding of receptors to adjacent sites.
Mol. Cell. Endocrinol.
82:313-323[CrossRef][Medline].
|
| 4.
|
Carey, M.
1998.
The enhanceosome and transcriptional synergy.
Cell
92:5-8[CrossRef][Medline].
|
| 5.
|
Chen, D.,
H. Ma,
H. Hong,
S. S. Koh,
S. M. Huang,
B. T. Schurter,
D. W. Aswad, and M. R. Stallcup.
1999.
Regulation of transcription by a protein methyltransferase.
Science
284:2174-2177[Abstract/Free Full Text].
|
| 6.
|
Danesch, U.,
B. Gloss,
W. Schmid,
G. Schutz,
R. Schule, and R. Renkawitz.
1987.
Glucocorticoid induction of the rat tryptophan oxygenase gene is mediated by two widely separated glucocorticoid-responsive elements.
EMBO J.
6:625-630[Medline].
|
| 7.
|
Darimont, B. D.,
R. L. Wagner,
J. W. Apriletti,
M. R. Stallcup,
P. J. Kushner,
J. D. Baxter,
R. J. Fletterick, and K. R. Yamamoto.
1998.
Structure and specificity of nuclear receptor-coactivator interactions.
Genes Dev.
12:3343-3356[Abstract/Free Full Text].
|
| 8.
|
Dash, A. B.,
F. C. Orrico, and S. A. Ness.
1996.
The EVES motif mediates both intermolecular and intramolecular regulation of c-Myb.
Genes Dev.
10:1858-1869[Abstract/Free Full Text].
|
| 9.
|
Dennig, J.,
M. Beato, and G. Suske.
1996.
An inhibitor domain in Sp3 regulates its glutamine-rich activation domains.
EMBO J.
15:5659-5667[Medline].
|
| 10.
|
Ding, X. F.,
C. M. Anderson,
H. Ma,
H. Hong,
R. M. Uht,
P. J. Kushner, and M. R. Stallcup.
1998.
Nuclear receptor-binding sites of coactivators glucocorticoid receptor interacting protein 1 (GRIP1) and steroid receptor coactivator 1 (SRC-1): multiple motifs with different binding specificities.
Mol. Endocrinol.
12:302-313[Abstract/Free Full Text].
|
| 11.
|
Emami, K. H., and M. F. Carey.
1992.
A synergistic increase in potency of a multimerized VP16 transcriptional activation domain.
EMBO J.
11:5005-5012[Medline].
|
| 12.
|
Gametchu, B., and R. W. Harrison.
1984.
Characterization of a monoclonal antibody to the rat liver glucocorticoid receptor.
Endocrinology
114:274-279[Abstract].
|
| 13.
|
Giese, K.,
C. Kingsley,
J. R. Kirshner, and R. Grosschedl.
1995.
Assembly and function of a TCRalpha enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions.
Genes Dev.
9:995-1008[Abstract/Free Full Text].
|
| 14.
|
Godowski, P. J.,
D. Picard, and K. R. Yamamoto.
1988.
Signal transduction and transcriptional regulation by glucocorticoid receptor-LexA fusion proteins.
Science
241:812-816[Abstract/Free Full Text].
|
| 15.
|
Hittelman, A. B.,
D. Burakov,
J. A. Iñiguez-Lluhí,
L. P. Freedman, and M. J. Garabedian.
1999.
Differential regulation of glucocorticoid receptor transcriptional activation via AF-1-associated proteins.
EMBO J.
18:5380-5388[CrossRef][Medline].
|
| 16.
|
Hong, K.,
W. Zheng,
A. Baker, and D. Papahadjopolous.
1997.
Stabilization of cationic liposome-plasmid DNA complex by polyamines and poly(ethylene glycol)-phospholipid conjugates for efficient in vivo gene delivery.
FEBS Lett.
400:233-237[CrossRef][Medline].
|
| 17.
|
Hu, Y. L.,
R. G. Ramsay,
C. Kanei-Ishii,
S. Ishii, and T. J. Gonda.
1991.
Transformation by carboxyl-deleted Myb reflects increased transactivating capacity and disruption of a negative regulatory domain.
Oncogene
6:1549-1553[Medline].
|
| 18.
|
Huse, B.,
S. Brenz Verca,
P. Mattey, and S. Rusconi.
1998.
Definition of a negative modulation domain in the human progesterone receptor.
Mol. Endocrinol.
12:1334-1342[Abstract/Free Full Text].
|
| 19.
|
Ikonen, T.,
J. J. Palvimo, and O. A. Janne.
1997.
Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators.
J. Biol. Chem.
272:29821-29828[Abstract/Free Full Text].
|
| 20.
|
Iñiguez-Lluhí, J. A.,
D. Y. Lou, and K. R. Yamamoto.
1997.
Three amino acid substitutions selectively disrupt the activation but not the repression function of the glucocorticoid receptor N-terminus.
J. Biol. Chem.
272:4149-4156[Abstract/Free Full Text].
|
| 21.
|
Kelly, E. J.,
E. P. Sandgren,
R. L. Brinster, and R. D. Palmiter.
1997.
A pair of adjacent glucocorticoid response elements regulate expression of two mouse metallothionein genes Proc.
Natl. Acad. Sci. USA
94:10045-10050[Abstract/Free Full Text].
|
| 22.
|
Kim, T. K., and T. Maniatis.
1997.
The mechanism of transcriptional synergy of an in vitro assembled interferon-beta enhanceosome.
Mol Cell.
1:119-129[CrossRef][Medline].
|
| 23.
|
Kunkel, T. A.,
J. D. Roberts, and R. A. Zakour.
1987.
Rapid and efficient site-specific mutagenesis without phenotypic selection.
Methods Enzymol.
154:367-382[Medline].
|
| 24.
|
Lefstin, J. A.,
J. R. Thomas, and K. R. Yamamoto.
1994.
Influence of a steroid receptor DNA-binding domain on transcriptional regulatory functions.
Genes Dev.
8:2842-2856[Abstract/Free Full Text].
|
| 25.
|
Lin, Y. S.,
M. Carey,
M. Ptashne, and M. R. Green.
1990.
How different eukaryotic transcriptional activators can cooperate promiscuously.
Nature
345:359-361[CrossRef][Medline].
|
| 26.
|
Liu, L.,
D. M. Scolnick,
R. C. Trievel,
H. B. Zhang,
R. Marmorstein,
T. D. Halazonetis, and S. L. Berger.
1999.
p53 sites acetylated in vitro by PCAF and p300 are acetylated in vivo in response to DNA damage.
Mol. Cell. Biol.
19:1202-1209[Abstract/Free Full Text].
|
| 27.
|
Liu, W.,
J. Wang,
G. Yu, and D. Pearce.
1996.
Steroid receptor transcriptional synergy is potentiated by disruption of the DNA-binding domain dimer interface.
Mol. Endocrinol.
10:1399-1406[Abstract].
|
| 28.
|
Luisi, B. F.,
W. X. Xu,
Z. Otwinowski,
L. P. Freedman,
K. R. Yamamoto, and P. B. Sigler.
1991.
Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA.
Nature
352:497-505[CrossRef][Medline].
|
| 29.
|
Miglarese, M. R.,
A. F. Richardson,
N. Aziz, and T. P. Bender.
1996.
Differential regulation of c-Myb-induced transcription activation by a phosphorylation site in the negative regulatory domain.
J. Biol. Chem.
271:22697-22705[Abstract/Free Full Text].
|
| 30.
|
Mitsui, A., and P. A. Sharp.
1999.
Ubiquitination of RNA polymerase II large subunit signaled by phosphorylation of carboxyl-terminal domain.
Proc. Natl. Acad. Sci. USA
96:6054-6059[Abstract/Free Full Text].
|
| 31.
|
Muller, M.,
C. Baniahmad,
C. Kaltschmidt, and R. Renkawitz.
1991.
Multiple domains of the glucocorticoid receptor involved in synergism with the CACCC box factor(s).
Mol. Endocrinol.
5:1498-1503[Abstract].
|
| 32.
|
Nordeen, S. K.,
C. A. Ogden,
L. Taraseviciene, and B. A. Lieberman.
1998.
Extreme position dependence of a canonical hormone response element.
Mol. Endocrinol.
12:891-898[Abstract/Free Full Text].
|
| 33.
|
Nye, J.,
J. Petersen,
C. Gunther,
M. Jonsen, and B. Graves.
1992.
Interaction of murine ets-1 with GGA-binding sites est |