Previous Article | Next Article 
Molecular and Cellular Biology, August 2000, p. 6114-6126, Vol. 20, No. 16
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Sik (BRK) Phosphorylates Sam68 in the Nucleus and
Negatively Regulates Its RNA Binding Ability
Jason J.
Derry,1
Stéphane
Richard,2
Héctor
Valderrama Carvajal,2
Xin
Ye,1
Valeri
Vasioukhin,1
Alan W.
Cochrane,3
Taiping
Chen,2 and
Angela
L.
Tyner1,*
Departments of Molecular Genetics and
Medicine, University of Illinois at Chicago, Chicago, Illinois
60607,1 and Terry Fox Molecular
Oncology Group, Lady Davis Institute for Medical Research, Sir Mortimer
B. Davis Jewish General Hospital, Departments of Oncology, Medicine
and Microbiology and Immunology, McGill University, Montreal,
Quebec H3T 1E2,2 and Department of
Medical Genetics and Microbiology, University of Toronto, Toronto,
Ontario M5S 1A8,3 Canada
Received 11 January 2000/Returned for modification 2 March
2000/Accepted 23 May 2000
 |
ABSTRACT |
Sik (mouse Src-related intestinal kinase) and its orthologue BRK
(human breast tumor kinase) are intracellular tyrosine kinases that are
distantly related to the Src family and have a similar structure, but
they lack the myristoylation signal. Here we demonstrate that Sik and
BRK associate with the RNA binding protein Sam68 (Src associated during
mitosis, 68 kDa). We found that Sik interacts with Sam68 through its
SH3 and SH2 domains and that the proline-rich P3 region of Sam68 is
required for Sik and BRK SH3 binding. In the transformed HT29
adenocarcinoma cell cell line, endogenous BRK and Sam68 colocalize in
Sam68-SLM nuclear bodies (SNBs), while transfected Sik and Sam68 are
localized diffusely in the nucleoplasm of nontransformed NMuMG mammary
epithelial cells. Transfected Sik phosphorylates Sam68 in SNBs in HT29
cells and in the nucleoplasm of NMuMG cells. In functional studies,
expression of Sik abolished the ability of Sam68 to bind RNA and act as
a cellular Rev homologue. While Sam68 is a substrate for Src family
kinases during mitosis, Sik/BRK is the first identified tyrosine kinase
that can phosphorylate Sam68 and regulate its activity within the
nucleus, where it resides during most of the cell cycle.
 |
INTRODUCTION |
The Src-related intestinal kinase
Sik is an intracellular tyrosine kinase that we identified in a screen
for tyrosine kinases in intestinal epithelial cells (34).
Although it is related to the Src family and contains SH2 and SH3
domains, it has a very short unique amino terminus and is not
myristoylated (41). Sik expression is restricted to
differentiating epithelial cells, and it is found in the skin and all
linings of the alimentary canal. Addition of calcium to cultured
primary mouse keratinocytes induces cell differentiation and rapid
activation of Sik (42). Overexpression of Sik in an
embryonic mouse keratinocyte cell line resulted in increased expression
of the differentiation marker filaggrin during calcium-induced
differentiation, suggesting that Sik is involved in a signal
transduction pathway that may promote differentiation (42).
The human orthologue of Sik is called BRK (breast tumor kinase)
(24, 25). Increased BRK expression has been detected in colon tumors (24), breast tumors (2, 25), and
melanomas (11, 22). Neither Sik nor BRK expression has been
detected in normal mammary tissue, but both proteins are expressed in
normal epithelial cells that are undergoing terminal differentiation in
the gastrointestinal tract (24, 41). While BRK appears to
play a role in signal transduction in normal epithelial linings, its
overexpression appears to be linked to the development of a variety of
epithelial tumors. The seemingly paradoxical roles of Sik and BRK
during differentiation and tumorigenesis are poorly understood.
To date, no substrates of Sik and BRK have been identified. Here we
report that Sam68 (Src associated in mitosis; 68 kDa) is a substrate of
Sik that can be phosphorylated by Sik within the nucleus. Sam68 is an
RNA binding protein (47) that was first identified as a
major target of Src during mitosis (14, 39). Thus far, Sam68
has been shown to be a substrate of Src family kinases (14, 29,
39, 46), ZAP70 (20), and the insulin receptor
(31). Although Sam68 resides in the nucleus during most of
the cell cycle, none of these tyrosine kinases colocalize with Sam68
within the nucleus. Sam68 has also been shown to be a substrate of Cdc2
during mitosis (28). Sam68 has been proposed to function as
a multifunctional adapter protein for Src kinases (29, 38),
and it can associate with phospholipase C
1, the p85 subunit of
phosphatidylinositol-3-kinase (31), and the adapter proteins
Grb2 (29), Nck (21), and Grap (40).
Sam68 has been shown to preferentially bind RNA with UAAA motifs
(23). The RNA binding activity of Sam68 is negatively
regulated by Src kinases (45), and Sam68 may function as a
protein that links signaling cascades by Src kinases to RNA metabolism.
The type of RNA binding motif present in Sam68 is called the hnRNP K
homology (KH) domain (15, 33). Sam68 is part of a subfamily of KH domain-containing proteins, because it contains an extended KH
domain embedded in a larger domain called the GSG (GRP33-Sam68-GLD1) domain (10, 19). This protein module is also referred to as the STAR (signal transduction and activation of RNA) domain
(43). The GSG domain of Sam68 has been shown to be required
for RNA binding (5, 23), RNA-dependent oligomerization
(5), and protein localization (4). Sam68 has been
observed to localize in novel nuclear bodies called Sam68-SLM nuclear
bodies (SNBs) in cancer cell lines (4). Although the
function of Sam68 is unknown, Sam68 has been shown to be required for
cell cycle progression (3) and can function as a cellular
homologue of Rev by transporting unspliced human immunodeficiency virus
(HIV) RNA into the cytoplasm (27).
Here we report that both Sik and BRK colocalize with Sam68 within the
nucleus. We show that Sik is active within the nucleus and that it can
phosphorylate Sam68 in vivo. In addition, we demonstrate that
phosphorylation of Sam68 by Sik negatively regulates its RNA binding
ability and its ability to function as a Rev cellular homologue.
Phosphorylation of Sam68 within the nucleus may have important
physiological significance and may contribute to the posttranscriptional control of gene expression during the
differentiation of epithelial linings.
 |
MATERIALS AND METHODS |
Expression constructs.
For the preparation of the mutant Sik
cDNAs, we used the oligonucleotide-mediated Altered sites in vitro
mutagenesis system (Promega). The Sik cDNA was cloned into the pAlter
plasmid, and the oligonucleotide with the sequence
5'-CACCAGGTTTGAGAACC-3', with a substitution of A for T
resulting in substitution of the tyrosine at position 447 with
phenylalanine, was used to generate the Sik Y-F construct. This type of
mutation has been shown to lead to constitutive activation of the Src
family of tyrosine kinases (8). Preparation of the kinase
defective Sik expression construct Sik K-M was previously described
(42). Wild-type Sik, Sik Y-F, and Sik K-M coding sequences
were cloned into the vector pcDNA3. The GST-Sik constructs were as
previously described (42).
The Fyn expression construct and Myc-Sam68 (68-347) (also called
P1234) were previously described (29), as was Myc-Sam68 (5). The coding region of mouse hnRNPK was amplified using the expressed sequence tags AA544863 and AA183839 and the
oligonucleotides with the sequences 5'-CAGGAATTCACTAGTCTTAGAAAA-3'
and 5'-AATGAATTCCGAACAGCCAGAAGA-3', and it was
digested with EcoRI and subcloned in frame in Myc-Bluescript (29). The DNA fragments encoding the Sam68 proline motifs
P0, P1P2, P3, P4, and P5 were amplified by PCR using Myc-Sam68 as a DNA
template (5). The DNA was digested with BamHI and
EcoRI and subcloned in the respective sites of pGEX-KG
(16). The sequences of the oligonucleotides are as follows:
P0, 5'-CGT GGA TCC AAG GAC CCG TCA GGT-3' and 5'-GCG
GAA TTC TCA AGC GCC TCC TCT GGG CCC AC-3'; P1P2, 5'-CGG GGA
TCC CCC GCC ACC CAG CCG CCG-3' and 5'-GCG GAA TTC TCA CGG
CTG TGG CTG ACG GGG GC-3'; P3, 5'-AAC GGA TCC CCT GAA CCC
TCT CGT GGT-3' and 5'-GCG GAA TTC TCA AGC TCC TCT AGG TGG
TCC AAC-3'; P4, 5'-CGT GGA TCC CCA GTG AGA GCT CCA TCA CC-3'
and 5'-GCG GAA TTC TCA CCC AGC TGT CCG AGC TCT TG-3'. For construction of GST-Sam68 (331-443), Myc-Sam68 was digested with XhoI and the DNA fragment corresponding to amino acids
331 to 443 was subcloned in frame into Myc-BS. The resulting plasmid was digested with BamHI and KpnI, and the
fragment was subcloned into the BamHI-HindIII
sites of pGEX-KG. The KpnI and HindIII sites
were made blunt. For construction of GST-Sam68 (354-393), Myc-Sam68 was
used as a template for the following primers: forward, CCCGGATCCATTCAGAGAATACCTTTG, and reverse,
ATAGAATTCTTACTCCCCTTGACTCTGGC. The DNA fragment was digested
with BamHI and EcoRI and subcloned into the
corresponding sites in pGEX-KG. Myc-pcDNA Sam68 was constructed by
digesting Myc-BS Sam68f (5) with EcoRI and
subcloning the fragment in frame in Myc-pcDNA (6). Myc-pcDNA
Sam68
C was constructed by digesting Myc-pcDNA Sam68 with
XhoI and religating. This deletes amino acids 348 to 443 of
Sam68, and the translation terminates in the vector.
Peptides P0, P3, and P4 used in competition assays were synthesized by
the W. M. Keck Biotechnology Resource Center, New Haven,
Conn.,
and their sequences are as follows: P0,
biotin-RLTPSRPSPLPHRPRGGGGGPRGG;
P3, biotin-GVSVRGRGAAPPPPPVPRGRGVGP;
P4, biotin-TRGATVTRGVPPPPTVRGAPTPR.
Cell lines.
Cell lines were obtained from the American Type
Culture Collection. NMuMG cells were generally transfected using the
LipofectAMINE Reagent (Gibco/BRL). HeLa cells were maintained in
Dulbecco modified Eagle medium (DMEM) with 1.0 mM sodium pyruvate and
10% bovine calf serum (HyClone, Logan, Utah) and were transfected with
the vaccinia virus T7 expression system and lysed as previously
described (29). COS7 cells were maintained in DMEM
supplemented with 10% bovine calf serum and were transfected using the
DEAE-dextran method.
Subcellular fractionation.
Cells were washed two times in
1× phosphate-buffered saline (PBS) and one time in hypotonic lysis
buffer (HLB; 20 mM Tris-HCl [pH 7.5], 1 mM MnCl2, 2 mM
EGTA) for 5 min on ice. Cells were then treated with 1.5 ml of HLB
(with 20 µg of leupeptin/ml and 1 mM phenylmethylsulfonyl fluoride
[PMSF]) and shaken for 20 min on ice. Cells were scraped and
homogenized in a Dounce homogenizer (50 to 60 strokes) and spun for 10 min at 2,300 rpm, 4°C. The supernatant from this spin was kept as
cytosolic and membrane fractions. The pellet was washed in 1 ml of HLB,
spun 4 min at 5,000 rpm at 4°C, and resuspended in 1 ml of Dignum
buffer (20 mM HEPES [pH 7.9], 420 mM NaCl, 1.5 mM MnCl2,
0.1 mM EDTA, 25% glycerol, 0.5 mM dithiothreitol [DTT], 0.5 mM PMSF,
2 µg of leupeptin/ml, 2 µg of aprotinin/ml, 1 mM
NaVO4). After shaking for 15 min at 4°C, samples were
spun at 14,000 rpm for 10 min at 4°C. The supernatant was kept as the
nuclear protein fraction.
Antibodies, immunoprecipitations, and immunoblotting.
Anti-Sik polyclonal antibodies N20 (sc-915) and C17 (sc-916) were
purchased from Santa Cruz Biotechnology. Immunoblot analyses were
performed with a combination of the two mouse Sik antibodies, N20 and
C17, at a 1:5,000 dilution for increased sensitivity. BRK was detected
with the Santa Cruz Biotechnology BRK antibody (C-17, sc-1188) or the
Sik N20 antibody. The monoclonal antibody anti-Myc 9E10 (Santa Cruz
Biotechnology) and antiphosphotyrosine antibodies 4G10 (1:10,000) and
PY-20 (1:2,000) (both from Santa Cruz Biotechnology) and RC20-HRPO
(1:5,000) (Transduction Laboratories) were also used. The anti-AD1
rabbit polyclonal antibody specific for Sam68 was generated using a
peptide from amino acids 330 to 348 of mouse Sam68 (4). For
immunoblotting, the designated primary antibody was followed by either
goat anti-rabbit antibody, goat anti-mouse antibody conjugated to
horseradish peroxidase (HRP) (ICN), HRP-conjugated donkey anti-rabbit
antibody, or HRP-conjugated protein A (Transduction Laboratories), and
chemiluminescence was used for protein detection.
Immunoprecipitations were performed as previously described
(
42). Anti-BRK antibodies or anti-Sam68 AD-1 and 50 µl of
protein
G-Sepharose (Amersham or Pharmacia Biotech) were incubated with
1 to 2 mg of cell lysate for 3 to 16 h at 4°C. As controls,
lysates
were incubated with Sepharose beads and rabbit serum, rabbit
immunoglobulin
G (IgG), or
alone.
Sik-GST fusion protein in vitro binding assays.
Glutathione
S-transferase-Sik (GST-Sik) and GST-Sam68 fusion proteins
were prepared as described previously (29, 42). Cell lysates
were precleared by incubating with GST-saturated glutathione beads for
30 min. Precipitations were performed by incubating lysates with GST,
GST-SikSH2/3, Sik SH2, or Sik SH3 for 45 min at 4°C, followed by
incubation with glutathione-Sepharose beads (Amersham) for 30 min.
Precipitates were eluted with sample buffer and subjected to sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed
by immunoblotting with anti-Sam68 antibody.
Immunofluorescence.
Cells were grown on chamber slides
(Falcon) and fixed in methanol at
20°C for 5 min or Carnoy's
fixative for 5 min at room temperature. Cells transfected with green
fluorescent protein (GFP) constructs were fixed in 4% paraformaldehyde
for 5 min at room temperature and permeabilized in 50% methanol-50%
acetone for 15 min at
20°C. Slides were blocked in 2% goat serum
or 3% bovine serum albumin in TNT buffer (0.1 M Tris-HCl [pH 7.5],
0.15 M NaCl, 0.05% Tween 20) for 30 to 40 min. Slides were then
incubated with anti-BRK or anti-Sam68 AD-1 antibodies (1:250) overnight at 4°C, washed, incubated with biotinylated goat anti-rabbit antibody (Vector Laboratories) (1:250) for 1 h at room temperature, washed, blocked 30 min with blocking reagent (from DuPont NEN), and incubated with streptavidin-HRP (DuPont NEN) (1:100). After washing, tyramide amplification was performed using the TSA-Indirect Kit (DuPont NEN)
according to manufacturer's directions. Reactions were visualized with
rhodamine-avidin (Vector Laboratories) (1:500), and slides were mounted
with Vectashield mounting medium (Vector Laboratories). Controls for
specificity of signal were performed by preincubating BRK antibodies
with the immunogenic BRK peptide (1:4) for 30 min at room temperature
or by incubating sections with normal rabbit sera alone.
For double antibody labeling in HT29 and MCF-7 cells, cells were
stained as above with rabbit anti-BRK antibody and visualized
with
rhodamine, followed by incubation with anti-Sam68 (Transduction
Laboratories) (1:50) for 1 h at room temperature and anti-mouse
IgG fluorescein isothiocyanate (FITC) conjugate (Sigma) (1:64),
and
they were analyzed by confocal
microscopy.
For double antibody labeling of cells transfected with GFP-Sam68 and
Sik constructs, cells were stained overnight with antiphosphotyrosine
antibody conjugated to HRP (RC20-HRPO; Transduction Laboratories)
at a
1:2,000 dilution at 4°C and were incubated with biotinyl
tyramide and
rhodamine-avidin (1:500). Next, slides were treated
with 1.0%
H
2O
2 for 15 min to inactivate HRP, followed by
incubation
with the second antibody, anti-Sik (C-17) at a 1:250
dilution,
followed by HRP-conjugated goat anti-rabbit antibody,
biotinyl
tyramide, and then streptavidin Alexa 350 conjugate (Molecular
Probes) (1:500) for visualization. Controls were performed by
substituting rabbit serum, rabbit IgG, or blocking buffer alone
for the
first and second antibodies. Omission of Sik antibody
in the second
antibody incubation, followed by tyramide amplification,
resulted in no
Alexa 350 signal in these double staining experiments.
Nuclei were
stained with DAPI (4',6'-diamidino-2-phenylindole)
(Boehringer
Mannheim) for 3 min and washed before
mounting.
poly(U) binding assays.
Following transfections with
Sam68
1-67 (45) and Sik Y-F or Fyn, HeLa cells were lysed
on ice in 1% Triton X-100, 25 mM Tris (pH 7.4), 150 mM NaCl, 25 mM
NaF, and 100 µM sodium orthovanadate. Lysates were centrifuged to
remove insoluble material, and one-fourth of the total cell lysate was
added to 20 µl of agarose-poly(U) beads (Pharmacia Biotech Inc.) or
agarose beads as a control for 30 min, 4°C. Beads were washed twice
with lysis buffer and eluted in Laemmli sample buffer. For assessment
of total protein expression, 2.5% of the cell lysate was blotted.
REV assays.
COS7 cells were transfected with a total of 3.5 µg of DNA supplemented with empty pcDNA3.1. Each transfection
contained 0.125 µg of Rev response element (RRE) chloramphenicol
acetyltransferase (CAT) reporter plasmid pDM128 (17), with
1.5 µg of Rev expression vector B1-SVH6Rev (7, 37), 1.5 µg of Rev mutant B1-SVH6RevM10, 1.5 µg of pcDNA-Sam68
C, or 1.5 µg of pcDNA-Sam68. Increasing amounts of expression vectors for Sik
K-M and Sik Y-F (0.05, 0.8, and 1.6 µg) were added with pcDNA-Sam68.
The
-galactosidase expression vector, pCH110 (0.125 µg;
Pharmacia-Amersham Inc.) was included in all transfections for
measuring the efficiency of transfection. Forty-eight hours after
transfection, the cells were collected and resuspended in 150 µl of
0.25 M Tris-HCl, pH 7.8. The cell extracts were prepared by three
freeze-thaw cycles, followed by a brief centrifugation to remove cell
debris. CAT and
-galactosidase assays were performed as previously
described (30). CAT activity was normalized to the
-galactosidase activity and did not exceed twofold.
 |
RESULTS |
BRK associates with Sam68 in human tumor cell lines.
BRK is
expressed in breast and colon tumors and tumor cell lines (2,
24). To better understand the role of BRK, we performed indirect
immunofluorescence microscopy to visualize its cellular localization.
We found that endogenous BRK localized into distinct nuclear dots in
the MCF-7 and HT29 breast and colon tumor cell lines (Fig.
1A, panels A and D). The presence of BRK
in nuclear dots was not due to the elevated expression of BRK
in these cells because Sik overexpression in normal murine mammary
gland cells was localized diffusely in the nucleus without the presence
of nuclear dots (see Fig. 5 below). The RNA binding protein
Sam68 was also observed in similar structures in these cells (Fig. 1A, panels B and E). When control nonimmune serum was used (Fig.
1A, panel F), or when the primary antibody was preincubated with the immunogenic peptide (Fig. 1A, panel C; BRK antibody plus BRK
peptide, long exposure), no dots were observed, confirming the
specificity of the signal.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 1.
BRK and Sam68 localize in nuclear structures in breast
and colon tumor cell lines. (A) BRK and Sam68 are found in nuclear
structures in human tumor cell lines. Immunofluorescence was used to
examine the localization of endogenous BRK and Sam68 in the MCF-7 (A,
B) and HT29 (C, D) tumor cell lines. Cells were fixed and stained with
antibodies against BRK (A, D) or Sam68 (B, E), BRK antibody
preincubated with immunogenic peptide (C), or control rabbit sera (F).
(B) BRK localizes to SNBs in HT29 cells. Cells were fixed and stained
with antibodies against BRK followed by staining with antibodies
against Sam68 and were analyzed by confocal microscopy. BRK was
visualized with rhodamine (A), and Sam68 staining was visualized with
FITC (B). A composite (C) shows colocalization of BRK and Sam68 as
yellow spots in the nuclei (C). Nuclei were stained with DAPI (D).
Bars, 5 µm.
|
|
Previously, Sam68 was reported to localize to novel nuclear structures
termed SNBs that are novel and distinct from coiled
bodies, gems, PML
nuclear bodies, the perinucleolar compartment,
and SC-35 speckles
(
4). SNBs contain nucleic acid that is most
likely
RNA, but their function remains unknown (
4). We
examined
whether BRK colocalized with Sam68 in SNBs. HT29 cells
were fixed
and stained with antibodies against Sam68
(
4) and BRK (BRK
C-17), followed by secondary antibodies
conjugated to FITC and
rhodamine, respectively. The fluorescent signals
were imaged using
confocal microscopy. It was observed that most of the
BRK nuclear
dots colocalized with Sam68 SNBs (Fig.
1B). These findings
demonstrate
that BRK is a nuclear kinase that appears to be a component
of
SNBs in the HT29 colon cancer cell
line.
The colocalization of BRK and Sam68 in SNBs suggested that these
proteins might associate. To examine whether endogenous BRK
associates
with Sam68 in HT29 and MCF-7 cells, we performed coimmunoprecipitation
experiments. Anti-BRK immunoprecipitates from HT29 and MCF-7 cells
contained a band corresponding to Sam68 that was not detected
when
normal rabbit serum was used as a control or when the primary
antibody
was omitted (Fig.
2A). A significant
increase in the
amount of Sam68 that coprecipitated with BRK was
detected when
nuclear protein fractions were used for the
immunoprecipitations
(Fig.
2B). These findings suggest that BRK is a
nuclear tyrosine
kinase that associates with Sam68 in SNBs in cancer
cell lines.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
BRK and Sam68 associate within the nuclei of HT29 and
MCF-7 cells. (A) Sam68 coimmunoprecipitates with BRK from lysates of
the HT29 colon and MCF-7 breast carcinoma cell lines. Cells were lysed,
and 1 mg of total-cell lysate was incubated with anti-BRK antibodies,
normal rabbit serum (NRS), or Sepharose beads alone as a control for
nonspecific binding to beads. The immunoprecipitate was resolved by
SDS-PAGE followed by immunoblotting with anti-Sam68 AD1 polyclonal
antibodies. (B) Nuclear (N) and cytosolic and membrane (C/M) fractions
from MCF-7 and HT29 cells were immunoprecipitated with anti-BRK
antibodies, followed by immunoblotting with anti-Sam68 antibodies. A
short exposure (10 s) shows interaction in the nuclear fraction only. A
longer exposure (45 s) shows much weaker interaction in the cytosolic
and membrane fraction.
|
|
Sik phosphorylates Sam68 in vivo.
Colocalization of BRK with
Sam68 suggested that Sam68 may be a substrate for the Sik and BRK
tyrosine kinase within the nucleus. To determine if Sam68 is a
substrate of Sik, the normal murine mammary gland cell line NMuMG
(18) was transiently transfected with wild-type,
putative activated (Y-F), and kinase-defective (K-M) Sik. The
putative activated form of Sik contains a Tyr-to-Phe substitution of
the potential regulatory tyrosine at position 447 of Sik, while
kinase-defective Sik contains a substitution of a conserved Lys at
position 219 within the kinase catalytic domain with Met
(42). Previously, we showed that Sik K-M has no kinase
activity and acts as a dominant negative protein, but no enzymatic
regulatory role has been demonstrated for the carboxy-terminal tyrosine
of Sik (42). The different Sik expression constructs were
cotransfected with a GFP-Sam68 fusion construct (4), and tyrosine phosphorylation of Sam68 was examined by immunoblotting with
anti-phosphotyrosine antibodies. The NMuMG cell line does not express
endogenous Sik (24) (Fig. 3A,
middle panel, Sam68 + Vector). Tyrosine-phosphorylated GFP-Sam68
was detected in total-cell lysates from NMuMG cells cotransfected with
wild-type Sik or Sik Y-F and the GFP-Sam68 expression construct, but
not in cells cotransfected with vector alone or the kinase-defective
Sik K-M construct (Fig. 3A, right panel). Higher levels of
phosphorylated GFP-Sam68 and endogenous Sam68 were detected in cells
expressing Sik Y-F than cells expressing wild-type Sik (Fig. 3A, right
panel). The elevated tyrosine phosphorylation of Sam68 in Sik
Y-F-transfected cells was not a result of elevated expression of Sik
Y-F or GFP-Sam68 (Fig. 3A, left and middle panels). The association
between Sik and Sam68 was further investigated in NMuMG cells
transfected with GFP-Sam68 and Sik. Anti-Sam68 immunoprecipitates
contained a coimmunoprecipitated phosphotyrosine protein with a
molecular mass of 50 kDa that migrates in the expected position for
autophosphorylated Sik (Fig. 3B, left panel). Moreover, Sik
coimmunoprecipitated with both GFP-Sam68 and endogenous Sam68,
because Sik could be detected in Sam68 immunoprecipitates from
cells transfected with only wild-type Sik (Fig. 3B, right panel).
Greater levels of Sik Y-F coimmunoprecipitated with Sam68 than
wild-type Sik or Sik K-M. This may be explained by the increased
ability of Sik Y-F to phosphorylate and then bind phosphorylated Sam68
through its SH2 domain (see Fig. 6A). No band corresponding to Sik was
present in Sam68 precipitates from cells transfected with GFP-Sam68 and pcDNA3 (Vector) or in immunoprecipitations with IgG.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Sik phosphorylates Sam68 in vivo. (A) Sam68 is tyrosine
phosphorylated in NMuMG cells expressing wild-type Sik and Sik Y-F.
NMuMG cells were cotransfected with GFP-Sam68 and Vector alone,
wild-type (WT) Sik, Sik Y-F, or kinase-defective Sik K-M. Total-cell
lysates were divided equally and immunoblotted with antibodies against
Sam68, Sik, and phosphotyrosine. Tyrosine-phosphorylated Sam68 was
detected only in lysates containing wild-type Sik or Sik Y-F. Although
lower levels of Sik Y-F were expressed than wild-type Sik, the highest
levels of tyrosine-phosphorylated Sam68 were detected in cells
cotransfected with Sik Y-F, suggesting that tyrosine 447 of Sik
negatively regulates its activity. (B) Sik associates with Sam68.
Immunoprecipitations were performed with Sam68 antibody or IgG as a
control and with lysates from the transfected cells in panel A. Immunoblotting was performed with antiphosphotyrosine or anti-Sik
antibodies. Sik was observed to coprecipitate with Sam68 from lysates
of cells transfected with Sik expression constructs. Sik antibody
binding was detected using HRP-conjugated protein A. Tyrosine-phosphorylated Sik could also be detected in the Sam68
immunoprecipitates (left panel).
|
|
The ability of the different Sik constructs to phosphorylate Sam68 in
HeLa cells transfected with wild-type Sik, Sik Y-F,
and Sik K-M and
Myc-tagged Sam68 was further examined using the
vaccinia virus T7
expression system. Transfected HeLa cells were
lysed, and the proteins
were analyzed by immunoblotting with anti-Sik,
anti-Myc, and
anti-phosphotyrosine antibodies. Several proteins,
including one
comigrating with Sam68, appeared heavily phosphorylated
by the
Sik Y-F construct (Fig.
4A, right panel).
These data provide
additional evidence that Sik is negatively regulated
by phosphorylation
of the carboxy-terminal tyrosine at position 447 and
that substitution
of Sik Y447F activates the kinase. The anti-Sik and
anti-Myc immunoblots
show equivalent expression of the proteins (Fig.
4A, left and
middle panels).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Sik Y-F has increased kinase activity and specifically
phosphorylates Sam68. (A) The carboxy-terminal tyrosine of Sik
functions as a negative regulatory site. HeLa cells were cotransfected
with Myc-tagged Sam68 and wild-type (WT) Sik, Sik Y-F, or Sik K-M
(kinase defective). Cells were lysed, the proteins were separated by
SDS-PAGE, and immunoblotting with anti-Sik, anti-Myc, and
antiphosphotyrosine antibodies was performed. Increased phosphorylation
of Myc-Sam68 was visible in total-cell lysates from Sik Y-F-transfected
cells (right panel). (B) HeLa cells were transfected with Sik Y-F or
were cotransfected with Sik Y-F and Myc-Sam68, Myc-hnRNPK, or truncated
Myc-Sam68 (68-347). The cells were lysed and immunoprecipitated with
IgG (control) or anti-Myc antibodies. The bound proteins were analyzed
by immunoblotting with antiphosphotyrosine antibodies (left panel). The
same membrane was subsequently immunoblotted with anti-Myc antibodies
(middle panel). Total-cell extracts (TCL) were immunoblotted with
anti-Sik antibodies (right panel). The band at ~55 kDa in lanes 1 to
16 represents the heavy chain of the immunoprecipitating antibodies.
(C) Sik phosphorylates the carboxy terminus of Sam68. In vitro kinase
assays were performed using full-length GST-Sik,
[ -32P]ATP, and 2 µg of the following substrates:
GST-Grb2-N-SH3 (negative control), GST alone, GST-Sam68 (331-443), or
GST-Sam68 (354-393). The proteins were separated by SDS-PAGE and
stained with Coomassie blue (left). The gel was dried, and the
phosphorylated proteins were visualized by autoradiography (right).
|
|
The ability of Sik Y-F to phosphorylate other nuclear KH domain
proteins, such as hnRNPK, was examined. A truncated form of
Sam68,
Sam68 (68-347), which contains amino acids 68 to 347 and
lacks part of
the amino terminus and the tyrosine-rich carboxy
terminus, was also
investigated as a substrate for Sik. HeLa cells
were transfected with
Sik Y-F alone or were cotransfected with
Sik Y-F and Myc-Sam68,
Myc-hnRNPK, or Myc-Sam68 (68-347). The
cells were lysed and
immunoprecipitated with control IgG or anti-Myc
antibodies. The bound
proteins were analyzed by immunoblotting
with antiphosphotyrosine,
anti-Myc, and anti-Sik antibodies (Fig.
4B). A
phosphotyrosine-containing protein with a molecular mass
of 68 kDa
(lane 6) was observed in anti-Myc immunoprecipitates
from extracts
transfected with wild-type Myc-tagged Sam68, but
not with Myc-hnRNPK or
Myc-Sam68 (68-347) (Fig.
4B, left panel).
The membrane was
reimmunoblotted with anti-Myc antibodies to confirm
the
equivalent expression of Myc-Sam68, Myc-hnRNPK, or Myc-Sam68
(68-347)
(Fig.
4B, middle panel). Total-cell extracts were also
verified for the
equivalent expression of Sik Y-F by immunoblotting
with anti-Sik
antibodies (Fig.
4B, right panel). These data suggest
that the C
terminus of Sam68 is the target for the Sik tyrosine
kinase.
To confirm that the carboxy terminus of Sam68 is directly
phosphorylated by Sik, we incubated full-length GST-Sik with GST-Sam68
(331-443) and GST-Sam68 (354-393), two Sam68 carboxy terminus
fusion
proteins containing amino acids 331 to 443 and 354 to 393,
respectively, in the presence of [

-
32P]ATP. These
two carboxy-terminal fragments of Sam68 were efficiently
phosphorylated
by Sik, whereas a control GST protein containing
the amino-terminal SH3
domain of Grb2 and GST alone was not phosphorylated
(Fig.
4C, right
panel). The amounts of proteins used were determined
to be equivalent
as visualized by Coomassie blue staining (left
panel). These data
suggest that Sik directly and specifically
phosphorylates the C
terminus of
Sam68.
Colocalization of Sik, Sam68, and phosphotyrosine in the nuclei of
transfected cells.
The localization of Sik and Sam68 was
investigated in the NMuMG cell line. NMuMG cells were transfected with
both wild-type Sik and GFP-Sam68 and were analyzed by confocal
microscopy. The pattern of wild-type Sik expression was visualized by
avidin-Alexa 350 (blue) (Fig.
5A, panel C) and was
detected in the nucleus and at the membrane. Expression of the Sik Y-F
and Sik K-M expression constructs was also detected in the nuclei and
at the membranes of transfected cells (data not shown). GFP-Sam68,
wild-type Sik, and phosphotyrosine colocalized in the nucleoplasm of
the cells (Fig. 5A, panel D). Nuclear bodies were more commonly seen in cancer cell lines, but were not generally observed in the
nontransformed NMuMG cell line (Fig. 5A and B). In experiments with
control IgG, no specific fluorescent signal was detected.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 5.
Wild-type Sik and Sik Y-F phosphorylate nuclear proteins
that colocalize with GFP-Sam68 within the nucleus. (A) Localization of
GFP-tagged Sam68, phosphotyrosine, and wild-type (WT) Sik in
transfected NMuMG cells. Antiphosphotyrosine antibody was visualized
with rhodamine (red), while anti-Sik antibody binding was visualized
with avidin-Alexa 350 (blue). Wild-type Sik is present in the nucleus
and at the membrane (panel C). (B) NMuMG cells were transfected with
GFP-Sam68 and wild-type Sik (A to D), GFP-Sam68 and Sik Y-F (E to H),
GFP-Sam68 and kinase-defective Sik K-M (I to L), or the GFP expression
vector pEGFP-C1 and pcDNA3 (M to P). Cells were fixed 24 h after
transfection, and tyrosine-phosphorylated proteins were localized using
anti-phosphotyrosine antibodies (B, F, J, N). DAPI was used to stain
the nuclei (D, H, L, P). In NMuMG cells, Sam68 displays diffuse,
nuclear localization visible by green fluorescence (A, E, I). Cells
cotransfected with GFP-Sam68 and wild-type Sik or Sik Y-F also stain
strongly with the anti-phosphotyrosine antibody visualized using
rhodamine (B, F), while no phosphotyrosine was detected in cells
expressing kinase-defective Sik K-M (J). Panels C, G, K, and O are
composites demonstrating colocalization that appears yellow. GFP alone
is expressed throughout the cell (M) and is negative for
anti-phosphotyrosine staining (N). (C) Increased phosphotyrosine in
SNBs in HT29 cells following introduction of the activated Sik Y-F
construct into HT29 cells. HT29 cells were transfected with GFP-Sam68
(A, C) and Sik Y-F, and tyrosine-phosphorylated proteins were localized
using antiphosphotyrosine antibodies (B, C). Colocalization of Sam68
and the increased phosphotyrosine signal in SNBs are shown in panel C. No phosphotyrosine signal was detected in control cells transfected
with kinase-defective Sik K-M (not shown). DAPI was used to stain the
nuclei (D). Bars represent 5 µm.
|
|
The localization and tyrosine phosphorylation of Sam68 in the presence
of wild-type Sik, Sik Y-F, and Sik K-M were examined
(Fig.
5B).
Phosphotyrosine was readily detected only in the nuclei
of cells
transfected with active Sik and Sam68, suggesting that
Sik is active
within the nuclei and phosphorylates Sam68. Phosphotyrosine
was
detected in the nuclei of cells transfected with wild-type
Sik and Sik
Y-F (Fig.
5B, panels B and F), but not in kinase-defective
Sik
K-M-transfected cells (Fig.
5B, panel J). The majority of
Sik-phosphorylated protein colocalized with Sam68 (Fig.
5B, panels
C
and G). We also observed that the intensity of the antiphosphotyrosine
staining was greatest in cells transfected with Sik Y-F and Sam68.
Cotransfection of the GFP expression vector pEGFP-C1 and the
empty
Sik expression vector pcDNA3 resulted in diffuse GFP
fluorescence
throughout the cell (Fig.
5B, panel M) and no detectable
antiphosphotyrosine
staining (Fig.
5B, panel N). These data provide
further support
that Sam68 is a substrate for Sik in
vivo.
Since BRK and Sam68 were observed to colocalize in SNBs (Fig.
1), the
presence of phosphotyrosine in these SNBs following
transfection of the
Sik expression constructs was examined. HT29
cells were transfected
with GFP-Sam68 and wild-type Sik, Sik Y-F,
or kinase-defective Sik K-M.
The transfected cells were fixed,
stained with antiphosphotyrosine
antibodies, and analyzed by confocal
microscopy.
Tyrosine-phosphorylated protein colocalized with Sam68
in SNBs in
these transformed cells transfected with wild-type
Sik and Sik Y-F, but
not with Sik K-M. The Sik Y-F transfection
is shown in Fig.
5C. These
data demonstrate that Sik most likely
targets Sam68 in SNBs in cancer
cell
lines.
Sik-Sam68 interaction is mediated by both the SH3 and SH2
domains.
To determine which part of Sik interacts with Sam68,
different domains of Sik were expressed in bacteria as GST-fusion
proteins and used in GST pull down assays. Lysates from NMuMG cells
transfected with wild-type Sik, Sik Y-F, or Sik K-M and GFP-Sam68
expression constructs were incubated with GST alone, GST-Sik SH2+SH3,
GST-Sik SH2, and GST-Sik SH3 bound to beads. Bound proteins were
detected by immunoblotting with anti-Sam68 AD1 antibody (Fig.
6A). GFP-Sam68 and the endogenous Sam68
were observed to associate with the Sik SH3 and Sik SH2+SH3 domain
fusion proteins (Fig. 6A). Association of GFP-Sam68 with the Sik SH2
domain was observed only when it was coexpressed with wild-type Sik or
Sik Y-F, but not kinase-defective Sik K-M (Fig. 6A). We also observed
association of endogenous phosphorylated Sam68 protein following longer
exposures of the immunoblots. These data demonstrate that Sik
associates with Sam68 through both its SH3 and SH2 domains.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 6.
The Sik SH2 and SH3 domains bind Sam68. (A) The ability
of Sam68 to bind the SH2 and SH3 domains of Sik was tested. NMuMG cells
were transfected with GFP-Sam68 and the expression vector pcDNA3
(Vector) or the wild-type Sik, activated Sik Y-F, or kinase-defective
Sik K-M expression constructs. Cell lysates were divided equally and
incubated with GST, GST-Sik SH2+SH3, GST-Sik SH2, and GST-SH3
covalently coupled to beads. Bound proteins as well as an aliquot of
total-cell lysate from GFP-Sam68-transfected cells were separated by
SDS-PAGE and immunoblotted with Sam68 AD1 polyclonal antibody.
Positions of GFP-Sam68 and the endogenous Sam68 protein are indicated
with arrows. GFP-Sam68 and endogenous Sam68 protein bound to the
GST-Sik, SH2+SH3, and GST-Sik SH3 fusion proteins in all of the cell
lysates. GFP-Sam68 binding to the GST-Sik SH2 domain was detected only
in cells transfected with wild-type Sik or Sik Y-F, suggesting that
phosphorylation by Sik is required for Sik SH2 binding. (B) Sam68
proline motif 3 (P3) associates with the SH3 domain of Sik. HeLa cell
lysates were incubated with GST, GST-Sam68 P0, GST-Sam68 P1P2,
GST-Sam68 P3, or GST Sam68 P4 covalently coupled to beads. The beads
were washed, and the bound BRK was observed by immunoblotting. An
aliquot of the HeLa cell lysate was used to represent total-cell
lysate. BRK binding was only detected with the GST-Sam68 P3 fusion
protein. (C) Beads containing covalently coupled GST-Sik SH3 protein
were preincubated for 15 min at room temperature with the indicated
concentration of Sam68 proline-rich peptide. Subsequently, HeLa cell
lysates were added to each tube for 30 min at 4°C. The beads were
washed extensively, and the bound Sam68 was quantitated by
immunoblotting. Binding of Sam68 with the GST-Sik SH3 fusion protein
was efficiently competed with the P3 peptide.
|
|
Sam68 contains at least five proline motifs and interacts with the SH3
domains of several proteins, including Src, Fyn, and
PLC

-1 (
14,
29,
39,
46). To determine which proline motif
within Sam68
mediates interaction with the Sik SH3 domain, we
used a GST pull down
approach, with lysates from HeLa cells that
express human BRK and GST
fusion proteins representing the five
proline (P0, P1P2, P3, and P4)
motifs in Sam68. We found that
GST-P3 was the main polypeptide that
interacted with BRK (Fig.
6B). To further confirm the specific
interaction of Sam68 P3 with
the Sik SH3 domain, we tested the ability
of peptides representing
the proline-rich sequences P0, P3, and P4 to
compete with binding
of Sam68 with the GST-Sik SH3 domain. The Sam68 P3
peptide competed
with the binding between Sam68 and the Sik SH3 domain.
No significant
competition was observed with the P0 and P4 peptides.
Thus, the
Sik SH3 domain appears to interact with one major proline
motif
in Sam68, P3, that is neither a type I nor a type II proline
motif
(
13).
Sik inhibits the RNA binding ability of Sam68.
Tyrosine
phosphorylation of Sam68
1-67 negatively regulates its ability to
bind to homopolymeric RNA (45). To determine whether Sik can
regulate the ability of Sam68 to bind RNA, HeLa cells were transfected
with Myc-Sam68
1-67 or cotransfected with Myc-Sam68
1-67 and Sik
Y-F or Fyn. The expression of Fyn served as a positive control, as we
have shown previously that Fyn can negatively regulate
Sam68
1-67 homopolymeric RNA binding (45). HeLa
cell lysates were divided equally and incubated with either poly(U)
immobilized to agarose or agarose alone. Sam68 bound poly(U) homopolymeric RNA, when expressed alone (Fig.
7A). However, little or no RNA binding
was detected when Sam68 was coexpressed with Sik Y-F or Fyn (Fig. 7A).
The reduction of bound Myc-Sam68 was not due to poor expression of
Myc-Sam68 (Fig. 7A). Total-cell lysates were immunoblotted with
anti-Sik, anti-Fyn, and anti-phosphotyrosine antibodies, and we found
that Sik Y-F and Fyn were both overexpressed and Myc-Sam68 was tyrosine
phosphorylated (Fig. 7B). These data suggest that Sik is able to
negatively regulate the ability of Sam68 to bind RNA.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Sik negatively regulates the ability of Sam68 to bind
RNA. (A) HeLa cell lysates from cells either transfected with
Myc-Sam68 1-67 alone or cotransfected with Myc-Sam68 1-67 and Sik
Y-F or Fyn were divided equally and precipitated with agarose (Con) or
poly(U)-agarose (pU), followed by anti-Myc immunoblotting. An aliquot
of total-cell lysate (TCL) was also included to monitor expression of
Myc-Sam68 1-67. The ability of Myc-Sam68 1-67 to bind poly(U)
agarose was inhibited in cells transfected with either Sik Y-F or Fyn.
(B) Sik and Fyn are efficiently expressed and phosphorylate
Myc-Sam68 1-67 in transfected cells. Cell lysates from transfected
cells were immunoblotted with anti-Sik and anti-Fyn antibodies to
demonstrate that these kinases were efficiently expressed.
Immunoprecipitation of Myc-Sam68 1-67 followed by immunoblotting
with antiphosphotyrosine confirmed that Myc-Sam68 1-67 was tyrosine
phosphorylated by both Sik and Fyn.
|
|
Sam68 has been shown to function as a cellular homologue of Rev in
transporting HIV RNA (
27). We examined whether Sik could
regulate this nuclear function of Sam68 by determining if Sik
could
modulate RRE-directed reporter gene expression (Fig.
8).
COS7 cells
were transfected with an RRE-CAT reporter plasmid in
the presence of
Sam68 and increasing amounts of kinase-active
Sik Y-F or
kinase-inactive Sik K-M. The transfection of Sam68
or Rev with the
RRE-CAT reporter resulted in a 10-fold increase
in CAT activation in
comparison to Sam68

C and RevM10, two proteins
shown to be inactive
in Rev function. These data are consistent
with previously published
data (
27). The cotransfection of Sam68
with Sik Y-F, but not
Sik K-M, decreased CAT activity in a dose-dependent
manner. These
findings indicate that Sik can regulate a nuclear
function of Sam68 and
that its kinase activity is
required.
 |
DISCUSSION |
The tyrosine kinases represent a large family of diverse proteins
that play important roles in the regulation of growth and differentiation. Thus far, only a small number of
nuclear tyrosine kinases have been identified, including Abl, Rak, Fes,
Fer, and the dual-specificity kinase Wee1 (reviewed in references
26 and 44). In these studies, we
showed that Sik and BRK are present in the nucleus. The mechanisms by
which Sik and BRK localize to the nucleus are unknown, as they lack a
clear nuclear localization signal (41). It is possible that
Sik and BRK are transported to the nucleus through association with
other proteins containing nuclear localization signals. Like Abl, Sik
and BRK are not nuclear specific. In addition to being present in the
nucleus, BRK was detected in the cytoplasm of HT29 cells (Fig. 1). Sik
protein and kinase activity were also detected at the membrane of
transfected NMuMG cells (Fig. 5A), consistent with the earlier
observation that Sik can associate with a GAP-associated protein
(37).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 8.
Sik negatively regulates the ability of Sam68 to
function as a cellular Rev homologue. (A) A schematic diagram of the
Rev responsive element reporter CAT construct is shown. The splice
acceptor and donor sites are indicated as SA and SD. CAT indicates the
chloramphenicol acetyltransferase cDNA, and RRE is the HIV Rev
responsive element. (B) COS7 cells were transfected with the RRE-CAT
reporter plasmid in the presence of the indicated expression vectors
and pCH110. CAT activity was normalized to -galactosidase activity.
Each bar represents CAT activity from at least eight samples from at
least three separate experiments and the standard deviation indicated.
The autoradiogram shown on the left represents a typical experiment:
the two rows of dots on the left represent monoacetylated
[14C]chloramphenicol and the row on the right represents
unacetylated [14C]chloramphenicol.
|
|
We demonstrate that the RNA binding protein Sam68 is a substrate for
Sik within the nucleus and that Sik can inhibit the ability of Sam68 to
bind RNA. RNA binding proteins may regulate gene expression by a number
of mechanisms (reviewed in reference 32). They may alter RNA structure to regulate interaction with
trans-acting factors or provide localization or targeting
signals. Although its cellular function is unknown, Sam68 has been
shown to be able to functionally substitute for the HIV-1 Rev protein,
which plays an essential role in the nuclear export of unspliced and
partially spliced viral transcripts and export of the HIV genome
(27). We show that Sik kinase activity can negatively
regulate the ability of Sam68 to function as a cellular homologue of
Rev. These data strengthen the possibility that signaling cascades can
regulate the RNA function of GSG domain-containing proteins or STAR
proteins. The ability of Sam68 to act in RNA transport suggests a role
in posttranscriptional regulation of gene expression, which may be negatively regulated by Sik within the nucleus. Sam68 may also serve as
an adaptor for Sik, bringing it into proximity of other, as of yet
unidentified, substrates.
Sik and its human orthologue BRK have only 80% amino acid sequence
identity (24). Nevertheless, the genes have been mapped to
regions of the mouse and human genomes that share conservation of
synteny, and we have found that the mouse and human proteins are
expressed in similar patterns in differentiated epithelial tissues
(24). Here we show that the mouse and human proteins both
localize to the nucleus and that they both associate with Sam68. These
data provide further evidence that the functions of Sik and BRK in the
two species are conserved.
NMuMG cells were isolated from the mammary glands of Namru mice and
have epithelial growth characteristics, and they do not form malignant
lesions when introduced into nude mice (18). Sik
localization is diffuse within the nuclei of immortalized NMuMG cells,
while BRK appears in SNBs in the HT29 colon adenocarcinoma cell line
(Fig. 5). These data complement earlier studies by Chen et al.
(4), who found that SNBs were predominant in transformed cells. SNBs are novel unique dynamic structures that disassemble when
transcription is inhibited with actinomycin D (4). When GFP-Sam68 and wild-type Sik are introduced into HT29 cells, they localize to the SNBs, which become tyrosine phosphorylated (Fig. 5C).
Tyrosine phosphorylation of Sam68 by Sik does not appear to alter its
localization because Sam68 coexpressed with active Sik Y-F is retained
in SNBs (Fig. 5).
We have shown that Sik can bind Sam68 through both its SH3 and SH2
domains. It was previously shown that Sam68 also binds SH3 and SH2
domains of Src kinases (14, 29, 39, 46). The binding
affinities of specific SH2 domains are influenced by sequence context.
For example, Src family members prefer the sequence pYEEI, while the
SH2 domains of p85 and PLC-
select the general motif pY-hydrophobic-X-hydrophobic (35, 36). Using a technique
employing degenerate phosphopeptide libraries to predict the
specificity of individual SH2 domains, it was determined that the Sik
SH2 domain may bind to phosphorylated proteins with p-YEEY, YEDY, YDEY, and YDDY motifs (Z. Songyang and L. C. Cantley, personal communication). Interestingly, Sam68 contains the sequence YEDY in its carboxy terminus, and this is a putative binding site for the
Sik SH2 domain. This sequence may also be the target of Sik, as we show
here that Sik can phosphorylate the carboxy terminus of Sam68.
Sam68 is the first substrate identified for the Sik kinase. Related KH
domain-containing proteins have been shown to play important roles in
development, and these include human FMR1 (fragile X mental retardation
syndrome) (9); mouse Qk1 (quaking), required for myelination
(12); Caenorhabditis elegans GLD-1, required for
germ cell differentiation (19); and Drosophila
Who/How, required for muscle differentiation (1). The
tissue- and differentiation-specific expression and activation of Sik
(41, 42) suggest that Sik is involved in regulating
epithelial cell differentiation. Sik is unique in that it is the only
known tyrosine kinase that can phosphorylate Sam68 within the nucleus,
where it can modulate its RNA binding ability and perhaps the pattern
of gene expression associated with epithelial cell differentiation.
Since Sam68 has also been shown to be involved in cell cycle regulation
(3), overexpression of Sik and BRK may contribute to the
development of epithelial cancers by altering the ability of Sam68 to
regulate cell growth.
 |
ACKNOWLEDGMENTS |
This work was supported by National Institutes of Health grant
DK44525, Department of the Army grant DAMD17-96-1-6175 (A.L.T.), and
Medical Research Council of Canada grant MT 13377 S.R. is a Scholar of
the MRC, and T.C. is supported by a Doctoral Research Award from the
MRC. J.J.D. is supported by the Signal Transduction and
Cellular Endocrinology NIH training grant DK07739.
We thank Michael Serfas and Shahab Uddin for helpful discussions and
critical reading of the manuscript.
J.J.D. and S.R. contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: University of
Illinois College of Medicine, Department of Molecular Genetics, M/C
669, 900 S. Ashland Ave., Chicago, IL 60607. Phone: (312) 996-7964. Fax: (312) 413-0353. E-mail: atyner{at}uic.edu.
 |
REFERENCES |
| 1.
|
Baehrecke, E. H.
1997.
who encodes a KH RNA binding protein that functions in muscle development.
Development
124:1323-1332[Abstract].
|
| 2.
|
Barker, K. T.,
L. E. Jackson, and M. R. Crompton.
1997.
BRK tyrosine kinase expression in a high proportion of human breast carcinomas.
Oncogene
15:799-805[CrossRef][Medline].
|
| 3.
|
Barlat, I.,
F. Maurier,
M. Duchesne,
E. Guitard,
B. Tocque, and F. Schweighoffer.
1997.
A role for Sam68 in cell cycle progression antagonized by a spliced variant within the KH domain.
J. Biol. Chem.
272:3129-3132[Abstract/Free Full Text].
|
| 4.
|
Chen, T.,
F. M. Boisvert,
D. P. Bazett-Jones, and S. Richard.
1999.
A role for the GSG domain in localizing Sam68 to novel nuclear structures in cancer cell lines.
Mol. Biol. Cell
10:3015-3033[Abstract/Free Full Text].
|
| 5.
|
Chen, T.,
B. B. Damaj,
C. Herrera,
P. Lasko, and S. Richard.
1997.
Self-association of the single-KH-domain family members Sam68, GRP33, GLD-1, and Qk1: role of the KH domain.
Mol. Cell. Biol.
17:5707-5718[Abstract].
|
| 6.
|
Chen, T., and S. Richard.
1998.
Structure-function analysis of Qk1: a lethal point mutation in mouse quaking prevents homodimerization.
Mol. Cell. Biol.
18:4863-4871[Abstract/Free Full Text].
|
| 7.
|
Cochrane, A. W.,
C. H. Chen,
R. Kramer,
L. Tomchak, and C. A. Rosen.
1989.
Purification of biologically active human immunodeficiency virus rev protein from Escherichia coli.
Virology
173:335-337[CrossRef][Medline].
|
| 8.
|
Cooper, J. A., and B. Howell.
1993.
The when and how of Src regulation.
Cell
73:1051-1054[Medline].
|
| 9.
|
De Boulle, K.,
A. J. Verkerk,
E. Reyniers,
L. Vits,
J. Hendrickx,
B. Van Roy,
F. Van den Bos,
E. de Graaff,
B. A. Oostra, and P. J. Willems.
1993.
A point mutation in the FMR-1 gene associated with fragile X mental retardation.
Nat. Genet.
3:31-35[CrossRef][Medline].
|
| 10.
|
Di Fruscio, M.,
T. Chen,
S. Bonyadi,
P. Lasko, and S. Richard.
1998.
The identification of two Drosophila K homology domain proteins. Kep1 and SAM are members of the Sam68 family of GSG domain proteins.
J. Biol. Chem.
273:30122-30130[Abstract/Free Full Text].
|
| 11.
|
Easty, D. J.,
P. J. Mitchell,
K. Patel,
V. A. Florenes,
R. A. Spritz, and D. C. Bennett.
1997.
Loss of expression of receptor tyrosine kinase family genes PTK7 and SEK in metastatic melanoma.
Int. J. Cancer
71:1061-1065[CrossRef][Medline].
|
| 12.
|
Ebersole, T. A.,
Q. Chen,
M. J. Justice, and K. Artzt.
1996.
The quaking gene product necessary in embryogenesis and myelination combines features of RNA binding and signal transduction proteins.
Nat. Genet.
12:260-265[CrossRef][Medline].
|
| 13.
|
Feng, S.,
C. Kasahara,
R. J. Rickles, and S. L. Schreiber.
1995.
Specific interactions outside the proline-rich core of two classes of Src homology 3 ligands.
Proc. Natl. Acad. Sci. USA
92:12408-12415[Abstract/Free Full Text].
|
| 14.
|
Fumagalli, S.,
N. F. Totty,
J. J. Hsuan, and S. A. Courtneidge.
1994.
A target for Src in mitosis.
Nature
368:871-874[CrossRef][Medline].
|
| 15.
|
Gibson, T. J.,
J. D. Thompson, and J. Heringa.
1993.
The KH domain occurs in a diverse set of RNA-binding proteins that include the antiterminator NusA and is probably involved in binding to nucleic acid.
FEBS Lett.
324:361-366[CrossRef][Medline].
|
| 16.
|
Guan, K. L., and J. E. Dixon.
1991.
Eucaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase.
Anal. Biochem.
192:262-267[CrossRef][Medline].
|
| 17.
|
Hope, T. J.,
X. J. Huang,
D. McDonald, and T. G. Parslow.
1990.
Steroid-receptor fusion of the human immunodeficiency virus type 1 Rev transactivator: mapping cryptic functions of the arginine-rich motif.
Proc. Natl. Acad. Sci. USA
87:7787-7791[Abstract/Free Full Text].
|
| 18.
|
Hynes, N. E.,
R. Jaggi,
S. C. Kozma,
R. Ball,
D. Muellener,
N. T. Wetherall,
B. W. Davis, and B. Groner.
1985.
New acceptor cell for transfected genomic DNA: oncogene transfer into a mouse mammary epithelial cell line.
Mol. Cell. Biol.
5:268-272[Abstract/Free Full Text].
|
| 19.
|
Jones, A. R., and T. Schedl.
1995.
Mutations in gld-1, a female germ cell-specific tumor suppressor gene in Caenorhabditis elegans, affect a conserved domain also found in Src-associated protein Sam68.
Genes Dev.
9:1491-1504[Abstract/Free Full Text].
|
| 20.
|
Lang, V.,
D. Mege,
M. Semichon,
H. Gary-Gouy, and G. Bismuth.
1997.
A dual participation of ZAP-70 and scr protein tyrosine kinases is required for TCR-induced tyrosine phosphorylation of Sam68 in Jurkat T cells.
Eur. J. Immunol.
27:3360-3367[Medline].
|
| 21.
|
Lawe, D. C.,
C. Hahn, and A. J. Wong.
1997.
The Nck SH2/SH3 adaptor protein is present in the nucleus and associates with the nuclear protein SAM68.
Oncogene
14:223-231[CrossRef][Medline].
|
| 22.
|
Lee, S. T.,
K. M. Strunk, and R. A. Spritz.
1993.
A survey of protein tyrosine kinase mRNAs expressed in normal human melanocytes.
Oncogene
8:3403-3410[Medline].
|
| 23.
|
Lin, Q.,
S. J. Taylor, and D. Shalloway.
1997.
Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains.
J. Biol. Chem.
272:27274-27280[Abstract/Free Full Text].
|
| 24.
|
Llor, X.,
M. S. Serfas,
W. Bie,
V. Vasioukhin,
M. Polonskaia,
J. Derry,
C. M. Abbott, and A. L. Tyner.
1999.
BRK/Sik expression in the gastrointestinal tract and in colon tumors.
Clin. Cancer Res.
5:1767-1777[Abstract/Free Full Text].
|
| 25.
|
Mitchell, P. J.,
K. T. Barker,
J. E. Martindale,
T. Kamalati,
P. N. Lowe,
M. J. Page,
B. A. Gusterson, and M. R. Crompton.
1994.
Cloning and characterisation of cDNAs encoding a novel non-receptor tyrosine kinase, brk, expressed in human breast tumours.
Oncogene
9:2383-2390[Medline].
|
| 26.
|
Pendergast, A. M.
1996.
Nuclear tyrosine kinases: from Abl to WEE1.
Curr. Opin. Cell Biol.
8:174-181[CrossRef][Medline].
|
| 27.
|
Reddy, T. R.,
W. Xu,
J. K. Mau,
C. D. Goodwin,
M. Suhasini,
H. Tang,
K. Frimpong,
D. W. Rose, and F. Wong-Staal.
1999.
Inhibition of HIV replication by dominant negative mutants of Sam68, a functional homolog of HIV-1 Rev.
Nat. Med.
5:635-642[CrossRef][Medline].
|
| 28.
|
Resnick, R. J.,
S. J. Taylor,
Q. Lin, and D. Shalloway.
1997.
Phosphorylation of the Src substrate Sam68 by Cdc2 during mitosis.
Oncogene
15:1247-1253[CrossRef][Medline].
|
| 29.
|
Richard, S.,
D. Yu,
K. J. Blumer,
D. Hausladen,
M. W. Olszowy,
P. A. Connelly, and A. S. Shaw.
1995.
Association of p62, a multifunctional SH2- and SH3-domain-binding protein, with src family tyrosine kinases, Grb2, and phospholipase C gamma-1.
Mol. Cell. Biol.
15:186-1897[Abstract].
|
| 30.
|
Richard, S., and H. H. Zingg.
1992.
Analysis of cis-acting elements of the oxytocin gene by DNA-mediated gene transfer, p. 324-343.
In
P. M. Conn (ed.), Methods in neuroscience. Academic Press Inc, Orlando, Fla.
|
| 31.
|
Sanchez-Margalet, V., and S. Najib.
1999.
p68 Sam is a substrate of the insulin receptor and associates with the SH2 domains of p85 PI3K.
FEBS Lett.
455:307-310[CrossRef][Medline].
|
| 32.
|
Siomi, H., and G. Dreyfuss.
1997.
RNA-binding proteins as regulators of gene expression.
Curr. Opin. Genet. Dev.
7:345-353[CrossRef][Medline].
|
| 33.
|
Siomi, H.,
M. J. Matunis,
W. M. Michael, and G. Dreyfuss.
1993.
The pre-mRNA binding K protein contains a novel evolutionarily conserved motif.
Nucleic Acids Res.
21:1193-1198[Abstract/Free Full Text].
|
| 34.
|
Siyanova, E. Y.,
M. S. Serfas,
I. A. Mazo, and A. L. Tyner.
1994.
Tyrosine kinase gene expression in the mouse small intestine.
Oncogene
9:2053-2057[Medline].
|
| 35.
|
Songyang, Z.,
S. E. Shoelson,
M. Chaudhuri,
G. Gish,
T. Pawson,
W. G. Haser,
F. King,
T. Roberts,
S. Ratnofsky,
R. J. Lechleider, et al.
1993.
SH2 domains recognize specific phosphopeptide sequences.
Cell
72:767-778[CrossRef][Medline].
|
| 36.
|
Songyang, Z.,
S. E. Shoelson,
J. McGlade,
P. Olivier,
T. Pawson,
X. R. Bustello,
M. Barbacid,
H. Sabe,
H. Hanafusa,
T. Yi,
R. Ren,
D. Baltimore,
S. Ratnofsky,
R. A. Feldman, and L. C. Cantley.
1994.
Specific motifs recognized by the SH2 domains of Csk, 3BP2, fps/fes, GRB-2, HCP, SHC, Syk, and Vav.
Mol. Cell. Biol.
14:2777-2785[Abstract/Free Full Text].
|
| 37.
|
Swenarchuk, L.,
P. Harakidas, and A. Cochrane.
1999.
Regulated expression of HIV-1 Rev function in mammalian cell lines.
Can. J. Microbiol.
45:480-490[CrossRef][Medline].
|
| 38.
|
Taylor, S. J.,
M. Anafi,
T. Pawson, and D. Shalloway.
1995.
Functional interaction between c-Src and its mitotic target, Sam 68.
J. Biol. Chem.
270:10120-10124[Abstract/Free Full Text].
|
| 39.
|
Taylor, S. J., and D. Shalloway.
1994.
An RNA-binding protein associated with Src through its SH2 and SH3 domains in mitosis.
Nature
368:867-871[CrossRef][Medline].
|
| 40.
|
Trub, T.,
J. D. Frantz,
M. Miyazaki,
H. Band, and S. E. Shoelson.
1997.
The role of a lymphoid-restricted, Grb2-like SH3-SH2-SH3 protein in T cell receptor signaling.
J. Biol. Chem.
272:894-902[Abstract/Free Full Text].
|
| 41.
|
Vasioukhin, V.,
M. S. Serfas,
E. Y. Siyanova,
M. Polonskaia,
V. J. Costigan,
B. Liu,
A. Thomason, and A. L. Tyner.
1995.
A novel intracellular epithelial cell tyrosine kinase is expressed in the skin and gastrointestinal tract.
Oncogene
10:349-357[Medline].
|
| 42.
|
Vasioukhin, V., and A. L. Tyner.
1997.
A role for the epithelial-cell-specific tyrosine kinase Sik during keratinocyte differentiation.
Proc. Natl. Acad. Sci. USA
94:14477-14482[Abstract/Free Full Text].
|
| 43.
|
Vernet, C., and K. Artzt.
1997.
STAR, a gene family involved in signal transduction and activation of RNA.
Trends Genet.
13:479-484[CrossRef][Medline].
|
| 44.
|
Wang, J. Y.
1994.
Nuclear protein tyrosine kinases.
Trends Biochem. Sci.
19:373-376[CrossRef][Medline].
|
| 45.
|
Wang, L. L.,
S. Richard, and A. S. Shaw.
1995.
P62 association with RNA is regulated by tyrosine phosphorylation.
J. Biol. Chem.
270:2010-2013[Abstract/Free Full Text].
|
| 46.
|
Weng, Z.,
S. M. Thomas,
R. J. Rickles,
J. A. Taylor,
A. W. Brauer,
C. Seidel-Dugan,
W. M. Michael,
G. Dreyfuss, and J. S. Brugge.
1994.
Identification of Src, Fyn, and Lyn SH3-binding proteins: implications for a function of SH3 domains.
Mol. Cell. Biol.
14:4509-4521[Abstract/Free Full Text].
|
| 47.
|
Wong, G.,
O. Muller,
R. Clark,
L. Conroy,
M. F. Moran,
P. Polakis, and F. McCormick.
1992.
Molecular cloning and nucleic acid binding properties of the GAP-associated tyrosine phosphoprotein p62.
Cell
69:551-558[CrossRef][Medline].
|
Molecular and Cellular Biology, August 2000, p. 6114-6126, Vol. 20, No. 16
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ie Kim, H., Lee, S.-T.
(2009). Oncogenic Functions of PTK6 are Enhanced by Its Targeting to Plasma Membrane But Abolished by Its Targeting to Nucleus. J Biochem
146: 133-139
[Abstract]
[Full Text]
-
Ostrander, J. H., Daniel, A. R., Lofgren, K., Kleer, C. G., Lange, C. A.
(2007). Breast Tumor Kinase (Protein Tyrosine Kinase 6) Regulates Heregulin-Induced Activation of ERK5 and p38 MAP Kinases in Breast Cancer Cells. Cancer Res.
67: 4199-4209
[Abstract]
[Full Text]
-
Haegebarth, A., Bie, W., Yang, R., Crawford, S. E., Vasioukhin, V., Fuchs, E., Tyner, A. L.
(2006). Protein tyrosine kinase 6 negatively regulates growth and promotes enterocyte differentiation in the small intestine.. Mol. Cell. Biol.
26: 4949-4957
[Abstract]
[Full Text]
-
Kasprzycka, M., Majewski, M., Wang, Z.-J., Ptasznik, A., Wysocka, M., Zhang, Q., Marzec, M., Gimotty, P., Crompton, M. R., Wasik, M. A.
(2006). Expression and Oncogenic Role of Brk (PTK6/Sik) Protein Tyrosine Kinase in Lymphocytes. Am. J. Pathol.
168: 1631-1641
[Abstract]
[Full Text]
-
Lukong, K. E., Larocque, D., Tyner, A. L., Richard, S.
(2005). Tyrosine Phosphorylation of Sam68 by Breast Tumor Kinase Regulates Intranuclear Localization and Cell Cycle Progression. J. Biol. Chem.
280: 38639-38647
[Abstract]
[Full Text]
-
Kim, H. I., Lee, S.-T.
(2005). An Intramolecular Interaction between SH2-Kinase Linker and Kinase Domain Is Essential for the Catalytic Activity of Protein-tyrosine Kinase-6. J. Biol. Chem.
280: 28973-28980
[Abstract]
[Full Text]
-
Modem, S., Badri, K. R., Holland, T. C., Reddy, T. R.
(2005). Sam68 is absolutely required for Rev function and HIV-1 production. Nucleic Acids Res
33: 873-879
[Abstract]
[Full Text]
-
Zhang, P., Ostrander, J. H., Faivre, E. J., Olsen, A., Fitzsimmons, D., Lange, C. A.
(2005). Regulated Association of Protein Kinase B/Akt with Breast Tumor Kinase. J. Biol. Chem.
280: 1982-1991
[Abstract]
[Full Text]
-
Haegebarth, A., Heap, D., Bie, W., Derry, J. J., Richard, S., Tyner, A. L.
(2004). The Nuclear Tyrosine Kinase BRK/Sik Phosphorylates and Inhibits the RNA-binding Activities of the Sam68-like Mammalian Proteins SLM-1 and SLM-2. J. Biol. Chem.
279: 54398-54404
[Abstract]
[Full Text]
-
Chen, H.-Y., Shen, C.-H., Tsai, Y.-T., Lin, F.-C., Huang, Y.-P., Chen, R.-H.
(2004). Brk Activates Rac1 and Promotes Cell Migration and Invasion by Phosphorylating Paxillin. Mol. Cell. Biol.
24: 10558-10572
[Abstract]
[Full Text]
-
Rafalska, I., Zhang, Z., Benderska, N., Wolff, H., Hartmann, A. M., Brack-Werner, R., Stamm, S.
(2004). The intranuclear localization and function of YT521-B is regulated by tyrosine phosphorylation. Hum Mol Genet
13: 1535-1549
[Abstract]
[Full Text]
-
Hong, E., Shin, J., Kim, H.-I., Lee, S.-T., Lee, W.
(2004). Solution Structure and Backbone Dynamics of the Non-receptor Protein-tyrosine Kinase-6 Src Homology 2 Domain. J. Biol. Chem.
279: 29700-29708
[Abstract]
[Full Text]
-
Mabrouk, M. E., Diep, Q. N., Benkirane, K., Touyz, R. M., Schiffrin, E. L.
(2004). SAM68: a downstream target of angiotensin II signaling in vascular smooth muscle cells in genetic hypertension. Am. J. Physiol. Heart Circ. Physiol.
286: H1954-H1962
[Abstract]
[Full Text]
-
Fredj, N. B., Grange, J., Sadoul, R., Richard, S., Goldberg, Y., Boyer, V.
(2004). Depolarization-induced translocation of the RNA-binding protein Sam68 to the dendrites of hippocampal neurons. J. Cell Sci.
117: 1079-1090
[Abstract]
[Full Text]
-
Lasko, P.
(2003). Gene Regulation at the RNA Layer: RNA Binding Proteins in Intercellular Signaling Networks. Sci Signal
2003: re6-re6
[Abstract]
[Full Text]
-
Coyle, J. H., Guzik, B. W., Bor, Y.-C., Jin, L., Eisner-Smerage, L., Taylor, S. J., Rekosh, D., Hammarskjold, M.-L.
(2003). Sam68 Enhances the Cytoplasmic Utilization of Intron-Containing RNA and Is Functionally Regulated by the Nuclear Kinase Sik/BRK. Mol. Cell. Biol.
23: 92-103
[Abstract]
[Full Text]
-
Moncion, A., Truong, N. T., Garrone, A., Beaune, P., Barouki, R., de Waziers, I.
(2002). Identification of a 16-Nucleotide Sequence That Mediates Post-transcriptional Regulation of Rat CYP2E1 by Insulin. J. Biol. Chem.
277: 45904-45910
[Abstract]
[Full Text]
-
Hong, W., Resnick, R. J., Rakowski, C., Shalloway, D., Taylor, S. J., Blobel, G. A.
(2002). Physical and Functional Interaction Between the Transcriptional Cofactor CBP and the KH Domain Protein Sam68. Mol Cancer Res
1: 48-55
[Abstract]
[Full Text]
-
Qiu, H., Miller, W. T.
(2002). Regulation of the Nonreceptor Tyrosine Kinase Brk by Autophosphorylation and by Autoinhibition. J. Biol. Chem.
277: 34634-34641
[Abstract]
[Full Text]
-
Soros, V. B., Carvajal, H. V., Richard, S., Cochrane, A. W.
(2001). Inhibition of Human Immunodeficiency Virus Type 1 Rev Function by a Dominant-Negative Mutant of Sam68 through Sequestration of Unspliced RNA at Perinuclear Bundles. J. Virol.
75: 8203-8215
[Abstract]
[Full Text]
-
Gilbert, C., Barabe, F., Rollet-Labelle, E., Bourgoin, S. G., McColl, S. R., Damaj, B. B., Naccache, P. H.
(2001). Evidence for a Role for SAM68 in the Responses of Human Neutrophils to Ligation of CD32 and to Monosodium Urate Crystals. J. Immunol.
166: 4664-4671
[Abstract]
[Full Text]
-
Stoss, O., Olbrich, M., Hartmann, A. M., Konig, H., Memmott, J., Andreadis, A., Stamm, S.
(2001). The STAR/GSG Family Protein rSLM-2 Regulates the Selection of Alternative Splice Sites. J. Biol. Chem.
276: 8665-8673
[Abstract]
[Full Text]
-
Chen, T., Cote, J., Carvajal, H. V., Richard, S.
(2001). Identification of Sam68 Arginine Glycine-rich Sequences Capable of Conferring Nonspecific RNA Binding to the GSG Domain. J. Biol. Chem.
276: 30803-30811
[Abstract]
[Full Text]