Previous Article | Next Article 
Molecular and Cellular Biology, September 2000, p. 6414-6425, Vol. 20, No. 17
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Multiple Splicing Defects in an Intronic
False Exon
Hanzhen
Sun and
Lawrence A.
Chasin*
Department of Biological Sciences, Columbia
University, New York, New York 10027
Received 25 February 2000/Returned for modification 17 April
2000/Accepted 15 June 2000
 |
ABSTRACT |
Splice site consensus sequences alone are insufficient to dictate
the recognition of real constitutive splice sites within the typically
large transcripts of higher eukaryotes, and large numbers of
pseudoexons flanked by pseudosplice sites with good matches to the
consensus sequences can be easily designated. In an attempt to identify
elements that prevent pseudoexon splicing, we have systematically
altered known splicing signals, as well as immediately adjacent
flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice
site that perfectly matches the 5' consensus combined with mutation to
match the CAG/G sequence of the 3' consensus failed to get this model
pseudoexon included as the central exon in a dhfr minigene
context. Provision of a real 3' splice site and a consensus 5' splice
site and removal of an upstream inhibitory sequence were necessary and
sufficient to confer splicing on the pseudoexon. This activated context
also supported the splicing of a second pseudoexon sequence containing
no apparent enhancer. Thus, both the 5' splice site sequence and the
polypyrimidine tract of the pseudoexon are defective despite their good
agreement with the consensus. On the other hand, the pseudoexon body
did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its
replacement with
-globin exon 2 only partially reversed the effect
of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are
not a prerequisite for constitutive exon definition and suggest that
intrinsically defective splice sites and negative elements play
important roles in distinguishing the real splicing signal from the
vast number of false splicing signals.
 |
INTRODUCTION |
A major question in mammalian pre-mRNA
splicing is how exons (or introns) are recognized. Mammalian
transcripts are typically tens of thousands of bases long, with large
introns alternating with internal exons that are usually less than 300 bases long. How are these small exons recognized within this sea of
intronic sequences? Sequences defining a consensus are found at
virtually all exon-intron joints (59). At the upstream side
of an exon, the 15-nucleotide (nt) 3' splice site consensus is
Y10NCAG/G, and at the downstream
side, the 5' splice site is MAG/GURAGU (M equals
A or C; boldface type indicates invariant nucleotides). At a variable
distance upstream of the exon (often ~30 nt) lies the branch point,
with the very loose consensus YNYURAY. The AG dinucleotide
immediately preceding the exon and the GU dinucleotide immediately
following the exon are almost always present. However, considerable
variation is found at the other positions: the highest frequency of
occurrence of a particular base at a given position ranges from about
35 to 80%. As a result, less than 5% of actual 3' or 5' splice sites
represent a perfect match to the consensuses described above (our
analysis of a database of 2,800 human exons compiled by Reese et al.
[http://www.fruitfly.org/sequence/human-datasets.html]).
In a typical mammalian transcript, there are many sequences that match
these consensuses as well as or better than the sequences at real
splice sites yet they are not used for splicing (47, 71). We
will refer to these false sites as pseudosites. Real exons are
recognized and spliced cotranscriptionally (5, 6, 44, 48,
91) with a half-time of about 5 min in vivo (44); the
pseudosites are efficiently ignored during this process. There must be
additional signals that distinguish real splice sites from pseudosites
or vice versa. These additional recognition elements could act either
positively or negatively, and examples of either type have been
demonstrated over the last few years. Positive elements, or splicing
enhancers, were first recognized as purine-rich sequences that promote
splicing when present within some exons (90); more recently,
the list of such enhancers has expanded to include AC-rich sequences
(24) and intronic locations (13, 38, 58, 76).
Despite the demonstration of specific interactions between enhancers
and mammalian trans-acting mediators (10, 20, 41, 56,
84), at best only very degenerate motifs have emerged to define
the enhancer sequence (51). Enhancers are better understood
from the alternative splicing examples for the sex determination genes
in drosophila, where several of these sequence elements, along with
their trans-acting mediators, having been genetically
characterized (for a review, see reference 52). Most
enhancers have been identified in the context of alternative splicing;
it is not yet clear whether they play an important role in constitutive
splicing. The characteristics of the SR family of proteins support this
idea, since some of these proteins bind to specific enhancer elements
(51, 57, 82) and can also act as essential splicing factors
(46, 89). Multiple sequences in constitutively spliced human
-globin exon 2 have been shown to act as enhancers when tested in an
alternative splicing framework, and it has been proposed that they
function in constitutive exon definition (70). However,
their physiological significance within the globin gene is not clear.
Our knowledge of the role and mechanism of action of splicing silencers
is more limited. It is known that these sequences can act from within
an exon (28, 41) or an intron (16, 33, 35, 42),
but no consensus sequence for such elements is apparent. In mammals, a
silencer-binding protein has been identified in only a few cases
(12, 16, 25, 42, 49). A well-studied example in drosophila
is the transposase transcript, where the protein PSI has been shown to
interact with 5' pseudosplice sites near the real 5' splice site to
block the alternative splicing of an internal exon (74).
Once again, it is not clear that these cases of silencing represent
general inhibitory mechanisms operating in constitutive splicing
decisions as well. However, the identification of PTB (hnRNP I)
(17, 49, 60) and hnRNP A1 (8, 12, 25) as splicing
inhibitors raises the possibility of such a role, given the abundance
of these proteins as part of hnRNP complexes (30).
The effects of premature termination codons on nuclear RNA processing
has prompted proposals that the translatability of exons plays a role
in their recognition during nuclear RNA processing (15,
88; H. C. Dietz, Letter, Am. J. Hum. Genet.
60:729-730, 1997). In this scenario, the absence of
in-frame stop codons in a potential exon could provide the defining
criterion for distinguishing real splice sites from pseudosplice sites.
However, there is no direct evidence for a cellular mechanism that
could capitalize on this information, i.e., recognize the
translatability of an exon before it is spliced. Moreover, there are
many examples of premature termination codons that do not affect
pre-mRNA splicing (e.g., reference 88). A real exon
sequence is constrained by its obligation to code for a protein, and so
exon sequences do differ statistically significantly from intron
sequences, e.g., in the frequency of particular hexanucleotides
(94). Recognition of this constraint and a requirement for
an open reading frame (ORF) together with the splice consensus
sequences allows the prediction of exons within large genes with fairly
high reliability (77, 78, 93). However, it is difficult to
see how these statistical differences could be exploited to afford
molecular recognition. The more likely mechanism is that exon
recognition proceeds through the binding of protein or RNA factors to
specific sequences or structures.
Site-directed mutagenesis of cloned genes and the analysis of mutations
in endogenous genes have revealed cis-acting sequences that
are necessary for constitutive splicing. In addition to the usual
necessity for the conserved GU and AG dinucleotides, these studies have
shown absolute or partial dependence on consensus nucleotides in other
positions. However, the severity of the phenotype resulting from
changes at a given position varies from one splice site to the next
(14, 47, 64). In addition, mutations in the exon or the
intron outside of the consensus sequence can also have strong effects
(14, 64, 67). Some of these sequences have been
characterized as enhancers or silencers, as mentioned above, and some
of these have been shown to bind specific proteins or snRNPs. In other
cases, secondary structure has been shown to play a role in either
promoting or inhibiting splicing (3, 32, 34, 40). The
general picture that has emerged from these studies is the recognition
of the consensus sequences by different snRNPs, with this binding being
stabilized either by exon- or intron-bridging interactions with SR and
other proteins or by secondary or higher-order structures. However, the
specificity and exact nature of these interactions are not clear enough
to allow the formulation of rules for exon recognition.
Although the requirements for splicing of exons and introns have been
extensively investigated, little attention has been paid to the other
side of the coin: why are the many sites that match the consensus
splice sites, the pseudosites, not used? Do they have perfectly
functional splice sites but lack enhancer sequences? Are the false
sites defective despite their agreement with the consensus? Are there
silencing elements that keep an otherwise functional site from being
recognized? We have used a mutational approach to address these
questions. Examining the sequence of the large first intron of the
human hprt gene, we chose a 3' pseudosplice site followed by
a downstream 5' pseudosplice site to define a pseudoexon. Rather than
using mutation to knock out the splicing function, we asked what it
takes to "knock in" splicing, that is, to convert the pseudoexon
into a functional exon. We found that despite their apparent similarity
to what we understand as splice sites, the intronic pseudosplice sites bordering this pseudoexon were defective. In addition, we found the 3'
pseudosplice site to be associated with an intronic splicing silencer.
A requirement for exonic enhancers was not evident in our studies.
 |
MATERIALS AND METHODS |
Cell lines and cell culture.
DG44 is a CHO cell line with a
double deletion at the dhfr locus (87), and U1S
is a CHO cell line with a double deletion of aprt
(9). These cells were grown in monolayer culture in Ham's
F-12 medium (GIBCO/Life Technologies) supplemented with 10% fetal calf
serum (Atlanta Biologicals). All cells were cultured at 37°C in a
humidified atmosphere of 95% air and 5% CO2. Generally, the medium was changed every 3 days.
Criteria for selecting hprt pseudoexons.
Consensus matrices for the 5' splice site (SAG/GURAGU, S
equals C or A) and the 3' splice site (Y10NCAG/G)
were derived from a database of 2,800 exons from a set of unique
human genes (http://www.fruitfly.org/sequence/human-datasets.html). These matrices were similar to those reported by Senapathy et al. for
primate genes (71) and are available upon request. Splice site consensus scores were calculated essentially as described by
Shapiro and Senapathy (72). A score of 100 represents the best match to the consensus, 0 represents the worst possible match, and
the GU and AG dinucleotides at the intron borders were an absolute
requirement. For a pseudoexon, we asked for a minimum 3' splice site
consensus score of 69, that being the lowest 3' score for a real exon
in this gene, and a minimum 5' splice site score of 75, which is the
lowest 5' score among the real hprt exons. We then asked
that a high-scoring 3' splice site be followed by a downstream
high-scoring 5' splice site to give a minimum combined score of 150 for
a pseudoexon, which is the lowest combined score for a real internal
hprt exon. We demanded that the minimum exon size be 50 nt,
since decreasing larger exons below this size reduces splicing
efficiency (29) and natural small exons below this size may
be initially recognized as larger entities (81). The maximum
exon size was set rather arbitrarily to 200: 85% of human exons are
<200 nt, the average exon size being about 135 nt (39, 94).
We also required the presence of a possible branch point within 60 nt
upstream of an exon with a bulged A at position 6 and at least 3 of the
remaining 6 nt capable of base pairing to U2 snRNA. Here again, we were
guided by the nature of the real splice sites in the hprt
gene: increasing the stringency of this requirement by one additional
base pair would have caused the loss of six of the eight real 3' splice
sites. Finally, we purged pseudoexons (60%) from sets that shared a 3'
or 5' pseudosplice site, choosing the candidate that produced the
highest combined score. One 141-nt pseudoexon (pseudoexon 1), starting
a position 6106 (31) near the center of hprt
intron 1, was chosen for study. For some experiments, we utilized a
second pseudoexon from hprt intron 1, i.e., pseudoexon 2, which is 123 nt long and starts at position 15862.
Plasmid constructions.
A more detailed description of the
methods used for plasmid constructions is available from us upon
request. For diagrams of the plasmids, see Fig. 4, 5, and 6.
Pseudoexon 1 was cloned together with its flanks from human placental
DNA by PCR amplification of the region from 131 nt upstream to 281 nt
downstream of the pseudoexon using primers with PstI restriction site tails. pDH1 was constructed by inserting this sequence
into a unique PstI site in the sole intron of the Chinese hamster dhfr minigene pDCH1P11 (63). pDH1S was
constructed from pDH1 using mutagenic primers that converted the sole
potential TGA stop codon at position 101 within the pseudoexon to CGA.
To create pDH2, the pseudoexon 1 flanking sequences were trimmed by PCR
amplification of pDH1S with PstI-tailed primers designed to
include just 48 nt of the upstream flank and 7 nt of the downstream flank and insertion of the PCR product into the PstI site of
pDCH1P11. Plasmid pDH3A was constructed by PCR-based site-directed
mutagenesis to substitute a G for the C at position +1 of pseudoexon 1, resulting in the CAG/G sequence of a consensus 3' splice site sequence. pDH3D was similarly constructed to change the sequence downstream of
pseudoexon 1 from CAG/GUGUGA to the consensus 5' splice site sequence CAG/GUGAGU. Plasmid pDH3AD, containing both the
optimized 3' splice site and 5' splice site sequences, was made by
cloning a 415-nucleotide BstXI fragment from pDH3D that
spanned the pseudoexon 5' splice site sequence into pDH3A. The
pseudoexon 1/dhfr exon 2 chimeric plasmid pH5D3 was
constructed by a PCR-ligation-PCR method (1). pH5D3A was
constructed by PCR amplifying a sequence extending through the first 34 nt of pseudoexon 1 and ligation to a fragment bearing sequences from
dhfr exon 2 and intron 2 from pD2B (18) at a
position 15 nt upstream of the 3' end of the exon. A dhfr
exon2/pseudoexon 1 chimeric plasmid was similarly constructed by
ligating a PCR product extending through the first 35 nt of
dhfr exon 2 to pseudoexon 1 at a position 107 nt upstream of
the 3' end, yielding pD5H3. Plasmid pAPRTH1 was constructed by PCR
amplification of a pDH2 fragment containing pseudoexon 1 from 52 nt
upstream of the 3' pseudosplice site to 33 nt downstream of the 5'
pseudosplice site and inserting this 246-nt PCR product into the
EcoRI site in intron 2 of pWTaprt (44). Plasmid
pD2P2 was constructed by inserting the 141-nt pseudoexon 1 sequence between the XhoI and ApaI sites of exon 2A in
pD2C3, a close derivative of pD2B constructed by Will Fairbrother
(32a). Plasmid pDH3 was constructed by replacing the
putative polypyrimidine tract (PPT) and branch point upstream of
pseudoexon 1 in pDH3D with 76 nt (
75 to +1) comprising the assumed
branch point region, PPT, and 3' splice site at the 3' end of the real
intron 1 of the human hprt gene; thus, pDH3 has a real 3'
splice site and an optimized 5' splice site. In the course of this
construction, an AflII site was introduced downstream of the
PstI site at the upstream end of the 76-mer. Plasmids
pDH3t3, pDH3t2, and pDH3t1 were constructed by deleting 20 nt (
75 to
56), 35 nt (
75 to
41), and 61 nt (
75 to
15), respectively,
from the 76-nt hprt intron 1 fragment in pDH3. Plasmid pAH
was derived by replacing 10 nt of the PPT (
14 to
5) upstream of
pseudoexon 1 in pDH3AD with its hprt intron 1 counterpart.
Plasmid pAD was constructed similarly, by replacing the same 10 nt
upstream of pseudoexon 1 with the dhfr intron 1 counterpart
(a PPT from another real 3' splice site). pDH4dt was constructed by
inserting a synthetic double-stranded oligonucleotide that included the
reverse complement of the original 34-mer into the AflII
site 14 nt upstream of the pseudoexon in pDH3t1. pDEL34 was created by
deleting 34 nt upstream of the PPT in pDH3AD using PCR methodology.
Thus, pDEL34 retains only 14 nt of the upstream sequence originally
flanking pseudoexon 1. pAPRTSS2 was constructed by inserting a 34-mer
from position
48 to position
15 of the pseudoexon 1 upstream flank
into a position 14 nt upstream of exon 4 in the aprt gene;
thus, the 34-mer occupies the same position relative to the downstream
aprt or hprt pseudoexon. Plasmid pDH3A3 was
constructed by inserting three tandem copies of the A3 enhancer sequence (responsive to ASF/SF2 [84]) into a
NarI site 24 nt downstream of the 5' end of pseudoexon I in
pDH3AD; PCR amplification with NarI-tailed primers and a
template provided by R. Tacke and J. Manley were used. Similarly,
plasmid pDH3S3 was constructed by inserting three tandem repeats of
sequence S3, a SELEX winner binding to SC35 (84) into the
NarI site of pseudoexon 1.
To make plasmid DG11, pseudoexon 1 in pDH3t2 was first replaced with a
9-nt-long exon containing a
BclI restriction site to
produce
pDH3EL. Human

-globin gene exon 2 (from +1 to the
BamHI
site at +211) was PCR amplified with
BclI-tailed primers and
inserted
into the
BclI site of pDH3EL. To make plasmid DG12,
pseudoexon
1 in pDH3A was first replaced with an 8-nt-long exon
containing
a
BclI restriction site to produce pDEL. To
create pDG12, human

-globin gene exon 2 (from +1 to the
BamHI site at +211) was PCR
amplified with
BclI-tailed primers and inserted into the
BclI
site of pDEL. pDG12D was created from pDG12 by mutating the 5'
splice
site to the consensus sequence by PCR mutagenesis. pDHP2
was similarly
constructed by insertion of a pseudoexon 2 sequence
from the human
hprt gene (123 nt starting at position 15862) into
pDH3EL.
PCR amplification of DNA templates.
PCR from DNA templates
was performed with 1 to 2 ng of plasmid DNA or 1 to 2 µg of genomic
DNA and Taq DNA polymerase (Perkin Elmer) in accordance with
the supplier's recommendations. A typical cycle consisted of initial
denaturation at 94°C for 5 min, followed by 30 cycles of denaturation
at 94°C for 30 s, annealing at 61°C for 30 s, and
extension at 72°C for 60 s. After completion of the final cycle,
a final extension was done at 72°C for an additional 7 min.
Transfection.
For transient transfections, monolayers of
cells (3 × 106 in a 100-mm-diameter dish) were
transfected with 10 µg of plasmid DNA using Lipofectamine (GIBCO/Life
Technologies). Ten micrograms of plasmid DNA was added to 0.6 ml of
Opti-MEM medium (GIBCO/Life Technologies) and mixed with 0.6 ml of
Opti-MEM medium containing 30 µl of Lipofectamine. This mixture was
incubated at room temperature for 30 min. After rinsing of the cells
successively with phosphate-buffered saline and serum-free Opti-MEM
medium. 4.5 ml of Opti-MEM medium was added to the above-described
mixture and used to cover the cells. After incubation at 37°C for
5 h, 5 ml of alpha-MEM medium supplemented with 10% fetal bovine
serum was added and incubation was continued. Total RNA was extracted
48 h after the transfection. For permanent transfections, a
similar procedure was used but 1 µg of a plasmid harboring a
neo gene (a derivative of pEGFP-N1; Clontech) was included
for cotransfection. At 72 h after transfection, one-fifth of the
cells were passaged into selective medium containing 400 µg of active
G418 (Geneticin; GIBCO/Life Technologies) per ml. After 8 to 10 days,
transfectant colonies were pooled and expanded and total RNA was
extracted. Each transfection experiment was first carried out by
transient transfection and then confirmed by permanent transfections.
RNA analysis.
Total RNA was extracted from exponentially
growing cells as follows (65). Cells were lysed in a
solution of 2% sodium dodecyl sulfate; 200 mM Tris-HCl (pH 7.5), and 1 mM EDTA. DNA and proteins were precipitated with 1.5 M potassium
acetate and centrifuged for 10 min at 4°C in a microcentrifuge. The
supernatant was extracted twice with chloroform-isoamyl alcohol, and
RNA was precipitated with 0.65 volume of isopropanol. RNA extracted
from a nearly confluent 100-mm dish of cells was treated with 30 U of
RNase-free DNase I (Boehringer Mannheim), 3 mM MgCl2, and
100 U of RNasin (Promega). We used reverse transcriptase (RT), followed
by PCR (RT-PCR), to quantify the splicing products. For the RT
reaction, a 20-µl reaction mixture contained 1 µg of RNA (dissolved
in water), 0.4 µg of random hexamer, 10 mM dithiothreitol, 40 U of
RNasin, 0.5 mM all four deoxynucleoside triphosphates, 4 µl of 5 × RT buffer, and 200 U of SuperScript RT (all from Promega except the
RT, which was from GIBCO/Life Technologies). The reaction was carried
out at 37°C for 1 h, followed by 5 min of heating at 95°C to
inactivate the enzyme. Three microliters of the RT reaction mixture was
used for a 50-µl PCR mixture. PCR products were labeled with
[
-32P]dATP to allow quantitation by phosphorimaging
(18). The PCR conditions were as follows: denaturing at
95°C for 30 s, annealing at 61°C for 30 s, and extension
at 72°C for 60 s. After 25 cycles, a 7-min extension at 72°C
was carried out. A 6-µl sample of the PCR mixture was electrophoresed
in a 5% nondenaturing polyacrylamide gel.
To establish the quantitative nature of the RT-PCR method in the
determination of ratios of different RNA molecules, we prepared
mixtures of mRNA that had included (DH3t3) or skipped (DH2) pseudoexon
1 in the
dhfr minigene context. These mRNA samples were
combined
in proportions of 0:10, 2:8, 4:6, 6:4, 8:2, and 10:0. The
mixtures
were subjected to RT-PCR using the conditions described above.
Phosphorimaging (Molecular Dynamics) resulted in good quantitative
agreement between the input ratios and the output of the PCR,
as shown
in Fig.
1.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Quantitation of the RT-PCR assay for exon skipping. An
RNA preparation from a cell population exhibiting complete pseudoexon
skipping (DH2) was mixed in various ratios with an RNA preparation from
a cell population exhibiting mostly (90%) pseudoexon inclusion
(DH3t3). The sample amounts were chosen so that the unmixed samples
(lanes 1 and 6) produced signals similar in intensity. After RT-PCR,
the radioactive PCR products were separated by polyacrylamide gel
electrophoresis. (A) Phosphorimage of the PCR products. The closed
arrow indicates exon inclusion, and the open arrow indicates exon
skipping. Lanes 1 to 6 represent mixtures containing the RNA exhibiting
90% exon inclusion in the following proportions of the total: 0, 0.17, 0.35, 0.55, 0.76, and 1, respectively. Lane M, X174 HinfI
fragments. (B) Graphical representation of the data in panel A.
|
|
The principal primers used have already been described by Kessler et
al. (
44): for the
dhfr context, primers 19 and
28;
for the
aprt context, primers 1 and 8. Additional
primers used
to analyze pAPRTSS2 products for
aprt were
AEx3FDL (forward) in
exon 3(CCACAGTGTCAGCCTCCTAT) and
A3exon5B (reverse) in exon
5(GGAGAGAGAAGAATGGTACT).
 |
RESULTS |
Pseudosplice sites are abundant in the human hprt
gene.
Although conserved elements are important for the selection
of splice sites, they do not seem to be sufficient to account for the
accuracy of exon-intron discrimination. Splice sites typically contain
several mismatches with the consensus; sequences with similar degrees
of mismatching are abundant. We term these unused yet seemingly
"good" sequences (close conformity to the consensus) pseudosplice
sites. We did a computer search for such sites in the 42-kb human
hprt gene, which contains nine exons and eight introns. We
used a consensus matrix for 5' and 3' human splice sites calculated
from a set of 2,400 of each type found in a database of nonredundant
human genes (http://www.fruitfly.org/sequence/human-datasets.html) and
a scoring formula adapted from that of Shapiro and Senapathy (72). Many pseudosplice sites were found distributed
throughout the gene. As shown in Fig. 2A,
there are eight real 5' splice site in the human hprt gene
but there are over 100 5' pseudosplice sites that have scores higher
than the lowest-scoring real internal 5' splice site. The case is even
worse for 3' splice sites, where 683 pseudosites were found with higher
scores than the lowest-scoring real site (Fig. 2B). Expressing sequence
scores as information content (80) or using a search
algorithm based on a neural network comparison
(http://www.fruitfly.org/seq_tools/splice.html) did not change the
basic observation that such pseudosites outnumber real sites by an
order of magnitude (data not shown). The recognition problem of
choosing the right splice sites, and only the right ones, seems
formidable. Part of the solution might be recognition of an entire exon
by the splicing machinery, thereby ignoring the isolated pseudosplice
sites. To determine whether this approach is sufficient to resolve the
recognition problem, we searched the hprt gene for a
combination of sequence elements that resemble entire exons, including
a potential branch point, using the criteria specified in the legend to
Fig. 2C and in Materials and Methods. As shown in Fig. 2C, we found 103 good-looking exons that are ignored by the cell (which we call
pseudoexons), all of which have higher combined 3' splice site and 5'
splice site scores than the lowest scoring of the seven real internal
hprt exons. There must be additional signals that
distinguish real exons from pseudoexons or vice versa. This additional
information could be acting positively to promote the recognition of
real exons or acting negatively to repress the recognition of
pseudoexons.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Pseudosplice sites and pseudoexons in the human
hprt gene. (A) Locations and consensus scores of 9-nt
sequences resembling 5' splice sites in the human hprt gene.
The open symbols indicate the eight real 5' splice sites (SS). Only
those sites having scores equal to or higher than the lowest real 5'
splice site scores (75 for intron 3) are shown. (B) Locations and
consensus scores of 15-nt sequences resembling 3' splice sites. The
open symbols indicate the eight real 5' splice sites. Only those 285 sites having scores equal to or higher than 75 are shown. The lowest
scores of real 3' splice site are 71 and 69 for introns 6 and 7, respectively; these two points are plotted as 75 and indicated by
downward-pointing open triangles. There are 675 sequences that would
meet the lower cutoff of 69. (C) Locations and combined 3' and 5'
scores of 103 pseudoexons in the hprt gene. The criteria for
a pseudoexon were a 3' pseudosplice site scoring at least 69, followed
within at least 50 nt but no more than 200 nt by a 5' pseudosplice site
scoring at least 75, plus the presence of a sequence resembling a
branch point within 60 nt upstream of the 3' pseudosplice site (see
Materials and Methods). If more than one pseudoexon shared a 3' or 5'
pseudosplice site, only the highest-scoring candidate was chosen. The
arrow points to the score of pseudoexon 1, which was selected for
further study.
|
|
We have approached the problem of exon recognition by determining what
changes are necessary to turn a pseudoexon into a real
one. In this
way, we hoped to define some of the sequence elements
involved. We
chose a model pseudoexon (pseudoexon 1) located in
large (13-kb) intron
1 of the human
hprt gene (Fig.
2C). Pseudoexon
1 has a 5'
splice site score of 83 (higher than those of two of
the seven internal
real
hprt exons), a 3' splice site score of
83 (higher than
those of four of the seven internal exons), and
a combined score of 166 (higher than those of four of the seven
internal exons). The comparable
values for the average of 1,980
internal exons in the human gene
database are 84, 82, and 165.
Pseudoexon 1 is 141 nt long and has
possible branch points located
15, 39, and 45 nt upstream of its 3'
pseudosplice site (Fig.
3,
line 1). By these
criteria, then, pseudoexon 1 has the appearance
of an average exon.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Sequence changes at the 3' pseudosplice site of
hprt pseudoexon 1. The slash indicates the predicted
potential 3' splice site. Upstream dhfr host minigene
sequences are in italics. Point mutations are in lowercase. The
intronic splicing silencer 34-mer and its truncated and mutated
versions are underlined. An inverted 34-mer sequence is overlined. A
10-nt PPT taken from the authentic 3' splice site of hprt
intron 1 is shaded. The original 5' splice site sequence downstream of
the pseudoexon was CAG/GUGUGA, which is present here only in
pDH2. All of the other constructs in this list contained the 5' splice
site consensus sequence CAG/GUGaGu.
|
|
No autonomous negative element lies within the pseudoexon 1 body or
distal flanking sequences.
One way of explaining the
nonutilization of pseudosplice sites is that they reside in a negative
context, being masked either by secondary structures (7, 21, 26,
45, 50) or by steric or mechanistic hindrance from proteins
binding to nearby sites (42, 73). To test whether or not the
skipping of pseudoexon 1 is dependent on the larger context of the
hprt gene, we placed the pseudoexon together with only 131 nt of the upstream and 281 nt of the downstream flanking sequences into
the sole 300-nt intron of a DHFR minigene (pDH1, Fig.
4A). This construct was then transfected into
a CHO dhfr deletion mutant (DG44). In this and all of the similar analyses described below, total RNA was isolated from pooled
permanent transfectants and analyzed for splicing by RT-PCR. In all
cases, transient transfections were also carried out, with essentially
the same results. In pDH1 transcripts, dhfr exons 1 and 2 were spliced together without inclusion of pseudoexon 1 (Fig. 4B, lane
5). Thus, this sequence had retained its inability to be spliced in
this more limited and foreign minigene context. In contrast, when a
real exon (exon 2A, a second copy of dhfr exon 2) was
inserted into the same position in this minigene intron (pD2B, Fig.
4A), it was efficiently included (Fig. 4B, lane 2, and reference
18).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Splicing characteristics of constructs carrying various
configurations of pseudoexon 1. (A) Schematic representations of
pseudoexon 1 constructs. Individual constructs are described in the
text. , hprt pseudoexon 1; S, mutation of a single
nonsense codon to sense in the body of the pseudoexon (all constructs
other than pDH1 contain this change); *, mutation of the original
CAG/C sequence at the 3' pseudosplice site to the consensus CAG/G;
**, mutation of the original CAGG/GUGUGA sequence at the
5' pseudosplice site to the consensus CAG/GUGAGU; X and A,
XhoI and ApaI restriction sites, respectively. (B
and C) Phosphorimages of RT-PCR products from total RNA extracted from
permanently transfected cells. The closed arrow indicates exon
inclusion (I) and the open arrow indicates exon skipping (S) in
dhfr minigene transcripts; closed arrow 1, 2, or 3 indicates
inclusion of the inserted exon in the construct pD2P2, pDH2, or pD2B,
respectively. The closed arrowhead indicates inclusion and the open
arrowhead indicates skipping of pseudoexon 1 in aprt
transcripts. The markers (lanes M) were X174 HinfI
fragments. U, unspliced transcripts.
|
|
If pseudoexon 1 had been spliced in, a stop codon would have
interrupted the ORF. Such premature translation terminations
have been
shown to decrease mRNA levels (
56,
88), either by
destabilization (
43) or by interference with splicing
(
27,
61). To eliminate the possibility of such effects in
this system,
we mutated the single in-frame stop codon in pseudoexon 1 to a
sense codon (see Materials and Methods). This modification (pDH1S,
Fig.
4A) did not change the nonsplicing phenotype (data not shown).
This no-nonsense construct was used as the starting point for
all
subsequent
modifications.
To search for negative elements within the
hprt sequences
surrounding pseudoexon 1, we further deleted the pseudoexon flanks,
leaving only 48 nt upstream of the 3' pseudosplice site and 7
nt
downstream of the 5' pseudosplice site (pDH2, Fig.
4A). This
truncation
did not change the skipping phenotype of pseudoexon
1 (Fig.
4B, lane
1), suggesting that no negative elements had
been removed. Similarly
truncated real
dhfr exon 2A was efficiently
included when
placed in this same context (pD2ID; data not shown).
Thus, the host
dhfr intron flanks did not exert a negative influence
at
this
proximity.
We also tested the ability of pseudoexon 1 to be spliced in another
gene context, moving the trimmed pseudoexon into intron
2 of the
hamster
aprt gene, yielding pAPRTH1 (Fig.
4A). This
construct
was transfected into CHO cell line U1S with
aprt
deleted (
9).
This truncated version of pseudoexon 1 failed
to be spliced in
this foreign context as well (Fig.
4B, lane
3).
To test for the presence of negative elements within pseudoexon 1 body,
we inserted the pseudoexon 1 sequence, exclusive of
flanking intron
sequences, into
dhfr exon 2A in a derivative of
splicing-permissive construct pD2B to create pD2P2 (Fig.
4A).
The
resulting 191-nt exon was efficiently spliced (Fig.
4B, lane
4),
suggesting that no autonomously acting negative element was
harbored
pseudoexon
1.
We next separated the upstream and downstream halves of pseudoexon 1 region in an attempt to isolate the splicing defect to
the 3' or 5'
pseudosplice site. Two chimeric plasmids were constructed.
pD5H3
contained a downstream segment pseudoexon 1 and an upstream
segment
from
dhfr exon 2A, including the real 3' splice site that
precedes exon 2A (Fig.
4A). pH5D3 contained an upstream segment
pseudoexon 1 and a downstream segment from
dhfr exon 2A,
including
the real 5' splice site that follows exon 2A (Fig.
4A).
Neither
of these two constructs allowed splicing of the pseudoexon
(Fig.
4C, lanes 1 and 2). We concluded that there are defective or
negative
elements in both moieties of the
pseudoexon.
Consensus 5' and 3' splice sites fail to transform pseudoexon 1 into a real exon.
Although the splice sites of pseudoexon 1 exhibit reasonable agreement with the consensus, it is possible that
they are nevertheless defective, with better agreement required in this
particular context. We therefore made constructs that optimized the 3'
splice site (without altering the PPT), the 5' splice site, or both.
Each of these constructs was derived from pDH2. In pDH3A, the CAG/C sequence at the 3' pseudosplice site was changed to the consensus CAG/G
(Fig. 4A); this change did not bring about splicing of pseudoexon (Fig.
4C, lane 3). In pDH3D, the original CAG/GUGUGA sequence at
the 5' pseudosplice site was changed to the consensus CAG/GUGAGU (Fig. 4A); although a small amount of intron 2 splicing was now apparent, the major product was still the exon-skipped species (Fig.
4C, lane 4). Both of these changes were then incorporated into pDH3AD
(Fig. 3, line 2; Fig. 4A); the combination likewise resulted in
predominant exon skipping (Fig. 4C, lane 5). These results suggested
that the less than perfect pseudosplice sites are not, or at least not
fully, responsible for keeping the pseudoexon silent.
Provision of a 3' region from a real intron can promote splicing of
the pseudoexon.
To test the idea that the inability of pseudoexon
1 to be spliced comes from its 48-nt upstream flank, we replaced this
suspected region with a 75-nt sequence from the 3' end of a real
intron, hprt intron 1. To maximize the chance of a positive
result, we used pDH3AD, with the optimized 3' and 5' splice site
sequences described above for this substitution. The splicing phenotype of the resultant construct, pDH3 (Fig. 5A),
showed that these changes were indeed sufficient to convert pseudoexon
1 into a real exon (Fig. 5B, lane 1). A series of 5' truncations was
then carried out to determine whether shorter sequences from
hprt intron 1 could also suffice. pDH3t3, pDH3t2, and pDH3t1
(Fig. 3, line 4) retain 55, 40, and 14 nt from the 3' end of
hprt intron 1, respectively (Fig. 5A). In all of these
truncated versions, the pseudoexon was included much more than it was
skipped (Fig. 5B, lanes 2, 3, and 4). Even in pDH3t1, with only 14 nt
of the hprt intron 1 sequence, pseudoexon inclusion was the
predominant (65%) phenotype (Fig. 5B, lane 4). Sequencing of the pDH3
RT-PCR products corresponding to the inclusion of pseudoexon 1 confirmed that splicing had taken place at the expected sites. In
pDH3t1, the hprt PPT is joined to the upstream
dhfr minigene intron sequence. Apparently a branch point
sequence is being recruited from that region (e.g., possibly via a
TAGGGAC sequence 52 nt upstream of the 3' splice site).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of altering the upstream flank and 3' and 5'
splice sites on the splicing of pseudoexon 1. (A) Schematic
representations of pseudoexon constructs. Individual constructs are
described in the text. The asterisks represent consensus CAG/G and
CAG/GUGAGU sequences as described in the legend to Fig. 4.
An open bar indicates a sequence derived from the 3' end of
hprt intron 1 (an authentic 3' splice site), except for pAD,
where it was derived from dhfr intron 1. The 34r in
construct pDH4dt denotes the reverse sequence of the 34-mer intronic
splicing silencer. The tc in the diagram of pDH3pM denotes a GU-to-TC
mutation that removes a potential competing GU dinucleotide at position
+7. In the column labeled Inclusion, +means >90% inclusion of the
central exon, means skipping of the central exon, and a number
indicates percent inclusion of the central exon (percent
included/included + skipped). (B, C, D, and E) Phosphorimages of
RT-PCR products from total RNA extracted from permanently transfected
cells (B, C, and D) or transiently transfected cells (E). The closed
arrows indicate exon inclusion and the open arrows indicate exon
skipping in the dhfr minigene transcripts. The closed
arrowhead indicates inclusion of aprt exon 4 in the pAPRTSS2
context. Lanes M, X174 HinfI fragments.
|
|
A sequence upstream of the pseudoexon acts as an intronic splicing
silencer.
The splicing-positive construct pDH3t1 differs from its
splicing-negative counterpart pDH3AD in that it has a different PPT and
lacks the remaining 34 nt of the upstream sequence from the 48-nt
pseudoexon 1 flank. Thus, the failure of pDH3AD transcripts to be
spliced could be due to (i) a defective PPT, (ii) a defective branch
point, (iii) a negative element present in the original pseudoexon 1 upstream flank, or (iv) any combination of these three. To test for a
negative element in the upstream flank, we inserted the 34-nt sequence
from
48 to
15 into pDH3t1 just upstream of the hprt
intron 1 PPT, forming pAH (Fig. 3, line 3; Fig. 5A). The pseudoexon in
pAH transcripts was no longer spliced (Fig. 5C, lane 1), implying that
this upstream sequence does play a negative role. To test the sequence
specificity of the 34-mer, it was reversed in its position upstream of
the PPT, forming pDH4dt (Fig. 3, line 5; Fig. 5A). Splicing of the
pseudoexon in pDH4dt was greatly improved (to 69%) (Fig. 5D, lane 1).
Thus, it is the sequence of the 34-mer, rather than its increase of the
spacing between upstream (e.g., a branch point) and downstream elements (54), that is responsible for most of the splicing
inhibition. We also tested a PPT taken from another real intron,
dhfr intron 1, in the presence of the 34-mer. Transcripts
from this construct, pAD (Fig. 5A), also failed to splice the
pseudoexon (Fig. 5C, lane 2), suggesting that the inhibition by the
34-mer is not specific for the hprt intron 1 PPT. The
generality of the inhibition was put to a more rigorous test by placing
the 34-mer in a completely different splicing context, 14 nt upstream
of exon 4 in the hamster aprt gene, to form pAPRTSS2 (Fig.
5A). Exon 4 was not skipped; rather, a longer form of exon 4 was
produced (Fig. 5D, lane 3). Sequencing of the RT-PCR product showed
that a cryptic 3' splice site 17 nt upstream of the normal 3' splice
site had been used. Thus, splicing at the normal aprt 3'
splice site was, in fact, inhibited by the 34-mer, notwithstanding the
fact that a new 3' splice site was recruited within the 34-mer itself
(position 31 of the 34-mer). We concluded that this 34-nt region
contains an intronic splicing silencer and this silencer prevented
pseudoexon 1 from being included in the final mRNA.
The PPT upstream of the pseudoexon is defective.
The silencer
may be sufficient for inhibiting the 3' pseudosplice site;
alternatively, the PPT of the 3' pseudosplice site may be intrinsically
defective. To distinguish between these possibilities, we deleted the
34-mer from pDH3AD (Fig. 4A). The resulting plasmid, pDEL34 (Fig. 5A),
retains the original PPT upstream of the pseudoexon, the change to
CAG/G at the 3' pseudosplice site, and the optimized downstream 5'
splice site. Pseudoexon 1 was still skipped in pDEL34 transcripts
(Fig. 5D, lane 2). pDEL34 and pDH3t1 differ only in the 14-nt PPT, yet
the pseudoexon is skipped in the former and included in the latter. We
conclude that the 14-nt PPT flanking pseudoexon 1 is defective or plays
some active negative role in splicing. Thus, at least two independent
defective or negative elements are present in the immediate upstream
flanking sequence of pseudoexon 1, more than accounting for its
inability to be spliced.
The 5' pseudosplice site is defective.
Having established a
defective 3' splice site and the presence of an intronic silencer
sequence in the 3' splice site region, we returned to the 5'
pseudosplice site. For the study of the 3' splice site region, the 5'
splice site sequence had been optimized to the consensus
CAG/GUGAGU. We investigated whether this optimization is
necessary when a functional 3' splice site is present. The original 5'
pseudosplice site (CAG/GUGUGA) was combined with the functional 3' splice site from hprt intron 1 to form pDH3p
(Fig. 5A). Pseudoexon 1 was ignored in cells transiently transfected with pDH3p (Fig. 5E, lane 2). Thus, despite its reasonable agreement (consensus agreement score of 84) with the consensus, the 5'
pseudosplice site is defective even when paired across the exon with a
functional 3' splice site. There is a second GU dinucleotide just
downstream of and adjacent to the proposed 5' pseudosite GU; we thought
the sequence resembling a 5' splice site based on this GU
(GGU/GUGAGU, consensus agreement score of 72) might
interfere with the proposed site (73). To test this
possibility, we mutated the last two nucleotides within this possible
interfering site. The GU-to-UC change reduced the consensus agreement
score to 58 (GGU/GUGAUC) without changing the originally
proposed 5' pseudosplice site sequence. The pseudoexon was still
skipped in transcripts of the resulting plasmid, pDH3pM (Fig. 5A and
E). Thus, in addition to the deficiency of the 3' pseudosplice site,
the 5'pseudosplice site is defective.
Contribution of the exon body to splicing recognition.
In
several cases of alternative splicing, so-called weak splice sites can
be activated by the presence of a splicing enhancer. The best
characterized of these are exonic splicing enhancers (23, 41, 82,
84-86, 90), but enhancing sequences can also be found in introns
(13, 38, 58, 76). The sequences surrounding pseudoexon 1 were not chosen to appear especially weak, yet they are not functional;
it is possible that they simply lack necessary positive information
within the exon body. We therefore investigated whether pseudoexon 1 can be activated by the presence of a sequence that might act as an
exonic splicing enhancer. First, we introduced a known strong enhancer
into pseudoexon 1 in pDH3AD. We chose a sequence selected by Tacke and
Manley (84) for its ability to bind to the splicing factor
ASF/SF2. Three tandem repeats of the SELEX winning sequence A3 were
inserted 20 nt from the 5' end of pseudoexon 1 (Fig.
6A).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of exon body sequence alteration on splicing. (A)
Schematic representations of pseudoexon constructs and derivatives.
Individual constructs are described in the text. A single asterisk
indicates mutation to the CAG/G of a consensus 3' splice site, and a
double asterisk indicates mutation to a perfect CAG/GUGAGU
5' consensus splice site. A3 denotes a 72-nt insert containing
three tandem repeats of an ASF/SF2-binding SELEX winning sequence, and
S3 denotes an analogous insert containing three tandem repeats of an
SC35-binding SELEX winning sequence (84). Gex2 indicates
human -globin exon 2, and -2 indicates hprt pseudoexon
2. (B and C) Phosphorimages of RT-PCR products of RNA extracted from
permanently transfected cells. The closed arrows indicate exon
inclusion and the open arrows indicate exon skipping in the
dhfr minigene context. Lanes M, X174 HinfI
fragments. Closed arrows in panel C indicate the following: 1, size of
unspliced RNA (or DNA) in constructs containing the globin exon; 2, size of RNA that has retained intron 1 in pDG12D (confirmed by
sequencing); 3, size of RNA produced by splicing of the central exon at
an upstream cryptic 3' splice site in pDG12 and pDG12D (confirmed by
sequencing); 4, size corresponding to inclusion of -globin exon 2 in
pDG11 (confirmed by sequencing); 5, size corresponding to inclusion of
pseudoexon 2 in pDHP2; 6, size corresponding to skipping of the central
exon in all constructs of the dhfr minigene. Lanes M,
X174 HinfI fragments.
|
|
RT-PCR results showed that the A3 sequences resulted in inclusion of
pseudoexon 1 in 55% of the spliced transcripts. (Fig.
6B, lane 1). In
contrast, the introduction of the SC35-selected
sequence S3 did not
have a detectable effect on splicing of pseudoexon
1 (Fig.
6B, lane 2).
Thus, it appeared that this particular enhancer
(A3) was able to
activate splicing at the 3' pseudosplice site.
However, sequencing of
the pertinent PCR product showed that splicing
of intron 1 actually
took place at a cryptic site 17 nt upstream
of the proposed 3'
pseudosplice site (data not shown). This site
is the same site
activated when the upstream 34-mer was inserted
into the
aprt gene. Ironically, this site lies within a sequence
that
acts negatively in other contexts. The originally chosen
3' splice
site, defined here as including the PPT, remained refractory
to
splicing.
This result suggests that enhancer sequences could contribute to the
definition of a constitutive exon. In fact, Schaal and
Maniatis have
suggested that multiple distinct splicing enhancers
are present within
exon 2 of the constitutively spliced human

-globin gene, where they
function to specify the 3' splice site
(
69). To test the
role of these

-globin exon 2 sequences in
the pseudoexon system, we
first we replaced pseudoexon 1 in pDH3t2
with

-globin exon 2 to form
pDG11. This plasmid contains a functional
hprt intron
1-derived 3' splice site, as well as an optimized
5' splice site (Fig.
6A). Like pseudoexon 1 (Fig.
5B, lane 3),
the

-globin exon was
efficiently included in this case (Fig.
6C, lane 3), indicating that it
is capable of being spliced in
this permissive context. We then swapped
the human

-globin exon
2 sequence for the pseudoexon 1 sequence of
the nonpermissive
plasmid pDH3A. The resulting construct, pDG12, has
the slightly
improved (3' splice site CAG/G) original 3' pseudosplice
site,
the

-globin exon 2 body, and the original 5' pseudosplice site
(Fig.
6A). In this context, the

-globin exon 2 sequence was no
better than the pseudoexon 1 sequence it replaced, as there was
no
splicing to either the originally proposed 3' splice site or
to the
cryptic site 17 nt upstream (Fig.
6C, lane 1). Thus, the
enhancer
elements that are present in this

-globin exon are unable
to convert
this pseudoexon into an exon. The enhancement exhibited
by the A3
sequences described above was realized in a more permissive
context, in
that an optimized 5' splice site was present. Our
final test of the

-globin sequences was to replace the original
5' splice site of
pDG12 with this optimized sequence, forming
pDG12D (Fig.
6A). Multiple
species resulted from these transcripts,
including three spliced
species, as well as some unspliced transcripts.
The exact nature of
these RNA molecules was determined by sequencing
of the RT-PCR
products. The most abundant product had spliced
intron 2 but retained
intron 1. Almost as frequent were exon skipping
and inclusion of the
exon spliced at the cryptic 3' splice site.
Thus, the improvement of
the 5' splice site influenced the enhancing
action of the

-globin
sequences but in a complex
way.
Are exonic splicing enhancers required for exon definition? The result
described above obtained with pDH3 and its derivatives
argues against
this idea. In these plasmids, the 3' splice site
was taken from the 3'
end of a working intron, the 5' splice site
matched the consensus, and
the pseudoexon body lying between these
two endpoints was efficiently
spliced. It should be remembered
that the pseudoexon body is actually
an intron sequence and so
would not be expected to contain any enhancer
elements. To confront
the possibility that an enhancer was fortuitously
present, we
substituted another
hprt intronic sequence for
pseudoexon 1. This
123-nt sequence, termed pseudoexon 2, was also
selected from
hprt intron 1 with the constraint that it not
include any sequences
resembling splice sites. The resulting construct,
pDHP2 (Fig.
6A), gave rise to RNA that predominantly included this
pseudoexon
2. This result supports the idea that it is defective splice
sites,
rather than the lack of an exonic enhancer, that account for the
nonsplicing of pseudoexon
sequences.
 |
DISCUSSION |
Pseudoexons.
It has long been recognized that consensus
sequences alone must be insufficient to identify either introns or
exons, since higher eukaryotic transcripts generally contain many more
sequences with good agreement with the consensus than there are bona
fide splice sites (71). In this study, we surveyed the human
hprt gene as a model and found a good example of this
incongruity: hundreds of sequences resembling 5' and 3' splice sites
were found in this 42-kb transcript. Moreover, the stipulation that
exons be of limited length and that a short branch point sequence be present upstream of the 3' pseudosplice sites did not solve the problem. Using criteria based on the characteristics of the seven real
internal exons in this gene, 103 exon-like sequences were found. We
called these sequences pseudoexons (79) without any implication of whether or not they were used as real exons at some
point during evolution.
Reading frames are without effect on splicing.
Computer
programs can predict the locations of exons within gene sequences with
reasonable accuracy (77, 78, 93). However, efficient
exon-finding programs use the protein coding information of exons as a
guide. Could the cell also be using this type of information to
differentiate real exons? Interruptions in the ORF of an internal exon
usually result in lower levels of the nucleus-associated mRNA (see
reference 56 for a review), and in some cases
internal exons bearing nonsense mutations are skipped (27)
or fail to splice (53). These results have suggested the
idea of nuclear scanning of pre-mRNA for translatable exons (15,
27, 88). The intronic (pseudoexons 1 and 2) and exonic (
-globin) sequences we introduced here produced stop codons near the
start of the central exon, yet we saw no evidence of either decreased
mRNA levels or increased exon skipping associated with these
disruptions of translatability (pDG11, pDHP2, pDH3A3, and pDG12D).
These results add to previous cases indicating normal splicing despite
the presence of nonsense mutations in the tpi (19) and aprt (43) genes and argue
against a general mechanism for exon identification based on ORFs.
The 5' pseudosplice site.
Pseudoexon 1 is not spliced even
when placed in a favorable context within a dhfr minigene,
i.e., a context in which a real exon with similarly trimmed minimal
flanks is efficiently spliced. Moreover, we found no evidence that the
pseudoexon sequence proper provides a negative influence. The 5'
pseudosplice site at the downstream end of pseudoexon 1 was not used
even when the upstream 3' pseudosite was replaced with a functional 3'
splice site. These data suggest that the 5' pseudosplice site is
defective. The sequence of the 5' pseudosplice site is CAG/GUGUGA;
it has a consensus score of 83, which is higher than those of
42% of the 2,400 authentic 5' splice sites in the database we have
used. However, this particular sequence was not found among the 5'
splice sites in the database. The first position of the 5' consensus,
at
3 relative to the splice site, is weakly conserved and is
sometimes not considered part of the consensus. The score and rank of
the pseudosplice site are similar (82 and higher than 37% of real
sites) if this 8-mer version of the consensus (AG/GUGUGA) is
considered. Unlike the 9-mer, this specific 8-mer sequence appears
three times as a real 5' splice site in this database. This last result
reinforces the idea that consensus sequences by themselves are
inadequate to specify correct splicing (41, 62, 71) and
implies that context still played a role in our experiments. This
context could include some as yet undefined enhancer sequence close to
the 5' splice site in question. Alternatively, the context effect could result from a local secondary or higher-order structure. Whatever the
deficiency of the context, it can be overridden by providing a perfect
consensus 5' splice site sequence to go with the functional 3' splice
site. Perhaps this particular sequence requires the action of an
enhancer-bound splicing factor either to recruit U1 snRNP or to
position the snRNP so that it avoids being steered into a dead-end
complex. For instance, Nelson and Green found that a perfect consensus
5' splice site was less sensitive to negative context effects than was
a less-than-perfect
-globin 5' splice site (62). A more
detailed mutagenic analysis of the 5' pseudosplice site and its real
counterparts should resolve some of these questions.
The 3' pseudosplice site.
Similarly, a 3' splice site with a
high score of agreement with the consensus is insufficient for
splicing. The 3' pseudosplice site has a sequence
(UUCUCCUGCCUCAG/C) consensus score of 83, higher than the
score of 53% of the 2,400 actual 3' splice sites in the database. We
can consider three possibilities to explain why this site is not used:
(i) it is masked by some local secondary or higher-order structure;
(ii) it is a weak site that needs promotion by a strong 5' splice site,
a strong branch point, or exonic enhancers; or (iii) this sequence is
somehow intrinsically defective (for example, an essential splicing
factor cannot efficiently bind to it), and so it fails to function
regardless of the context. We did not include the branch point as one
of the elements that we varied in these experiments, since the
consensus sequence for the branch point is quite degenerate
(36) and mutations in branch points often result in the
recruitment of a nearby cryptic site (66, 68). Our inability
to activate splicing at this 3' pseudosplice site supports the third
possibility. Our attempts to activate splicing included, in
combination, the substitution of a G at position +1 to form a CAG/G
consensus at the potential splice site, the provision of known enhancer
sequences within the body of the downstream exon, and the placement of
an optimized 5' splice site sequence downstream of the pseudoexon.
Splicing was indeed activated by a combination of these three changes,
but it occurred instead at a nearby upstream cryptic site
(CUCCUGGGUUCUAG/C) with a lower consensus matching score of
69. On the other hand, the database of real 3' splice sites contains
two sequences similar (allowing only C-to-U or U-to-C changes in the
PPT region) to this optimized (with CAG/G) 3' pseudosplice site. The
exact sequence of the 3' pseudosplice site is not present, but this
result is not unexpected since 99% of real 3' splice site sequences
(taken as 15-mers) are represented only once. This result implies that the exact C and U placement within the PPT is important. There is
evidence in support of this idea; for example, Singh et al. (75) found that, in vitro, sequences selected for binding to U2AF65 were enriched in U but interrupted by two or three C's, the
consensus being UUUUU(U/C)CC(C/U)UUUUUUUCC. In a survey of 3' sequences that function in splicing, Coolidge et al. found U tracts
to be the most effective, but their placement relative to the splice
site was critical (22). In an analysis of in vivo mutations,
we previously demonstrated a 50% splicing decrease brought about by a
single U-to-C change in a PPT (18). Here again, a detailed
mutational analysis of the 3' pseudosplice site sequence should be revealing.
An intronic splicing silencer.
Splicing to the original
candidate 3' splice site was effected when a bona fide PPT (from
hprt intron 1) was placed just upstream of a CAG/G sequence
and when an optimized 5' splice site followed the pseudoexon. However,
even in this permissive situation, a 34-nt intronic silencer sequence
upstream of the pseudoexon prevented it from being included in the
mRNA. This sequence also inhibited splicing at the 3' splice site of an
aprt intron into which it had been inserted. Ironically,
splicing to a cryptic 3' splice site within the 34-mer was promoted in
the aprt case. This cryptic site was also activated in the
dhfr minigene when ASF/SF2 or
-globin exonic splicing
enhancers were included in the pseudoexon. It is possible that the
inhibition is exerted through this cryptic site, which could act as a
competitor for U2 snRNP, tying it up in a dead-end complex that
precludes any nearby potential 3' splice site, similar to what has been
proposed for the immunoglobulin M2 exonic silencer (41). A
second model for splicing inhibition based on secondary or higher-order
structures that sequester the 3' splice sites seems less likely in view
of the fact that the 34-mer inhibits splicing of at least three
different downstream 3' sites: the hprt intron 1 site joined
to pseudoexon 1 and hprt intron 1 joined to
-globin exon
2 and aprt exon 4.
A search for the occurrence of the 34-mer silencer sequence in the
human genome revealed that it is homologous to a region
in an Alu
repeat. The Alu homology extends through the body of
pseudoexon 1: the
141-nt pseudoexon is homologous to the sequence
from position 179 to
position 23 (reverse of the standard orientation)
of the Alu Sc family
consensus, although it lacks an internal
stretch of 16 nt
(
4). It is not surprising that pseudoexon
1 is a repeated
sequence, since they represent about a third to
a half of the human
genome. Using RepeatMasker
(
http://ftp.genome.washington.edu/cgi-bin/RepeatMasker)
to
search just for Alu repeats in the 41,109-bp
hprt gene we
have
analyzed, we found 32 instances, comprising 23% of the gene
sequence.
Moreover, Alu sequences in the reverse orientation contain
several
sequences resembling 3' and 5' splice sites. Although several
cases of splicing at an Alu sequence have been reported
(
55),
the vast majority of Alu sites contain pseudosites;
i.e., they
are not used. This coincidence raised the possibility that
Alu
repeats were the source of the majority of pseudoexons detected
in
our computer analysis. We therefore repeated our search for
pseudoexons
in an
hprt sequence that had been divested of Alu
repeats.
Only 20% (21 of 103) of the pseudoexons were eliminated
in this
reanalysis, the same proportion as the number of nucleotides
removed
(23%). Thus, Alu sequences are no more likely to contribute
to a
pseudoexon than nonrepeated sequences. The question of why
pseudosplice
sites in Alu sequences are not used is, at this point,
no different
than the question of why pseudosplice sites in general
are not
used.
Exon inclusion without a recognized exonic splicing enhancer.
It is possible that real exons are recognized because they contain
exonic splicing enhancers and pseudoexons are not recognized because
they lack them. Exonic splicing enhancers have been demonstrated, for
the most part, in alternatively spliced exons. However, mutations in
exons outside of the consensus sequence can disrupt the splicing of
constitutive exons (18, 64, 67) and some constitutively spliced exons contain sequences that can provide splicing enhancement to alternatively spliced exons (69, 92). In particular,
human
-globin gene exon 2 has been shown to harbor at least three
such sequences, which bind to different SR proteins (57,
69). Substitution of this
-globin exon 2 sequence for the
pseudoexon 1 body did promote splicing. However, a complex pattern
resulted, leading to intron retentions and exon skipping, as well as
partial exon inclusion. Moreover, the 3' splicing that did take place
did so at a site upstream from the candidate we had identified on the basis of agreement with the 3' consensus. Insertion of ASF/SF2 binding
sequences into the pseudogene body also stimulated splicing and again
to the lower-scoring upstream 3' splice site sequence. Exon inclusion
still required the presence of an improved 5' splice site. The
exclusive use of the distal lower-scoring 3' splice site in both cases
suggests either a topological constraint or, as discussed above, an
intrinsic defectiveness of the proximal sequence despite its better
agreement with the consensus. Interestingly, an SC35 binding sequence
did not promote splicing here. Such context specificity for exonic
splicing enhancers has been seen before, whereby some exons respond to
an inserted SC35 binding sequence, others respond to an ASF/SF2
sequence, and yet others respond to both (57, 69).
The results of the enhancer experiments described above are consistent
with the idea that pseudoexons are not used because
they lack enhancer
sequences, but they still do not explain why
some potential splice
sites can be recruited in this way and others
can not. When functional
splice sites were joined to pseudoexon
1 and the 34-mer inhibitory
sequence was deleted, pseudoexon 1
was efficiently spliced despite its
apparent lack of an enhancer.
Moreover, substitution of a different
intronic sequence for the
exon body, termed pseudoexon 2, also resulted
in exon inclusion.
The inclusion of both pseudoexons in this context
supports the
idea that exon-bridging enhancers are not a prerequisite
for constitutive
exon definition or recognition. It may be, as is often
stated
for cases of alternative splicing, that enhancers are needed
only
when the splice sites are weak. However, our understanding of
what
distinguishes a weak from a strong splice site is incomplete.
Quantitative agreement with the consensus is not a reliable guide,
as
evidenced here by the recruitment of a poorer-scoring upstream
3'
splice site over our original choice when enhancers were included
in
the exon. Taken together, our data are also consistent with
another
model, one in which the function of an enhancer is to
counteract the
effect of a nearby splicing inhibitor, as has been
reported for several
specific systems (
2,
11,
41,
95).
In line with this idea, we
have found that sequences that can
act as exonic splicing inhibitors
are common in the human genome,
occurring at a frequency of one per
several hundred nucleotides
(Fairbrother,
submitted).
Our data also speak to a more ingenious model for the recognition of
intronic splice site-like sites. It has been suggested
that large
introns may be removed by a process in which smaller
sections are first
extracted via intermediate splicing events
(
37). Hatton et
al. demonstrated the stepwise removal of a large
intron in the
Drosophila ultrabithorax transcript by resplicing
at the
junction between certain joined exons. An extension of
this strategy
would be to drop the requirement for resplicing:
proximally located
intermediate exons would be spliced only to
be removed by subsequent
splicing of external exons. The final
splice would remove a now
much-abbreviated intron, facilitated
by the new-found proximity of the
final 5' and 3' splice sites.
In this piecemeal splicing scenario, the
pseudosites are not false
sites at all but function rather as the
functional boundaries
of intermediate introns. Our data do not support
such a model,
since the 5' and 3' pseudosplice sites represented by the
ends
of pseudoexon 1 do not function when placed in the apparently
favorable context of the small
dhfr minigene.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grant GM22629.
We thank Will Fairbrother and Jim Manley for useful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 912 Fairchild,
Department of Biological Sciences, Columbia University, New York, NY 10027. Phone: (212) 854-4645. Fax: (212) 531-0425. E-mail:
lac2{at}columbia.edu.
 |
REFERENCES |
| 1.
|
Ali, S. A., and A. Steinkasserer.
1995.
PCR-ligation-PCR mutagenesis: a protocol for creating gene fusions and mutations.
BioTechniques
18:746-750[Medline].
|
| 2.
|
Amendt, B. A.,
D. Hesslein,
L. -J. Chang, and C. M. Stoltzfus.
1994.
Presence of negative and positive cis-acting RNA splicing elements within and flanking the first tat coding exon of human immunodeficiency virus type 1.
Mol. Cell. Biol.
14:3960-3970[Abstract/Free Full Text].
|
| 3.
|
Balvay, L.,
D. Libri, and M. Y. Fiszman.
1993.
Pre-mRNA secondary structure and the regulation of splicing.
Bioessays
15:165-169[CrossRef][Medline].
|
| 4.
|
Batzer, M. A.,
P. L. Deininger,
U. Hellmann-Blumberg,
J. Jurka,
D. Labuda,
C. M. Rubin,
C. W. Schmid,
E. Zietkiewicz, and E. Zuckerkandl.
1996.
Standardized nomenclature for Alu repeats.
J. Mol. Evol.
42:3-6[CrossRef][Medline].
|
| 5.
|
Bauren, G., and L. Wieslander.
1994.
Splicing of Balbiani ring 1 gene pre-mRNA occurs simultaneously with transcription.
Cell
76:183-192[CrossRef][Medline].
|
| 6.
|
Beyer, A. L., and Y. N. Osheim.
1988.
Splice site selection, rate of splicing, and alternative splicing on nascent transcripts.
Genes Dev.
2:754-765[Abstract/Free Full Text].
|
| 7.
|
Blanchette, M., and B. Chabot.
1997.
A highly stable duplex structure sequesters the 5' splice site region of hnRNP A1 alternative exon 7B.
RNA
3:405-419[Abstract].
|
| 8.
|
Blanchette, M., and B. Chabot.
1999.
Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization.
EMBO J.
18:1939-1952[CrossRef][Medline].
|
| 9.
|
Bradley, W. E., and D. Letovanec.
1982.
High-frequency nonrandom mutational event at the adenine phosphoribosyltransferase (aprt) locus of sib-selected CHO variants heterozygous for aprt.
Somatic Cell Genet.
8:51-66[CrossRef][Medline].
|
| 10.
|
Burnette, J. M.,
A. R. Hatton, and A. J. Lopez.
1999.
Trans-acting factors required for inclusion of regulated exons in the Ultrabithorax mRNAs of Drosophila melanogaster.
Genetics
151:1517-1529[Abstract/Free Full Text].
|
| 11.
|
Caputi, M.,
G. Casari,
S. Guenzi,
R. Tagliabue,
A. Sidoli,
C. A. Melo, and F. E. Baralle.
1994.
A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon.
Nucleic Acids Res.
22:1018-1022[Abstract/Free Full Text].
|
| 12.
|
Caputi, M.,
A. Mayeda,
A. R. Krainer, and A. M. Zahler.
1999.
hnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing.
EMBO J.
18:4060-4067[CrossRef][Medline].
|
| 13.
|
Carlo, T.,
D. A. Sterner, and S. M. Berget.
1996.
An intron splicing enhancer containing a G-rich repeat facilitates inclusion of a vertebrate micro-exon.
RNA
2:342-353[Abstract].
|
| 14.
|
Carothers, A. M.,
G. Urlaub,
D. Grunberger, and L. A. Chasin.
1993.
Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in Chinese hamster ovary cells.
Mol. Cell. Biol.
13:5085-5098[Abstract/Free Full Text].
|
| 15.
|
Carter, M. S.,
S. Li, and M. F. Wilkinson.
1996.
A splicing-dependent regulatory mechanism that detects translation signals.
EMBO J.
15:5965-5975[Medline].
|
| 16.
|
Chabot, B.,
M. Blanchette,
I. Lapierre, and H. La Branche.
1997.
An intron element modulating 5' splice site selection in the hnRNP A1 pre-mRNA interacts with hnRNP A1.
Mol. Cell. Biol.
17:1776-1786[Abstract].
|
| 17.
|
Chan, R. C., and D. L. Black.
1997.
The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream.
Mol. Cell. Biol.
17:4667-4676[Abstract].
|
| 18.
|
Chen, I. T., and L. A. Chasin.
1993.
Direct selection for mutations affecting specific splice sites in a hamster dihydrofolate reductase minigene.
Mol. Cell. Biol.
13:289-300[Abstract/Free Full Text].
|
| 19.
|
Cheng, J., and L. E. Maquat.
1993.
Nonsense codons can reduce the abundance of nuclear mRNA without affecting the abundance of pre-mRNA or the half-life of cytoplasmic mRNA.
Mol. Cell. Biol.
13:1892-1902[Abstract/Free Full Text].
|
| 20.
|
Chou, M.-Y.,
N. Rooke,
C. W. Turck, and D. L. Black.
1999.
hnRNP H is a component of a splicing enhancer complex that activates a c-src alternative exon in neuronal cells.
Mol. Cell. Biol.
19:69-77[Abstract/Free Full Text].
|
| 21.
|
Clouet d'Orval, B.,
Y. d'Aubenton Carafa,
P. Sirand-Pugnet,
M. Gallego,
E. Brody, and J. Marie.
1991.
RNA secondary structure repression of a muscle-specific exon in HeLa cell nuclear extracts.
Science
252:1823-1828[Abstract/Free Full Text].
|
| 22.
|
Coolidge, C. J.,
R. J. Seely, and J. G. Patton.
1997.
Functional analysis of the polypyrimidine tract in pre-mRNA splicing.
Nucleic Acids Res.
25:888-896[Abstract/Free Full Text].
|
| 23.
|
Cooper, T. A.
1998.
Muscle-specific splicing of a heterologous exon mediated by a single muscle-specific splicing enhancer from the cardiac troponin T gene.
Mol. Cell. Biol.
18:4519-4525[Abstract/Free Full Text].
|
| 24.
|
Coulter, L. R.,
M. A. Landree, and T. A. Cooper.
1997.
Identification of a new class of exonic splicing enhancers by in vivo selection.
Mol. Cell. Biol.
17:2143-2150[Abstract].
|
| 25.
|
Del Gatto-Konczak, F.,
M. Olive,
M. -C. Gesnel, and R. Breathnach.
1999.
hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer.
Mol. Cell. Biol.
19:251-260[Abstract/Free Full Text].
|
| 26.
|
Deshler, J. O., and J. J. Rossi.
1991.
Unexpected point mutations activate cryptic 3' splice sites by perturbing a natural secondary structure within a yeast intron.
Genes Dev.
5:1252-1263[Abstract/Free Full Text].
|
| 27.
|
Dietz, H. C., and R. J. Kendzior, Jr.
1994.
Maintenance of an open reading frame as an additional level of scrutiny during splice site selection.
Nat. Genet.
8:183-188[CrossRef][Medline].
|
| 28.
|
Dominski, Z., and R. Kole.
1994.
Identification of exon sequences involved in splice site selection.
J. Biol. Chem.
269:23590-23596[Abstract/Free Full Text].
|
| 29.
|
Dominski, Z., and R. Kole.
1991.
Selection of splice sites in pre-mRNAs with short internal exons.
Mol. Cell. Biol.
11:6075-6083[Abstract/Free Full Text].
|
| 30.
|
Dreyfuss, G. M.,
J. Matunis,
S. Pinol-Roma, and C. G. Burd.
1993.
hnRNP proteins and the biogenesis of mRNA.
Annu. Rev. Biochem.
62:289-321[CrossRef][Medline].
|
| 31.
|
Edwards, A.,
H. Voss,
P. Rice,
A. Civitello,
J. Stegemann,
C. Schwater,
J. Zimmermann,
H. Erfle,
C. T. Caskey, and W. Ansorge.
1990.
Automated DNA sequencing of the human HPRT locus.
Genomics
6:593-608[CrossRef][Medline].
|
| 32.
|
Eperon, L. P.,
I. R. Graham,
A. D. Griffiths, and I. C. Eperon.
1988.
Effects of RNA secondary structure on alternative splicing of pre-mRNA: is folding limited to a region behind the transcribing RNA polymerase?
Cell
54:393-401[CrossRef][Medline].
|
| 32a.
| Fairbrother, W. G., and L. A. Chasin. Human genomic
sequences that inhibit splicing. Mol. Cell. Biol., in press.
|
| 33.
|
Gilbert, E.,
F. Del Gatto,
P. Champion-Arnaud,
M. C. Gesnel, and R. Breathnach.
1993.
Control of BEK and K-SAM splice sites in alternative splicing of the fibroblast growth factor receptor 2 pre-mRNA.
Mol. Cell. Biol.
13:5461-4568[Abstract/Free Full Text].
|
| 34.
|
Goguel, V., and M. Rosbash.
1993.
Splice site choice and splicing efficiency are positively influenced by pre-mRNA intramolecular base pairing in yeast.
Cell
72:893-901[CrossRef][Medline].
|
| 35.
|
Gooding, C.,
G. C. Roberts,
G. Moreau,
B. Nadal-Ginard, and C. W. Smith.
1994.
Smooth muscle-specific switching of alpha-tropomyosin mutually exclusive exon selection by specific inhibition of the strong default exon.
EMBO J.
13:3861-3872[Medline].
|
| 36.
|
Green, M. R.
1986.
Pre-mRNA splicing.
Annu. Rev. Genet.
20:671-708[CrossRef][Medline].
|
| 37.
|
Hatton, A. R.,
V. Subramaniam, and A. J. Lopez.
1998.
Generation of alternative Ultrabithorax isoforms and stepwise removal of a large intron by resplicing at exon-exon junctions.
Mol. Cell
2:787-796[CrossRef][Medline].
|
| 38.
|
Haut, D. D., and D. J. Pintel.
1999.
Inclusion of the NS2-specific exon in minute virus of mice mRNA is facilitated by an intronic splicing enhancer that affects definition of the downstream small intron.
Virology
258:84-94[CrossRef][Medline].
|
| 39.
|
Hawkins, J. D.
1988.
A survey on intron and exon lengths.
Nucleic Acids Res.
16:9893-9908[Abstract/Free Full Text].
|
| 40.
|
Howe, K. J., and M. Ares, Jr.
1997.
Intron self-complementarity enforces exon inclusion in a yeast pre-mRNA.
Proc. Natl. Acad. Sci. USA
94:12467-12472[Abstract/Free Full Text].
|
| 41.
|
Kan, J. L., and M. R. Green.
1999.
Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor.
Genes Dev.
13:462-471[Abstract/Free Full Text].
|
| 42.
|
Kanopka, A.,
O. Muhlemann, and G. Akusjarvi.
1996.
Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA.
Nature
381:535-538[CrossRef][Medline].
|
| 43.
|
Kessler, O., and L. A. Chasin.
1996.
Effects of nonsense mutations on nuclear and cytoplasmic adenine phosphoribosyltransferase RNA.
Mol. Cell. Biol.
16:4426-4435[Abstract].
|
| 44.
|
Kessler, O.,
Y. Jiang, and L. A. Chasin.
1993.
Order of intron removal during splicing of endogenous adenine phosphoribosyltransferase and dihydrofolate reductase pre-mRNA.
Mol. Cell. Biol.
13:6211-6222[Abstract/Free Full Text].
|
| 45.
|
Kister, L.,
L. Domenjoud,
H. Gallinaro, and J. Monique.
1993.
A cis-acting selector of a 5' splice site. Cooperation between the sequence of the site and an upstream exonic element.
J. Biol. Chem.
268:21955-21961[Abstract/Free Full Text].
|
| 46.
|
Krainer, A. R.,
G. C. Conway, and D. Kozak.
1990.
Purification and characterization of pre-mRNA splicing factor SF2 from HeLa cells.
Genes Dev.
4:1158-1171[Abstract/Free Full Text].
|
| 47.
|
Krawczak, M.,
J. Reiss, and D. N. Cooper.
1992.
The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences.
Hum. Genet.
90:41-54[Medline].
|
| 48.
|
LeMaire, M. F., and C. S. Thummel.
1990.
Splicing precedes polyadenylation during Drosophila E74A transcription.
Mol. Cell. Biol.
10:6059-6063[Abstract/Free Full Text].
|
| 49.
|
Lin, C. H., and J. G. Patton.
1995.
Regulation of alternative 3' splice site selection by constitutive splicing factors.
RNA
1:234-245[Abstract].
|
| 50.
|
Liu, H. X.,
G. J. Goodall,
R. Kole, and W. Filipowicz.
1995.
Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.
EMBO J.
14:377-388[Medline].
|
| 51.
|
Liu, H. X.,
M. Zhang, and A. R. Krainer.
1998.
Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins.
Genes Dev.
12:1998-2012[Abstract/Free Full Text].
|
| 52.
|
Lopez, A. J.
1998.
Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation.
Annu. Rev. Genet.
32:279-305[CrossRef][Medline].
|
| 53.
|
Lozano, F.,
B. Maertzdorf,
R. Pannell, and C. Milstein.
1994.
Low cytoplasmic mRNA levels of immunoglobulin kappa light chain genes containing nonsense codons correlate with inefficient splicing.
EMBO J.
13:4617-4622[Medline].
|
| 54.
|
Luukkonen, B. G., and B. Seraphin.
1997.
The role of branchpoint-3' splice site spacing and interaction between intron terminal nucleotides in 3' splice site selection in Saccharomyces cerevisiae.
EMBO J.
16:779-792[CrossRef][Medline].
|
| 55.
|
Makalowski, W.,
G. A. Mitchell, and D. Labuda.
1994.
Alu sequences in the coding regions of mRNA: a source of protein variability.
Trends Genet.
10:188-193[CrossRef][Medline].
|
| 56.
|
Maquat, L. E.
1995.
When cells stop making sense: effects of nonsense codons on RNA metabolism in vertebrate cells.
RNA
1:453-465[Abstract].
|
| 57.
|
Mayeda, A.,
G. R. Screaton,
S. D. Chandler,
X. D. Fu, and A. R. Krainer.
1999.
Substrate specificities of SR proteins in constitutive splicing are determined by their RNA recognition motifs and composite pre-mRNA exonic elements.
Mol. Cell. Biol.
19:1853-1863[Abstract/Free Full Text].
|
| 58.
|
Modafferi, E. F., and D. L. Black.
1997.
A complex intronic splicing enhancer from the c-src pre-mRNA activates inclusion of a heterologous exon.
Mol. Cell. Biol.
17:6537-6545[Abstract].
|
| 59.
|
Mount, S. M.
1982.
A catalogue of splice junction sequences.
Nucleic Acids Res.
10:459-472[Abstract/Free Full Text].
|
| 60.
|
Mulligan, G. J.,
W. Guo,
S. Wormsley, and D. M. Helfman.
1992.
Polypyrimidine tract binding protein interacts with sequences involved in alternative splicing of beta-tropomyosin pre-mRNA.
J. Biol. Chem.
267:25480-25487[Abstract/Free Full Text].
|
| 61.
|
Naeger, L. K.,
R. V. Schoborg,
Q. Zhao,
G. E. Tullis, and D. J. Pintel.
1992.
Nonsense mutations inhibit splicing of MVM RNA in cis when they interrupt the reading frame of either exon of the final spliced product.
Genes Dev.
6:1107-1119[Abstract/Free Full Text].
|
| 62.
|
Nelson, K. K., and M. R. Green.
1988.
Splice site selection and ribonucleoprotein complex assembly during in vitro pre-mRNA splicing.
Genes Dev.
2:319-329[Abstract/Free Full Text].
|
| 63.
|
Noe, V.,
C. Ciudad, and L. Chasin.
1999.
Effect of differential polyadenylation and cell growth phase on dihydrofolate reductase mRNA stability.
J. Biol. Chem.
274:27807-27814[Abstract/Free Full Text].
|
| 64.
|
O'Neill, J. P.,
P. K. Rogan,
N. Cariello, and J. A. Nicklas.
1998.
Mutations that alter RNA splicing of the human HPRT gene: a review of the spectrum.
Mutat. Res.
411:179-214[CrossRef][Medline].
|
| 65.
|
Peppel, K., and C. Baglioni.
1990.
A simple and fast method to extract RNA from tissue culture cells.
BioTechniques
9:711-713[Medline].
|
| 66.
|
Reed, R., and T. Maniatis.
1985.
Intron sequences involved in lariat formation during pre-mRNA splicing.
Cell
41:95-105[CrossRef][Medline].
|
| 67.
|
Reed, R., and T. Maniatis.
1986.
A role for exon sequences and splice-site proximity in splice-site selection.
Cell
46:681-690[CrossRef][Medline].
|
| 68.
|
Ruskin, B.,
J. M. Greene, and M. R. Green.
1985.
Cryptic branch point activation allows accurate in vitro splicing of human beta-globin intron mutants.
Cell
41:833-844[CrossRef][Medline].
|
| 69.
|
Schaal, T. D., and T. Maniatis.
1999.
Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA.
Mol. Cell. Biol.
19:261-273[Abstract/Free Full Text].
|
| 70.
|
Schaal, T. D., and T. Maniatis.
1999.
Selection and characterization of pre-mRNA splicing enhancers: identification of novel SR protein-specific enhancer sequences.
Mol. Cell. Biol.
19:1705-1719[Abstract/Free Full Text].
|
| 71.
|
Senapathy, P.,
M. B. Shapiro, and N. L. Harris.
1990.
Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project.
Methods Enzymol.
183:252-278[Medline].
|
| 72.
|
Shapiro, M. B., and P. Senapathy.
1987.
RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression.
Nucleic Acids Res.
15:7155-7174[Abstract/Free Full Text].
|
| 73.
|
Siebel, C. W.,
L. D. Fresco, and D. C. Rio.
1992.
The mechanism of somatic inhibition of Drosophila P-element pre-mRNA splicing: multiprotein complexes at an exon pseudo-5' splice site control U1 snRNP binding.
Genes Dev.
6:1386-1401[Abstract/Free Full Text].
|
| 74.
|
Siebel, C. W.,
R. Kanaar, and D. C. Rio.
1994.
Regulation of tissue-specific P-element pre-mRNA splicing requires the RNA-binding protein PSI.
Genes Dev.
8:1713-1725[Abstract/Free Full Text].
|
| 75.
|
Singh, R.,
J. Valcarcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Science
268:1173-1176[Abstract/Free Full Text].
|
| 76.
|
Sirand-Pugnet, P.,
P. Durosay,
E. Brody, and J. Marie.
1995.
An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA.
Nucleic Acids Res.
23:3501-3507[Abstract/Free Full Text].
|
| 77.
|
Snyder, E. E., and G. D. Stormo.
1995.
Identification of protein coding regions in genomic DNA.
J. Mol. Biol.
248:1-18[CrossRef][Medline].
|
| 78.
|
Solovyev, V., and A. Salamov.
1997.
The Gene-Finder computer tools for analysis of human and model organisms genome sequences.
Intelligent Syst. Mol. Biol.
5:294-302.
|
| 79.
|
Solovyev, V. V.,
A. A. Salamov, and C. B. Lawrence.
1994.
The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames.
ISMB
2:354-362.
|
| 80.
|
Stephens, R. M., and T. D. Schneider.
1992.
Features of spliceosome evolution and function inferred from an analysis of the information at human splice sites.
J. Mol. Biol.
228:1124-1136[CrossRef][Medline].
|
| 81.
|
Sterner, D. A., and S. M. Berget.
1993.
In vivo recognition of a vertebrate mini-exon as an exon-intron-exon unit.
Mol. Cell. Biol.
13:2677-2687[Abstract/Free Full Text].
|
| 82.
|
Sun, Q.,
R. K. Hampson, and F. M. Rottman.
1993.
In vitro analysis of bovine growth hormone pre-mRNA alternative splicing. Involvement of exon sequences and trans-acting factor(s).
J. Biol. Chem.
268:15659-15666[Abstract/Free Full Text].
|
| 83.
|
Sun, Q.,
A. Mayeda,
R. K. Hampson,
A. R. Krainer, and F. M. Rottman.
1993.
General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer.
Genes Dev.
7:2598-2608[Abstract/Free Full Text].
|
| 84.
|
Tacke, R., and J. L. Manley.
1995.
The human splicing factors ASF/SF2 and SC35 possess distinct, functionally significant RNA binding specificities.
EMBO J.
14:3540-3551[Medline].
|
| 85.
|
Tian, H., and R. Kole.
1995.
Selection of novel exon recognition elements from a pool of random sequences.
Mol. Cell. Biol.
15:6291-6298[Abstract].
|
| 86.
|
Tian, M., and T. Maniatis.
1993.
A splicing enhancer complex controls alternative splicing of doublesex pre-mRNA.
Cell
74:105-114[CrossRef][Medline].
|
| 87.
|
Urlaub, G.,
E. Kas,
A. M. Carothers, and L. A. Chasin.
1983.
Deletion of the diploid dihydrofolate reductase locus from cultured mammalian cells.
Cell
33:405-412[CrossRef][Medline].
|
| 88.
|
Urlaub, G.,
P. J. Mitchell,
C. J. Ciudad, and L. A. Chasin.
1989.
Nonsense mutations in the dihydrofolate reductase gene affect RNA processing.
Mol. Cell. Biol.
9:2868-2880[Abstract/Free Full Text].
|
| 89.
|
Wang, J.,
Y. Takagaki, and J. L. Manley.
1996.
Targeted disruption of an essential vertebrate gene: ASF/SF2 is required for cell viability.
Genes Dev.
10:2588-2599[Abstract/Free Full Text].
|
| 90.
|
Watakabe, A.,
K. Tanaka, and Y. Shimura.
1993.
The role of exon sequences in splice site selection.
Genes Dev.
7:407-418[Abstract/Free Full Text].
|
| 91.
|
Wuarin, J., and U. Schibler.
1994.
Physical isolation of nascent RNA chains transcribed by RNA polymerase II: evidence for cotranscriptional splicing.
Mol. Cell. Biol.
14:7219-7225[Abstract/Free Full Text].
|
| 92.
|
Yeakley, J. M.,
J. P. Morfin,
M. G. Rosenfeld, and X. D. Fu.
1996.
A complex of nuclear proteins mediates SR protein binding to a purine-rich splicing enhancer.
Proc. Natl. Acad. Sci. USA
93:7582-7587[Abstract/Free Full Text].
|
| 93.
|
Zhang, M. Q.
1997.
Identification of protein coding regions in the human genome by quadratic discriminant analysis.
Proc. Natl. Acad. Sci. USA
94:565-568[Abstract/Free Full Text]. (Erratum, 94:5495.)
|
| 94.
|
Zhang, M. Q.
1998.
Statistical features of human exons and their flanking regions.
Hum. Mol. Genet.
7:919-932[Abstract/Free Full Text].
|
| 95.
|
Zheng, Z. M.,
P. He, and C. C. Baker.
1996.
Selection of the bovine papillomavirus type 1 nucleotide 3225 3' splice site is regulated through an exonic splicing enhancer and its juxtaposed exonic splicing suppressor.
J. Virol.
70:4691-4699[Abstract].
|
Molecular and Cellular Biology, September 2000, p. 6414-6425, Vol. 20, No. 17
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pastor, T., Talotti, G., Lewandowska, M. A., Pagani, F.
(2009). An Alu-derived intronic splicing enhancer facilitates intronic processing and modulates aberrant splicing in ATM. Nucleic Acids Res
0: gkp778v2-gkp778
[Abstract]
[Full Text]
-
Faa, V., Incani, F., Meloni, A., Corda, D., Masala, M., Baffico, A. M., Seia, M., Cao, A., Rosatelli, M. C.
(2009). Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene. J. Biol. Chem.
284: 30024-30031
[Abstract]
[Full Text]
-
Stucki, M., Suormala, T., Fowler, B., Valle, D., Baumgartner, M. R.
(2009). Cryptic Exon Activation by Disruption of Exon Splice Enhancer: NOVEL MECHANISM CAUSING 3-METHYLCROTONYL-CoA CARBOXYLASE DEFICIENCY. J. Biol. Chem.
284: 28953-28957
[Abstract]
[Full Text]
-
Kollberg, G., Tulinius, M., Melberg, A., Darin, N., Andersen, O., Holmgren, D., Oldfors, A., Holme, E.
(2009). Clinical manifestation and a new ISCU mutation in iron-sulphur cluster deficiency myopathy. Brain
132: 2170-2179
[Abstract]
[Full Text]
-
Zhang, X. H.-F., Arias, M. A., Ke, S., Chasin, L. A.
(2009). Splicing of designer exons reveals unexpected complexity in pre-mRNA splicing. RNA
15: 367-376
[Abstract]
[Full Text]
-
Coles, J. L., Hallegger, M., Smith, C. W.J.
(2009). A nonsense exon in the Tpm1 gene is silenced by hnRNP H and F. RNA
15: 33-43
[Abstract]
[Full Text]
-
Jenkins, J. L., Shen, H., Green, M. R., Kielkopf, C. L.
(2008). Solution Conformation and Thermodynamic Characteristics of RNA Binding by the Splicing Factor U2AF65. J. Biol. Chem.
283: 33641-33649
[Abstract]
[Full Text]
-
Suryavathi, V., Khattri, A., Gopal, K., Rani, D. S., Panneerdoss, S., Gupta, N. J., Chakravarty, B., Deenadayal, M., Singh, L., Thangaraj, K.
(2008). Novel Variants in UBE2B Gene and Idiopathic Male Infertility. J Androl
29: 564-571
[Abstract]
[Full Text]
-
Goina, E., Skoko, N., Pagani, F.
(2008). Binding of DAZAP1 and hnRNPA1/A2 to an Exonic Splicing Silencer in a Natural BRCA1 Exon 18 Mutant. Mol. Cell. Biol.
28: 3850-3860
[Abstract]
[Full Text]
-
Ram, O., Schwartz, S., Ast, G.
(2008). Multifactorial Interplay Controls the Splicing Profile of Alu-Derived Exons. Mol. Cell. Biol.
28: 3513-3525
[Abstract]
[Full Text]
-
Wang, Z., Burge, C. B.
(2008). Splicing regulation: From a parts list of regulatory elements to an integrated splicing code. RNA
14: 802-813
[Abstract]
[Full Text]
-
Gal-Mark, N., Schwartz, S., Ast, G.
(2008). Alternative splicing of Alu exons--two arms are better than one. Nucleic Acids Res
36: 2012-2023
[Abstract]
[Full Text]
-
Ke, S., Zhang, X. H.-F., Chasin, L. A.
(2008). Positive selection acting on splicing motifs reflects compensatory evolution. Genome Res
18: 533-543
[Abstract]
[Full Text]
-
Lee, E.-G., Kuppers, D., Horn, M., Roy, J., May, C., Linial, M. L.
(2008). A Premature Termination Codon Mutation at the C Terminus of Foamy Virus Gag Downregulates the Levels of Spliced pol mRNA. J. Virol.
82: 1656-1664
[Abstract]
[Full Text]
-
Hung, L.-H., Heiner, M., Hui, J., Schreiner, S., Benes, V., Bindereif, A.
(2008). Diverse roles of hnRNP L in mammalian mRNA processing: A combined microarray and RNAi analysis. RNA
14: 284-296
[Abstract]
[Full Text]
-
Leparc, G. G., Mitra, R. D.
(2007). A sensitive procedure to detect alternatively spliced mRNA in pooled-tissue samples. Nucleic Acids Res
35: e146-e146
[Abstract]
[Full Text]
-
Akker, S. A., Misra, S., Aslam, S., Morgan, E. L., Smith, P. J., Khoo, B., Chew, S. L.
(2007). Pre-Spliceosomal Binding of U1 Small Nuclear Ribonucleoprotein (RNP) and Heterogenous Nuclear RNP E1 Is Associated with Suppression of a Growth Hormone Receptor Pseudoexon. Mol. Endocrinol.
21: 2529-2540
[Abstract]
[Full Text]
-
Buratti, E., Dhir, A., Lewandowska, M. A., Baralle, F. E.
(2007). RNA structure is a key regulatory element in pathological ATM and CFTR pseudoexon inclusion events. Nucleic Acids Res
35: 4369-4383
[Abstract]
[Full Text]
-
Leparc, G. G., Mitra, R. D.
(2007). Non-EST-based prediction of novel alternatively spliced cassette exons with cell signaling function in Caenorhabditis elegans and human. Nucleic Acids Res
35: 3192-3202
[Abstract]
[Full Text]
-
David, A., Camacho-Hubner, C., Bhangoo, A., Rose, S. J., Miraki-Moud, F., Akker, S. A., Butler, G. E., Ten, S., Clayton, P. E., Clark, A. J. L., Savage, M. O., Metherell, L. A.
(2007). An Intronic Growth Hormone Receptor Mutation Causing Activation of a Pseudoexon Is Associated with a Broad Spectrum of Growth Hormone Insensitivity Phenotypes. J. Clin. Endocrinol. Metab.
92: 655-659
[Abstract]
[Full Text]
-
Zhang, X. H.-F., Chasin, L. A.
(2006). Comparison of multiple vertebrate genomes reveals the birth and evolution of human exons. Proc. Natl. Acad. Sci. USA
103: 13427-13432
[Abstract]
[Full Text]
-
Smith, P. J., Zhang, C., Wang, J., Chew, S. L., Zhang, M. Q., Krainer, A. R.
(2006). An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum Mol Genet
15: 2490-2508
[Abstract]
[Full Text]
-
Buratti, E., Baralle, M., Baralle, F. E.
(2006). Defective splicing, disease and therapy: searching for master checkpoints in exon definition. Nucleic Acids Res
34: 3494-3510
[Abstract]
[Full Text]
-
Xing, Y., Wang, Q., Lee, C.
(2006). Evolutionary Divergence of Exon Flanks: A Dissection of Mutability and Selection. Genetics
173: 1787-1791
[Abstract]
[Full Text]
-
Spena, S., Tenchini, M. L., Buratti, E.
(2006). Cryptic splice site usage in exon 7 of the human fibrinogen B{beta}-chain gene is regulated by a naturally silent SF2/ASF binding site within this exon. RNA
12: 948-958
[Abstract]
[Full Text]
-
Grellscheid, S.-N., Smith, C. W. J.
(2006). An Apparent Pseudo-Exon Acts both as an Alternative Exon That Leads to Nonsense-Mediated Decay and as a Zero-Length Exon.. Mol. Cell. Biol.
26: 2237-2246
[Abstract]
[Full Text]
-
Kralovicova, J., Vorechovsky, I.
(2006). Position-Dependent Repression and Promotion of DQB1 Intron 3 Splicing by GGGG Motifs. J. Immunol.
176: 2381-2388
[Abstract]
[Full Text]
-
DYE, M.J., GROMAK, N., HAUSSECKER, D., WEST, S., PROUDFOOT, N.J.
(2006). Turnover and Function of Noncoding RNA Polymerase II Transcripts. Cold Spring Harb Symp Quant Biol
71: 275-284
[Abstract]
-
Baralle, D, Baralle, M
(2005). Splicing in action: assessing disease causing sequence changes. J. Med. Genet.
42: 737-748
[Abstract]
[Full Text]
-
Wang, J., Smith, P. J., Krainer, A. R., Zhang, M. Q.
(2005). Distribution of SR protein exonic splicing enhancer motifs in human protein-coding genes. Nucleic Acids Res
33: 5053-5062
[Abstract]
[Full Text]
-
Lei, H., Vorechovsky, I.
(2005). Identification of Splicing Silencers and Enhancers in Sense Alus: a Role for Pseudoacceptors in Splice Site Repression. Mol. Cell. Biol.
25: 6912-6920
[Abstract]
[Full Text]
-
Zhang, X. H.-F., Kangsamaksin, T., Chao, M. S. P., Banerjee, J. K., Chasin, L. A.
(2005). Exon Inclusion Is Dependent on Predictable Exonic Splicing Enhancers. Mol. Cell. Biol.
25: 7323-7332
[Abstract]
[Full Text]
-
Lewandowska, M. A., Stuani, C., Parvizpur, A., Baralle, F. E., Pagani, F.
(2005). Functional studies on the ATM intronic splicing processing element. Nucleic Acids Res
33: 4007-4015
[Abstract]
[Full Text]
-
Lei, H., Day, I. N. M., Vorechovsky, I.
(2005). Exonization of AluYa5 in the human ACE gene requires mutations in both 3' and 5' splice sites and is facilitated by a conserved splicing enhancer. Nucleic Acids Res
33: 3897-3906
[Abstract]
[Full Text]
-
Zhang, X. H-F., Leslie, C. S., Chasin, L. A.
(2005). Dichotomous splicing signals in exon flanks. Genome Res
15: 768-779
[Abstract]
[Full Text]
-
Burnette, J. M., Miyamoto-Sato, E., Schaub, M. A., Conklin, J., Lopez, A. J.
(2005). Subdivision of Large Introns in Drosophila by Recursive Splicing at Nonexonic Elements. Genetics
170: 661-674
[Abstract]
[Full Text]
-
ROCA, X., SACHIDANANDAM, R., KRAINER, A. R.
(2005). Determinants of the inherent strength of human 5' splice sites. RNA
11: 683-698
[Abstract]
[Full Text]
-
Zhang, X. H-F., Chasin, L. A.
(2004). Computational definition of sequence motifs governing constitutive exon splicing. Genes Dev.
18: 1241-1250
[Abstract]
[Full Text]
-
Sironi, M., Menozzi, G., Riva, L., Cagliani, R., Comi, G. P., Bresolin, N., Giorda, R., Pozzoli, U.
(2004). Silencer elements as possible inhibitors of pseudoexon splicing. Nucleic Acids Res
32: 1783-1791
[Abstract]
[Full Text]
-
Zhang, X. H-F., Heller, K. A., Hefter, I., Leslie, C. S., Chasin, L. A.
(2003). Sequence Information for the Splicing of Human Pre-mRNA Identified by Support Vector Machine Classification. Genome Res
13: 2637-2650
[Abstract]
[Full Text]
-
Roca, X., Sachidanandam, R., Krainer, A. R.
(2003). Intrinsic differences between authentic and cryptic 5' splice sites. Nucleic Acids Res
31: 6321-6333
[Abstract]
[Full Text]
-
Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R.
(2003). ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acids Res
31: 3568-3571
[Abstract]
[Full Text]
-
ZHANG, X., LEE, J., CHASIN, L. A.
(2003). The effect of nonsense codons on splicing: A genomic analysis. RNA
9: 637-639
[Abstract]
[Full Text]
-
Faustino, N. A., Cooper, T. A.
(2003). Pre-mRNA splicing and human disease. Genes Dev.
17: 419-437
[Full Text]
-
Verhoef, K., Bilodeau, P. S., van Wamel, J. L. B., Kjems, J., Stoltzfus, C. M., Berkhout, B.
(2001). Repair of a Rev-Minus Human Immunodeficiency Virus Type 1 Mutant by Activation of a Cryptic Splice Site. J. Virol.
75: 3495-3500
[Abstract]
[Full Text]
-
Cote, J., Dupuis, S., Wu, J. Y.
(2001). Polypyrimidine Track-binding Protein Binding Downstream of Caspase-2 Alternative Exon 9 Represses Its Inclusion. J. Biol. Chem.
276: 8535-8543
[Abstract]
[Full Text]