Previous Article | Next Article 
Molecular and Cellular Biology, September 2000, p. 6579-6586, Vol. 20, No. 17
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Retinoic Acid Regulation of Cdx1: an Indirect
Mechanism for Retinoids and Vertebral Specification
Martin
Houle,1,2
Panagiotis
Prinos,2
Angelo
Iulianella,1,2
Nathalie
Bouchard,2 and
David
Lohnes1,2,3,*
Department of Molecular Biology,
Université de Montréal,1
Division of Experimental Medicine, McGill
University,3 and Institut de Recherches
Cliniques de Montréal,2
Montréal, Québec, Canada H2W 1R7
Received 19 April 2000/Accepted 25 May 2000
 |
ABSTRACT |
Retinoic acid (RA) is required for diverse developmental programs,
including vertebral specification. Both RA receptor disruption and
excess RA result in homeotic transformations of the axial skeleton.
These effects are believed to occur through altered expression of
Hox genes, several of which have been demonstrated to be
direct RA targets. Members of the cdx (caudal)
homeobox gene family are also implicated in regulating Hox
expression. Disruption of cdx1 results in vertebral
homeotic transformations and alteration of Hox expression
boundaries; similar homeosis is also observed in cdx2
heterozygotes. In Xenopus, gain or loss of Cdx function
affects vertebral morphogenesis through a mechanism that also
correlates with altered Hox expression. Taken together with
the finding of putative Cdx binding motifs in several Hox promoters, these data strongly support a role for Cdx members in direct
regulation of expression of at least some Hox genes. Most
retinoid-responsive Hox genes have not been demonstrated to
be direct RA targets, suggesting that intermediaries are involved. Based on these findings, we hypothesized that one or more
cdx members may transduce the effects of RA on
Hox transcription. Consistent with this, we present
evidence that cdx1 is a direct RA target gene, suggesting
an additional pathway for retinoid-dependent vertebral specification.
 |
INTRODUCTION |
Retinoids such as retinoic acid (RA)
play key roles in vertebrate development (43). The retinoid
signal is transduced by two families of nuclear receptors: the RA
receptors (RARs) and their isoforms (RAR
1 and -
2; RAR
1, -
2,
-
3, and -
4; and RAR
1 and -
2) and the retinoid x receptors
(RXR
, -
, and -
). These receptors mediate ligand-dependent
target gene transcription typically by binding as heterodimers to
cis-acting RA response elements (RAREs) (6, 14, 29,
47).
Vertebral specification is believed to be governed by a Hox "code."
This model is supported by a multitude of studies which demonstrate
that anterior or posterior shifts in Hox expression or the
ablation of specific Hox genes often leads to alterations in
somite identity, as inferred by vertebral homeosis (10, 13, 31). Transplantation experiments suggest that vertebral
specification, and hence Hox expression boundaries, is
established in the unsegmented paraxial mesoderm at or shortly
following gastrulation (36).
Both RAR knockout studies and studies on the effects of excess RA
demonstrate roles for retinoids in vertebral morphogenesis (10,
31). RAR
null mice display axial malformations, including vertebral homeotic transformations (25). Although disruption of either RAR
or RAR
2 does not affect skeletal development
(27, 33), both receptors collaborate with RAR
in
vertebral development, as judged by the marked increase in frequency
and severity of axial skeletal defects in the corresponding double null
mutants (26). A role for Hox genes in this
program is suggested by the finding of altered expression of some
Hox members following RA treatment in vivo. Moreover,
certain Hox mutants are phenocopies of the axial
transformations observed in RAR mutants (25, 26). However,
despite these correlations, few RA-responsive Hox genes have
been shown to be direct RAR targets (11, 24, 35, 38, 39,
45).
Several lines of evidence suggest that vertebrate caudal
homologues are key regulators of Hox expression. The murine
caudal homologues cdx1, cdx2, and
cdx4, are expressed in overlapping domains in the primitive
streak region, with expression maintained in the posterior embryo
through embryonic day 12.5 (E12.5) (5, 12, 34). These
expression patterns suggest that a gradient of cdx function
exists in the posterior embryo, which may reflect a means of regulating
expression of different cohorts of Hox genes during somite
specification (30). Consistent with this, cdx1 null mutants as well as cdx2 heterozygotes exhibit vertebral
homeotic transformations (8, 46), which, in the former case,
correlate with altered expression of certain Hox genes. The
finding of consensus Cdx response elements in the promoter regions of
several Hox loci (5, 46) further supports a role
for Cdx members in direct regulation of Hox expression.
Similar observations in Xenopus and Caenorhabditis
elegans suggest that this pathway may be conserved (17,
20).
As most RA-responsive Hox genes are not known to be direct
RAR targets, we hypothesized that a cdx member(s) may
function as an intermediate. In support of this, we present evidence
that cdx1 responds to RA and RAR ablation in vivo in a
manner consistent with it being a direct retinoid target. These results
suggest an indirect pathway by which RA regulates Hox
expression via direct control of cdx1.
 |
MATERIALS AND METHODS |
Animals.
The RAR
, RAR
1, and RAR
1/
null mice used
in the present study have been described previously (26,
27). RAR
heterozygous and null embryos were generated from
RAR
+/
intercrosses, whereas RAR
1 and RAR
1/
null embryos were derived from
RAR
1
/
+/
intercrosses. Wild-type
embryos were obtained either from RAR
+/
matings, from
intercrosses of wild-type stock from the RAR
colony (C57BL/6-129Sv
hybrid), or from CD-1 intercrosses. No overt differences in gene
expression or RA response were noted between any of these backgrounds.
Females were dosed by oral gavage with all-trans RA
dissolved in corn oil to a final delivery of 10 or 100 mg/kg of body
weight at E7.5, E8.5, or E9.5 (noon of the day of plug appearance was
considered E0.5). Animals were sacrificed 1 to 8 h posttreatment,
and embryos were dissected in phosphate-buffered saline (PBS), fixed
overnight in 4% paraformaldehyde, dehydrated through a methanol
series, and stored at
20°C in 100% methanol. Yolk sacs were used
to establish genotype by PCR as described previously (19).
In some experiments, embryos were treated as described above and the
presomitic caudal embryonic region was dissected out, snap frozen, and
stored at
80°C prior to RNA isolation.
In situ hybridization analysis and embryo culture.
Embryos
were pooled by stage, genotype, and RA treatment and rehydrated.
Whole-mount in situ hybridization was performed as described previously
(50), using a riboprobe generated from the cdx1
cDNA (34). After hybridization, embryos were cleared and
photographed. Some specimens were then postfixed in 4%
paraformaldehyde-0.2% glutaraldehyde at 4°C for 30 min, rinsed in
several changes of PBS, embedded in Paraplast (Fisher), and sectioned.
Embryo culture was performed essentially as described previously
(15). Embryos were dissected out in PBS containing 10% fetal bovine serum and stored briefly in Dulbecco's modified Eagle's medium (DMEM) (Life Technologies) buffered with HEPES. Embryos were
cultured in DMEM-rat serum (50:50) preequilibrated with 5% O2-5% CO2 in N2 at 37°C.
Cultures were maintained for 4 h in the presence of RA
(10
9 to 10
7 M in dimethyl sulfoxide
[DMSO]) or vehicle (0.1%) prior to in situ hybridization analysis.
In some experiments, cycloheximide (30 mg/ml) or the vehicle (EtOH,
0.1%) was also included in the culture medium for 30 min prior to
addition of RA or DMSO. To monitor de novo protein synthesis in the
latter experiments, 100 µCi of [35S]methionine was
added per ml, and incorporation of the label was assessed by filter
binding as described previously (3).
Cell culture and transfection analysis.
F9 embryocarcinoma
cells were maintained in DMEM (Life Technologies) supplemented with
glucose (4.5 g/liter), 10% fetal bovine serum, and gentamicin (10 µg/ml). For routine culture, cells were passaged every third day into
gelatinized 100-mm tissue culture plates and cultured at 37°C in 5%
CO2. For Northern blot experiments, cells were seeded in
100-mm plates (approximately 106 cells/plate) and treated
the following day with all-trans RA (1 µM) dissolved in
DMSO (final concentration, 0.1%). Control cultures were treated with
DMSO only. For Northern blot analysis, cells were harvested 2 to
48 h posttreatment, snap frozen, and stored at
80°C prior to
RNA extraction.
To assess the requirement for de novo protein synthesis, cells were
treated for 30 min with 15 or 30 µg of cycloheximide/ml
or with the
vehicle alone prior to RA treatment. Cells were then
harvested, snap
frozen, and stored as described above prior to
Northern blot analysis.
Parallel cultures were incubated with
40 µCi of
[
35S]methionine/ml, and incorporation of the label was
assessed by
filter
binding.
For transfection analysis, cells were passaged into gelatin-treated
six-well cluster plates (approximately 10
5 cells/well) and
transfected 24 h later using the calcium phosphate
method. DNA
mixtures were comprised of 1.5 µg of luciferase reporter
construct,
0.75 µg of a
lacZ expression vector as an internal
control, and pBluescript KS(+), to a final concentration of 5
µg DNA
per transfection. The following day, the medium was replenished
and
cells were treated with RA or DMSO, and culture was continued
for
24 h. Monolayers were then rinsed twice in ice-cold PBS, and
cells
were disrupted by addition of 250 µl of lysis buffer (0.1
M Tris-Cl
[pH 8], 1% NP-40, 1 µM dithiothreitol) for 5 min at
room
temperature. Cell lysates were collected and assessed for
luciferase
and

-galactosidase as described previously (
3),
and

-galactosidase activity was used to correct for transfection
efficiency. Results were corrected for background (empty expression
vector) and expressed as the means of three independent transfections.
Unless otherwise stated, each experiment was repeated a minimum
of
three
times.
To assess RA regulation in stable transfectants, 50 µg of the
parental 2-kb
cdx1 reporter vector was linearized and
cotransfected
with 5 µg of a neomycin selection vector. Cells were
selected
by culture in the presence of 300 µg of G418 (Life
Technologies)/ml
for 2 weeks. Clones (approximately 100) were pooled
and used to
assess RA response by luciferase assay as described
above.
Northern blotting and representative cDNA analysis.
Total
RNA was extracted from frozen embryos or cell pellets by using Trizol
(Life Technologies) according to the manufacturer's directions.
Fifteen micrograms of total RNA was resolved by electrophoresis through
a formaldehyde gel and subjected to Northern blotting using Hybond N
(Amersham) as described by the manufacturer. To quantify differences in
embryonic gene expression, caudal tissue (posterior to the closed
neural tube) was used for the generation of representative cDNA by PCR
as previously described (18), followed by analysis by
Southern blotting. Hybridizations were performed overnight at 42°C in
a formamide-based buffer (40% formamide, 0.9 M sodium chloride, 50 mM
sodium phosphate, 2 mM EDTA, 4× Denhardt's solution, 0.1% sodium
dodecyl sulfate [SDS]) supplemented with 0.1 mg of denatured salmon
sperm DNA/ml; denatured probe (approximately 106 cpm/ml)
prepared by random priming was used. Blots were washed in 2×
SSC-0.1% SDS (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)
three times at 65°C, followed by three washes in 0.2× SSC-0.1% SDS
at the same temperature, and signal was revealed by autoradiography
using X-Omat film (Kodak). For representative cDNA analysis, following
autoradiography, densitometry was performed using Alpha Imager IS-1000
software (Alpha Innotech Corporation, San Leandro, Calif.). Values were
normalized with respect to
-actin and expressed as fold change
relative to untreated controls.
EMSA.
The region of the cdx1 promoter region
conferring RA response, as defined by transfection analysis, was
scanned by initially using fragments amplified by PCR. Each fragment
was purified, end labeled with T4 polynucleotide kinase, and tested for
RAR and RXR binding by electrophoretic mobility shift assay (EMSA). The
putative RARE identified by this approach was evaluated for binding by
EMSA with a double-stranded end-labeled oligonucleotide harboring
either the sequence 5'-AAGGGTCGTGACCCT or the mutated sequence 5'-AAGGGCAAGTTCCCT (altered nucleotides
are underlined). The end-labeled double-stranded oligonucleotide
5'-GGGTAGGGTTCACCGAAAGTTCACTCGCA, harboring a consensus RARE
(DR5), was used as a positive control in all binding assays. Nuclear
extracts from Cos cells which had been either mock transfected or
transfected with expression vectors encoding RAR
and RXR
were
used as a source of protein. Binding reaction mixtures containing
approximately 2 ng of probe (50,000 cpm) and 2 µl of nuclear extract
(3 µg of protein) were equilibrated for 30 min at room temperature
and separated by electrophoresis through a 5% polyacrylamide gel
containing 0.25× Tris-borate-EDTA. For antibody supershifts, 0.5 µl
of anti-RAR
antibody (Santa Cruz) was added to protein extracts and
equilibrated on ice for 30 min prior to addition of probe and further
incubation as described above. Specificity of binding was assessed by
competition with a 100-fold excess of unlabeled RARE nucleotides
(sequences noted above) or with nucleotides harboring an SP-1 binding
motif (5'-TCGATCGGGGCGGGGCGA). In other EMSA experiments,
electrophoresis was initiated at various times after probe addition or
with various amounts of transfected Cos cell extracts.
Isolation of genomic sequences and derivation of plasmids.
Sequences were isolated from a murine phage genomic library. A
BamHI-NotI fragment containing the endogenous
transcription initiation site (16) and extending
approximately 2 kb 5' was ligated into the promoterless luciferase
expression vector pXP2 (37), and subsequent deletion
constructs were prepared by using convenient restriction sites. A
reporter bearing the putative cdx1 RARE was obtained by
ligating either the double-stranded oligonucleotide
5'-AAGGGTCGTGACCCCT, harboring the wild-type sequences, or
the mutated sequence 5'-AAGGGCAAGTTCCCCT into pTK109-Luc. A positive RA-responsive control, RARE-Luc, was derived by ligating the double-stranded oligonucleotide GGGTAGGGTTCACCGAAAGTTCACTCGCA, bearing the RAR
2 consensus RARE, into pTK109-Luc.
Site-directed mutagenesis was performed using a Transformer kit
(Clontech). All constructs were confirmed by sequencing.
 |
RESULTS |
RA induces cdx1 in vivo.
In untreated wild-type
embryos at E8.5, cdx1 transcripts were abundant in the
ectoderm and mesoderm in the primitive streak region, with weaker
expression in caudal neuroepithelium, in agreement with previous
studies (Fig. 1A) (34). Eight
hours following gavage with RA (100 mg/kg), expression was markedly
increased (Fig. 1B) in all germ layers of the caudal embryo (Fig. 1D,
compare to the control in 1C), with induction detectable as early as
1 h posttreatment (data not shown). Note that in this and other experiments, embryos to be compared were processed in parallel using
the same probe to control for variables in signal intensity. Note also
that experiments were terminated when strong staining was observed in
any of the pooled samples. Therefore, untreated embryos were sometimes
understained to clearly demonstrate the effect of RA.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Induction of cdx1 by RA in vivo. (A and B)
cdx1 expression in E8.5 embryos treated with a vehicle (A)
or 8 h following gavage with 100 mg of RA/kg (B). (C and D)
Sagittal sections of embryos shown in panels A and B, respectively.
Note the marked induction in signal throughout the caudal embryo. (E,
F, and G) Semiquantitative analysis of cdx1 expression.
Representative cDNA Southern blots were generated from E8.5 caudal
tissue, as described in Materials and Methods, and hybridized to either
cdx1 (E) or -actin gene (F) probes. Compare basal
expression (panel E, lanes 2 through 4) to expression following an RA
treatment (lanes 6 through 8). -Actin gene expression from the same
material (F) was not affected. Densitometry from the blots shown in
panels E and F was performed, and cdx1 expression levels
were normalized to -actin gene expression levels. Results (G) are
expressed relative to those for untreated controls and indicate a
ninefold induction. Due to saturation of the X-ray film in the lanes
from the treated samples, this is likely an underrepresentation of
regulation. (H to J) Ex vivo response of cdx1 to RA. E8.5
embryos were excised and cultured for 4 h in the presence of a
vehicle (H), 10 9 M RA (I), or 10 7 M RA (J),
following which cdx1 expression was assessed by whole-mount
in situ hybridization. Bar, 500 µm (A, B, H, I, and J) and 250 µm
(C and D).
|
|
In order to calculate induction, semiquantitative PCR was employed to
compare
cdx1 transcript abundance in control and treated
caudal embryo tissue. Treated embryos clearly exhibited a strong
induction of message relative to untreated controls (Fig.
1E),
whereas
actin transcript abundance was not affected (Fig.
1F).
Densitometric
assessment of this regulation revealed a ninefold
induction of
cdx1 signal when normalized for actin transcript
abundance
(Fig.
1G).
Embryo culture was employed to allow administration of known
concentrations of RA and to more precisely regulate the time
of
exposure. In these experiments, both doses of RA tested
(10
9 and 10
7 M) rapidly induced
cdx1 expression (Fig.
1I and J, compare to
control in 1H).
Notably, the lower concentration is in close agreement
with the
Kd of the RARs for RA (
2), further
supporting a physiological
role for retinoids in regulating
cdx1 expression. Similar results
were obtained by using a
low dose of RA (10 mg/kg) in vivo at
E8.5 (data not shown) and by using
tissue culture models (see
below).
RA induces cdx1 expression at several developmental
stages.
In the mouse, exogenous RA can induce vertebral homeosis
from E7.5 to E9.5 in a manner that is coincident with altered
Hox expression (22). We therefore determined if
cdx1 responded to RA throughout this window. In untreated
embryos at E7.5, cdx1 expression was observed in the
ectoderm and mesoderm of the primitive streak region (Fig.
2A) as described previously
(34), whereas RA elicited a strong induction of expression
in the entire streak region at this stage (Fig. 2B). Interestingly,
treatment appeared to induce cdx1 precociously in embryos
where expression either had not yet commenced or was only weakly
detected (Fig. 2E, compare with F). At E9.5, cdx1
transcripts in the caudal embryo were present at low levels (Fig. 2I).
At this stage, hybridization was also observed in the forelimb bud
mesenchyme, with weaker expression sometimes observed in the
presumptive dermamyotome (Fig. 2I) (34). Four hours
following treatment at E9.5, message was markedly induced in all of
these domains, with a stronger signal consistently observed in the
dermamyotome (Fig. 2J).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
cdx1 expression in wild-type and RAR 1/
mutant embryos. Shown are results for whole-mount analysis of
cdx1 expression in E7.5 wild-type embryos without (A and E)
or 4 h following (B and F) RA treatment. Note induction throughout
the primitive streak region in the treated samples. (C and D)
Expression in untreated (C) and RA-treated (D) E7.5 RAR 1/ mutant
embryos. Note the reduced expression in the untreated mutant relative
to the wild type (C versus A) and the decreased effects of RA on
expression in the mutant background relative to controls (compare
mutants in panels C and D to wild types in panels A and B). (I and J)
cdx1 expression in wild-type embryos at E9.5 without (I) and
following (J) RA treatment. In untreated embryos, weak expression of
cdx1 was observed in the tail bud, with transcripts also
evident in the forelimb bud and dermamyotome (asterisk and arrowhead,
respectively, in panel I); RA strongly induced expression in all of
these domains (J, compare to panel I). In RAR 1/ null embryos at
E8.5 (G and H) and E9.5 (K and L), RA induction was reduced relative to
that seen in the wild-type samples (compare effects of treatment in
mutants in panels G and H and panels K and L to the effect on wild-type
controls in Fig. 1A and B and Fig. 2I and J, respectively). Bars, 50 µm (A through F), 100 µm (G and H), and 75 µm (I through L).
|
|
cdx1 expression is altered in RAR null mutants.
cdx1 expression was not overtly different in wild-type
controls and RAR
1 or RAR
single mutants at E7.5 to E9.5 (data not shown). In contrast, E7.5 RAR
1/
double mutants always exhibited reduced cdx1 expression in the primitive streak region (Fig.
2C, compare with A). In marked contrast, transcript levels in the primitive streak region of these mutants at E8.5 were often comparable to levels in wild-type embryos (Fig. 2G, compare with 1A; also data not
shown). At E9.5, expression in the tail bud was either comparable or
too weak to compare between RAR
1/
mutants and controls. Similar
variability was also seen with regard to expression in the limb buds
and dermamyotome of these mutants, with expression sometimes weaker in
the mutants than in stage-matched wild-type controls (Fig. 2K, compare
with I). However, differences in expression were not consistently
observed between RAR
1/
mutants and controls at E9.5. Similar
variability in signal intensity was often seen in control E9.5 samples,
suggesting highly variable and dynamic expression of cdx1 at
this stage. Such variance precluded an accurate determination of the
effects of RAR loss on cdx1 levels in these embryos.
We also determined whether RAR

1 and/or RAR

was required for
induction of
cdx1 by exogenous RA. Following treatment at
E8.5,
caudal
cdx1 expression in RAR

1 null embryos was
comparable to
expression in the wild type, whereas induction in RAR

mutants
was only modestly reduced relative to that in the wild-type
controls
(data not shown). In contrast, induction in RAR

1/

mutants was
markedly compromised in all normally responsive domains
(primitive
streak, dermamyotome, and forelimb bud) at all stages
examined
(compare untreated mutants in Fig.
2C, G, and K with the
treated
stage-matched samples in Fig.
2D, H, and L; also compare the
relative
induction in these double mutants to that seen in wild-type
specimens
at comparable stages (Fig.
2; see Fig.
1A and B for E8.5
wild-type
embryos).
cdx1 is a direct RA target.
To further investigate
the effects of RA on cdx1 expression, we employed F9
embryocarcinoma cells. In these cultures, RA up-regulated cdx1 transcript levels as early as 2 h after treatment,
with a maximum level attained after 24 to 48 h (Fig.
3A). In both F9 cells (Fig. 3B) and
embryo cultures (Fig. 3C through F), this response was independent of
de novo protein synthesis, as induction was evident in the absence or
presence of cycloheximide (cycloheximide treatment resulted in
95%
inhibition of de novo protein synthesis in either system). Notably, in
embryo cultures, cdx1 message was increased by cycloheximide
treatment alone (Fig. 3E, compare to C), whereas a further increase in
message abundance was seen upon subsequent treatment with RA (Fig. 3F).
This superinduction effect suggests both an increase in transcription
and a stabilization of message, a common phenomenon for immediate-early
target genes.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
cdx1 induction is independent of de novo
protein synthesis. (A) cdx1 expression in F9 cells treated
with RA (lanes 2, 4, 6, 8, and 10) or DMSO (lanes 3, 5, 7, 9, and 11)
for the indicated times. (B) Northern blot of RNA from F9 cells treated
for 4 h with RA (lanes 2, 4, and 6) or DMSO (lanes 1, 3, and 5)
with the indicated amounts of cycloheximide. Both blots were reprobed
for -actin as a loading control. (C and D) cdx1
expression in cultured embryos. Embryos were cultured for 4 h in
the presence of a vehicle (C), 20 µg of cycloheximide (CHX)/ml (E),
or 10 6 M RA (D) or RA plus cycloheximide (F) prior to in
situ hybridization. Results shown are typical of several experiments.
Bar, 400 µm (C to F).
|
|
We further investigated the mechanism of transcriptional regulation by
using transfection approaches. The genomic region of
cdx1,
comprising approximately 2 kb of 5' sequences, including
the endogenous
transcriptional start site and a portion of the
5' untranslated region
(5'-UTR) (
16), was as potent as a synthetic
RARE at
eliciting an RA response in transient-transfection assays
in F9 cells
(Fig.
4A). Removal of sequences
comprising the endogenous
transcriptional start site and 5'-UTR
revealed that the remaining,
nontranscribed, sequences elicited an
induction in transfection
assays when coupled to a heterologous
promoter (data not shown;
see also below), suggesting that the RA
response was not mediated
through posttranscriptional mechanisms
operating via the 5'-UTR.
Finally, the 2-kb reporter was used to
establish stably integrated
reporter cell lines. These cell lines
responded to low (10
9 M) levels of RA in dose-response
experiments (data not shown),
indicating that, as observed in vivo,
this region conferred a
response to physiological levels of RA.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Identification of an RARE in the cdx1
promoter. (A) F9 cells were transfected with the indicated reporter
constructs, and luciferase activity was determined 24 h following
treatment with 10 6 M RA. Results are expressed as fold
induction by RA relative to that in untreated cultures. Bm,
BamHI; Bs, BstXI; P, PstI; X,
XmnI. Numbering to the left indicates the 5'-most position
relative to the transcriptional start site. DR5 is the positive control
reporter construct. (B) The cdx1 RARE motif was tested for
receptor binding by EMSA using the radiolabeled oligonucleotide probes
indicated at the bottom. Lane 1, no extract; lanes 2 and 9, mock-transfected cells; lanes 3 through 8 and 10 through 15, cdx1 RARE and DR5 probe, respectively, incubated with
extracts from cells transfected with RAR plus RXR . Specific
binding complexes ("Specific") were not affected by nonspecific
competitor (lanes 8 and 15) or by mutated cdx1 RARE (lanes 6 and 14) but were competed by excess DR5 (lanes 7 and 12) or Cdx1 RARE
(lanes 5 and 13). "Super Shift" indicates complexes formed by
incubation with anti-RAR (lanes 4 and 11). (C) Transfection
analysis, as in panel A, indicates that point mutation of the RARE
sequences (*) in the context of the 2-kb parental cdx1
promoter results in complete loss of RA induction in F9 cells. A single
copy of the cdx1 RARE motif confers an RA response with a
heterologous promoter, and this effect is lost upon mutation of these
sequences (Cdx1 RARE*). (D and E) Stability of the receptor association
with cdx1 RARE compared to the canonical DR5 RARE motif. (D)
Comparable amounts of the probes were incubated with different amounts
of extracts from receptor-transfected Cos cells for 30 min before
electrophoresis. The protein (Prot.) amounts used were 3.00, 1.00, 0.30, 0.10, 0.03, 0.01, and 0.00 µg/incubation. (E) cdx1
RARE and DR5 probes were incubated with 3 µg of Cos extract for the
indicated amount of time, and binding complexes were resolved by
electrophoresis.
|
|
Deletion analysis and transfection assays mapped the RA response region
between

694 and

185 relative to the transcription
start site (Fig.
4A). As a typical RARE (DR5) was not observed
in these sequences, EMSAs
were employed to identify the element.
These experiments identified the
motif AAGGGTCGTGACCCT as a target
for RAR and RXR binding
and demonstrated that all parameters of
the
cdx1 RARE
investigated by EMSA were identical to those exhibited
by the control
DR5 element (Fig.
4B, left and right sides, respectively).
In
particular, receptor binding to
cdx1 sequences was
efficiently
competed with excess unlabeled self or consensus DR5 RARE
sequences,
but not by an SP-1 binding motif or a mutated
cdx1 RARE. Conversely,
the putative
cdx1 RARE,
but not the mutated element, competed
efficiently for binding to the
DR5 RARE. Specificity was further
confirmed by supershift assays, which
demonstrated the presence
of RAR

in the complex. Although this
supershift was not quantitative
(for unknown reasons), the
cdx1 and DR5 elements exhibited identical
degrees of
antibody binding (Fig.
4B, compare supershift binding
between lanes 4 and
11).
The relative affinity between the
cdx1 and DR5 motifs was
also assessed either by varying the RAR-RXR concentration or by
comparing relative binding as a function of reaction time. These
data
suggest that the
cdx1 motif is tightly associated with
receptor
complexes comparable to the DR5 control element, differing
approximately
twofold (Fig.
4D and data not shown). Moreover, the
cdx1 sequences
exhibited only modestly slower kinetics of
association relative
to the DR5 element (Fig.
4E). These data are
consistent with the
finding that the
cdx1 RARE was
absolutely essential for retinoid
response in the context of the 2-kb
promoter, as mutation of this
motif completely abolished the response
in F9 cells (Fig.
4C).
Moreover, a single copy of this element was also
sufficient to
confer an RA response to a heterologous basal promoter
(Fig.
4C).
These
cdx1 sequences bear remarkable similarity
to the rat growth
hormone promoter TRE, the thyroid hormone response
element, which
has previously been shown to confer an RA response in
transfection
assays (
49). The finding that this motif is
perfectly conserved
in the human
cdx1 promoter (data not
shown) further suggests a
conserved and important role for this element
in directing
expression.
 |
DISCUSSION |
Many Hox genes respond to RA both in tissue culture and
in vivo, and this relationship is believed to be a principal means by
which retinoids act in vertebral specification (10).
Although a number of Hox genes have been shown to be direct
RA targets, the mechanism(s) by which RA affects expression of most of
the responsive Hox genes is largely unknown. Our present
findings demonstrate that cdx1 is a direct RA target, which,
together with the established relationship between Cdx and
Hox gene expression, strongly suggests a novel pathway for
retinoids in axial specification.
Contribution of RA to cdx1 expression.
Findings
from several models illustrate a role for caudal family
members in anterior-posterior patterning. cdx1 null mutants exhibit anterior vertebral homeosis which is coincident with posterior shifts in the expression boundaries of certain Hox genes;
similar vertebral defects are also observed in cdx2
heterozygotes (8, 46). In Xenopus, gain or loss
of the function of Xcad (the frog homologue of
cdx4) results in patterning defects which correlate with
altered Hox gene expression along the anterior-posterior axis (17). Taken together with the presence of potential Cdx response elements in a number of Hox promoters (7,
46), these data support a role for Cdx members in the direct
control of Hox expression.
Our finding that
cdx1 is a direct RA target is in agreement
with a number of observations. The homeotic transformations and
rib
fusions observed in
cdx1 null offspring (
46) are
reminiscent
of the axial skeletal malformations exhibited by certain
RAR null
offspring (
26). These similarities occur with
respect to both
the nature of the defects and their location along the
vertebral
column, being largely restricted to the cervical region in
both
classes of mutants. Consistent with this finding, a reduction
in
cdx1 message was apparent in RAR

1/

mutants at E7.5.
This
is in agreement both with the window during which the cervical
vertebrae are presumed to be specified and with the high frequency
of
vertebral defects observed in RAR

1/

mutants relative to RAR

1
null offspring (which appear to be normal). However, reduction
of
cdx1 expression was not observed in RAR

null embryos.
This
may relate to the low incidence of homeosis seen in these mutants
(
25), suggesting that effects on
cdx1 may be
observed only at
a correspondingly low frequency and/or may be too
subtle to be
readily detected by in situ hybridization
techniques.
Our present data are entirely consistent with retinoid distribution
studies. In the mouse, biologically active retinoids are
first detected
in the primitive streak region at E7.5 (
4,
41).
This
correlates closely with the initial appearance of
cdx1
transcripts
(
34) and the ability of exogenous RA to
precociously induce
cdx1 at this time. Moreover,
cdx1 expression was strongly reduced
in RAR

1/

null
embryos at E7.5. The finding that expression at
E8.5 was not
reproducibly altered in the double mutant background
is likely related
to the fact that retinoid activity is greatly
reduced or absent in the
primitive streak region commencing at
this time (
41). These
data suggest that RA plays a role in the
initial period of
cdx1 expression (perhaps to initiate expression)
but that an
additional factor(s) is involved in maintaining later
phases of
transcription. In this regard, in
Xenopus, fibroblast
growth
factor (FGF) regulates
Hox expression via control of
Xcad (
17,
40). Taken together with our present
findings, this suggests
that both retinoid signaling and FGF signaling
converge on a common
target gene. Indeed, FGF and RA act
synergistically in inducing
posterior
Hox genes in
Xenopus (
9). However, whether this mechanism
can
be extrapolated to other vertebrates is unclear, as a relationship
between FGF and
cdx expression has not been described for
the
mouse.
RAR-specific regulation of cdx1.
Studies with F9 cells
suggest a key role for RAR
in induction of cdx1
(48), an observation that contrasts with our findings in
vivo. However, cdx1 induction in F9 cells is only maximal
after 24 to 48 h of treatment, in marked contrast to induction in
vivo, which is evident 1 h posttreatment. This difference may be
due, in part, to the fact that RAR
null F9 cells are refractory to RA-induced differentiation, suggesting that additional RAR
-dependent events impact cdx1 transcription. Interestingly, another RA
target gene, CYP26, exhibits similar differences between
regulation in vivo and in F9 cells (1, 18). Although the
basis for these discrepancies is speculative, these findings may be
indicative of common cell-type-specific regulatory mechanisms which
govern control of expression of these, and perhaps additional, RA
target genes.
RA, Hox expression, and somite specification.
RA
has been suggested to be a "posteriorizor" in the
activation-transformation model of neurulation (reviewed in reference 42). RA can impart more posterior molecular
characteristics on the anterior neuroepithelium, and interference with
RAR signaling in Xenopus, or vitamin A deficiency in quail,
results in hindbrain patterning defects, presumably due to effects on
target genes such as Hoxa-1 and Hoxb-1 (11,
23, 28, 32, 44, 45). However, to date, a somite-specific RARE
which is essential for expression of a Hox member with
definitive function in paraxial mesoderm has not been described. As
defects in cdx1 null mice appear to be related only to
somitic Hox misexpression, it is tempting to speculate that
RA-dependent vertebral specification may manifest largely through
cdx1. In contrast, the nonhomeotic axial patterning defects
observed in RAR
1/
double mutant offspring, which are not
exhibited by cdx1 mutants, clearly underscore the existence
of other retinoid target genes involved in vertebral morphogenesis. The
nature of these genes is unknown.
cdx1 and retinoid-induced teratogenesis.
Excess RA
has profound effects on vertebrate development and is capable of
eliciting, among other malformations, neural tube and limb defects,
axial truncation, and homeotic transformation, depending on both the
dose and the embryonic stage upon exposure. As overexpression of
cdx members can lead to neural tube defects in mouse embryos
as well as caudal malformations of Xenopus tadpoles (7,
17), excess RA could conceivably exert some of its teratogenic effects through misexpression of cdx1. In this regard,
RAR
is essential for retinoid-induced axial truncation
(25). The finding that cdx1 induction in RAR
mutants was only modestly compromised suggests that it is not involved
in eliciting this malformation. However, in Xenopus,
relatively small changes in Xcad3 gene dosage result in
dramatic differences in phenotypic outcome (17). Thus, we
cannot exclude the possibility that the relatively small difference in
cdx1 induction in RAR
mutants is significant.
Current models suggest that up-regulation of
cdx should lead
to posterior transformation concomitant with anteriorization
of
Hox expression domains, whereas loss of Cdx function should
lead to the converse situation. RA exposure at E7.5 to E9.5 induces
cdx1, yet posteriorization events are seen only following
treatment
at E7.5. Exposure at later stages results in predominantly
anterior
transformation with loss of
Hox expression
(
21,
22). At least
two possibilities may explain these
observations. First, as previously
discussed (
17), the
overall level of Cdx proteins may be of
importance, and induction of
cdx1 may be offset by reduction of
cdx2 (our
preliminary observation) and
cdx4 (
18), thus
resulting
in a loss of function at E8.5 and E9.5. Alternatively, Cdx
members
may differentially regulate target genes, as previously
suggested
(
7). Additional studies are needed to address this
as well
as to further investigate the relationship between RA,
cdx, and
Hox expression.
 |
ACKNOWLEDGMENTS |
We thank Peter Gruss for Cdx1 cDNA, P. Chambon for the RAR null
lines, and Mark Featherstone, Deborah Allan, and other members of our
group for their thoughtful suggestions.
This work was supported by the March of Dimes Birth Defects Foundation
(FY98-0562) and the MRC of Canada. M.H. and A.I. are supported by
studentships from the MRC of Canada, P.P. is supported by a fellowship
from the Spina Bifida and Hydrocephalus Association of Ontario/MRC, and
D.L. is supported by the FRSQ (Junior 2).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut de
Recherches Cliniques de Montréal, 110 Avenue des Pins, ouest,
Montréal, Québec, Canada H2W 1R7. Phone: (514) 987-5668. Fax: (514) 987-5767. E-mail: lohnesd{at}ircm.qc.ca.
 |
REFERENCES |
| 1.
|
Abu-Abed, S. S.,
B. R. Beckett,
H. Chiba,
J. V. Chithalen,
G. Jones,
D. Metzger,
P. Chambon, and M. Petkovich.
1998.
Mouse p450RAI (CYP26) expression and retinoic acid-inducible retinoic acid metabolism in F9 cells are regulated by retinoic acid receptor gamma and retinoid x receptor alpha.
J. Biol. Chem.
273:2409-2415[Abstract/Free Full Text].
|
| 2.
|
Allenby, G.,
M. T. Bocquel,
M. Saunders,
S. Kazmer,
J. Speck,
M. Rosenberger,
A. Lovey,
P. Kastner,
J. F. Grippo, and P. Chambon.
1993.
Retinoic acid receptors and retinoid X receptors: interactions with endogenous retinoic acids.
Proc. Natl. Acad. Sci. USA
90:30-34[Abstract/Free Full Text].
|
| 3.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1988.
Current protocols in molecular biology.
John Wiley and Sons, New York, N.Y.
|
| 4.
|
Balkan, W.,
M. Colbert,
C. Bock, and E. Linney.
1992.
Transgenic indicator mice for studying activated retinoic acid receptors during development.
Proc. Natl. Acad. Sci. USA
89:3347-3351[Abstract/Free Full Text].
|
| 5.
|
Beck, F.,
T. Erler,
A. Russell, and R. James.
1995.
Expression of cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes.
Dev. Dyn.
204:219-227[Medline].
|
| 6.
|
Chambon, P.
1996.
A decade of molecular biology of retinoic acid receptors.
FASEB J.
10:940-954[Abstract].
|
| 7.
|
Charité, J.,
W. de Graaff,
D. Consten,
M. J. Reijnen,
J. Korving, and J. Deschamps.
1998.
Transducing positional information to the Hox genes: critical interaction of cdx gene products with position-sensitive regulatory elements.
Development
125:4349-4358[Abstract].
|
| 8.
|
Chawengsaksophak, K.,
R. James,
V. E. Hammond,
F. Kontgen, and F. Beck.
1997.
Homeosis and intestinal tumours in Cdx2 mutant mice.
Nature
386:84-87[CrossRef][Medline].
|
| 9.
|
Cho, K. W., and E. M. De Robertis.
1990.
Differential activation of Xenopus homeo box genes by mesoderm-inducing growth factors and retinoic acid.
Genes Dev.
4:1910-1916[Abstract/Free Full Text].
|
| 10.
|
Conlon, R. A.
1995.
Retinoic acid and pattern formation in vertebrates.
Trends Genet.
11:314-319[CrossRef][Medline].
|
| 11.
|
Dupe, V.,
M. Davenne,
J. Brocard,
P. Dolle,
M. Mark,
A. Dierich,
P. Chambon, and F. M. Rijli.
1997.
In vivo functional analysis of the Hoxa-1 3' retinoic acid response element (3'RARE).
Development
124:399-410[Abstract].
|
| 12.
|
Gamer, L. W., and C. V. Wright.
1993.
Murine cdx-4 bears striking similarities to the Drosophila caudal gene in its homeodomain sequence and early expression pattern.
Mech. Dev.
43:71-81[CrossRef][Medline].
|
| 13.
|
Gellon, G., and W. McGinnis.
1998.
Shaping animal body plans in development and evolution by modulation of hox expression patterns.
Bioessays
20:116-125[CrossRef][Medline].
|
| 14.
|
Heyman, R. A.,
D. J. Mangelsdorf,
J. A. Dyck,
R. B. Stein,
G. Eichele,
R. M. Evans, and C. Thaller.
1992.
9-cis retinoic acid is a high affinity ligand for the retinoid x receptor.
Cell
68:397-406[CrossRef][Medline].
|
| 15.
|
Hogan, B.,
R. Beddington,
F. Costantini, and E. Lacy.
1994.
Manipulating the mouse embryo. A laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 16.
|
Hu, Y.,
J. Kazenwadel, and R. James.
1993.
Isolation and characterization of the murine homeobox gene Cdx-1. Regulation of expression in intestinal epithelial cells.
J. Biol. Chem.
268:27214-27225[Abstract/Free Full Text].
|
| 17.
|
Isaacs, H. V.,
M. E. Pownall, and J. M. Slack.
1998.
Regulation of Hox gene expression and posterior development by the Xenopus caudal homologue Xcad3.
EMBO J.
17:3413-3427[CrossRef][Medline].
|
| 18.
|
Iulianella, A.,
B. Beckett,
M. Petkovich, and D. Lohnes.
1999.
A molecular basis for retinoic acid-induced axial truncation.
Dev. Biol.
205:33-48[CrossRef][Medline].
|
| 19.
|
Iulianella, A., and D. Lohnes.
1997.
Contribution of retinoic acid receptor gamma to retinoid-induced craniofacial and axial defects.
Dev. Dyn.
209:92-104[CrossRef][Medline].
|
| 20.
|
Kenyon, C. J.,
J. Austin,
M. Costa,
D. W. Cowing,
J. M. Harris,
L. Honigberg,
C. P. Hunter,
J. N. Maloof,
M. M. Muller-Immergluck,
S. J. Salser,
D. A. Waring,
B. B. Wang, and L. A. Wrischnik.
1997.
The dance of the Hox genes: patterning the anteroposterior body axis of Caenorhabditis elegans.
Cold Spring Harbor Symp. Quant. Biol.
62:293-305[Abstract/Free Full Text].
|
| 21.
|
Kessel, M.
1992.
Respecification of vertebral identities by retinoic acid.
Development
115:487-501[Abstract].
|
| 22.
|
Kessel, M., and P. Gruss.
1991.
Homeotic transformations of murine vertebrae and concomitant alteration of hox codes induced by retinoic acid.
Cell
67:89-104[CrossRef][Medline].
|
| 23.
|
Kolm, P. J.,
V. Apekin, and H. Sive.
1997.
Xenopus hindbrain patterning requires retinoid signaling.
Dev. Biol.
192:1-16[CrossRef][Medline].
|
| 24.
|
Langston, A. W.,
J. R. Thompson, and L. J. Gudas.
1997.
Retinoic acid-responsive enhancers located 3' of the Hox a and Hox b homeobox gene clusters. Functional analysis.
J. Biol. Chem.
272:2167-2175[Abstract/Free Full Text].
|
| 25.
|
Lohnes, D.,
P. Kastner,
A. Dierich,
M. Mark,
M. LeMeur, and P. Chambon.
1993.
Function of retinoic acid receptor gamma in the mouse.
Cell
73:643-658[CrossRef][Medline].
|
| 26.
|
Lohnes, D.,
M. Mark,
C. Mendelsohn,
P. Dolle,
A. Dierich,
P. Gorry,
A. Gansmuller, and P. Chambon.
1994.
Function of the retinoic acid receptors (RARs) during development. I. Craniofacial and skeletal abnormalities in RAR double mutants.
Development
120:2723-2748[Abstract].
|
| 27.
|
Lufkin, T.,
D. Lohnes,
M. Mark,
A. Dierich,
P. Gorry,
M. P. Gaub,
M. LeMeur, and P. Chambon.
1993.
High postnatal lethality and testis degeneration in retinoic acid receptor alpha mutant mice.
Proc. Natl. Acad. Sci. USA
90:7225-7229[Abstract/Free Full Text].
|
| 28.
|
Maden, M.,
E. Gale,
I. Kostetskii, and M. Zile.
1996.
Vitamin A-deficient quail embryos have half a hindbrain and other neural defects.
Curr. Biol.
6:417-426[CrossRef][Medline].
|
| 29.
|
Mangelsdorf, D. J.,
U. Borgmeyer,
R. A. Heyman,
J. Y. Zhou,
E. S. Ong,
A. E. Oro,
A. Kakizuka, and R. M. Evans.
1992.
Characterization of three RXR genes that mediate the action of 9-cis retinoic acid.
Genes Dev.
6:329-344[Abstract/Free Full Text].
|
| 30.
|
Marom, K.,
E. Shapira, and A. Fainsod.
1997.
The chicken caudal genes establish an anterior-posterior gradient by partially overlapping temporal and spatial patterns of expression.
Mech. Dev.
64:41-52[CrossRef][Medline].
|
| 31.
|
Marshall, H.,
A. Morrison,
M. Studer,
H. Popperl, and R. Krumlauf.
1996.
Retinoids and Hox genes.
FASEB J.
10:969-978[Abstract].
|
| 32.
|
Marshall, H.,
M. Studer,
H. Popperl,
S. Aparicio,
A. Kuroiwa,
S. Brenner, and R. Krumlauf.
1994.
A conserved retinoic acid response element required for early expression of the homeobox gene Hoxb-1.
Nature
370:567-571[CrossRef][Medline].
|
| 33.
|
Mendelsohn, C.,
M. Mark,
P. Dolle,
A. Dierich,
M. P. Gaub,
A. Krust,
C. Lampron, and P. Chambon.
1994.
Retinoic acid receptor beta 2 (RAR beta 2) null mutant mice appear normal.
Dev. Biol.
166:246-258[CrossRef][Medline].
|
| 34.
|
Meyer, B. I., and P. Gruss.
1993.
Mouse Cdx-1 expression during gastrulation.
Development
117:191-203[Abstract/Free Full Text].
|
| 35.
|
Morrison, A.,
M. C. Moroni,
L. Ariza-McNaughton,
R. Krumlauf, and F. Mavilio.
1996.
In vitro and transgenic analysis of a human HOXD4 retinoid-responsive enhancer.
Development
122:1895-1907[Abstract].
|
| 36.
|
Noden, D. M.
1983.
The role of the neural crest in patterning of avian cranial skeletal, connective, and muscle tissues.
Dev. Biol.
96:144-165[CrossRef][Medline].
|
| 37.
|
Nordeen, S. K.
1988.
Luciferase reporter gene vectors for analysis of promoters and enhancers.
BioTechniques
6:454-458[Medline].
|
| 38.
|
Packer, A. I.,
D. A. Crotty,
V. A. Elwell, and D. J. Wolgemuth.
1998.
Expression of the murine Hoxa-4 gene requires both autoregulation and a conserved retinoic acid response element.
Development
125:1991-1998[Abstract].
|
| 39.
|
Pöpperl, H., and M. S. Featherstone.
1993.
Identification of a retinoic acid response element upstream of the murine Hox-4.2 gene.
Mol. Cell. Biol.
13:257-265[Abstract/Free Full Text].
|
| 40.
|
Pownall, M. E.,
A. S. Tucker,
J. M. Slack, and H. V. Isaacs.
1996.
eFGF, Xcad3 and Hox genes form a molecular pathway that establishes the anteroposterior axis in Xenopus.
Development
122:3881-3892[Abstract].
|
| 41.
|
Rossant, J.,
R. Zirngibl,
D. Cado,
M. Shago, and V. Giguere.
1991.
Expression of a retinoic acid response element-hsplacz transgene defines specific domains of transcriptional activity during mouse embryogenesis.
Genes Dev.
5:1333-1344[Abstract/Free Full Text].
|
| 42.
|
Sasai, Y., and E. M. De Robertis.
1997.
Ectodermal patterning in vertebrate embryos.
Dev. Biol.
182:5-20[CrossRef][Medline].
|
| 43.
|
Sporn, M. B.,
A. B. Roberts, and D. S. Goodman (ed.).
1994.
The retinoids.
Raven Press, New York, N.Y.
|
| 44.
|
Studer, M.,
A. Gavalas,
H. Marshall,
L. Ariza-McNaughton,
F. M. Rijli,
P. Chambon, and R. Krumlauf.
1998.
Genetic interactions between hoxa1 and hoxb1 reveal new roles in regulation of early hindbrain patterning.
Development
125:1025-1036[Abstract].
|
| 45.
|
Studer, M.,
H. Popperl,
H. Marshall,
A. Kuroiwa, and R. Krumlauf.
1994.
Role of a conserved retinoic acid response element in rhombomere restriction of hoxb-1.
Science
265:1728-1732[Abstract/Free Full Text].
|
| 46.
|
Subramanian, V.,
B. I. Meyer, and P. Gruss.
1995.
Disruption of the murine homeobox gene cdx1 affects axial skeletal identities by altering the mesodermal expression domains of hox genes.
Cell
83:641-653[CrossRef][Medline].
|
| 47.
|
Sucov, H. M., and R. M. Evans.
1995.
Retinoic acid and retinoic acid receptors in development.
Mol. Neurobiol.
10:169-184[Medline].
|
| 48.
|
Taneja, R.,
P. Bouillet,
J. F. Boylan,
M. P. Gaub,
B. Roy,
L. J. Gudas, and P. Chambon.
1995.
Reexpression of retinoic acid receptor (RAR) gamma or overexpression of RAR alpha or RAR beta in RAR gamma-null F9 cells reveals a partial functional redundancy between the three RAR types.
Proc. Natl. Acad. Sci. USA
92:7854-7858[Abstract/Free Full Text].
|
| 49.
|
Umesono, K.,
V. Giguere,
C. K. Glass,
M. G. Rosenfeld, and R. M. Evans.
1988.
Retinoic acid and thyroid hormone induce gene expression through a common responsive element.
Nature
336:262-265[CrossRef][Medline].
|
| 50.
|
Wilkinson, D. G. (ed.).
1992.
In situ hybridization. A practical approach.
IRL Press, New York, N.Y.
|
Molecular and Cellular Biology, September 2000, p. 6579-6586, Vol. 20, No. 17
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gaunt, S. J., Drage, D., Trubshaw, R. C.
(2008). Increased Cdx protein dose effects upon axial patterning in transgenic lines of mice. Development
135: 2511-2520
[Abstract]
[Full Text]
-
Chang, C.-L., Lao-Sirieix, P., Save, V., De La Cueva Mendez, G., Laskey, R., Fitzgerald, R. C
(2007). Retinoic acid-induced glandular differentiation of the oesophagus. Gut
56: 906-917
[Abstract]
[Full Text]
-
Pilon, N., Oh, K., Sylvestre, J.-R., Savory, J. G. A., Lohnes, D.
(2007). Wnt signaling is a key mediator of Cdx1 expression in vivo. Development
134: 2315-2323
[Abstract]
[Full Text]
-
Volle, D. H., Duggavathi, R., Magnier, B. C., Houten, S. M., Cummins, C. L., Lobaccaro, J.-M. A., Verhoeven, G., Schoonjans, K., Auwerx, J.
(2007). The small heterodimer partner is a gonadal gatekeeper of sexual maturation in male mice. Genes Dev.
21: 303-315
[Abstract]
[Full Text]
-
Kobrossy, L., Rastegar, M., Featherstone, M.
(2006). Interplay between Chromatin and Trans-acting Factors Regulating the Hoxd4 Promoter during Neural Differentiation. J. Biol. Chem.
281: 25926-25939
[Abstract]
[Full Text]
-
Beland, M., Lohnes, D.
(2005). Chicken Ovalbumin Upstream Promoter-Transcription Factor Members Repress Retinoic Acid-induced Cdx1 Expression. J. Biol. Chem.
280: 13858-13862
[Abstract]
[Full Text]
-
Beland, M., Pilon, N., Houle, M., Oh, K., Sylvestre, J.-R., Prinos, P., Lohnes, D.
(2004). Cdx1 Autoregulation Is Governed by a Novel Cdx1-LEF1 Transcription Complex. Mol. Cell. Biol.
24: 5028-5038
[Abstract]
[Full Text]
-
Shiotsugu, J., Katsuyama, Y., Arima, K., Baxter, A., Koide, T., Song, J., Chandraratna, R. A. S., Blumberg, B.
(2004). Multiple points of interaction between retinoic acid and FGF signaling during embryonic axis formation. Development
131: 2653-2667
[Abstract]
[Full Text]
-
Rankin, E. B., Xu, W., Silberg, D. G., Suh, E.
(2004). Putative intestine-specific enhancers located in 5' sequence of the CDX1 gene regulate CDX1 expression in the intestine. Am. J. Physiol. Gastrointest. Liver Physiol.
286: G872-G880
[Abstract]
[Full Text]
-
Houle, M., Sylvestre, J.-R., Lohnes, D.
(2003). Retinoic acid regulates a subset of Cdx1 function in vivo. Development
130: 6555-6567
[Abstract]
[Full Text]
-
Bel-Vialar, S., Itasaki, N., Krumlauf, R.
(2003). Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development
129: 5103-5115
[Abstract]
[Full Text]
-
Escriva, H., Holland, N. D., Gronemeyer, H., Laudet, V., Holland, L. Z.
(2003). The retinoic acid signaling pathway regulates anterior/posterior patterning in the nerve cord and pharynx of amphioxus, a chordate lacking neural crest. Development
129: 2905-2916
[Abstract]
[Full Text]
-
Zhang, L., E, X., Luker, K. E., Shao, J.-S., Levin, M. S., Suh, E., Li, E.
(2002). Analysis of human cellular retinol-binding protein II promoter during enterocyte differentiation. Am. J. Physiol. Gastrointest. Liver Physiol.
282: G1079-G1087
[Abstract]
[Full Text]
-
Plateroti, M., Gauthier, K., Domon-Dell, C., Freund, J.-N., Samarut, J., Chassande, O.
(2001). Functional Interference between Thyroid Hormone Receptor {alpha} (TR{alpha}) and Natural Truncated TR{Delta}{alpha} Isoforms in the Control of Intestine Development. Mol. Cell. Biol.
21: 4761-4772
[Abstract]
[Full Text]