INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Retinoids such as retinoic acid (RA) play key roles in vertebrate development (43). The retinoid signal is transduced by two families of nuclear receptors: the RA receptors (RARs) and their isoforms (RAR1 and -2; RAR1, -2, -3, and -4; and RAR1 and -2) and the retinoid x receptors (RXR, -, and -). These receptors mediate ligand-dependent target gene transcription typically by binding as heterodimers to cis-acting RA response elements (RAREs) (6, 14, 29, 47).

Vertebral specification is believed to be governed by a Hox "code." This model is supported by a multitude of studies which demonstrate that anterior or posterior shifts in Hox expression or the ablation of specific Hox genes often leads to alterations in somite identity, as inferred by vertebral homeosis (10, 13, 31). Transplantation experiments suggest that vertebral specification, and hence Hox expression boundaries, is established in the unsegmented paraxial mesoderm at or shortly following gastrulation (36).

Both RAR knockout studies and studies on the effects of excess RA demonstrate roles for retinoids in vertebral morphogenesis (10, 31). RAR null mice display axial malformations, including vertebral homeotic transformations (25). Although disruption of either RAR or RAR2 does not affect skeletal development (27, 33), both receptors collaborate with RAR in vertebral development, as judged by the marked increase in frequency and severity of axial skeletal defects in the corresponding double null mutants (26). A role for Hox genes in this program is suggested by the finding of altered expression of some Hox members following RA treatment in vivo. Moreover, certain Hox mutants are phenocopies of the axial transformations observed in RAR mutants (25, 26). However, despite these correlations, few RA-responsive Hox genes have been shown to be direct RAR targets (11, 24, 35, 38, 39, 45).

Several lines of evidence suggest that vertebrate caudal homologues are key regulators of Hox expression. The murine caudal homologues cdx1, cdx2, and cdx4, are expressed in overlapping domains in the primitive streak region, with expression maintained in the posterior embryo through embryonic day 12.5 (E12.5) (5, 12, 34). These expression patterns suggest that a gradient of cdx function exists in the posterior embryo, which may reflect a means of regulating expression of different cohorts of Hox genes during somite specification (30). Consistent with this, cdx1 null mutants as well as cdx2 heterozygotes exhibit vertebral homeotic transformations (8, 46), which, in the former case, correlate with altered expression of certain Hox genes. The finding of consensus Cdx response elements in the promoter regions of several Hox loci (5, 46) further supports a role for Cdx members in direct regulation of Hox expression. Similar observations in Xenopus and Caenorhabditis elegans suggest that this pathway may be conserved (17, 20).

As most RA-responsive Hox genes are not known to be direct RAR targets, we hypothesized that a cdx member(s) may function as an intermediate. In support of this, we present evidence that cdx1 responds to RA and RAR ablation in vivo in a manner consistent with it being a direct retinoid target. These results suggest an indirect pathway by which RA regulates Hox expression via direct control of cdx1.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Animals. The RAR, RAR1, and RAR1/ null mice used in the present study have been described previously (26, 27). RAR heterozygous and null embryos were generated from RAR^+/ intercrosses, whereas RAR1 and RAR1/ null embryos were derived from RAR1^/+/ intercrosses. Wild-type embryos were obtained either from RAR^+/ matings, from intercrosses of wild-type stock from the RAR colony (C57BL/6-129Sv hybrid), or from CD-1 intercrosses. No overt differences in gene expression or RA response were noted between any of these backgrounds. Females were dosed by oral gavage with all-trans RA dissolved in corn oil to a final delivery of 10 or 100 mg/kg of body weight at E7.5, E8.5, or E9.5 (noon of the day of plug appearance was considered E0.5). Animals were sacrificed 1 to 8 h posttreatment, and embryos were dissected in phosphate-buffered saline (PBS), fixed overnight in 4% paraformaldehyde, dehydrated through a methanol series, and stored at 20°C in 100% methanol. Yolk sacs were used to establish genotype by PCR as described previously (19). In some experiments, embryos were treated as described above and the presomitic caudal embryonic region was dissected out, snap frozen, and stored at 80°C prior to RNA isolation.

In situ hybridization analysis and embryo culture. Embryos were pooled by stage, genotype, and RA treatment and rehydrated. Whole-mount in situ hybridization was performed as described previously (50), using a riboprobe generated from the cdx1 cDNA (34). After hybridization, embryos were cleared and photographed. Some specimens were then postfixed in 4% paraformaldehyde-0.2% glutaraldehyde at 4°C for 30 min, rinsed in several changes of PBS, embedded in Paraplast (Fisher), and sectioned.

9

7

Cell culture and transfection analysis. F9 embryocarcinoma cells were maintained in DMEM (Life Technologies) supplemented with glucose (4.5 g/liter), 10% fetal bovine serum, and gentamicin (10 µg/ml). For routine culture, cells were passaged every third day into gelatinized 100-mm tissue culture plates and cultured at 37°C in 5% CO₂. For Northern blot experiments, cells were seeded in 100-mm plates (approximately 10⁶ cells/plate) and treated the following day with all-trans RA (1 µM) dissolved in DMSO (final concentration, 0.1%). Control cultures were treated with DMSO only. For Northern blot analysis, cells were harvested 2 to 48 h posttreatment, snap frozen, and stored at 80°C prior to RNA extraction.

Northern blotting and representative cDNA analysis. Total RNA was extracted from frozen embryos or cell pellets by using Trizol (Life Technologies) according to the manufacturer's directions. Fifteen micrograms of total RNA was resolved by electrophoresis through a formaldehyde gel and subjected to Northern blotting using Hybond N (Amersham) as described by the manufacturer. To quantify differences in embryonic gene expression, caudal tissue (posterior to the closed neural tube) was used for the generation of representative cDNA by PCR as previously described (18), followed by analysis by Southern blotting. Hybridizations were performed overnight at 42°C in a formamide-based buffer (40% formamide, 0.9 M sodium chloride, 50 mM sodium phosphate, 2 mM EDTA, 4× Denhardt's solution, 0.1% sodium dodecyl sulfate [SDS]) supplemented with 0.1 mg of denatured salmon sperm DNA/ml; denatured probe (approximately 10⁶ cpm/ml) prepared by random priming was used. Blots were washed in 2× SSC-0.1% SDS (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) three times at 65°C, followed by three washes in 0.2× SSC-0.1% SDS at the same temperature, and signal was revealed by autoradiography using X-Omat film (Kodak). For representative cDNA analysis, following autoradiography, densitometry was performed using Alpha Imager IS-1000 software (Alpha Innotech Corporation, San Leandro, Calif.). Values were normalized with respect to -actin and expressed as fold change relative to untreated controls.

EMSA. The region of the cdx1 promoter region conferring RA response, as defined by transfection analysis, was scanned by initially using fragments amplified by PCR. Each fragment was purified, end labeled with T4 polynucleotide kinase, and tested for RAR and RXR binding by electrophoretic mobility shift assay (EMSA). The putative RARE identified by this approach was evaluated for binding by EMSA with a double-stranded end-labeled oligonucleotide harboring either the sequence 5'-AAGGGTCGTGACCCT or the mutated sequence 5'-AAGGGCAAGTTCCCT (altered nucleotides are underlined). The end-labeled double-stranded oligonucleotide 5'-GGGTAGGGTTCACCGAAAGTTCACTCGCA, harboring a consensus RARE (DR5), was used as a positive control in all binding assays. Nuclear extracts from Cos cells which had been either mock transfected or transfected with expression vectors encoding RAR and RXR were used as a source of protein. Binding reaction mixtures containing approximately 2 ng of probe (50,000 cpm) and 2 µl of nuclear extract (3 µg of protein) were equilibrated for 30 min at room temperature and separated by electrophoresis through a 5% polyacrylamide gel containing 0.25× Tris-borate-EDTA. For antibody supershifts, 0.5 µl of anti-RAR antibody (Santa Cruz) was added to protein extracts and equilibrated on ice for 30 min prior to addition of probe and further incubation as described above. Specificity of binding was assessed by competition with a 100-fold excess of unlabeled RARE nucleotides (sequences noted above) or with nucleotides harboring an SP-1 binding motif (5'-TCGATCGGGGCGGGGCGA). In other EMSA experiments, electrophoresis was initiated at various times after probe addition or with various amounts of transfected Cos cell extracts.

Isolation of genomic sequences and derivation of plasmids. Sequences were isolated from a murine phage genomic library. A BamHI-NotI fragment containing the endogenous transcription initiation site (16) and extending approximately 2 kb 5' was ligated into the promoterless luciferase expression vector pXP2 (37), and subsequent deletion constructs were prepared by using convenient restriction sites. A reporter bearing the putative cdx1 RARE was obtained by ligating either the double-stranded oligonucleotide 5'-AAGGGTCGTGACCCCT, harboring the wild-type sequences, or the mutated sequence 5'-AAGGGCAAGTTCCCCT into pTK109-Luc. A positive RA-responsive control, RARE-Luc, was derived by ligating the double-stranded oligonucleotide GGGTAGGGTTCACCGAAAGTTCACTCGCA, bearing the RAR2 consensus RARE, into pTK109-Luc. Site-directed mutagenesis was performed using a Transformer kit (Clontech). All constructs were confirmed by sequencing.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

RA induces cdx1 in vivo. In untreated wild-type embryos at E8.5, cdx1 transcripts were abundant in the ectoderm and mesoderm in the primitive streak region, with weaker expression in caudal neuroepithelium, in agreement with previous studies (Fig. 1A) (34). Eight hours following gavage with RA (100 mg/kg), expression was markedly increased (Fig. 1B) in all germ layers of the caudal embryo (Fig. 1D, compare to the control in 1C), with induction detectable as early as 1 h posttreatment (data not shown). Note that in this and other experiments, embryos to be compared were processed in parallel using the same probe to control for variables in signal intensity. Note also that experiments were terminated when strong staining was observed in any of the pooled samples. Therefore, untreated embryos were sometimes understained to clearly demonstrate the effect of RA.

View larger version (46K): [in this window] [in a new window]   FIG. 1.   Induction of cdx1 by RA in vivo. (A and B) cdx1 expression in E8.5 embryos treated with a vehicle (A) or 8 h following gavage with 100 mg of RA/kg (B). (C and D) Sagittal sections of embryos shown in panels A and B, respectively. Note the marked induction in signal throughout the caudal embryo. (E, F, and G) Semiquantitative analysis of cdx1 expression. Representative cDNA Southern blots were generated from E8.5 caudal tissue, as described in Materials and Methods, and hybridized to either cdx1 (E) or -actin gene (F) probes. Compare basal expression (panel E, lanes 2 through 4) to expression following an RA treatment (lanes 6 through 8). -Actin gene expression from the same material (F) was not affected. Densitometry from the blots shown in panels E and F was performed, and cdx1 expression levels were normalized to -actin gene expression levels. Results (G) are expressed relative to those for untreated controls and indicate a ninefold induction. Due to saturation of the X-ray film in the lanes from the treated samples, this is likely an underrepresentation of regulation. (H to J) Ex vivo response of cdx1 to RA. E8.5 embryos were excised and cultured for 4 h in the presence of a vehicle (H), 109 M RA (I), or 107 M RA (J), following which cdx1 expression was assessed by whole-mount in situ hybridization. Bar, 500 µm (A, B, H, I, and J) and 250 µm (C and D).

9

7

RA induces cdx1 expression at several developmental stages. In the mouse, exogenous RA can induce vertebral homeosis from E7.5 to E9.5 in a manner that is coincident with altered Hox expression (22). We therefore determined if cdx1 responded to RA throughout this window. In untreated embryos at E7.5, cdx1 expression was observed in the ectoderm and mesoderm of the primitive streak region (Fig. 2A) as described previously (34), whereas RA elicited a strong induction of expression in the entire streak region at this stage (Fig. 2B). Interestingly, treatment appeared to induce cdx1 precociously in embryos where expression either had not yet commenced or was only weakly detected (Fig. 2E, compare with F). At E9.5, cdx1 transcripts in the caudal embryo were present at low levels (Fig. 2I). At this stage, hybridization was also observed in the forelimb bud mesenchyme, with weaker expression sometimes observed in the presumptive dermamyotome (Fig. 2I) (34). Four hours following treatment at E9.5, message was markedly induced in all of these domains, with a stronger signal consistently observed in the dermamyotome (Fig. 2J).

View larger version (57K): [in this window] [in a new window]   FIG. 2.   cdx1 expression in wild-type and RAR1/ mutant embryos. Shown are results for whole-mount analysis of cdx1 expression in E7.5 wild-type embryos without (A and E) or 4 h following (B and F) RA treatment. Note induction throughout the primitive streak region in the treated samples. (C and D) Expression in untreated (C) and RA-treated (D) E7.5 RAR1/ mutant embryos. Note the reduced expression in the untreated mutant relative to the wild type (C versus A) and the decreased effects of RA on expression in the mutant background relative to controls (compare mutants in panels C and D to wild types in panels A and B). (I and J) cdx1 expression in wild-type embryos at E9.5 without (I) and following (J) RA treatment. In untreated embryos, weak expression of cdx1 was observed in the tail bud, with transcripts also evident in the forelimb bud and dermamyotome (asterisk and arrowhead, respectively, in panel I); RA strongly induced expression in all of these domains (J, compare to panel I). In RAR1/ null embryos at E8.5 (G and H) and E9.5 (K and L), RA induction was reduced relative to that seen in the wild-type samples (compare effects of treatment in mutants in panels G and H and panels K and L to the effect on wild-type controls in Fig. 1A and B and Fig. 2I and J, respectively). Bars, 50 µm (A through F), 100 µm (G and H), and 75 µm (I through L).

cdx1 expression is altered in RAR null mutants. cdx1 expression was not overtly different in wild-type controls and RAR1 or RAR single mutants at E7.5 to E9.5 (data not shown). In contrast, E7.5 RAR1/ double mutants always exhibited reduced cdx1 expression in the primitive streak region (Fig. 2C, compare with A). In marked contrast, transcript levels in the primitive streak region of these mutants at E8.5 were often comparable to levels in wild-type embryos (Fig. 2G, compare with 1A; also data not shown). At E9.5, expression in the tail bud was either comparable or too weak to compare between RAR1/ mutants and controls. Similar variability was also seen with regard to expression in the limb buds and dermamyotome of these mutants, with expression sometimes weaker in the mutants than in stage-matched wild-type controls (Fig. 2K, compare with I). However, differences in expression were not consistently observed between RAR1/ mutants and controls at E9.5. Similar variability in signal intensity was often seen in control E9.5 samples, suggesting highly variable and dynamic expression of cdx1 at this stage. Such variance precluded an accurate determination of the effects of RAR loss on cdx1 levels in these embryos.

cdx1 is a direct RA target. To further investigate the effects of RA on cdx1 expression, we employed F9 embryocarcinoma cells. In these cultures, RA up-regulated cdx1 transcript levels as early as 2 h after treatment, with a maximum level attained after 24 to 48 h (Fig. 3A). In both F9 cells (Fig. 3B) and embryo cultures (Fig. 3C through F), this response was independent of de novo protein synthesis, as induction was evident in the absence or presence of cycloheximide (cycloheximide treatment resulted in 95% inhibition of de novo protein synthesis in either system). Notably, in embryo cultures, cdx1 message was increased by cycloheximide treatment alone (Fig. 3E, compare to C), whereas a further increase in message abundance was seen upon subsequent treatment with RA (Fig. 3F). This superinduction effect suggests both an increase in transcription and a stabilization of message, a common phenomenon for immediate-early target genes.

View larger version (52K): [in this window] [in a new window]   FIG. 3.   cdx1 induction is independent of de novo protein synthesis. (A) cdx1 expression in F9 cells treated with RA (lanes 2, 4, 6, 8, and 10) or DMSO (lanes 3, 5, 7, 9, and 11) for the indicated times. (B) Northern blot of RNA from F9 cells treated for 4 h with RA (lanes 2, 4, and 6) or DMSO (lanes 1, 3, and 5) with the indicated amounts of cycloheximide. Both blots were reprobed for -actin as a loading control. (C and D) cdx1 expression in cultured embryos. Embryos were cultured for 4 h in the presence of a vehicle (C), 20 µg of cycloheximide (CHX)/ml (E), or 106 M RA (D) or RA plus cycloheximide (F) prior to in situ hybridization. Results shown are typical of several experiments. Bar, 400 µm (C to F).

9

View larger version (61K): [in this window] [in a new window]   FIG. 4.   Identification of an RARE in the cdx1 promoter. (A) F9 cells were transfected with the indicated reporter constructs, and luciferase activity was determined 24 h following treatment with 106 M RA. Results are expressed as fold induction by RA relative to that in untreated cultures. Bm, BamHI; Bs, BstXI; P, PstI; X, XmnI. Numbering to the left indicates the 5'-most position relative to the transcriptional start site. DR5 is the positive control reporter construct. (B) The cdx1 RARE motif was tested for receptor binding by EMSA using the radiolabeled oligonucleotide probes indicated at the bottom. Lane 1, no extract; lanes 2 and 9, mock-transfected cells; lanes 3 through 8 and 10 through 15, cdx1 RARE and DR5 probe, respectively, incubated with extracts from cells transfected with RAR plus RXR. Specific binding complexes ("Specific") were not affected by nonspecific competitor (lanes 8 and 15) or by mutated cdx1 RARE (lanes 6 and 14) but were competed by excess DR5 (lanes 7 and 12) or Cdx1 RARE (lanes 5 and 13). "Super Shift" indicates complexes formed by incubation with anti-RAR (lanes 4 and 11). (C) Transfection analysis, as in panel A, indicates that point mutation of the RARE sequences (*) in the context of the 2-kb parental cdx1 promoter results in complete loss of RA induction in F9 cells. A single copy of the cdx1 RARE motif confers an RA response with a heterologous promoter, and this effect is lost upon mutation of these sequences (Cdx1 RARE*). (D and E) Stability of the receptor association with cdx1 RARE compared to the canonical DR5 RARE motif. (D) Comparable amounts of the probes were incubated with different amounts of extracts from receptor-transfected Cos cells for 30 min before electrophoresis. The protein (Prot.) amounts used were 3.00, 1.00, 0.30, 0.10, 0.03, 0.01, and 0.00 µg/incubation. (E) cdx1 RARE and DR5 probes were incubated with 3 µg of Cos extract for the indicated amount of time, and binding complexes were resolved by electrophoresis.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Many Hox genes respond to RA both in tissue culture and in vivo, and this relationship is believed to be a principal means by which retinoids act in vertebral specification (10). Although a number of Hox genes have been shown to be direct RA targets, the mechanism(s) by which RA affects expression of most of the responsive Hox genes is largely unknown. Our present findings demonstrate that cdx1 is a direct RA target, which, together with the established relationship between Cdx and Hox gene expression, strongly suggests a novel pathway for retinoids in axial specification.

Contribution of RA to cdx1 expression. Findings from several models illustrate a role for caudal family members in anterior-posterior patterning. cdx1 null mutants exhibit anterior vertebral homeosis which is coincident with posterior shifts in the expression boundaries of certain Hox genes; similar vertebral defects are also observed in cdx2 heterozygotes (8, 46). In Xenopus, gain or loss of the function of Xcad (the frog homologue of cdx4) results in patterning defects which correlate with altered Hox gene expression along the anterior-posterior axis (17). Taken together with the presence of potential Cdx response elements in a number of Hox promoters (7, 46), these data support a role for Cdx members in the direct control of Hox expression.

RAR-specific regulation of cdx1. Studies with F9 cells suggest a key role for RAR in induction of cdx1 (48), an observation that contrasts with our findings in vivo. However, cdx1 induction in F9 cells is only maximal after 24 to 48 h of treatment, in marked contrast to induction in vivo, which is evident 1 h posttreatment. This difference may be due, in part, to the fact that RAR null F9 cells are refractory to RA-induced differentiation, suggesting that additional RAR-dependent events impact cdx1 transcription. Interestingly, another RA target gene, CYP26, exhibits similar differences between regulation in vivo and in F9 cells (1, 18). Although the basis for these discrepancies is speculative, these findings may be indicative of common cell-type-specific regulatory mechanisms which govern control of expression of these, and perhaps additional, RA target genes.

RA, Hox expression, and somite specification. RA has been suggested to be a "posteriorizor" in the activation-transformation model of neurulation (reviewed in reference 42). RA can impart more posterior molecular characteristics on the anterior neuroepithelium, and interference with RAR signaling in Xenopus, or vitamin A deficiency in quail, results in hindbrain patterning defects, presumably due to effects on target genes such as Hoxa-1 and Hoxb-1 (11, 23, 28, 32, 44, 45). However, to date, a somite-specific RARE which is essential for expression of a Hox member with definitive function in paraxial mesoderm has not been described. As defects in cdx1 null mice appear to be related only to somitic Hox misexpression, it is tempting to speculate that RA-dependent vertebral specification may manifest largely through cdx1. In contrast, the nonhomeotic axial patterning defects observed in RAR1/ double mutant offspring, which are not exhibited by cdx1 mutants, clearly underscore the existence of other retinoid target genes involved in vertebral morphogenesis. The nature of these genes is unknown.

cdx1 and retinoid-induced teratogenesis. Excess RA has profound effects on vertebrate development and is capable of eliciting, among other malformations, neural tube and limb defects, axial truncation, and homeotic transformation, depending on both the dose and the embryonic stage upon exposure. As overexpression of cdx members can lead to neural tube defects in mouse embryos as well as caudal malformations of Xenopus tadpoles (7, 17), excess RA could conceivably exert some of its teratogenic effects through misexpression of cdx1. In this regard, RAR is essential for retinoid-induced axial truncation (25). The finding that cdx1 induction in RAR mutants was only modestly compromised suggests that it is not involved in eliciting this malformation. However, in Xenopus, relatively small changes in Xcad3 gene dosage result in dramatic differences in phenotypic outcome (17). Thus, we cannot exclude the possibility that the relatively small difference in cdx1 induction in RAR mutants is significant.