Next Article 
Molecular and Cellular Biology, September 2000, p. 6627-6637, Vol. 20, No. 18
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Involvement of Retinoblastoma Protein and HBP1
in Histone H10 Gene Expression
Claudie
Lemercier,
Kym
Duncliffe,
Isabelle
Boibessot,
Hui
Zhang,
André
Verdel,
Dimitar
Angelov,
and
Saadi
Khochbin*
Laboratoire de Biologie Moléculaire et
Cellulaire de la Différentiation
INSERM U309, Equipe,
Chromatine et Expression des Gènes, Institut Albert Bonniot,
Faculté de Médecine, Domaine de la Merci, 38706 La
Tronche Cedex, France
Received 28 March 2000/Returned for modification 17 May
2000/Accepted 8 June 2000
 |
ABSTRACT |
The histone H10-encoding gene is expressed in
vertebrates in differentiating cells during the arrest of
proliferation. In the H10 promoter, a specific regulatory
element, which we named the H4 box, exhibits features which implicate a
role in mediating H10 gene expression in response to both
differentiation and cell cycle control signals. For instance, within
the linker histone gene family, the H4 box is found only in the
promoters of differentiation-associated subtypes, suggesting that it is
specifically involved in differentiation-dependent expression of these
genes. In addition, an element nearly identical to the H4 box is
conserved in the promoters of histone H4-encoding genes and is known to
be involved in their cell cycle-dependent expression. The transcription
factors interacting with the H10 H4 box were therefore
expected to link differentiation-dependent expression of
H10 to the cell cycle control machinery. The aim of this
work was to identify such transcription factors and to obtain
information concerning the regulatory pathway involved. Interestingly,
our cloning strategy led to the isolation of a retinoblastoma protein (RB) partner known as HBP1. HBP1, a high-mobility group box
transcription factor, interacted specifically with the H10
H4 box and moreover was expressed in a differentiation-dependent manner. We also showed that the HBP1-encoding gene is able to produce
different forms of HBP1. Finally, we demonstrated that both HBP1 and RB
were involved in the activation of H10 gene expression. We
therefore propose that HBP1 mediates a link between the cell cycle
control machinery and cell differentiation signals. Through modulating
the expression of specific chromatin-associated proteins such as
histone H10, HBP1 plays a vital role in chromatin
remodeling events during the arrest of cell proliferation in
differentiating cells.
 |
INTRODUCTION |
During embryonic development and
cell differentiation, specific transitions in gene expression are
associated with chromatin remodeling (39, 58). One important
aspect of these remodeling events is the synthesis of specific core and
linker histones (11, 30, 25, 33, 40, 51). For instance, in
many organisms embryonic- and adult-type histone H1s characterize the
chromatin of proliferating and differentiated cells, respectively
(23). In vertebrates, the histone H10 gene
encodes a linker histone variant which is expressed in terminally differentiated cells concomitant with the arrest of cell proliferation (23, 61). The specific role of this linker histone is not clearly established, but the timing and pattern of its expression during early embryogenesis strongly suggest a role for the protein in
the organization of chromatin in arrested and differentiated cells
(61). It is therefore of great interest to discover the regulatory cascade that induces the expression of this gene in differentiated cells. We believe that molecules involved in this cascade interact with different regulatory pathways, leading to a
general control of chromatin remodeling during cell differentiation. Indeed, through the control of a specific group of genes encoding chromatin-associated proteins (such as H10), these
molecules may regulate chromatin structure and function. Transcription
factors interacting with the H10 promoter are presumably
part of this regulatory cascade and are believed to link cell cycle
control machinery to chromatin remodeling. The discovery of these
transcription factors would therefore be useful for gaining an
understanding of the interaction between these two important biological processes.
The first step in this work was a detailed study of all the
cis-acting regulatory elements involved in the control of
H10 gene expression and to define those that were sensitive
to differentiation signals. Previously, we and others defined major
cis-acting regulatory elements involved in the expression of
the histone H10 gene (4, 7, 21). Besides the
TATA box, essentially three major cis-acting regulatory
elements contribute to maximal H10 promoter activity
(21, 22). Two of these elements, the upstream conserved
element (UCE) and the so-called H1 box, are located 435 and 100 bp,
respectively, upstream of the initiation site, (4, 21). Both
elements reside at the same relative position in all vertebrate
replication-dependent H1 genes (15). The third element,
located almost immediately upstream of the TATA box, is intriguing
because of its similarity to H4 site II, a highly conserved promoter
element located at the same position of almost all vertebrate histone
H4-encoding genes (23). H4 site II is involved in the cell
cycle-dependent control of the H4 promoter (24, 43). These
two elements share extensive sequence homology and reside at
corresponding positions in their respective promoters (23).
For this reason, we named this third element the H4 box (22). Among the linker histone genes, the H4 box is a unique feature of the differentiation-dependent H10 and H5 genes
(23, 41). Almost all of the replication-dependent histone
H1-encoding genes have a CAAT box at this position (41). The
unusual characteristics of the H10 H4 box make this a
potential response element to both cell cycle control machinery and
differentiation signals. We used a yeast one-hybrid screen strategy to
isolate H10 H4-box-interacting factors. Interestingly, this
approach allowed us to identify the high-mobility-group (HMG) box
protein HBP1 as an H4-box-binding transcription factor. HBP1 is a
partner of the retinoblastoma protein (RB), and we showed that both RB
and HBP1 control H10 gene expression. These findings
confirmed the function of RB in the control of cell differentiation
and, most importantly, established a link between cell cycle control
machinery and chromatin remodeling during differentiation.
 |
MATERIALS AND METHODS |
Cell culture conditions.
Murine erythroleukemia (MEL) cells
from clone G9, a subclone of F4NW0, were maintained in minimum
essential medium (MEM; Gibco) containing 10% (vol/vol) fetal calf
serum. Murine B16 melanoma cells were grown in Dulbecco's DMEM
supplemented with 5% fetal calf serum and 2 mM
L-glutamine. The Clone 6 (Cl6) cell line, a rat embryonic
fibroblast line transformed by ras (34), was maintained in RPMI 1640 (Boehringer) supplemented with 5% fetal calf
serum and 4 mM L-glutamine, grown normally at 37°C, or
shifted to 32°C to induce cell growth arrest. SAOS-2 cells, an
RB-deficient osteosarcoma cell line which is stably transfected with a
tetracycline-inhibitable RB expression vector, were cultured in
DMEM-10% fetal calf serum supplemented with tetracycline (1 µg/ml),
puromycin (1 µg/ml), and G418 (400 µg/ml).
Northern blot analysis. (i) Cells in culture.
Total RNA was
purified from MEL, B16, and SAOS-2 cells using Tri-reagent (Sigma)
according to the manufacturer's recommendations.
(ii) Rat partial hepatectomy and RNA preparation.
Male
Wistar rats were hepatectomized, and RNA was purified from control
liver or from liver at different times after the surgery exactly
as described by Khochbin et al. (20).
(iii) Adult mouse and human tissues.
Mouse and human
multiple-tissue Northern blots were obtained from Clontech and analyzed
using different probes as indicated.
One-hybrid screen.
Saccharomyces cerevisiae HIS3-lacZ
double-reporter strains were created with the aid of the MATCHMAKER
one-hybrid system (Clontech), using procedures essentially as described
in the supplied protocol (PT1031-1). Oligonucleotides containing three
tandem copies of the human H10 H4 box were cloned upstream
of the reporter genes, which were then stably integrated into the
genome of yeast strain YM4271. The sequence of this
oligonucleotide is
AATTCCTGTCCTCACCGCGGTCCGCTGTCCTCACCGCGGTCCGCTGTCCTCACCGCGGTCCGCCC. The H4 box strain was used to screen a MATCHMAKER GAL4
activation domain (AD)-cDNA fusion library from adult human brain
(HL4004AB; Clontech). Approximately 4.0 × 106
recombinants were screened. On selective media lacking histidine and
containing 30 mM-aminotriazole, (3-AT), we selected two fast-growing His+ clones which also tested positive in the
-galactosidase assay. Plasmid DNA from the positive clones was
amplified in Escherichia coli and retransformed into the H4
box reporter strain, as well as control reporter strains containing
either three tandem copies of the p53-binding site or a minimal strain
which lacked a defined DNA-binding site.
Plasmids and transfection.
Mouse and Xenopus
H10 gene promoters (fragments from
610 to +210 and
860
to +30, respectively), were cloned into a chloramphenicol acetyltransferase (CAT) reporter plasmid (pCAT-Basic; Promega). Site-directed mutagenesis was performed by overlapping PCR
(18). Human and rat HBP1 cDNAs were cloned into pcDNA3.1
expression vector (Invitrogen) and used in transfection assays. The
HMG-box-containing region of HBP1 (amino acids 396 to 513) was cloned
into pGEX-5X-3 (Pharmacia). The full-length HBP1 cDNA was cloned into
the same vector. The recombinant vectors were introduced into E. coli strain BL21, and the fusion proteins were purified using
glutathione-Sepharose 4B beads (Pharmacia) according to the supplier's
instructions. The HBP1 HMG-less construct (HBP1dHMG) was obtained by
PCR amplification of the region encoding amino acids 1 to 427 and
cloning of this fragment into an expression vector. The HBP1d
expression vector produces a protein containing the putative AD of HBP1
(26) fused to the DNA-binding domain and was constructed
as follows. The region encoding amino acids 37 to 120 of HBP1 was PCR
amplified and fused to the HMG-box-containing domain (amino acids 394 to 513). The Mist1 reporter plasmid has been described elsewhere (27). For transfections, Lipofectin reagent (Gibco-BRL) was used; CAT assays were performed according to the protocol published by
Nordeen et al. (37).
Footprinting and gel shift assays.
DNase I footprinting was
performed as follows. 32P (50,000 cpm)-labeled restriction
fragments corresponding to the Xenopus H10
sequence (
120 to +30) from either wild-type, TCA-mutated, or GT-mutated promoters were incubated with increasing amounts of purified
glutathione S-transferase (GST)-HBP1 DNA-binding domain in
DBB buffer (10 mM Tris HCl [pH 7.8], 15 mM HEPES [pH 7.8], 50 mM
NaCl, 5 mM MgCl2, 1 mM dithiothreitol bovine serum albumin [100 µg/ml], 5% glycerol for 30 min on ice. After this incubation period, DNase I was added, and incubation was carried out for an
additional 5 min on ice. The digestion was stopped by the addition of
EDTA and phenol extraction. The products of DNase digestion were then
analyzed on a 6% sequencing gel.
For photofootprinting, an oligonucleotide covering the region of
Xenopus H10 H4 box
(CAGCCGCTAGTCCTCAACTCGGTCCGACCCCA) was end labeled,
annealed, gel purified, and incubated with GST-HBP1 fusion protein as
above. After the incubation period, the samples were UV irradiated in siliconized 0.65-ml Eppendorf tubes with a single pulse from the fourth
harmonic (266 nm) of a Surelite II (Continuum) Nd-YAG laser (maximum
energy, 60 mJ; pulse duration, 5 ns). The diameter of the laser beam
was adjusted to fit that of the sample surface by means of a set of
circular diaphragms. The pulse energy of radiation was measured with a
calibrated pyroelectrical detector (Ophir Optronics Ltd.) using an 8%
deviation beam splitter. The irradiation dose (pulse energy divided by
beam surface) did not exceed 1 kJ/m2 (this dose has been
previously determined as required for a 35-bp DNA single-hit experiment
(48). After irradiation, the samples were treated with 1 M
piperidine for 30 min at 90°C. The piperidine was removed by five
successive evaporations in a Speed-Vac. Finally, the samples were
dissolved in 3 µl of formamide loading buffer and analyzed on a 15%
sequencing gel.
Gel shift assays were performed as follows. 32P-labeled
oligonucleotides (32 bp) representing the wild-type Xenopus
H10 H4 box sequence (see above) or the same sequence
containing a TCA mutation were incubated with bacterially expressed
GST-tagged full-length HBP1 alone or with increasing amounts of
bacterially expressed His-tagged RB in DBB buffer (20 µl) containing
0.5 µg of poly(dI-C) for 30 min on ice. The mixture was loaded onto a 4% polyacrylamide gel containing 5% glycerol and 1× electrophoresis buffer (10 mM HEPES, 10 mM Tris HCl [pH 8], 1 mM EDTA), and
electrophoresis was carried out at 4°C.
[3H]thymidine incorporation.
After different
times of induction, [3H]thymidine was introduced to the
culture medium (10 µCi/25-mm-diameter dish) for a period of 15 min.
Cells were collected, washed in phosphate-buffered saline, and lysed in
a lysis buffer containing 7.6 M guanidine hydrochloride in 0.1 M
potassium acetate (pH 5). Trichloroacetic acid was added to a final
concentration of 10%; after 30 min at 0°C, insoluble material was
washed three times with 5% trichloroacetic acid (0°C) and twice with ethanol.
Nucleotide sequence accession number.
The novel nucleotide
sequence reported here (HBP1a) has been deposited with GenBank under
accession number AF182038.
 |
RESULTS |
The H4 box is a proximal cis-acting element that
specifies differentiation-dependent linker histone-encoding
genes.
Among the three functionally defined
cis-regulatory elements involved in H10 gene
expression, two, the UCE and H1 box, are also present in vertebrate
replication-dependent histone H1-encoding genes (Fig. 1A). The H4 box thus defines a class of
H1 genes that are expressed in differentiated- and growth-arrested
cells, because it is found only in the proximal promoter region of the
differentiation-specific H1 genes, H10 and H5 (23,
41). Indeed, all vertebrate replication-dependent H1 genes
possess a CAAT box at this position (Fig. 1A). In fact, the H4 box
shows high sequence similarity with H4 site II, one of the
cis-acting regulatory elements of histone H4-encoding genes (38). van Wijnen et al. established a consensus sequence for H4 site II after the alignment of vertebrate histone H4 promoter regions (53). Figure 1B shows that the H10 H4
box is almost identical to H4 site II, which is an essential and highly
conserved promoter element involved in the cell cycle-dependent activity of the histone H4 gene promoter (24, 43). All
highly conserved nucleotide motifs in the consensus H4 site II sequence are absolutely conserved in the proximal promoter region of all known
vertebrate H10 genes (Fig. 1B). These observations
strongly suggest that at least in proliferating cells, H4 site II and
the H10 H4 box should be functionally equivalent. To
confirm this hypothesis, we converted the H4 box from the
Xenopus H10 promoter to human H4 site II
(derived from the H4 gene FO108 promoter) and cloned the promoter
upstream of a CAT reporter gene. Transient transfection assays showed
that in proliferating cells, the human H4 site II was fully functional
in the Xenopus H10 gene promoter and could
maintain efficient transcription of this gene (Fig.
2A, H4H4 construct). To show the
specificity of this element, we converted the two highly conserved TCA
and GT motifs (Fig. 1B) to unrelated GTC and AA, respectively. These
mutations almost completely abolished the activity of the
H10 promoter (Fig. 2A, TCAm and GTm
constructs). These experiments showed that in exponentially growing cells, histone H4 site II binding factors can participate to maintain the transcriptional activity of both H10 and H4 genes.
However, in differentiating cells, endogenous histone H4 and histone
H10 genes show different patterns of expression. Histone
H10 gene expression is induced during the early stages of
cell differentiation and expression is maintained in fully arrested,
differentiated cells, while histone H4 expression decreases rapidly.
Figure 2B illustrates this situation. The induced differentiation of
murine melanoma cells (line B16) is accompanied by a rapid exit of
cells from the cell cycle (45). Incorporation of
[3H]thymidine into DNA was measured in order to visualize
this phenomenon. Different times after the induction,
[3H]thymidine was added to the culture medium for 15 min;
then cells were lysed and the rate of thymidine incorporation into
trichloroacetic acid-insoluble material was measured (Fig. 2C). Two
hours after the induced differentiation, the rate of DNA synthesis
started to decrease, reflecting an exit from the cell cycle. This
phenomenon became more and more pronounced as the time of induction
proceeded (Fig. 2C, 4, 6, and 8 h). This event is associated with
an induction of H10 gene activity and a concomitant
dramatic decrease of histone H4 gene expression. As the H4 box is the
only element that specifies differentiation-specific H1 variants, one
can suggest that during cell differentiation, specific
H4-box-interacting factors are activated, leading to induction of the
H10 promoter.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
The H4 box cis-acting regulatory element is a
distinctive feature of differentiation-dependent histone H1 genes. (A)
The schematic representation of the vertebrate histone H1-encoding gene
proximal promoter region illustrates that the nature of regulatory
elements present is relatively conserved. However, upstream of the TATA
box, a CAAT box is found in almost all vertebrate replication-dependent
H1 genes, while an H4 box is found at this position in all known
histone H10 genes. (B) The histone H10 H4 box
is essentially identical to the histone H4 site II regulatory element.
The sequence of the H4 box region of all known H10 gene
promoters was compared with that of the H4 site II consensus
established by van Wijnen et al. (53). Y, C or T; R, A or G;
K, G or T; W, A or T; M, A or C. The shadowed sequences are absolutely
conserved between almost all H4 genes and all H10 genes.
The underlined sequence highlights the repetition of the GTCC motif,
discussed in the text.
|
|

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Histone H4 site II and H10 H4 box are
functionally equivalent in proliferating cells. The H4 box from the
Xenopus histone H10 gene promoter was replaced
by the H4 site II sequence from a human histone H4 promoter (construct
2, H4H4). Conserved TCA and GT motifs in the H10 H4 box
were replaced by GTC and AA, respectively (TCAm and
GTm constructs). Construct 1 is the wild-type
Xenopus histone H10 promoter. One microgram of
each plasmid was used to transfect Cl6 cells; 48 h after
transfection, CAT activity was measured. Plasmid uptake was controlled
by Southern blot analysis of DNA extracted from transfected cells and
hybridization with a 32P-labeled plasmid probe. The
measured CAT activity was then normalized with respect to the plasmid
uptake. Data are presented as percentage of the activity detected from
the wild-type promoter, and bars indicate standard deviations of two
independent experiments. (B) Different transcriptional activities of
histone H4 and H10 genes during cell cycle exit in
differentiating cells. B16 cells were induced to differentiate with 5 mM butyrate, and cells were taken at indicated times. A Northern blot
containing these RNAs was probed successively with
32P-labeled H10 and H4 probes. The ethidium
bromide-stained gel before the transfer of RNAs onto the membrane is
also shown. (C) Early cell cycle exit after the induced differentiation
of B16 cells. B16 cells were pulse-labeled with
[3H]thymidine at the indicated times after the induced
differentiation and analyzed; 100% represents
[3H]thymidine incorporation in noninduced cells (means of
three independent counts); bars indicate standard deviations.
|
|
Identification of H4-box-interacting factors.
A yeast
one-hybrid screening strategy was adopted to clone factors interacting
with the histone H10 H4 box. We generated a yeast reporter
strain in which three tandem copies of the H4 box from the human
H10 promoter were inserted upstream of His3 and
lacZ genes. A human brain cDNA library cloned in the yeast
expression vector pGAD10, which expresses the cDNA insert as a fusion
protein containing the GAL4 AD, was transformed into the reporter
strain. Adult brain was selected as the source of cDNA to minimize the
cloning of histone H4-specific transcription factors, since this tissue
is constituted of mostly differentiated and arrested cells which express a high level of H10 (13, 42). Two cDNA
clones able to confer a high rate of growth on selective media (lacking
histidine) and also capable of activating
-galactosidase production
were isolated. These two clones had the same sequence and encoded an
HMG-box-containing protein known as HBP1 (29). We also used
two established yeast strains harboring either three copies of the UCE
from the human H10 promoter or three copies of a
p53-binding site, upstream of the HIS3 and lacZ
genes. One of the GAL4 AD-HBP1-expressing plasmids isolated after the
library screening was introduced into these lines to check the
specificity of the interaction of HBP1 with the H4 box element. Figure
3 shows that while the three strains (H4
box, UCE, and p53-binding sites) grow well on nonselective media (left
panel), only the H4-box-containing strain can efficiently activate
lacZ gene expression (middle panel). On selective media lacking histidine and containing 30 mM 3-AT, only the H4 box strain was
able to grow (right panel). This experiment demonstrated that in vivo,
HBP1 is able to specifically recognize the H4 box. Interestingly, two
groups using the yeast two-hybrid system have independently identified
HBP1 as an RB-interacting protein and also as a potential transcription
factor (26, 50). Indeed, two distinct RB-binding sites are
present in HBP1 (50).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
HBP1 interacts specifically with the H10 H4
box in vivo. A GAL4 AD-HBP1 expression vector, isolated from the
one-hybrid screening, was introduced into three different yeast strains
harboring three copies of either the H4 box, UCE, or a p53-binding site
(P53 BS) upstream of each of two reporter genes (lacZ and
HIS3). After transfection and selection of HBP1-expressing
clones, one clone of each strain was spread on nonselective medium
(left panel) or histidine-deficient medium containing 30 mM 3-AT (-His
panel). Yeast grown on nonselective medium were transferred to a
membrane and assayed for -galactosidase activity (middle panel).
|
|
HBP1 interacts specifically with the H10 H4 box
element.
To confirm the observed interaction of HBP1 with the
H10 H4-box in vivo, we studied in vitro HBP1-H4 box
interaction. Figure 4A represents a
standard DNase I footprinting experiment with a fragment covering the
H4 box region of the wild-type Xenopus H10 gene
or the same fragment isolated from the mutated H10
promoters, TCA and GT (Fig. 1). As shown in Fig. 1 and 2, these motifs
are highly conserved in all H4 boxes and are necessary to maintain
H10 promoter activity. An HBP1 DNA-binding domain-GST
fusion protein was expressed in bacteria, purified, and used for this
study. The HBP1-DNA-binding domain fusion protected several
nucleotides within the wild-type H4 box sequence (Fig. 4A, left panel).
Interestingly, when the corresponding fragments isolated from the TCA-
and GT-mutated H4 boxes were used, HBP1 could not protect these regions
against DNase I digestion (Fig. 4A, compare WT, TCA, and GT
constructs). To obtain information on specific regions within the H4
box affected by the interaction with HBP1, we used the powerful UV
laser footprinting strategy (2). The HBP1 DNA-binding
domain-GST fusion protein was incubated with a 32P-labeled
oligonucleotide (32 bp) corresponding to the H4 box sequence.
Irradiation of the complex by the UV laser followed by a hot piperidine
treatment revealed bases presenting a modified photoreactivity due to
the presence of the protein. This methodology allowed us to visualize,
with high precision, bases within the H4 box that were the most
affected by HBP1 interaction. The photoreactivity of the GT nucleotides
located in the highly conserved GGTCC motif was the most severely
affected by the presence of HBP1 (Fig. 4B, arrows). Although the
photofootprinting did not show significant modification of the
photoreactivity of TCA and GT motifs (not shown), the DNase I
footprinting using the promoter fragments mutated at these sites showed
that they were also important for HBP1 interaction. It is interesting
that the GTCC motif is present twice in the H10 H4 box,
once in the highly conserved GGTCC element and once just upstream of
the TCA motif and including the highly conserved GT dinucleotide (Fig.
1B, underlined).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
DNA-binding analysis of HBP1 on the H10
promoter. (A) A 150-bp DraIII-XbaI fragment was
excised from the wild-type Xenopus H10 gene
promoter, or promoters containing mutations in TCA and GT subelements
(WT, TCAm, and GTm, respectively; see the
legend to Fig. 2), end labeled, and incubated with 100 and 500 ng of
GST-HBP1 fusion protein (lane 2 and 3 for each panel). Lane 1 shows the
pattern of DNase I digestion in the absence of the protein. The
position of the H4 box is indicated on the left. (B) UV laser
footprinting of H4 box HBP1 complex. An end-labeled H4-box-containing
oligonucleotide (32 bp) was complexed with 100 and 500 ng of purified
GST-HBP1 fusion protein and irradiated with a single 266-nm laser
pulse. The irradiated samples were then treated with hot piperidine,
and the cleaved products were analyzed on a sequencing gel. The
patterns of the cleavage of nonirradiated (lane 1) and irradiated (lane
2) naked DNA are also shown. The light gray box indicates the position
of the highly conserved GGTCC motif. Arrowheads show a modified
photoreactivity of the GT nucleotides in the presence of HBP1.
|
|
Different forms of HBP1 are expressed in various adult
tissues.
The HBP1 clone that we isolated after one-hybrid
screening possesses five different amino acids at its C-terminal
extremity compared to the reported human HBP1 (accession no. AF019214). This observation suggested that different HBP1-related mRNAs were expressed. To elucidate this issue and to establish the pattern of
different HBP1-related mRNAs in adult tissues, Northern blots containing mRNA samples from various mouse and human adult tissues were
probed with an HBP1 probe. In mouse cells, at least three different HBP1-related mRNAs (3.4, 2.4, and 1.7 kb), expressed at
different levels, were observed (Fig.
5D). In human cells, although the same
HBP1-related mRNAs were observed, the 3.4-kb species constituted the
most abundant form (not shown). In our search of the sequence
databanks, we noticed the presence of the human HBP1-encoding gene
whose sequence is now available thanks to the chromosome 7 mapping
project (GenBank accession no. AC004492). We used this sequence to
establish the intron/exon organization of the gene (Fig. 5A) and to
identify the nature of different HBP1-related mRNAs. Sequence
comparison of the two available human HBP1 cDNAs (ours and the
previously reported one, AF019214) showed that the two cDNAs were the
result of an alternative splicing. Intron 10 (1 kb long), spliced
in the AF019214 sequence (named here HBP1b), was found unspliced in our
cDNA (HBP1a). This event results in the alteration of the five most
C-terminal amino acids (Fig. 5B) as well as in a longer 3'
untranslated region in our cDNA (Fig. 5C). This alternative splicing
explained the two upper mRNA bands observed in the Northern blot (3.4 and 2.4 kb). We do not know the nature of the smaller HBP1-related
mRNA. However, a search of the EST (expressed sequence tag)
databank revealed the existence of an EST of 600 bp (GenBank accession
no. AI186052) showing sequence identity with both the N- and C-terminal
parts of the HBP1-encoding sequence. A detailed analysis of this
EST (not shown) revealed that a splicing event removed exons 2 to 7, leading to an mRNA that potentially encodes a protein containing essentially the HMG box domain.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Structure of the human HBP1-encoding gene. (A) The
sequence of a human bacterial artificial chromosome clone, RG363E19
(accession no. AC004492), from chromosome 7q31.1 was compared with the
sequence of the cDNA cloned in this work as well as that of human HBP1
available in the GenBank database (accession no. AF019214). The
positions of exons and introns were determined, and a map was obtained.
(B and C) An alternative splicing event produces two types of
HBP1-encoding mRNA. Intron 10 remained unspliced in the cDNA that we
cloned in this work and is removed in the HBP1 sequence available in
the database (AF0192114). This alternative splicing alters the sequence
of the five most C-terminal amino acids (B) and includes (HBP1a) or
omits (HBP1b) 1 kb of 3' untranslated region to the HBP1-encoding mRNAs
(C). (D) Three HBP1-related mRNAs are expressed in different mouse
adult tissues. A Northern blot containing 2 µg of
poly(A)+ RNAs from indicated mouse tissues was probed a
32P-labeled HBP1 probe. The positions of HBP1a and HBP1b at
3.4 and 2.4 kb, respectively, are indicated.
|
|
The differentiation-dependent expression of HBP1 correlates
with the induction of H10 gene expression.
We have
identified HBP1 as a transcription factor that is potentially involved
in the control of H10 gene expression during cell
differentiation. Moreover, different HBP1-related mRNAs have been
observed. Previously, several groups demonstrated the accumulation of
HBP1 mRNA during the induced differentiation of two cell lines
(29, 50). Here we tried to correlate the expression of HBP1
mRNAs with that of H10 in systems where the pattern of
H10 gene expression was precisely established during
cell differentiation. Previously, we showed that the induction of
MEL cell differentiation by hexamethylene bisacetamide treatment
efficiently induced the expression of H10 (44).
We used the same system to examine the timing of HBP1 expression.
Figure 6A shows that the expression of
HBP1 correlated very well with that of H10 mRNA, and the
only form of messenger detected was that corresponding to HBP1a (3.4 kb). Moreover, this event takes place before the commitment of cells to
differentiate, as judged by the timing of globin gene expression (Fig.
6A). To exclude any artifactual expression of these genes in vitro (due
to the treatment with chemicals), we tested an inducible in vivo
system: rat liver regeneration after partial hepatectomy. This
procedure induces liver cell proliferation to regenerate the functional
differentiated tissue (1), a process accompanied by an
induction of H10 mRNA (20). Interestingly, in
this case the induction of HBP1 expression preceded that of
H10 gene expression, and the expression of both genes
decreased 72 h after the hepatectomy (Fig. 6B). Here again the
only form detected corresponded to HBP1a. These data identify HBP1 as a
candidate regulator of H10 gene expression during cell
differentiation.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 6.
Differentiation-dependent expression of HBP1. (A) MEL
cells were induced to differentiate with 4 mM hexamethylene
bisacetamide. At the indicated times after induction, RNA was prepared
and a Northern blot was obtained. The blot was probed successively with
HBP1, H10, and -globin probes. (B) Rats were partially
hepatectomized, and regeneration was allowed to proceed for the
indicated times; then RNA was purified and analyzed as above. The
ethidium bromide-stained gels before the transfer of RNAs onto the
membrane are also shown.
|
|
Involvement of RB in the control of H10 gene expression
in vivo.
The fact that the expression of H10 is
activated during induced differentiation, concomitant with the exit of
cells from the cell cycle, suggests strongly that there should exist a
link between the cell cycle control machinery and the expression of
H10. Since RB is a partner of HBP1 (26, 50), one
can suggest that it provides the link between arrest of cell
proliferation and the expression of H10. To confirm this
hypothesis, we used the RB-deficient osteosarcoma cell line SAOS-2,
which is stably transfected with a tetracycline-inhibitable RB
expression vector. The removal of tetracycline leads to the induction
of the RB transgene. SAOS-2 cells were cultured for various periods in
the absence of tetracycline, and expression of the endogenous
H10 gene was monitored. The Northern blot presented in Fig.
7 shows that 24 h after the removal
of tetracycline, RB expression is efficiently induced. Interestingly,
the expression of endogenous H10 is sensitive to this event
and a significant accumulation of H10 mRNA can be observed
concomitant with that of RB. At 48 and 72 h after withdrawal of
tetracycline, decreases in both H10 and GAPDH mRNA levels
were observed, probably due to the toxicity of RB overexpression. As
expected, the induction of RB is accompanied with a modification of
cell cycle parameters. Interestingly, the first visible event is an
accumulation of cells in the G2/M phase of the cell cycle
(Fig. 7B, 12 and 24 h), followed by an arrest of cells in both
G1 and G2/M phases after 24 h of RB
induction (not shown). These results show that RB, a well-known
regulator of the cell cycle, is able to communicate with the
H10 promoter and therefore provides a link between cell
cycle regulation and H10 gene expression.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 7.
RB modulates the expression of the endogenous
H10 gene. The RB-deficient SAOS-2 cell line, harboring an
inducible RB-encoding transgene, was cultured in the absence of
tetracycline to induce the expression of RB. (A) At the indicated
times, RNA was prepared from these cells, and the Northern blot
obtained was probed successively with 32P-labeled
H10, RB, and GAPDH probes. The ethidium bromide-stained gel
before the transfer of RNAs onto the membrane is shown. (B) The induced
accumulation of RB is associated with the modification of cell cycle
parameters. SAOS-2 cells were fixed at the indicated times after the
removal of tetracycline, stained with propidium iodide, and analyzed
using a flow cytofluorimeter. Histograms represent the number of cells
as a function of DNA content (DNA fluorescence).
|
|
Involvement of RB and HBP1 in the control of H10 gene
expression.
To show directly the involvement of HBP1 and RB in the
control of H10 gene expression, we introduced a mouse
H10 promoter-CAT reporter construct into cells expressing
HBP1 and RB proteins. The expression of HBP1 alone or together with RB only slightly stimulated the activity of the H10 promoter
using various exponentially growing cell lines in transient transfection assays (Fig. 8A and data not
shown). Because of the abundance of histone H4 transcriptional
regulatory factors in proliferative cells (19, 52) and a
possible interference of these factors with HBP1 and thereby
H10 expression, we decided to transfect arrested cells
where H4 site II binding activity is greatly reduced (49). A
very convenient cell line for this purpose is Cl6, a ras-
and thermosensitive p53 mutant-transformed line. At 37°C, p53 is in a
mutated conformation which is responsible for the appearance of a
transformed phenotype. At 32°C, p53 exhibits the property of the
wild-type protein and triggers an arrest of cell proliferation
(34). After the temperature shift from 37 to 32°C and
arrest of cell proliferation, cells were transfected with the
H10 promoter-CAT reporter gene. The cotransfection of an
HBP1 expression vector led to a 2-fold activation of H10
activity compared with transfection of the reporter construct alone,
while cotransfection of an RB expression vector stimulated promoter
activity 1.5-fold. Interestingly, when HBP1 and RB were introduced
simultaneously in cells, the transactivation observed was approximately
fourfold. This activation is dependent on RB-HBP1 interaction.
Replacement of the first RB-binding site on HBP1 (LXCXE) by an
unrelated sequence (Fig. 8B, HBP1X1 construct) completely abolished
HBP1-RB cooperation in H10 activation (Fig. 8C). The
destruction of the second RB-binding site, IXCXE, did not strongly
affect the RB-HBP1 cooperativity in activating the H10 gene
promoter (Fig. 8C, HBP1X2 construct).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 8.
HBP1 and RB cooperate to activate the H10
gene promoter in growth-arrested cells. (A) Proliferative Cl6 cells
(cultured at 37°C) were transfected with 1 µg of mouse
H10 promoter-CAT reporter construct in the absence ( ) or
presence (+) of 500 ng of the indicated expression vectors. (B)
Schematic representation of various HBP1 mutants expressed in cells.
aa, amino acids. (C) Growth-arrested Cl6 cells cultured at 32°C were
transfected with the indicated HBP1 expression vectors together with a
H10 promoter-CAT construct. In the HBP1X1 construct, the
putative RB-binding site (LXCXE; black circle) is replaced by RPCRP
encoded by an SfiI restriction site (crossed circle). In the
HBP1X2 mutant, the second putative RB-binding site (IXCXE; black
circle) is replaced by the SfiI sequence (crossed circle).
HBP1X1X2 harbors both mutations. The HBP1d expression vector expresses
a protein containing amino acids 37 to 120 of HBP1 fused to the
HMG-box-containing domain (amino acids 394 to 513), lacking the two
putative RB-binding sites. The HBP1dHMG construct expresses a truncated
HBP1 protein (amino acids 1 to 427) lacking the HMG box domain. (D)
Growth-arrested Cl6 cells were transfected with HBP1, RB, or both
expression vectors with a reporter plasmid containing the
Mist1 gene promoter. A 500-ng aliquot of each expression
vector was used for each transfection, and in every transfection the
total amount of expression vector was kept constant to 500 ng using a
CMV-directed green fluorescent protein expression vector. Data
summarize results of three to six independent experiments and are
normalized and represented as in Fig. 2. The histograms (cell
number/DNA) show the state of cell proliferation at the moment of
transfection.
|
|
We also prepared a construct expressing a fusion protein containing the
93-amino-acid putative AD of HBP1 (26) fused to the HMG box
domain (HBP1d construct). The expressed protein lacked both
RB-binding sites. Expression of this protein did not activate the
H10 promoter; moreover, it could not cooperate with
RB (Fig. 8C, HBP1d construct). The same situation was observed when a
truncated form of HBP1, lacking the HMG box domain, was expressed
(Fig. 8C, HBP1dHMG construct).
To show the specific involvement of HBP1 and RB in H10 gene
expression, we used another cellular promoter controlling expression of
Mist1 gene, which does not contain any H4-box-like element (27). Mist1, a gene expressed in various cell
types, encodes a DNA-binding protein of the basic-helix-loop-helix
family capable of dimerization with other members of this family and
specifically inhibits MyoD transcriptional activity (28).
Figure 8D shows that upon the expression of RB and HBP1 in arrested Cl6
cells, while H10 promoter activity is significantly
stimulated, that of Mist1 is only slightly affected. In
these experiments we also used a reporter gene under the control of
cytomegalovirus (CMV) promoter and found that HBP1 alone or together
with RB inhibited the CMV promoter activity by about 20 to 30% (not
shown). These results showed the specific involvement of both HBP1 and
RB in the control of H10 gene expression.
RB enhances the binding of HBP1 to H10 H4 box.
To
investigate whether RB might in some way facilitate or stabilize
binding of HBP1 to H4 box site, we considered the capacity of RB to
influence the binding of HBP1 to its target sequence. A gel shift assay
was carried out using a 32-mer oligonucleotide containing the wild-type
Xenopus H10 H4 box. In the presence of
suboptimum binding levels of GST-HBP1 (Fig.
9, lane 2), the addition of an increasing
amount of RB led to an enhancement of the HBP1-dependent DNA-binding
activity (Fig. 9, lanes 4 to 5). When the same experiment was performed
with an oligonucleotide containing a TCA mutation (Fig. 9, lanes 6 to
8), the effect of RB in HBP1 DNA-binding activity was greatly reduced.
These experiments demonstrated that the DNA-binding activity of HBP1,
like that of c-Jun and C/EBP members (9, 10, 35, 36), can be
enhanced upon its interaction with RB, and the results supported the
observed cooperativity between RB and HBP1 in the activation of
H10 gene expression.

View larger version (92K):
[in this window]
[in a new window]
|
FIG. 9.
Modulation of HBP1 DNA-binding activity by RB. Gel shift
assays were performed with a constant amount (200 ng) of bacterially
expressed GST-HBP1 in the absence (lanes 2) or in the presence of
increased amounts of His-RB (100 ng, lanes 3 and 6; 200 ng, lanes 4 and
7; 300 ng, lanes 5 and 8). WT indicates the wild-type H10
H4 box sequence, and TCAm indicates the same sequence
bearing a mutation at the TCA subelement level.
|
|
 |
DISCUSSION |
Detailed analysis of factors interacting with histone H4 site II,
known to be involved in the S-phase-dependent activation of histone H4
genes (24, 43), showed the obvious link between the cell
cycle control machinery and histone H4 gene expression. Indeed, the H4
site II element interacts with at least three distinct complexes, named
HiNF-D, HiNF-M, and HiNF-P (53). Extensive research on the
nature of these complexes has led to the identification of several
interacting subunits. Interferon regulatory factor 2 is the DNA-binding
subunit of the HiNF-M complex (56), while HiNF-D, a complex
that is associated with the S-phase activation of H4 genes
(52), harbors the transcription factor CDP/cut
(55) in addition to Cdc2, cyclin A, and RB, three major cell
cycle regulatory factors (54). The DNA-binding subunit of
the HiNF-P complex (H4TF2 [12]) has not been yet
identified. Here we have shown that in proliferating cells, the
H10 H4 box can be replaced by H4 site II from the H4 gene
FO108, demonstrating that these two elements are functionally
equivalent. However, during embryonic development and cell
differentiation, H10 and H4 genes present opposite patterns
of expression. H4 genes are sensitive to signals inducing the S phase
of the cell cycle, while the H10 gene is activated when
growth arrest signals become functional. This observation allows one to
propose a hypothesis for the presence of the H4 box in the promoter of
the H10 gene. Indeed, this element could be considered as a
site of connection with the cell cycle control machinery, informing the
H10 gene about the state of cell proliferation. In the same
way as H4 site II links H4 gene expression to S-phase-inducing signals, the H10 H4 box could render the H10 gene
responsive to growth arrest signals. All of these considerations prompted us to search for novel H4-box-binding proteins from fully differentiated and growth-arrested cells. For this reason we used a
one-hybrid screen of a human adult brain cDNA library. The
H4-box-interacting factor cloned was HBP1, an HMG box transcription
factor (29). This factor was able to interact with the H4
box in vivo and in vitro. Previously, a detailed analysis of the
N-myc promoter showed that the TCCTTCAATGGGGA
motif is the HBP1-binding site on this promoter (50).
Interestingly, there exists some sequence homology between this site
and the Xenopus H10 H4 box, TCCTCAACTCGGTC.
The TCC and TCAA submotifs are found in both sites. The TCA
trinucleotide motif, conserved between these two sites, appears
therefore to play an important role in HBP1 recognition. Indeed, our
data showed that the destruction of this motif abolished HBP1 binding.
Moreover, very recently a high-affinity HBP1-binding site,
TTCATTCATTCA, containing a triple copy of the TCA motif, has
been reported (60). All of these observations point to the
crucial role of the TCA trinucleotide motif in HBP1 binding. However,
the laser photofootprinting approach showed that the binding of HBP1
more specifically affects the GT dinucleotide in the GGTCC element,
which is the other highly conserved submotif in all histone H4-encoding
genes (53) and in all differentiation-specific H1s
(41). It is important to note that the photoreactivity of
bases in DNA is very sensitive to local conformational changes in DNA,
such as those induced by protein-DNA interactions (2).
Considering the DNA-bending activity of HMG-box-containing proteins
(8, 59), it is very probable that the modification of the
photoreactivity observed at the GT dinucleotide is due to the bending
of DNA at this level.
The expression of HBP1 was found to be positively controlled by cell
differentiation, suggesting its involvement in the expression of
differentiation-dependent genes. Most interestingly, HBP1 is a partner
of RB (26, 50) and therefore establishes a link between
transcriptional regulation and control of the cell cycle (46,
50). Moreover, the expression of HBP1 leads to an arrest of cell
proliferation (50). These observations prompted Tevosian et
al. (50) to propose that HBP1 functions in the initiation and the maintenance of irreversible cell cycle arrest during cell differentiation. HBP1 is therefore an excellent candidate as a regulator of the H10 gene, since H10 expression
is activated after induced differentiation (61), precisely
during the early cell cycle modifications suggested to be controlled by
HBP1 (50). We were also able to show that the expression of
RB in an RB-deficient cell line leads to induced expression of the
endogenous H10 gene. This observation has been confirmed in
transient transfection assays. RB, more generally known as a repressor
of transcription, has been shown to be the activator of several
differentiation-dependent genes. For instance, in adipocytes RB binds
to C/EBPs in differentiating cells and enhances the binding of these
factors to the target element, leading to the activation of a
C/EBP-responsive reporter (10). The interaction of RB with
NF-IL6, also a member of C/EBP family, was found to enhance its
transactivation capacity and to be involved in monocyte/macrophage
differentiation (9). In muscle cells, RB binds MyoD and
mediates differentiation (16). Moreover, the interaction of
RB with c-Jun and the enhancement of its transactivator capacity
implicates RB as a transcriptional activator in the early
G1 phase of the cell cycle (35, 36) and more
specifically during keratinocyte differentiation (35). This
transcriptional stimulatory effect of RB might be, at least in part,
due to the enhancement of DNA-binding activity of target transcription
factors upon their interaction with RB. Indeed, it has been shown that
the interaction of RB with c-Jun stimulates its DNA-binding activity
(35, 36). Similar results have been obtained with members of
the C/EBP transcription factor family, in the presence of RB (9,
10). Interestingly, here we could show that RB can also stimulate
the DNA-binding activity of HBP1. It appears therefore that the
stimulation of transcription by RB generally involves an increase in
the DNA-binding activity of partner transcription factors.
In this work, we showed that HBP1 is a ubiquitous transcription factor
expressed in various tissues. Histone H10 is also expressed
in almost all arrested and fully differentiated cells. Our findings
therefore provide evidence for a more general involvement of RB in cell
differentiation rather than in the control of specific programs. Data
presented here also indicate a role for RB in chromatin remodeling
during cell differentiation through the control of histone
H10 gene activity. A role for RB in modulation of chromatin
structure has already been postulated (6). This activity of
RB could either be indirect or direct. A permanent hyperphosphorylation of histone H1, associated with relaxed chromatin structure, has been
found in RB-deficient fibroblasts, indicating an involvement of RB in
the regulation of those kinases responsible for the phosphorylation of
chromatin proteins (17). Besides this indirect role, RB may have a direct role in chromatin remodeling through its interaction with
a human SWI2/SNF2 homologue, hBrm (47), and through the recruiting of histone deacetylase, HDAC1 (5, 31, 32). The interaction of RB with topoisomerase II
, shown recently, is also a
possible means by which RB could modulate chromatin structure (3).
Finally, this work constitutes the first attempt to identify a
regulatory pathway involved in the control of the
differentiation-dependent expression of H10. However,
results reported here do not exclude a role for other factors,
interacting with key regulatory elements in H10 promoter,
in the differentiation-dependent expression of this gene. It is
important to consider the fact that the basal H10 promoter
activity is dependent on the concerted action of at least three
cis-acting regulatory elements, UCE, H1 box, and H4 box
(21, 22). Therefore, besides the H4 box and transcription factors interacting with this element, other yet unknown factors are
expected to participate in the organization of the active H10 promoter during cell differentiation. Some of these
factors may be also involved in the regulation of expression of
replication-dependent H1s. Indeed, one of these elements, also present
in replication-dependent H1 promoter (15) and known as the
UCE (21) or site IV (14), has been shown to play
an important role in the activation of H10 gene expression
in differentiating Friend cells (14). However, the
identification of the H10 H4 box as a unique
cis-acting regulatory element, linked to both differentiation and cell cycle control signals, allowed us to search
for a key regulator responding to both of these processes. Interestingly, the transcription factor identified, HBP1, shows exactly
the characteristics of the expected regulator; it is expressed in
differentiated cells, and interacts with the cell cycle regulator RB.
Moreover, the presence of an HMG box in this factor strongly suggests
that HBP1 may be involved in an architectural regulation, organizing
the active H10 promoter and facilitating the recruitment of
other factors such as those discussed above.
These findings place also RB at the center of the putative chromatin
remodeling command system that we were looking for. Recently, we have
identified a new family of HDACs related to yeast HDA1 deacetylase
(57). We showed that the expression of these genes is
strictly coordinated with that of histone H10. These
observations suggest that the regulatory mechanism presented here may
control the expression of other differentiation-dependent chromatin
modifiers and therefore identify RB as an essential regulator of
chromatin structure during cell differentiation.
 |
ACKNOWLEDGMENTS |
We are grateful to Jean-Jacques Lawrence for encouraging this
work and to Marie-Paule Brocard and Sandrine Curtet for technical assistance. We are deeply indebted to Annick Harel-Belan and Didier Trouche for RB expression vectors and other materials and helpful discussions and to E. Harlow for the Saos-2 cell line.
A.V. was a recipient of a fellowship from the Ligue Nationale Contre le
Cancer, comité de la Haute Savoie. This work was supported by
Association pour la Recherche sur le Cancer (ARC) and Groupement des
Entreprises Françaises et Monegasques dans la Lutte Contre le
Cancer (GEFLUC).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratoire de
Biologie Moléculaire et Cellulaire de la
Différentiation
INSERM U309, Equipe, chromatine et
expression des gènes, Institut Albert Bonniot, Faculté de
Médecine, Domaine de la Merci, 38706 La Tronche Cedex, France.
Phone: (33) 4 76 54 95 83. Fax: (33) 4 76 54 95 95. E-mail: khochbin{at}ujf-grenoble.fr.
Present address: Department of Clinical Pharmacology, Flinders
Medical Centre, Bedford Park, South Australia 5042, Australia.
Present address: Institut of Solid State Physics, Bulgarian
Academy of Science, 1784 Sofia, Bulgaria.
 |
REFERENCES |
| 1.
|
Alison, M. R.
1986.
Regulation of hepatic growth.
Physiol. Rev.
66:499-541[Abstract/Free Full Text].
|
| 2.
|
Angelov, D.,
S. Khochbin, and S. Dimitrov.
1999.
UV laser footprinting and protein-DNA crosslinking, p. 481-495.
In
P. B. Becker (ed.), Chromatin protocols. Humana Press, Totowa, N.J.
|
| 3.
|
Bhat, U. G.,
P. Raychaudhuri, and W. T. Beck.
1999.
Functional interaction between human topoisomerase IIalpha and retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
96:7859-7864[Abstract/Free Full Text].
|
| 4.
|
Bouterfa, H. L.,
S. M. Triebe, and D. R. Doenecke.
1993.
Differential regulation of the human H10 histone gene transcription in human tumor cell line.
Eur. J. Biochem.
217:353-360[Medline].
|
| 5.
|
Brehm, A.,
E. A. Miska,
D. J. McCance,
J. L. Reid,
A. J. Bannister, and T. Kouzarides.
1998.
Retinoblastoma protein recruits histone deacetylase to repress transcription.
Nature
391:597-601[CrossRef][Medline].
|
| 6.
|
Brehm, A., and T. Kouzarides.
1999.
Retinoblastoma protein meets chromatin.
Trends Biochem. Sci.
24:142-145[CrossRef][Medline].
|
| 7.
|
Breuer, B.,
B. Steuer, and A. Alonso.
1993.
Basal level of transcription of H10 gene is mediated by 80 bp promoter fragment.
Nucleic Acids Res.
21:927-934[Abstract/Free Full Text].
|
| 8.
|
Bustin, M.
1999.
Regulation of DNA-dependent activities by functional motifs of the high-mobility-group chromosomal proteins.
Mol. Cell. Biol.
19:5237-5246[Free Full Text].
|
| 9.
|
Chen, P. L.,
D. J. Riley,
S. Chen-Kiang, and W. H. Lee.
1996.
Retinoblastoma protein directly interacts with and activates the transcription factor NF-IL6.
Proc. Natl. Acad. Sci. USA
93:465-469[Abstract/Free Full Text].
|
| 10.
|
Chen, P. L.,
D. J. Riley,
Y. Chen, and W. H. Lee.
1996.
Retinoblastoma protein positively regulates terminal adipocyte differentiation through direct interaction with C/EBPs.
Genes Dev.
10:2794-2804[Abstract/Free Full Text].
|
| 11.
|
Clarkson, M. J.,
J. R. Wells,
F. Gibson,
R. Saint, and D. J. Tremethick.
1999.
Regions of variant histone His2AvD required for Drosophila development.
Nature
399:694-697[CrossRef][Medline].
|
| 12.
|
Dailey, L.,
S. B. Roberts, and N. Heintz.
1988.
Purification of the human histone H4 gene-specific transcription factors H4TF-1 and H4TF-2.
Genes Dev.
2:1700-1712[Abstract/Free Full Text].
|
| 13.
|
Dominguez, V.,
B. Pina, and P. Suau.
1992.
Histone H1 subtype synthesis in neurons and neuroblasts.
Development
115:181-185[Abstract].
|
| 14.
|
Dong, Y.,
D. Liu, and A. I. Skoultchi.
1995.
An upstream control region required for inducible transcription of the mouse H10 histone gene during terminal differentiation.
Mol. Cell. Biol.
15:1889-1900[Abstract].
|
| 15.
|
Duncliffe, K. N.,
M. E. Rondahl, and J. R. Wells.
1995.
A H1 histone gene-specific AC-box-related element influences transcription from a major chicken H1 promoter.
Gene
163:227-232[CrossRef][Medline].
|
| 16.
|
Gu, W.,
J. W. Schneider,
G. Condorelli,
S. Kaushal,
V. Mahdavi, and B. Nadal-Ginard.
1993.
Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation.
Cell
72:309-324[CrossRef][Medline].
|
| 17.
|
Herrera, R. E.,
F. Chen, and R. A. Weinberg.
1996.
Increased histone H1 phosphorylation and relaxed chromatin structure in Rb-deficient fibroblasts.
Proc. Natl. Acad. Sci. USA
93:11510-11515[Abstract/Free Full Text].
|
| 18.
|
Ho, S. N.,
H. D. Hunt,
R. M. Horton,
J. K. Pullen, and L. R. Pease.
1989.
Site-directed mutagenesis by overlap extension using PCR.
Gene
77:51-59[CrossRef][Medline].
|
| 19.
|
Holthuis, J.,
T. A. Owen,
A. J. van Wijnen,
K. L. Wright,
A. Ramsey-Ewing,
M. B. Kennedy,
R. Carter,
S. C. Cosenza,
K. J. Soprano,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1990.
Tumor cells exhibit deregulation of the cell cycle histone gene promoter factor HiNF-D.
Science
247:1454-4547[Abstract/Free Full Text].
|
| 20.
|
Khochbin, S.,
C. Gorka, and J. J. Lawrence.
1991.
Multiple control level governing H10 mRNA and protein accumulation.
FEBS Lett.
238:65-67.
|
| 21.
|
Khochbin, S., and A. P. Wolffe.
1993.
Developmental regulation and butyrate inducible transcription of the Xenopus histone H10 promoter.
Gene
128:173-180[CrossRef][Medline].
|
| 22.
|
Khochbin, S., and J. J. Lawrence.
1994.
Molecular basis of the activation of basal histone H10 gene expression.
Nucleic Acids Res.
22:2887-2893[Abstract/Free Full Text].
|
| 23.
|
Khochbin, S., and A. P. Wolffe.
1994.
Developmentally regulated expression of linker histone variants in vertebrates.
Eur. J. Biochem.
225:501-510[Medline].
|
| 24.
|
Kroeger, P.,
T. Stewart,
T. Schaap,
J. van Wijnen,
S. Hirshman,
G. Helms,
G. Stein, and J. Stein.
1987.
Proximal and distal regulatory elements that influence in vivo expression of a cell cycle-dependent human H4 histone gene.
Proc. Natl. Acad. Sci. USA
84:3982-3986[Abstract/Free Full Text].
|
| 25.
|
Lai, Z. C.,
R. Maxson, and G. Childs.
1988.
Both basal and ontogenic promoter elements affect the timing and level of expression of a sea urchin H1 gene during early embryogenesis.
Genes Dev.
2:173-183[Abstract/Free Full Text].
|
| 26.
|
Lavender, P.,
L. Vandel,
A. J. Bannister, and T. Kouzarides.
1997.
The HMG-box transcription factor HBP1 is targeted by the pocket proteins and E1A.
Oncogene
14:2721-2728[CrossRef][Medline].
|
| 27.
|
Lemercier, C.,
A. Brown,
M. Mamani,
J. Ripoche, and J. Reiffers.
2000.
The rat Mist1 gene: structure and promoter characterization.
Gene
242:209-218[CrossRef][Medline].
|
| 28.
|
Lemercier, C.,
R. Q. To,
R. A. Carrasco, and S. F. Konieczny.
1998.
The basic helix-loop-helix transcription factor Mist1 functions as a transcriptional repressor of MyoD.
EMBO J.
17:1412-1422[CrossRef][Medline].
|
| 29.
|
Lesage, F.,
J. P. Hugnot,
E. Z. Amri,
P. Grimaldi,
J. Barhanin, and M. Lazdunski.
1994.
Expression cloning in K+ transport defective yeast and distribution of HBP1, a new putative HMG transcriptional regulator.
Nucleic Acids Res.
22:3685-3688[Abstract/Free Full Text].
|
| 30.
|
Lieber, T.,
K. Weisser, and G. Childs.
1986.
Analysis of histone gene expression in adult tissues of the sea urchins Strongylocentrotus purpuratus and Lytechinus pictus: tissue-specific expression of sperm histone genes.
Mol. Cell. Biol.
7:2602-2612.
|
| 31.
|
Luo, R. X.,
A. A. Postigo, and D. C. Dean.
1998.
Rb interacts with histone deacetylase to repress transcription.
Cell
92:463-473[CrossRef][Medline].
|
| 32.
|
Magnaghi-Jaulin, L.,
R. Groisman,
I. Naguibneva,
P. Robin,
S. Lorain,
J. P. Le Villain,
F. Troalen,
D. Trouche, and A. Harel-Bellan.
1998.
Retinoblastoma protein represses transcription by recruiting a histone deacetylase.
Nature
391:601-605[CrossRef][Medline].
|
| 33.
|
Mandl, B.,
W. F. Brandt,
G. Superti-Furga,
P. G. Graninger,
M. L. Birnstiel, and M. Busslinger.
1997.
The five cleavage-stage (CS) histones of the sea urchin are encoded by a maternally expressed family of replacement histone genes: functional equivalence of the CS H1 and frog H1M (B4) proteins.
Mol. Cell. Biol.
3:1189-1200.
|
| 34.
|
Michalovitz, D.,
O. Halevy, and M. Oren.
1990.
Conditional inhibition of transformation and of cell proliferation by a temperature-sensitive mutant of p53.
Cell
62:671-680[CrossRef][Medline].
|
| 35.
|
Nead, M. A.,
L. A. Baglia,
M. J. Antinore,
J. W. Ludlow, and D. J. McCance.
1988.
Rb binds c-Jun and activates transcription.
EMBO J.
17:2342-2352[CrossRef][Medline].
|
| 36.
|
Nishitani, J.,
T. Nishinaka,
C. H. Cheng,
W. Rong,
K. K. Yokoyama, and R. Chiu.
1999.
Recruitment of the retinoblastoma protein to c-Jun enhances transcription activity mediated through the AP-1 binding site.
J. Biol. Chem.
274:5454-5461[Abstract/Free Full Text].
|
| 37.
|
Nordeen, S.,
P. P. Green III, and D. M. Fowlkes.
1987.
A rapid, sensitive, and inexpensive assay for chloramphenicol acetyltransferase.
DNA
6:173-178[Medline].
|
| 38.
|
Pauli, U.,
S. Chrysogelos,
G. Stein,
J. Stein, and H. Nick.
1987.
Protein-DNA interactions in vivo upstream of a cell cycle-regulated human H4 histone gene.
Science
236:1308-1311[Abstract/Free Full Text].
|
| 39.
|
Patterton, D., and A. P. Wolffe.
1996.
Developmental role for chromatin and chromosomal structure.
Dev. Biol.
173:2-13[CrossRef][Medline].
|
| 40.
|
Pehrson, J. R.,
C. Costanzi, and C. Dharia.
1997.
Developmental and tissue expression patterns of histone macroH2A1 subtypes.
J. Cell Biochem.
65:107-13[CrossRef][Medline].
|
| 41.
|
Peretti, M., and S. Khochbin.
1997.
The evolution of the differentiation-specific histone H1 gene basal promoter.
J. Mol. Evol.
44:128-134[CrossRef][Medline].
|
| 42.
|
Ponte, I.,
P. Martinez,
A. Ramirez,
J. L. Jorcano,
M. Monzo, and P. Suau.
1994.
Transcriptional activation of histone H10 during neuronal terminal differentiation.
Dev. Brain Res.
80:35-44[CrossRef][Medline].
|
| 43.
|
Ramsey-Ewing, A.,
A. J. van Wijnen,
G. S. Stein, and J. L. Stein.
1994.
Delineation of a human histone H4 cell cycle element in vivo: the master switch for H4 gene transcription.
Proc. Natl. Acad. Sci. USA
91:4475-4479[Abstract/Free Full Text].
|
| 44.
|
Rousseau, D.,
S. Khochbin,
C. Gorka, and J. J. Lawrence.
1991.
Regulation of H10 accumulation during induced differentiation of murine erythroleukemia cells.
J. Mol. Biol.
194:174-179.
|
| 45.
|
Rousseau, D.,
S. Khochbin,
C. Gorka, and J. J. Lawrence.
1992.
Induction of H10 gene expression in B16 murine melanoma.
Eur. J. Biochem.
208:775-779[Medline].
|
| 46.
|
Shih, H.,
S. G. Tevosian, and A. Yee.
1998.
Regulation of differentiation by HBP1, a target of the retinoblastoma protein.
Mol. Cell. Biol.
18:4732-4743[Abstract/Free Full Text].
|
| 47.
|
Singh, P.,
J. Coe, and W. Hong.
1995.
A role for retinoblastoma protein in potentiating transcriptional activation by the glucocorticoid receptor.
Nature
374:562-565[CrossRef][Medline].
|
| 48.
|
Spassky, A., and D. Angelov.
1997.
Influence of the local helical conformation on the guanine modifications generated from one-electron DNA oxidation.
Biochemistry
36:6571-6576[CrossRef][Medline].
|
| 49.
|
Stein, G.,
J. Lian,
J. Stein,
R. Briggs,
V. Shalhoub,
K. Wright,
U. Pauli, and A. van Wijnen.
1989.
Altered binding of human histone gene transcription factors during the shutdown of proliferation and onset of differentiation in HL-60 cells.
Proc. Natl. Acad. Sci. USA
86:865-869.
|
| 50.
|
Tevosian, S. G.,
H. H. Shih,
K. G. Mendelson,
K. A. Sheppard,
K. E. Paulson, and A. S. Yee.
1997.
HBP1: a HMG-box transcriptional repressor that is targeted by the retinoblastoma family.
Genes Dev.
11:383-396[Abstract/Free Full Text].
|
| 51.
|
Trieschmann, L.,
E. Schulze,
B. Schulze, and U. Grossbach.
1997.
The histone H1 genes of the dipteran insect, Chironomus thummi, fall under two divergent classes and encode proteins with distinct intranuclear distribution and potentially different functions.
Eur. J. Biochem.
250:184-196[Medline].
|
| 52.
|
van Wijnen, A. J.,
K. L. Wright,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1989.
Human H4 histone gene transcription requires the proliferation-specific nuclear factor HiNF-D. Auxiliary roles for HiNF-C (Sp1-like) and HiNF-A (high mobility group-like).
J. Biol. Chem.
264:15034-15042[Abstract/Free Full Text].
|
| 53.
|
van Wijnen, A. J.,
F. M. I. Van den Ent,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1992.
Overlapping and CpG methylation-sensitive protein-DNA interaction at the histone H4 transcriptional cell cycle domain: distinctions between two human H4 gene promoters.
Mol. Cell. Biol.
12:3273-3287[Abstract/Free Full Text].
|
| 54.
|
van Wijnen, A. J.,
F. Aziz,
X. Grana,
A. De Luca,
R. K. Desai,
K. Jaarsveld,
T. J. Last,
K. Soprano,
A. Giordano,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1994.
Transcription of histone H4, H3, and H1 cell cycle genes: promoter factor HiNF-D contains CDC2, cyclin A, and an RB-related protein.
Proc. Natl. Acad. Sci. USA
91:12882-12886[Abstract/Free Full Text].
|
| 55.
|
van Wijnen, A. J.,
M. F. van Gurp,
M. C. de Ridder,
C. Tufarelli,
T. J. Last,
M. Birnbaum,
P. S. Vaughan,
A. Giordano,
W. Krek,
E. J. Neufeld,
J. L. Stein, and G. S. Stein.
1996.
CDP/cut is the DNA-binding subunit of histone gene transcription factor HiNF-D: a mechanism for gene regulation at the G1/S phase cell cycle transition point independent of transcription factor E2F.
Proc. Natl. Acad. Sci. USA
93:11516-11521 |