Previous Article | Next Article 
Molecular and Cellular Biology, September 2000, p. 6677-6685, Vol. 20, No. 18
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Functions of E2A-HEB Heterodimers in T-Cell
Development Revealed by a Dominant Negative Mutation of HEB
Robert J.
Barndt,
Meifang
Dai, and
Yuan
Zhuang*
Department of Immunology, Duke University
Medical Center, Durham, North Carolina 27710
Received 28 March 2000/Returned for modification 4 May
2000/Accepted 20 June 2000
 |
ABSTRACT |
Lymphocyte development and differentiation are regulated by the
basic helix-loop-helix (bHLH) transcription factors encoded by the
E2A and HEB genes. These bHLH proteins bind to
E-box enhancers in the form of homodimers or heterodimers and,
consequently, activate transcription of the target genes. E2A
homodimers are the predominant bHLH proteins present in B-lineage cells
and are shown genetically to play critical roles in B-cell development.
E2A-HEB heterodimers, the major bHLH dimers found in thymocyte
extracts, are thought to play a similar role in T-cell development.
However, disruption of either the E2A or HEB
gene led to only partial blocks in T-cell development. The exact role
of E2A-HEB heterodimers and possibly the E2A and HEB homodimers in
T-cell development cannot be distinguished in simple disruption
analysis due to a functional compensation from the residual bHLH
homodimers. To further define the function of E2A-HEB heterodimers, we
generated and analyzed a dominant negative allele of HEB,
which produces a physiological amount of HEB proteins capable of
forming nonfunctional heterodimers with E2A proteins. Mice carrying
this mutation show a stronger and earlier block in T-cell development
than HEB complete knockout mice. The developmental block is
specific to the
/
T-cell lineage at a stage before the completion
of V(D)J recombination at the TCR
gene locus. This
defect is intrinsic to the T-cell lineage and cannot be rescued by
expression of a functional T-cell receptor transgene. These results
indicate that E2A-HEB heterodimers play obligatory roles both before
and after TCR
gene rearrangement during the
/
lineage T-cell development.
 |
INTRODUCTION |
T lymphocytes are derived in the
thymus following a stepwise developmental pathway. Each T cell acquires
a unique T-cell receptor (TCR), composed of either an
/
or
/
heterodimer, on the cell surface after the V(D)J recombination
at the corresponding TCR gene loci. The
/
cell lineage
development in the thymus has been conveniently divided into several
stages based on the expression of TCR and its coreceptor CD4 and CD8
surface molecules. The most immature population is negative for TCR,
CD4, and CD8 expression (double negative, or DN). These cells progress
and expand to the TCRlow CD4+ CD8+
(double positive, or DP) stage, which makes up 70 to 80% of total cell
mass of the thymus (11). DP cells are then subject to major histocompatibility complex-mediated positive and negative selection before maturing into either TCR+ CD4
CD8+ cytotoxic T cells or TCR+ CD4+
CD8
helper T cells (single positive, or SP). These
cytotoxic and helper T cells exit the thymus to peripheral lymph
organs, where they provide and mediate antigen-specific immune
responses, respectively.
Lineage commitment and initiation of V(D)J recombination occur in the
DN population, which is composed of less than 2% of total thymocytes
in young adult mice. With additional markers such as CD44 and CD25, the
DN cells can be further divided into precommitment (CD44+
CD25
, or DN1) and postcommitment (CD44+
CD25+, or DN2) T-lineage cells (13). Following
lineage commitment, the DN2 cells become DN3 cells by down-regulating
CD44 but maintaining CD25 expression. While a small number of committed
cells develop into the
/
T-cell lineage, most DN3 cells in the
late fetal and postnatal thymus enter the
/
T-cell lineage and
initiate V(D)J recombination at the TCR
gene locus
(10). The formation of the pre-TCR complex, composed of a
functional TCR
chain paired with pre-T
, is necessary for
generating a signal driving the DN cells to the DP stage (11,
33). The nonreceptor tyrosine kinase p56lck and
several other tyrosine kinases have been mapped immediately downstream
of the pre-TCR signal (22, 23, 39). Downstream of the
tyrosine kinases, the linker molecules SLP76 and LAT also play
essential roles in mediating the pre-TCR signals (28, 44). It is less clear how these membrane proximal signals are transduced by
nuclear transcription factors leading to gene expression and ultimately
to cellular differentiation.
Several transcription factors have been identified by gene targeting
analysis to play important roles during early T-cell development. These
include the Ikaros, GATA3, TCF1,
E2A, HEB, and a number of other structurally and
functionally related genes. Ikaros encodes a lymphoid
cell-restricted zinc finger DNA-binding protein which functions as a
protein dimer (12). Ikaros together with several related
zinc finger proteins seem to play complex and sustaining roles
throughout lymphopoiesis (42). GATA3 is a member of the GATA
zinc finger protein family. A Rag2-reconstitution test showed that
disruption of the GATA3 gene leads to a complete elimination
of the T-cell lineage while having little or no effect on the B-cell
and other hematopoietic lineages (36). TCF1 is a
T-cell-specific high-mobility group transcription factor important for
TCR
gene expression (29). Disruption of the
TCF1 gene leads to an accumulation of an intermediate cell
type, TCR
CD4
CD8+ (immature
single positive, or ISP), which is in transition from DN to DP stages
of T-cell development (40). This function of TCF1 is
partially compensated for by LEF1, a structurally related high-mobility
group transcription factor which plays a much broader role in embryonic
and tissue development (27).
E2A and HEB encode transcription factors that
belong to the basic helix-loop-helix (bHLH) protein family. The basic
region and the HLH domain of bHLH proteins mediate DNA binding and
protein dimerization, respectively. Proteins containing the HLH domain but not the basic region (6) are effective dominant negative inhibitors of bHLH proteins. bHLH genes are evolutionarily conserved and found to play important roles in lineage specification and differentiation of many tissue types, including skeletal muscle and
lymphocytes (17, 43). The E-protein class of the bHLH family, including the gene products of E2A, HEB,
and E2-2, has been shown to participate in lymphopoiesis
(3, 5, 45, 46). The bHLH domain of E-proteins mediates the
formation of both homodimers and heterodimers, which recognize the
canonical CANNTG E-box sequence found in many lymphoid cell-specific
genes, including the immunoglobulin (Ig) heavy and light chain genes (25, 26). E2A plays an essential role in B-cell lineage
development (2, 45), whereas HEB and E2-2 play facilitating
roles by modulating E2A protein activity through two possible
mechanisms (46). First, HEB and E2-2 may help increase the
availability of E2A proteins by dimerizing with the Id proteins, which
are the common inhibitory molecules of all E-proteins (35,
46). Second, HEB and E2-2 may also form heterodimers with the E2A
proteins and participate directly in B-cell-specific gene transcription (1, 15). Although functional specificities among different E-protein dimers still remain to be defined (47), many
studies have indicated that E2A homodimers are unique to B-lineage
cells (7, 32) and are capable of activating directly B-cell-
and lymphoid cell-specific genes such as Ig heavy chain
Iµ,
5, EBF, TdT, and
Rag1 (3, 9, 19, 31, 34).
In contrast, T-cell development does not seem to be heavily dependent
on any single E-protein gene. Among all three E-protein gene knockouts,
disruption of HEB induces the most severe defect in T-cell development.
Mice lacking the HEB gene show an accumulation of ISP cells
and a roughly 5- to 10-fold reduction of total thymocytes. The ISP
cells in HEBko mice are CD4lo/
CD8+ CD5lo HSA+
TCRlo/
and are in noncycling state (5). These
characteristics are reminiscent of the TCFko mice discussed
above (40). However, mature T cells are found in the thymus
and peripheral lymphoid organs of HEB knockout mice, indicating a functional compensation for HEB by other genes
(5). A partial block at the DN1 stage and normal thymocyte
development were reported for the E2A and E2-2
knockout mice, respectively (3, 46). Two crucial pieces of
evidence indicated that E2A and HEB play overlapping roles in T-cell
development. First, Sawada and Littman (30) showed in their
analysis of CD4 gene enhancers that the CD4-3 E-box site was
predominantly occupied by the E2A-HEB heterodimers in cloned
T-cell and thymocyte nuclear extracts. Second, a genetic interaction
between HEB and E2A genes was revealed by
analyzing E2A and HEB compound heterozygous mice,
which displayed a thymic defect similar to that in HEB
knockout mice (46). These observations raised a possibility
that E2A-HEB heterodimers could directly instruct T-cell-specific gene
expression in a way parallel to the function of E2A homodimers in
B-cell development.
In this study, we find that the T-cell-specific E2A-HEB heterodimers
are replaced by E2A homodimers in the HEB knockout mice and
by HEB homodimers in the E2A knockout mice. This observation substantiates the conclusion made from genetic studies (46) that E2A and HEB are able to compensate for each other in T-cell development. To test the function of E2A-HEB heterodimers, we generated
and analyzed mice carrying a dominant negative allele of HEB, named
HEBbm. We show that HEBbm produces
physiological levels of a mutant HEB protein capable of forming
nonfunctional heterodimers with E2A proteins. Although several minor
defects are found in other cell types, the most severe dominant
negative effects of HEBbm are restricted to the T-cell
lineage, where HEB is highly expressed. Overall, we find that
HEBbm induces a stronger and earlier block in T-cell
development than that in HEB knockout (HEBko) mice.
Comparing HEBbm mice with HEBko mice,
HEBbm mice show several distinct phenotypes. First, the
thymic cellularity in HEBbm mice is reduced 3- to 10-fold
from that in HEBko mice or 15- to 100-fold from that in the
wild-type control. Second, T-cell development in HEBbm mice
is blocked within the DN stage, one stage earlier than the ISP stage
block seen in HEBko mice. Third, a defect in V(D)J
recombination at the TCR
gene locus is found in DN3 cells
from HEBbm mice but not from HEBko mice
reported earlier (5). Finally, we show that the
developmental block in the DN stage cannot be rescued by forced
expression of a functional TCR gene. These studies indicate that
E2A-HEB heterodimers play essential roles both before and after
the assembly of functional TCR
genes.
 |
MATERIALS AND METHODS |
Construction of the HEBbm allele.
The basic region mutation was introduced by PCR-based mutagenesis on a
0.7-kb BamHI fragment of genomic DNA covering the entire bHLH encoding exon and adjacent intron sequences. The basic DNA-binding domain was changed from RRMANNARERLRV to
RRMANNAREGHGV with an NcoI site incorporated in
the DNA sequence. The mutated DNA fragment was verified by sequencing
analysis before it was introduced into the targeting vector.
Southern blotting and PCR genotyping of the
HEBbm allele.
Southern blotting was
performed by probing the NcoI-digested mouse tail DNA with
an HEB genomic DNA derived from the intron sequence upstream
of the bHLH-encoding exon. The wild-type and the
HEBbm alleles were revealed as 5.8- and 3.8-kb
fragments, respectively. PCR genotyping was conducted by first
amplifying toe DNA with a sense primer, YZ-119
(5'GACATCAAGGTCTCATCTAGG3'), and an antisense primer, YZ-122
(5'TCTCACTTGCTGTTCTAGACT3'). The PCR products were digested
by NcoI and then separated on agarose gels. The wild-type and the HEBbm alleles were detected as 2.0-kb
and 1.8-kb products, respectively, after NcoI digestion.
Western and EMSA analyses.
Nuclear extracts were prepared
from total thymocytes according to the protocol previously described
(5). Protein concentrations were determined by the Bio-Rad
protein assay. A sodium dodecyl sulfate-10% polyacrylamide gel
electrophoresis minigel was loaded with 10 µg of nuclear extract,
blotted to nitrocellulose with a Trans-Blot SD electrophoretic transfer
cell (Bio-Rad), and blocked with 10% nonfat dried milk in 1×
Tris-buffered saline-0.5% Tween 20. Primary antibodies were anti-HEB
rabbit polyclonal antiserum purchased from Santa Cruz Biotech. The
secondary donkey anti-rabbit antibody conjugated to horseradish
peroxidase was used at a 1:5,000 dilution, followed by enhanced
chemiluminescence treatment as suggested by the manufacturer (ECL kit;
Amersham, Little Chalfont, Buckinghamshire, England). Electrophoretic
mobility shift assay (EMSA) analysis was performed according to Sawada
and Littman (30).
Protein synthesis.
Thymocyte RNA from an
HEBbm heterozygous mouse was used in reverse
transcription reaction with random hexamers. The cDNA was used in a PCR
to clone the carboxyl-terminal 220-amino-acid coding region of the
wild-type and the mutant HEB transcripts. The E47 subclone
(pB4X) used in the assay contains the carboxyl-terminal 280-amino-acid
coding region of the human E47 transcript. These cDNA fragments were
cloned in the pBluescript expression vector. RNA transcripts were
prepared using T3 or T7 polymerase and were quantified before they were
used in translation. The rabbit reticulocyte lysate system with or
without [35S]methionine was used for protein synthesis.
The 35S-containing samples were used in sodium dodecyl
sulfate gel for determining protein concentrations,
whereas the nonradioactive samples were used in EMSAs.
PCR analysis of TCR
gene V(D)J rearrangements.
DNA was
isolated from total thymocytes (106) or cell-sorted DN3
thymocytes (2 × 104 to 10 × 104). Cells
were lysed in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA (pH 8.0)-0.2 µg of
proteinase K/ml-0.2% Triton X-100 for 30 min at 55°C and then 10 min at 94°C. The rearrangement assay and PCR primers were used as
previously described (5, 38). Briefly, PCRs were performed
for 30 cycles of 45 s at 94°C, 45 s at 57°C, and 1 min at
72°C. Products were run on a 1.3% agarose gel, blotted onto nitrocellulose, and probed with a J
2-specific probe (1.4 kb
HincII-SacII DNA fragment covering the entire
J
2 region).
Flow cytometry.
Bone marrow, spleen, lymph node, and fetal
thymus cells were isolated from age-matched mice in phosphate-buffered
saline supplemented with 5% bovine calf serum and were used
immediately for fluorescence-activated cell sorting (FACS) analysis.
Cell suspensions were stained with a combination of a fluorescein
isothiocyanate-conjugated antibody and a phycoerythrin (PE)-conjugated
antibody plus 7-aminoactinomycin D (7AAD; Molecular Probes) and
analyzed on a FACScan (Becton Dickinson). CD4-PE-cy5, CD8-PE-cy5, and
TCR-PE-cy5 (clone H57-597) were also used together with 7AAD in the
analysis of DN thymocytes. Cells from the adoptive transfer experiment
were analyzed on a FACS Calibur with allophycocyanin (apc) included as
the fourth color. Two-parameter dot plots were shown after gating
populations by size and viability. Antibodies were purchased from
Caltag and Pharmingen.
Irradiation and stem cell reconstitution.
C57BL/6 mice
congenic for the Ly5.1 allotype marker were originally purchased from
Jackson Laboratories and then bred in-house. Host mice at 8 to 12 weeks
of age were irradiated with 1,100 rads 1 day before stem cell
transfusion and were maintained thereafter in sterile bedding with
antibiotics added in drinking water. Donor cells were prepared either
from frozen stocks or from freshly isolated fetal liver and neonatal
bone marrow cells. Either 0.1 × 106 to 0.5 × 106 total fetal liver cells or 0.5 × 105 to
2 × 105 total bone marrow cells were delivered to the
host in 0.2 ml of phosphate-buffered saline through tail vein
injection. For each donor type, three to five recipients were used in
the test. Mice were sacrificed 1 or 2 months after irradiation for FACS analysis.
 |
RESULTS |
Functional compensation among individual E-protein
dimers.
To understand further the functional relationship
between HEB and E2A proteins in T-cell development, we performed EMSA
to determine the DNA-binding ability of individual E-protein dimers present in thymocyte extracts of various mutant strains (Fig. 1). Functional E-protein dimers were detected via their
ability to bind to the CD4-3 E-box DNA (30). Antibody
supershift analysis was used to identify the components of DNA bound
dimers. In agreement with Sawada and Littman's observation, we
find that the E2A-HEB heterodimers account for the majority of
E-box DNA-binding activities in wild-type thymocyte extract. The
identity of E2A-HEB heterodimers (arrow A in lane 1) was determined by
the supershifts generated with anti-HEB antibodies (arrow C in lane 2)
and anti-E2A antibodies (arrow B in lane 3). The presumed E2A and HEB
homodimers (complexes resistant to antibody supershift in lanes 2 and
3, respectively) account for only a small but detectable amount of
E-box binding activity. Deletion of one and two copies of HEB resulted
in a proportional increase in the amount of E2A homodimers determined by the anti-HEB antibody-resistant complexes (arrow A in lanes 2, 5, and 8) and the anti-E2A antibody-dependent supershift (arrow B in lane
9). Similarly, the amount of HEB homodimers, determined by the anti-E2A
antibody-resistant complexes (arrow A in lanes 3, 12, and 15) and the
anti-HEB antibody-dependent supershift (arrow C in lane 14), is
proportionally increased due to deletion of one and two copies of E2A.
These results indicate that homodimers of E2A or HEB are capable of
replacing the DNA-binding activity of E2A-HEB heterodimers and
therefore provide a molecular basis for the functional compensation
between the HEB and E2A gene.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
EMSA analysis of E-protein dimer formation on the CD4-3
E-box DNA. Thymocyte extracts from wild-type (WT) (lanes 1 to 3),
HEBko heterozygous (lanes 4 to 6),
HEBko homozygous (lanes 7 to 9),
E2Ako heterozygous (lanes 10 to 12), and
E2Ako homozygous (lanes 13 to 14) mice were
incubated with 32P-labeled CD4-3 DNA in the absence of
antibodies (lanes 1, 4, 7, 10, and 13), in the presence of anti-HEB
antiserum (lanes 2, 5, 8, 11, and 14), or in the presence in anti-E2A
antibody Yae (lanes 3, 6, 9, 12, and 15). Arrows on the left (A, B, and
C) indicate CD4-3-bound E-protein dimer complexes, the E2A-dependent
supershift complexes, and the HEB-dependent supershift complexes,
respectively.
|
|
Construction of a dominant negative HEB allele.
The
compensation among different E-protein dimers renders a leaky thymic
phenotype and obscures the functional analysis of the native E-protein
dimers in thymopoiesis. It is technically difficult to generate mice
lacking both E2A and HEB by interbreeding of the single knockout mice
because the double mutation leads to early embryonic death
(46). We therefore undertook a dominant negative approach to
investigate the function of E2A-HEB heterodimers and to create a better
genetic model for understanding the mechanism of T-cell-specific gene
regulation by E-protein dimers. It has been shown that an E-protein
with altered DNA-binding domain can form nonfunctional heterodimers
with other bHLH proteins (41). We hypothesized that
disruption of the DNA-binding domain of HEB will suppress the function
of both HEB homodimers and E2A-HEB heterodimers.
A two-step knockin approach was used to generate such a dominant
negative
HEB allele in mice. As illustrated in Fig.
2, a
genomic HEB DNA construct carrying a point mutation
(marked by
NcoI) in the basic region of HEB (Fig.
2A and B)
and a pgk-Neo
selection marker (flanked by LoxP sites, or floxed) was
introduced
into mouse embryonic stem cells. The diphtheria toxin gene
provided
a negative selection against the nonhomologous recombination
events.
The floxed pgk-Neo was subsequently deleted in the targeted
embryonic
stem cell clones following transient transfection with the
CMVCre
plasmid. The final knockin clone with Neo deleted was verified
by Southern blotting and was subsequently introduced into mouse
embryos. Germ line transmission was established and confirmed
by
Southern blotting (Fig.
2C). This allele is referred to hereafter
as
HEBbm, for basic region mutation.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 2.
Generation of the HEBbm allele.
(A) Schematic diagrams of the bHLH region of the HEB gene
(top), the gene targeting construct (middle), and the final knockin
HEBbm allele. Filled boxes and open boxes
represent exons and selection markers, respectively. Intron and vector
sequences are shown as single lines. LoxP insertions on each side of
the Neo cassette are indicated by filled triangles. The positions of
restriction sites and the probe relevant to the Southern analysis are
indicated. The basic region mutation was introduced along with a
NcoI site (underlined) into the bHLH encoding exon. WT, wild
type. (B) The sequence of the basic region of HEB. Underlines indicate
amino acids conserved among all E-proteins. Sequences mutated are shown
in boldface. (C) Southern blot analysis of tail DNA digested with
NcoI. The wild-type and HEBbm alleles
are identified as 5.8- and 3.8-kb fragments, respectively, in the blot.
Lane 1 contains an end-labeled 1-kb ladder as size markers. The size of
each marker band is shown on the left. Two wild-type samples (lanes 2 and 3), two HEBbm heterozygous samples (lanes 4 and 5), and one HEBbm homozygous sample (lane
6) are shown in the blot. (D) Western analysis of thymocyte
nuclear extracts for HEB and HEBbm proteins. Lanes: 1, wild
type; 2, HEBko homozygote; 3, HEBko/bm compound heterozygote; 4, HEBbm heterozygote. Ten micrograms of proteins
was loaded in each lane. (E) EMSA of HEBbm proteins.
Proteins synthesized from programmed reticulocyte lysates were
incubated with end-labeled CD4-3 probe. Lanes contain the following:
lane 1, 3 µl of reticulocyte lysates (RL) without any RNA added in
protein synthesis; lane 2, 3 µl of E47 proteins; lane 3, 3 µl of
HEB proteins; lane 4, 3 µl of HEBbm proteins; lane 5, 3 µl of E47 plus 3 µl of HEB proteins; and lane 6, 3 µl of E47 plus
2 µl of HEBbm proteins. The E47, HEB, and
HEBbm proteins synthesized in the programmed RL were in
equal concentrations determined by a 35S protein gel (data
not shown). Diamonds indicate bound E47 homodimers, HEB homodimers, and
E47-HEB heterodimers; the asterisk indicates an unrelated RL-dependent
shift.
|
|
Western analysis was performed to evaluate the expression level
of the HEB
bm protein. Thymocyte extracts from
HEBbm/ko transheterozygous mice were used to
determine the mobility and
expression level of proteins produced from a
single copy
HEBbm allele. As shown in
previous studies (
5),
HEBko
homozygous mice show no detectable HEB protein (Fig.
2D, lane
2). In
contrast, the single copy
HEBbm allele on the
HEB null background produces a protein (Fig.
2D,
lane 3)
indistinguishable from the HEB protein detected in wild-type
mice (Fig.
2D, lane 1). To evaluate the dimerization and DNA-binding
activity of
HEB
bm proteins, we subcloned the wild-type and the mutant
HEB cDNAs
from thymocytes of an
HEBbm
heterozygous mouse. Proteins were synthesized in reticulocyte
lysate and tested in EMSAs with radiolabeled CD4-3 E-box DNA.
E47, a
bHLH protein encoded by the
E2A gene, was also synthesized.
As shown in Fig.
2E, E47 homodimers (lane 2), HEB homodimers (lane
3),
and E47-HEB heterodimers (lane 5) are readily detected (marked
by
diamonds). However, under the same assay conditions, the
HEB
bm protein is incapable of binding to the DNA (lane 4)
but is capable
of reducing the DNA-binding activity of E47 homodimers
(lane 6).
This test confirms that HEB
bm proteins are
capable of interfering with the DNA-binding activity
of E2A
proteins.
Gross phenotypic comparison of HEBbm and
HEBko mice.
HEBbm
heterozygous mice are grossly indistinguishable from their wild-type
littermates and are completely fertile. However, after 6 to 12 months
of age, approximately 10 to 20% of the mice showed episodes of
seizures upon handling by the tail, a phenomenon not seen in the
wild-type and HEBko heterozygous controls. This
phenotype underscores the importance of an earlier observation that
HEB is highly expressed in the brain (21).
HEBbm homozygotes were recovered from
heterozygous interbreeding at full-term gestation at the expected
Mendelian frequency (9 HEBbm/bm in a total of 34 genotyped E17.5 to E18.5 fetuses). Some HEBbm
homozygous fetuses displayed exencephaly, a low-penitrant phenotype that has previously been observed in the HEBko
and E2Ako homozygous embryos. Similar to
HEBko homozygous mice,
HEBbm homozygous neonates displayed severe
growth retardation and often died within 2 weeks of birth (only 1.4%
were HEBbm/bm of 785 genotyped 2-week-old F2 offspring).
A severe and specific defect in thymopoiesis.
The effect of
HEBbm on hematopoiesis was evaluated by flow cytometry
analysis with hematopoietic lineage and stage-specific markers. Similar
to HEBko homozygous mice, no obvious defect was
found in the erythroid (determined by ter119 marker) and myeloid
(determined by Mac1 and Gr1 markers) cell lineages in
HEBbm homozygous mice (data not shown). B-cell
development was normal in HEBbm heterozygous
mice but impaired in HEBbm homozygous mice.
Numbers of pro-B cells (CD43+ B220+), pre-B and
immature B cells (CD43low B220+), and mature B
cells (CD43
B220high) in
HEBbm homozygous mice were found reduced
compared to littermate controls (Fig. 3A, top panel).
However, an analysis of spleen and lymph nodes showed no gross
abnormality of B cells in the peripheral lymph organs, suggesting that
the effect of HEBbm may be restricted to bone marrow B-cell
development (Fig. 3A, bottom panel, and data not shown).



View larger version (102K):
[in this window]
[in a new window]
|
FIG. 3.
FACS analysis of B- and T-cell development in
HEBbm mice. (A) Analysis of bone marrow (top)
and lymph node (bottom) cells from adult HEBbm/+
and HEBbm/bm mice. CD43 and B220 markers were
used to separate pro-B cells (CD43+ B220+),
pre- and immature B cells (CD43low B220+), and
mature B cells (CD43 B220high) in the bone
marrow. TCR and B220 markers were used to separate T and B cells,
respectively, in the lymph nodes. The relative percentage for each
population is shown in the plots. Inguinal lymph nodes were collected
from each animal, with the total cell numbers given on top of the
plots. (B) E18.5 fetal thymus of wild-type,
HEBbm/+, and HEBbm/bm
thymocytes were analyzed in three separate stainings for CD4 and CD8
(top) and TCR / and TCR / (bottom) markers. CD4-, CD8-, and
TCR-positive cells were gated out in the bottom panel. Cell counts of
total thymocytes and individual populations are shown in the plots.
Data are representative of multiple tests (n = 7 for
HEBbm/bm). Events displayed for all plots in A and B are
after size and 7AAD gating, which eliminates nonlymphoid and dead
cells, respectively. (C) Cell count of E18.5 fetal thymus collected
from five litters of timed mating between HEBbm
heterozygous mice. Numbers of fetuses for each genotype included in the
analysis are shown next to the genotype name in the chart. Means and
standard deviations (in parentheses) for wild type,
HEBbm/+, and HEBbm/bm are 3.3 (1.4) × 106, 3.6 (1.5) × 106, and 0.2 (0.2) × 106, respectively. Two-tailed t test shows a
statistical difference between wild type and HEBbm/bm
(P = 1.7 × 10 5) and no significant
difference between wild type and HEBbm/+ (P = 0.7).
|
|
In contrast to B-cell development, T-cell development in
HEBbm/bm was severely disrupted in both
peripheral and central lymph organs
(Fig.
3A, B, and C). The defect in
T-cell development begins in
fetal thymus.
HEBbm/bm fetal thymus showed an approximately
15-fold reduction in the
thymic cellularity, an accumulation of DN
cells, and a near absence
of DP and SP cells. This developmental defect
seems specific to
the

/

T-cell lineage since the

/

T cells
were detected in
HEBbm/bm mice, albeit with a
slightly reduced number per
thymus.
Multiple roles of HEB in T-cell development revealed by gene dosage
effect.
A similar defect was observed in postnatal thymus (Fig.
4). A direct comparison of age-matched
HEBbm mice and HEBko mice
showed that the HEBbm mutation causes a much
tighter and earlier block in T-cell development than the complete
disruption of the HEB gene. T-cell development in the
HEBbm homozygous mice was almost completely
blocked at the DN stage rather than the ISP stage as seen in the
HEBko/ko mice (5). This severe defect
in thymopoiesis was accompanied by about a 10-fold reduction of total
thymocytes relative to the HEBko/ko background
and about a 100-fold reduction relative to levels in the wild-type
controls among 2- to 3-week-old mice (Fig. 4 and data not shown).
Interestingly, T-cell development in the HEBbm/ko transheterozygous mice can proceed to
the ISP stage but not to the SP stage, a phenotype intermediate of
HEBko homozygous mice and
HEBbm homozygous mice. This result indicates
that HEBbm exerts its dominant negative effects at several
discrete developmental stages in a dosage-dependent manner.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 4.
FACS analysis of thymocytes from mice carrying various
HEB alleles. (A) Two- to three-week-old mice were used in the analysis,
with genotype and thymocyte count shown on the top. CD4 and CD8 plots
were drawn after eliminating nonlymphocytes and dead cells in the size
scatter and 7AAD plots, respectively. The relative percentage of cells
in each quadrant was given in the plots. Data are representative of
multiple tests including 8 wild-type and HEB+/ko
mice, 8 HEBko/ko mice, 3 HEBko/bm mice, and 4 HEBbm/bm mice.
|
|
T-cell developmental defect is intrinsic to the T-cell
lineage.
In addition to their high-level expression in the thymus,
HEB transcripts were also detected in many other tissues, such as the
brain. The low recovery rate of HEBbm/bm
neonates indicates that HEB must play essential roles in cell types
other than the T-cell lineage. Therefore, the dominant negative effect
of the HEBbm mutation on T-cell development
could be due to a disruption of T-cell intrinsic differentiation
program or due to a perturbation of the environment needed for proper
T-cell development. To distinguish these two possibilities, we
performed an adoptive transfer experiment. Bone marrow cells from
wild-type or HEBbm/bm neonatal animals were
transfused into irradiated wild-type hosts. The ability of donor stem
cells to provide radioprotection and to give rise to T-lineage cells
was evaluated 1 or 2 months after transfusion. We find that
HEBbm/bm bone marrow cells are able to protect
the hosts from lethal irradiation, to produce myeloid cells, and with a
reduced efficiency to produce B cells (Fig. 5). However,
T-cell development from HEBbm/bm donors is
severely impaired. The quantitative defect in B-cell development and
the strong block in T-cell development recapitulate the
phenotypes of HEBbm/bm mice. This result shows
that the dominant negative effect of the HEBbm
allele is due to disruption of normal HEB function within the lymphoid
lineages.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
Adoptive transfer test of wild-type (left) and
HEBbm/bm (right) stem cells into wild-type
hosts. Bone marrow cells (1 to 2 × 105) from
wild-type or HEBbm homozygous neonates were
transferred into C57BL/6 Ly5A congenic mice irradiated with 1,100 rads.
Bone marrow cells, splenocytes, and thymocytes were collected and
analyzed 1 month after adoptive transfer. A four-color flow cytometry
test was carried out with CD45.2-fluorescein isothiocyanate
(donor-specific marker) and 7AAD included in all experiments. The
CD45.2+ 7AAD cells were analyzed with
CD43-PE and B220-apc markers for bone marrow cells,
Mac1-PE and B220-apc for splenocytes, and
CD8-PE and CD4-apc for thymocytes. Total thymocytes
recovered from the wild type transfer and
HEBbm/bm mutant transfer were indicated on the
top of the plots. Data are representative of three separate sets of
transfer experiment.
|
|
Impairments in V(D)J recombination at the TCR
gene
locus.
It has been well established that cells at the DN3 stage
undergo V(D)J recombination at the TCR
gene locus
(10). A sequential assembly of the V, D, and J segments (D
to J and then V to DJ) and the expression of a functional
chain
paired with the pre-T
chain is necessary for the DN3 cells to
proceed to the next developmental stage. An analysis of the
rearrangement status at the TCR
gene locus showed a
severe impairment in V to DJ rearrangements (Fig. 6B) in
HEBbm/bm mice. While wild-type mice show
efficient and random V(D)J rearrangements in both total thymocytes and
sorted DN3 cells, HEBbm/bm mice show very
inefficient and sporadic V(D)J rearrangements in total thymocytes and
no VDJ rearrangements in sorted DN3 cells (Fig. 6B and data not shown
for V
5 to J
2 rearrangements). This phenotype is in sharp contrast
to that of HEBko/ko mice, which show relatively
normal V(D)J rearrangements at the TCR
gene locus
(5). These results indicate that E-protein dimers, most
likely the E2A-HEB heterodimers, are required for V(D)J rearrangements
at the TCR
gene locus.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
(A) PCR analysis of TCR gene DJ rearrangement.
DNA samples were prepared from either total thymocytes or sorted
CD25+ CD44 DN3 cells of 2- to 3-week-old
mice. DJ rearrangement products from the D 2 and J 2 region were
analyzed by PCR with D 2 and J 2.6 primers. PCR products were
blotted and hybridized with a J segment-specific probe. The expected DJ
rearrangement products are indicated on the right. Samples in the blot
are toe DNA (lane 1), a 1-kb size ladder (lane 2), wild-type total
thymocytes (lane 3), HEBbm/bm total thymocytes
(lane 4), HEBbm/bm DN3 cells (lane 5), and
wild-type DN3 cells (lane 6). (B) PCR analysis of TCR gene VDJ
rearrangement. DNA used in the DJ rearrangement assay were PCR
amplified with V 8 and J 2.6 primers. PCR products with expected
J usage are indicated on the left. Samples in the blot are wild-type
total thymocytes (lane 1), wild-type DN3 cells (lane 2),
HEBbm/bm total thymocytes (lane 3), and
HEBbm/bm DN3 cells (lane 4). Similar results
were obtained with V 5 and J 2.6 primers.
|
|
DN cells in HEBbm/bm mice cannot be rescued
to the DP stage by forced expression of a functional TCR
transgene.
Expression of a functional TCR is necessary and
sometimes sufficient for DN3 cells to progress to the DP stage and
later from the DP to the SP stage (33). We therefore
attempted to rescue the V(D)J recombination defect in
HEBbm/bm mice by introducing a functional
TCR
/
transgene. AND is a functional
/
TCR
transgene capable of overcoming the block imposed by the RAG2 gene knockout, which arrests T-cell development at the
DN3 stage. As previously reported (18), expression of this
transgene in both H-2b and H-2k backgrounds
with endogenous peptides will drive major histocompatibility complex
class II-dependent positive selection, resulting in an increased CD4 SP
population (Fig. 7A). When AND was bred to
the HEBbm/bm background, we saw no increase in
DP population and thymic cellularity. However, an increase in the
percentage of CD4 SP cells is clearly visible, indicating that
AND is expressed and capable of driving differentiation from
the DP to the SP stage (Fig. 7A). An analysis of peripheral T cells
from adult double transgenic mice also confirmed that the
AND transgene failed to rescue the developmental block imposed by HEBbm. No substantial increase in numbers or
percentage of total lymph node T cells was seen due to the addition of
the AND transgene in HEBbm/bm mice
(Fig. 7B). This study indicates that impaired V(D)J recombination is
not sufficient to explain the developmental arrest in the
HEBbm/bm mice. It implies that E2A-HEB
heterodimers are also involved in controlling other genes, which
function downstream or parallel to the TCR signaling pathway.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
The AND TCR transgene cannot rescue the
HEBbm mutation. (A) E18.5 fetal thymuses were
analyzed by costaining with CD8, CD4, and TCR antibodies. Size plots
are shown with genotypes indicated on the top. Cells highlighted in the
R1 gate in the size plots (top panel) are displayed for CD4/CD8
staining (bottom panel). Data are representative of multiple litters.
(B) Lymph nodes of single and double transgenic mice were analyzed with
CD8, CD4, and 7AAD. The percentages of CD4 single positive and CD8
single positive populations are indicated in the CD4/CD8 plots. The
total cell number of inguinal lymph nodes for each genotype analyzed is
given on the top. Similar results were obtained from the analysis of
splenocytes.
|
|
Although no significant increase in thymic cellularity is seen after
introduction of
AND into
HEBbm mice,
a substantial increase in the ratio of CD4 SP to DP cells
is detected
in the thymus. These CD4 SP cells express a normal
level of
AND TCR on their cell surface, suggesting that they are
resulting from
AND-mediated positive selection. This
observation
indicates that E2A-HEB heterodimers are dispensable during
differentiation
from the DP to the CD4 SP stage. Because of a
persistent block
in the transition from DN to DP, the absolute number
of CD4 SP
cells remains small in both thymus and peripheral lymphoid
organs.
The appearance of phenotypically normal CD4 SP cells in thymus
also indicates that the CD4 expression is not absolutely dependent
on
E2A-HEB heterodimers at this stage of
development.
 |
DISCUSSION |
In summary, we have shown that the dominant negative
HEBbm allele blocks T-cell development at an
earlier stage than the previously reported HEB knockout
allele. This observation provides the strongest genetic evidence to
date to support the notion that E2A-HEB heterodimers are the major bHLH
dimers involved in early T-cell development. Results from our study of
HEBbm mice suggest that E2A-HEB heterodimers may
play a role in T cells similar to that of E2A homodimers in B cells. In
both cell lineages, E-proteins may be directly involved in regulating
the lymphoid cell-specific genes, such as TCR genes in T cells and Ig
genes in B cells. The use of different E-protein dimers in B- and
T-cell lineage development may reflect a need for lineage-restricted gene expression.
The dominant negative mutation reveals multiple roles of HEB in
T-cell development.
Earlier studies have indicated that E2A
homodimers directly control B-cell development. A search for the
counterpart of E2A dimers involved in T-cell development has led us to
investigate HEB function. HEB is highly homologous to E2A and is highly
expressed in thymocytes (15). Disruption of the
HEB gene leads to impaired T-cell development with a
developmental block at the transition from the DN to the DP stage
(5). However, TCR
gene expression and rearrangement seem
unaffected by HEB disruption. Moreover, T cells can develop
to maturity in HEB knockout mice, albeit at a reduced
frequency and with delayed timing. We now show that a mutation in the
DNA-binding domain of HEB induces a tighter and earlier block in T-cell
development. Therefore, the dominant negative approach reveals a
function of HEB which could not be seen by conventional gene knockout studies.
Studies by Heemskerk et al. have shown that retrovirus-mediated
expression of Id3 in CD34
+ progenitors can promote NK cell
development at the expense of
the T-cell lineage in fetal thymic organ
culture (
14). Further,
ectopic expression of the same Id3
retroviral construct in pro-T
cells leads to specific inhibition of

/

but not

/

T-cell lineage
development (
8).
Works from two other groups have also shown
that a strong block in
T-cell development is induced in transgenic
animals overexpressing Id1
or Id2 under the control of the
lck proximal promoter
(
20,
24). Our observations from HEB
bm studies
are generally in agreement with these reports. The fact
that
HEB
bm inhibits

/

but not

/

T-cell lineage
development indicates
a highly restricted role for HEB in lymphoid
lineage cells after
their commitment to the T-cell lineage. We have
also carried out
a preliminary study to evaluate the potential role of
HEB in NK
cell development in the thymus. Analysis of fetal thymi from
three
HEBbm/bm and four wild-type and
HEBbm/+ littermate controls showed that the
number of NK1.1-positive
cells per thymus is decreased approximately
10-fold in
HEBbm/bm. We do not know at the
present time if this inhibition on thymic
NK cell development is
intrinsic to the NK cell lineage or regulated
by other cells in the
thymus.
One caveat in Id overexpression studies is that one cannot distinguish
which E-protein dimer is specifically inhibited by
Id. In addition, the
postulated interaction between Id2 and Rb
proteins (
16)
further complicated the interpretation of the
results. The use of the
knockin rather than the transgenic approach
renders protein expression
at a physiological level. Thus, the
dominant negative effect of
HEB
bm is most likely reflecting a real function of HEB in
the T-cell
lineage. In the absence of the wild-type
HEB
gene, escalating
phenotypes were found due to sequential introduction
of one and
two copies of
HEBbm. Zero copy (for
HEBko/ko mice), one copy (for
HEBbm/ko mice), and two copies (for
HEBbm/bm mice) of HEB
bm render a
partial block in ISP and DP development, a complete
block before SP,
and a complete block before ISP and DP, respectively.
This result
suggests that HEB is required for T-cell development
in at least three
distinct developmental stages: DN, ISP, and
the transition from DP to
SP. It is not clear whether the dimerization
partners of HEB in these
three developmental stages are the same.
We provided biochemical
evidence that this HEB
bm protein is capable of dimerizing
with E47 proteins and consequently
reduces the DNA-binding ability of
E47. It is formally possible
that the dominant negative effect of
HEB
bm proteins could result from their ability to dimerize
with an
unknown bHLH protein partner instead of E2A. However, the
existence
of such a bHLH protein is not supported by the EMSA analysis
with
CD4-3 E-box
sites.
E2A-HEB heterodimer activity is associated with lineage
differentiation but not commitment.
Results from this study do not
exclude the possibility that E2A homodimers may play a separate role
prior to the DN3 stage, as has been implicated in the study of
E2A knockout mice (3). Bain et al. have reported
a proportional increase of DN1 thymocytes in mice carrying mutant
alleles of E2A (4), which indicates that E2A may
be needed for T-cell lineage commitment. Presumably, the
HEBbm allele can effectively function as a
dominant negative gene only in developmental stages where it is highly
expressed. In fact, B-cell development is only mildly affected by the
HEBbm allele, which is consistent with
observations that E2A is expressed at a much higher level than HEB in
the B-cell lineage (data not shown). The strong block in thymopoiesis
at the DN3 stage suggests that E2A-HEB heterodimers are specifically
required for lineage differentiation rather than commitment. It is
plausible that a switch from E2A homodimers to E2A-HEB heterodimers may
have occurred after T-cell lineage commitment.
Are E2A homodimers and E2A-HEB heterodimers functionally
equivalent?
It will be important to determine the functional
specificity of individual E-protein dimers. E2A protein homodimers have
been suggested to provide tissue-specific function in regulating
lymphoid- and B-cell-specific genes (3, 7, 9, 19, 31, 34). T-cell-restricted heterodimerization between E2A and HEB may be necessary for eliminating E2A homodimers, which would otherwise lead to
activation of B-cell-specific genes. This argument is supported by
detailed characterization of E2Aheb mice whose
E2A gene is replaced by HEB (47). Due
to gene replacement, these mice express no E2A proteins but an excess
amount of HEB proteins. We have shown that B-cell deficiency induced by
E2A knockout is only partially rescued by the addition of
extra copies of HEB. Interestingly, the thymic phenotype of
E2Aheb resembles that of
E2Ako rather than that of the wild-type animals
(data not shown). Therefore, HEB homodimers and E2A-HEB heterodimers
are not equally efficient in supporting T-cell development, even if
they were produced to the same level.
Possible roles for E2A-HEB heterodimers both before and after
TCR
gene rearrangement.
The defect in V(D)J
recombination at the TCR
gene locus indicates a possible
role of E2A-HEB heterodimers in regulating TCR
gene
expression and/or rearrangement. This result substantiates recent work
by Tripathi et al. showing that the TCR
gene
rearrangement is critically dependent on two E-box sites present in the
TCR
gene enhancer (37). However, our finding
did not rule out the possibility that the defect in TCR
gene rearrangement is due to altered expression of other genes, such as
RAG1 and RAG2, required for normal
TCR
gene activation and rearrangement. Similarly, the
results from the AND transgenic rescue experiment may also be due to lack of proper expression of CD3 or other TCR components needed for proper function of the AND transgene. To address
these possibilities, we have carried out reverse transcriptase-PCR
analysis on sorted DN3 cells to evaluate the expression of selected
genes relevant to thymocyte development. This preliminary study shows that the expression of RAG1, p56lck, SLP-76, IL-7R, TdT,
and pre-T
are the same in HEBbm and wild-type mice;
RAG2, CD3
, and CD3
are decreased in HEBbm mice; and
CD3
expression is increased in HEBbm mice (data not
shown). Although this analysis did not provide a simple answer to the
question, these results clearly indicate that E-proteins may regulate
multiple genes in T-cell development.
The use of E2A-HEB heterodimers instead of E2A homodimers in the T-cell
lineage may provide one possible means for T-cell-specific
gene
expression. This partially explains why
TCR genes but not
Ig
genes are activated in the T-cell lineage while Ig genes but
not
TCR genes are activated in the B-cell lineage. Further tests
are needed to determine if E2A-HEB heterodimers are sufficient
to
activate the
TCR
gene
locus.
 |
ACKNOWLEDGMENTS |
We thank Jenifer Hanrahan and Reshma Rangwala for assistance in
making constructs, Mike Cook for assistance in flow cytometry analysis,
and Lihua Pan, Jenifer Hanrahan, Steve Greenbaum, Curtis Bradney, and
Michael Krangel for critical reading of the manuscript.
This work has been supported by the Leukemia Society of America
Scholarship, the Whitehead Scholarship, and NIH grants
(R01CA72433 and R01GM59638) to Y.Z.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Immunology, Box 3010, Duke University Medical Center, Durham, NC 27710. Phone: (919) 613-7824. Fax: (919) 684-8982. E-mail:
yzhuang{at}acpub.duke.edu.
 |
REFERENCES |
| 1.
|
Bain, G.,
S. Gruenwald, and C. Murre.
1993.
E2A and E2-2 are subunits of B-cell-specific E2-box DNA-binding proteins.
Mol. Cell. Biol.
13:3522-3529[Abstract/Free Full Text].
|
| 2.
|
Bain, G.,
E. C. Maandag,
D. J. Izon,
D. Amsen,
A. M. Kruisbeek,
B. C. Weintraub,
I. Krop,
M. S. Schlissel,
A. J. Feeney,
M. van Roon,
M. van der Valk,
H. P. J. te Riele,
A. Berns, and C. Murre.
1994.
E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements.
Cell
79:885-892[CrossRef][Medline].
|
| 3.
|
Bain, G.,
E. C. R. Maandag,
H. P. te Riele,
A. J. Feeney,
A. Sheehy,
M. Schlissel,
S. A. Shinton,
R. R. Hardy, and C. Murre.
1997.
Both E12 and E47 allow commitment to the B cell lineage.
Immunity
6:145-154[CrossRef][Medline].
|
| 4.
|
Bain, G.,
I. Engel,
E. C. R. Maandag,
H. P. J. te Reile,
J. R. Voland,
L. L. Sharp,
J. Chun,
B. Huey,
D. Pinkel, and C. Murre.
1997.
E2A deficiency leads to abnormalities in / T-cell development and to rapid development of T-cell lymphomas.
Mol. Cell. Biol.
17:4782-4791[Abstract].
|
| 5.
|
Barndt, R. J.,
M. F. Dai, and Y. Zhuang.
1999.
A novel role for HEB downstream or parallel to the pre-TCR signal during alpha/beta thymopoiesis.
J. Immunology
163:3331-3343[Abstract/Free Full Text].
|
| 6.
|
Benezra, R.,
R. L. Davis,
D. Lockshon,
D. L. Turner, and H. Weintraub.
1990.
The protein Id: a negative regulator of helix-loop-helix DNA binding proteins.
Cell
61:49-59[CrossRef][Medline].
|
| 7.
|
Benezra, R.
1994.
An intermolecular disulfide bond stabilizes E2A homodimers and is required for DNA binding at physiological temperatures.
Cell
79:1057-1067[CrossRef][Medline].
|
| 8.
|
Blom, B.,
M. H. Heemskerk,
M. C. Verschuren,
J. J. van Dongen,
A. P. Stegmann,
A. Q. Bakker,
F. Couwenberg,
P. C. Res, and H. Spits.
1999.
Disruption of alpha beta but not of gamma delta T cell development by overexpression of the helix-loop-helix protein Id3 in committed T cell progenitors.
EMBO J.
18:2793-2802[CrossRef][Medline].
|
| 9.
|
Choi, J. K.,
C. P. Shen,
H. S. Radomska,
L. A. Eckhardt, and T. Kadesch.
1997.
E47 activates the Ig-heavy chain and TdT loci in non-B cells.
EMBO J.
15:5014-5021[Medline].
|
| 10.
|
Dudley, E. C.,
H. T. Petrie,
L. M. Shah,
M. J. Owen, and A. C. Hayday.
1994.
T cell receptor beta chain gene rearrangement and selection during thymocyte development in adult mice.
Immunity
1:83-93[CrossRef][Medline].
|
| 11.
|
Fehling, H. J., and H. von Boehmer.
1997.
Early  T-cell development in the thymus of normal and genetically altered mice.
Curr. Opin. Immunol.
9:263[CrossRef][Medline].
|
| 12.
|
Georgopolos, K.,
D. D. Moore,
J.-H. Wang,
A. Molnar,
P. Wu,
S. Winandy, and A. Sharpe.
1994.
The Ikaros gene is required for the development of all lymphoid lineages.
Cell
79:143-156[CrossRef][Medline].
|
| 13.
|
Godfrey, D. I.,
J. Kennedy,
T. Suda, and A. Zlotnik.
1993.
A developmental pathway involving four phenotypically and functionally distinct subsets of CD3-CD4-CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25 expression.
J. Immunol.
150:4244[Abstract].
|
| 14.
|
Heemskerk, M. H.,
B. Blom,
G. Nolan,
A. P. Stegmann,
A. Q. Bakker,
K. Weijer,
P. C. Res, and H. Spits.
1997.
Inhibition of T cell and promotion of natural killer cell development by the dominant negative helix loop helix factor Id3.
J. Exp. Med.
186:1597-1602[Abstract/Free Full Text].
|
| 15.
|
Hu, J.-S.,
E. N. Olson, and R. E. Kingston.
1992.
HEB, a helix-loop-helix protein related to E2A and ITF2 that can modulate the DNA-binding ability of myogenic regulatory factors.
Mol. Cell. Biol.
12:1031-1042[Abstract/Free Full Text].
|
| 16.
|
Iavarone, A.,
P. Garg,
A. Lasorella,
J. Hsu, and M. A. Israel.
1994.
The helix-loop-helix protein Id-2 enhances cell proliferation and binds to the retinoblastoma protein.
Genes Dev.
8:1270-1284[Abstract/Free Full Text].
|
| 17.
|
Kadesch, T.
1992.
Helix-loop-helix proteins in the regulation of immunoglobulin gene transcription.
Immunol. Today
13:31-36[CrossRef][Medline].
|
| 18.
|
Kaye, J.,
M.-L. Hsu,
M.-E. Sauron,
S. C. Jameson,
N. R. J. Gascoigne, and S. M. Hedrick.
1989.
Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor.
Nature
341:746[CrossRef][Medline].
|
| 19.
|
Kee, B. L., and C. Murre.
1998.
Induction of early B cell factor (EBF) and multiple B lineage genes by the basic helix-loop-helix transcription factor E12.
J. Exp. Med.
188:699-713[Abstract/Free Full Text].
|
| 20.
|
Kim, D.,
D. C. Peng, and X. H. Sun.
1999.
Massive apoptosis of thymocytes in T-cell-deficient Id1 transgenic mice.
Mol. Cell. Biol.
19:8240-8253[Abstract/Free Full Text].
|
| 21.
|
Klein, E. S.,
D. M. Simmons,
L. W. Swanson, and M. G. Rosenfeld.
1993.
Tissue-specific RNA splicing generates an ankyrin-like domain that affects the dimerization and DNA-binding properties of a bHLH protein.
Genes Dev.
7:55-71[Abstract/Free Full Text].
|
| 22.
|
Molina, T. J.,
K. Kishihara,
D. P. Siderovski,
W. van Ewijk,
A. Narendran,
E. Timms,
A. Wakeham,
C. J. Paige,
K. U. Hartmann,
A. Veillette,
D. Davidson, and T. W. Mak.
1992.
Profound block in thymocyte development in mice lacking p56lck.
Nature
357:161[CrossRef][Medline].
|
| 23.
|
Mombaerts, P.,
S. J. Anderson,
R. M. Perlmutter,
T. W. Mak, and S. Tonegawa.
1994.
An activated lck transgene promotes thymocyte development in RAG-1 mutant mice.
Immunity
1:261[CrossRef][Medline].
|
| 24.
|
Morrow, M. A.,
E. W. Mayer,
C. A. Perez,
M. Adlam, and G. Siu.
1999.
Overexpression of the helix-loop-helix protein Id2 blocks T cell development at multiple stages.
Mol. Immunol.
36:491-503[CrossRef][Medline].
|
| 25.
|
Murre, C.,
P. S. McCaw, and D. Baltimore.
1989.
A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins.
Cell
56:777-783[CrossRef][Medline].
|
| 26.
|
Murre, C.,
P. S. McCaw,
H. Vaessin,
M. Caudy,
L. Y. Jan,
Y. N. Jan,
C. V. Cabrera,
J. N. Buskin,
S. D. Hauschka,
A. B. Lassar,
H. Weintraub, and D. Baltimore.
1989.
Interactions between heterodimeric helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence.
Cell
58:537-544[CrossRef][Medline].
|
| 27.
|
Okamura, R. M.,
M. Sigvardsson,
J. Galceran,
S. Verbeek,
H. Clevers, and R. Grosschedl.
1998.
Redundant regulation of T cell differentiation and TCRalpha gene expression by the transcription factors LEF-1 and TCF-1.
Immunity
8:11-20[CrossRef][Medline].
|
| 28.
|
Pivniouk, V.,
E. Tsitsikov,
P. Swinton,
G. Rathbun,
F. W. Alt, and R. S. Geha.
1998.
Impaired viability and profound block in thymocyte development in mice lacking the adaptor protein SLP-76.
Cell
94:229-238[CrossRef][Medline].
|
| 29.
|
Roberts, J. L.,
P. Lauzurica, and M. S. Krangel.
1997.
Developmental regulation of VDJ recombination by the core fragment of the T cell receptor alpha enhancer.
J. Exp. Med.
185:131-140[Abstract/Free Full Text].
|
| 30.
|
Sawada, S., and D. R. Littman.
1993.
A heterodimer of HEB and an E12-related protein interacts with the CD4 enhancer and regulates its activity in T-cell lines.
Mol. Cell. Biol.
13:5620[Abstract/Free Full Text].
|
| 31.
|
Schlissel, M.,
A. Voronova, and D. Baltimore.
1991.
Helix-loop-helix transcription factor E47 activates germ-line immunoglobulin heavy-chain gene transcription and rearrangement in a pre-T-cell line.
Genes Dev.
5:1367-1376[Abstract/Free Full Text].
|
| 32.
|
Shen, C.-P., and T. Kadesch.
1995.
B-cell-specific DNA binding by an E47 homodimer.
Mol. Cell. Biol.
15:4518-4524[Abstract].
|
| 33.
|
Shinkai, Y.,
S. Koyasu,
K.-I. Nakayama,
K. Murphy,
D. Y. Loh,
E. L. Reinherz, and F. W. Alt.
1993.
Restoration of T cell development to RAG-2-deficient mice by functional TCR transgenes.
Science
259:822[Abstract/Free Full Text].
|
| 34.
|
Sigvardsson, M.,
M. O'Riordan, and R. Grosschedl.
1997.
EBF and E47 collaborate to induce expression of the endogenous immunoglobulin surrogate light chain genes.
Immunity
7:25-36[CrossRef][Medline].
|
| 35.
|
Sun, X.-H.
1994.
Constitutive expression of the Id1 genes impairs mouse B cell development.
Cell
79:893-900[CrossRef][Medline].
|
| 36.
|
Ting, C. N.,
M. C. Olson,
K. P. Barton, and J. M. Leiden.
1996.
Transcription factor GATA-3 is required for development of the T-cell lineage.
Nature
384:474-478[CrossRef][Medline].
|
| 37.
|
Tripathi, R. K.,
N. Mathieu,
S. Spicuglia,
D. Payet,
C. Verthuy,
G. Bouvier,
D. Depetris,
M. G. Mattei,
W. M. Hempel, and P. Ferrier.
2000.
Definition of a T-cell receptor gene core enhancer of V(D)J recombination by transgenic mapping.
Mol. Cell. Biol.
20:42-53[Abstract/Free Full Text].
|
| 38.
|
Van Meerwijk, J. P.,
H. Bluthmann, and M. Steinmetz.
1990.
T-cell specific rearrangement of T-cell receptor beta transgenes in mice.
EMBO J.
9:1057[Medline].
|
| 39.
|
Van Oers, N. S.,
B. Lowin-Kropf,
D. Finlay,
K. Connolly, and A. Weiss.
1996.
Alpha beta T cell development is abolished in mice lacking both Lck and Fyn protein tyrosine kinases.
Immunity
5:429-436[CrossRef][Medline].
|
| 40.
|
Verbeek, S.,
D. Izon,
F. Hofhuis,
E. Robanus-Maandag,
H. te Riele,
M. van de Wetering,
M. Oosterwegel,
A. Wilson,
H. R. MacDonald, and H. Clevers.
1995.
An HMG-box-containing T-cell factor required for thymocyte differentiation.
Nature
374:70-74[CrossRef][Medline].
|
| 41.
|
Voronova, A., and D. Baltimore.
1990.
Mutations that disrupt DNA binding and dimer formation in the E47 helix-loop-helix protein map to distinct domains.
Proc. Natl. Acad. Sci. USA
87:4722-4726[Abstract/Free Full Text].
|
| 42.
|
Wang, J. H.,
A. Nichogiannopoulou,
L. Wu,
L. Sun,
A. H. Sharpe,
M. Bigby, and K. Georgopoulos.
1996.
Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation.
Immunity
5:537-549[CrossRef][Medline].
|
| 43.
|
Weintraub, H.,
R. Davis,
S. Tapscott,
M. Thayer,
M. Krause,
R. Benezra,
T. K. Blackwell,
D. Turner,
R. Rupp,
S. Hollenberg,
Y. Zhuang, and A. Lassar.
1991.
The myoD gene family: nodal point during specification of the muscle cell lineage.
Science
251:761-766[Abstract/Free Full Text].
|
| 44.
|
Zhang, W.,
C. L. Sommers,
D. N. Burshtyn,
C. C. Stebbins,
J. B. DeJarnette,
R. P. Trible,
A. Grinberg,
H. C. Tsay,
H. M. Jacobs,
C. M. Kessler,
E. O. Long,
P. E. Love, and L. E. Samelson.
1999.
Essential role of LAT in T cell development.
Immunity
10:323-332[CrossRef][Medline].
|
| 45.
|
Zhuang, Y.,
P. Soriano, and H. Weintraub.
1994.
The helix-loop-helix gene E2A is required for B cell formation.
Cell
79:875-884[CrossRef][Medline].
|
| 46.
|
Zhuang, Y.,
P. Cheng, and H. Weintraub.
1996.
B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB.
Mol. Cell. Biol.
16:2898-2905[Abstract].
|
| 47.
|
Zhuang, Y.,
R. J. Bardnt,
L. Pan,
R. Kelley, and M. Dai.
1998.
Functional replacement of the mouse E2A gene with a human HEB cDNA.
Mol. Cell. Biol.
18:3340-3349[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 2000, p. 6677-6685, Vol. 20, No. 18
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Guo, C., Hu, Q., Yan, C., Zhang, J.
(2009). Multivalent Binding of the ETO Corepressor to E Proteins Facilitates Dual Repression Controls Targeting Chromatin and the Basal Transcription Machinery. Mol. Cell. Biol.
29: 2644-2657
[Abstract]
[Full Text]
-
Ueda-Hayakawa, I., Mahlios, J., Zhuang, Y.
(2009). Id3 Restricts the Developmental Potential of {gamma}{delta} Lineage during Thymopoiesis. J. Immunol.
182: 5306-5316
[Abstract]
[Full Text]
-
Semerad, C. L., Mercer, E. M., Inlay, M. A., Weissman, I. L., Murre, C.
(2009). E2A proteins maintain the hematopoietic stem cell pool and promote the maturation of myelolymphoid and myeloerythroid progenitors. Proc. Natl. Acad. Sci. USA
106: 1930-1935
[Abstract]
[Full Text]
-
Ko, J., Patel, N., Ikawa, T., Kawamoto, H., Frank, O., Rivera, R. R., Van Etten, R. A., Murre, C.
(2008). Suppression of E-protein activity interferes with the development of BCR-ABL-mediated myeloproliferative disease. Proc. Natl. Acad. Sci. USA
105: 12967-12972
[Abstract]
[Full Text]
-
Nie, L., Perry, S. S., Zhao, Y., Huang, J., Kincade, P. W., Farrar, M. A., Sun, X.-H.
(2008). Regulation of Lymphocyte Development by Cell-Type-Specific Interpretation of Notch Signals. Mol. Cell. Biol.
28: 2078-2090
[Abstract]
[Full Text]
-
Fujimoto, S., Ikawa, T., Kina, T., Yokota, Y.
(2007). Forced expression of Id2 in fetal thymic T cell progenitors allows some of their progeny to adopt NK cell fate. Int Immunol
19: 1175-1182
[Abstract]
[Full Text]
-
Wojciechowski, J., Lai, A., Kondo, M., Zhuang, Y.
(2007). E2A and HEB Are Required to Block Thymocyte Proliferation Prior to Pre-TCR Expression. J. Immunol.
178: 5717-5726
[Abstract]
[Full Text]
-
Yang, Y., Liou, H.-C., Sun, X.-H.
(2006). Id1 Potentiates NF-{kappa}B Activation upon T Cell Receptor Signaling. J. Biol. Chem.
281: 34989-34996
[Abstract]
[Full Text]
-
Clements, J. L., John, S. A., Garrett-Sinha, L. A.
(2006). Impaired Generation of CD8+ Thymocytes in Ets-1-Deficient Mice. J. Immunol.
177: 905-912
[Abstract]
[Full Text]
-
Wang, D., Claus, C. L., Vaccarelli, G., Braunstein, M., Schmitt, T. M., Zuniga-Pflucker, J. C., Rothenberg, E. V., Anderson, M. K.
(2006). The Basic Helix-Loop-Helix Transcription Factor HEBAlt Is Expressed in Pro-T Cells and Enhances the Generation of T Cell Precursors. J. Immunol.
177: 109-119
[Abstract]
[Full Text]
-
Schwartz, R., Engel, I., Fallahi-Sichani, M., Petrie, H. T., Murre, C.
(2006). Gene expression patterns define novel roles for E47 in cell cycle progression, cytokine-mediated signaling, and T lineage development. Proc. Natl. Acad. Sci. USA
103: 9976-9981
[Abstract]
[Full Text]
-
Ikawa, T., Kawamoto, H., Goldrath, A. W., Murre, C.
(2006). E proteins and Notch signaling cooperate to promote T cell lineage specification and commitment. JEM
203: 1329-1342
[Abstract]
[Full Text]
-
Borghesi, L., Aites, J., Nelson, S., Lefterov, P., James, P., Gerstein, R.
(2005). E47 is required for V(D)J recombinase activity in common lymphoid progenitors. JEM
202: 1669-1677
[Abstract]
[Full Text]
-
Lefebvre, J. M., Haks, M. C., Carleton, M. O., Rhodes, M., Sinnathamby, G., Simon, M. C., Eisenlohr, L. C., Garrett-Sinha, L. A., Wiest, D. L.
(2005). Enforced Expression of Spi-B Reverses T Lineage Commitment and Blocks {beta}-Selection. J. Immunol.
174: 6184-6194
[Abstract]
[Full Text]
-
Carabana, J., Ortigoza, E., Krangel, M. S.
(2005). Regulation of the Murine D{delta}2 Promoter by Upstream Stimulatory Factor 1, Runx1, and c-Myb. J. Immunol.
174: 4144-4152
[Abstract]
[Full Text]
-
Huang, Z., Nie, L., Xu, M., Sun, X.-H.
(2004). Notch-Induced E2A Degradation Requires CHIP and Hsc70 as Novel Facilitators of Ubiquitination. Mol. Cell. Biol.
24: 8951-8962
[Abstract]
[Full Text]
-
Qi, Z., Sun, X.-H.
(2004). Hyperresponse to T-Cell Receptor Signaling and Apoptosis of Id1 Transgenic Thymocytes. Mol. Cell. Biol.
24: 7313-7323
[Abstract]
[Full Text]
-
Ko, M., Ahn, J., Lee, C., Chung, H., Jeon, S. H., Chung, H.-Y., Seong, R. H.
(2004). E2A/HEB and Id3 Proteins Control the Sensitivity to Glucocorticoid-induced Apoptosis in Thymocytes by Regulating the SRG3 Expression. J. Biol. Chem.
279: 21916-21923
[Abstract]
[Full Text]
-
Quong, M. W., Martensson, A., Langerak, A. W., Rivera, R. R., Nemazee, D., Murre, C.
(2004). Receptor Editing and Marginal Zone B Cell Development Are Regulated by the Helix-Loop-Helix Protein, E2A. JEM
199: 1101-1112
[Abstract]
[Full Text]
-
Bradney, C., Hjelmeland, M., Komatsu, Y., Yoshida, M., Yao, T.-P., Zhuang, Y.
(2003). Regulation of E2A Activities by Histone Acetyltransferases in B Lymphocyte Development. J. Biol. Chem.
278: 2370-2376
[Abstract]
[Full Text]
-
Engel, I., Murre, C.
(2002). Disruption of pre-TCR expression accelerates lymphomagenesis in E2A-deficient mice. Proc. Natl. Acad. Sci. USA
99: 11322-11327
[Abstract]
[Full Text]
-
Pan, L., Hanrahan, J., Li, J., Hale, L. P., Zhuang, Y.
(2002). An Analysis of T Cell Intrinsic Roles of E2A by Conditional Gene Disruption in the Thymus. J. Immunol.
168: 3923-3932
[Abstract]
[Full Text]
-
Smith, J. E. III, Cronmiller, C.
(2001). The Drosophila daughterless gene autoregulates and is controlled by both positive and negative cis regulation. Development
128: 4705-4714
[Abstract]
[Full Text]
-
Engel, I., Johns, C., Bain, G., Rivera, R. R., Murre, C.
(2001). Early Thymocyte Development Is Regulated by Modulation of E2A Protein Activity. JEM
194: 733-746
[Abstract]
[Full Text]
-
Takeuchi, A., Yamasaki, S., Takase, K., Nakatsu, F., Arase, H., Onodera, M., Saito, T.
(2001). E2A and HEB Activate the Pre-TCR{alpha} Promoter During Immature T Cell Development. J. Immunol.
167: 2157-2163
[Abstract]
[Full Text]
-
Staal, F. J.T., Weerkamp, F., Langerak, A. W., Hendriks, R. W., Clevers, H. C.
(2001). Transcriptional Control of T Lymphocyte Differentiation. Stem Cells
19: 165-179
[Abstract]
[Full Text]