Previous Article | Next Article 
Molecular and Cellular Biology, September 2000, p. 6816-6825, Vol. 20, No. 18
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Human Genomic Sequences That Inhibit
Splicing
William G.
Fairbrother and
Lawrence A.
Chasin*
Department of Biological Sciences, Columbia
University, New York, New York 10027
Received 25 February 2000/Returned for modification 17 April
2000/Accepted 23 June 2000
 |
ABSTRACT |
Mammalian genes are characterized by relatively small exons
surrounded by variable lengths of intronic sequence. Sequences similar
to the splice signals that define the 5' and 3' boundaries of these
exons are also present in abundance throughout the surrounding introns.
What causes the real sites to be distinguished from the multitude of
pseudosites in pre-mRNA is unclear. Much progress has been made in
defining additional sequence elements that enhance the use of
particular sites. Less work has been done on sequences that repress the
use of particular splice sites. To find additional examples of
sequences that inhibit splicing, we searched human genomic DNA
libraries for sequences that would inhibit the inclusion of a
constitutively spliced exon. Genetic selection experiments suggested
that such sequences were common, and we subsequently tested randomly
chosen restriction fragments of about 100 bp. When inserted into the
central exon of a three-exon minigene, about one in three inhibited
inclusion, revealing a high frequency of inhibitory elements in human
DNA. In contrast, only 1 in 27 Escherichia coli DNA
fragments was inhibitory. Several previously identified silencing
elements derived from alternatively spliced exons functioned weakly in
this constitutively spliced exon. In contrast, a high-affinity site for
U2AF65 strongly inhibited exon inclusion. Together, our results suggest
that splicing occurs in a background of repression and, since many of
our inhibitors contain splice like signals, we suggest that
repression of some pseudosites may occur through an inhibitory
arrangement of these sites.
 |
INTRODUCTION |
The removal of introns during
pre-mRNA splicing represents a fundamental step in the transfer of
information from DNA to protein. Introns are defined by at least three
discrete elements: the 5' splice site, the branch point, and the 3'
splice site. The spliceosome assembles around these three elements and
excises introns with high fidelity in an ordered, stepwise process. In
the yeast genes that contain introns, the almost perfect agreement of
these elements with three consensus sequences appears sufficient to
account for a high fidelity of splicing. Higher eukaryotes, on the
other hand, have larger introns defined by more-degenerate splicing
signals. In general, these large introns contain many close matches to the 5' and 3' splice site consensus sequences (54). These
pseudosites often compare favorably to real splice sites yet are not
used in the splicing reaction. Discovering what causes real sites to be
used in favor of these sometimes stronger pseudosites is fundamental to
our understanding of pre-mRNA processing.
Since consensus sequences for splice sites were first compiled
(43), there has been much effort devoted to finding
additional requirements that predict whether a site will be used. It
has been proposed that a branch point, a 3' splice site, and a 5' splice site are recognized as a tripartite signal defining an exon
rather than an intron (52). Several lines of experimental evidence support this exon definition model. (i) Downstream 5' splice
sites have a stimulatory effect on splicing at an upstream 3' splice
sites in single intron constructs (20, 52). (ii) The
predominant phenotype of a mutation in a splice site of an internal
exon is exon skipping rather than intron retention or the activation of
a cryptic site (12, 36, 48). (iii) Mutations at a 5' splice
site that eliminate splicing can be suppressed by additional mutations
that strengthen the upstream 3' splice site across the exon
(12).
The exon definition model implies a bridging activity across an exon,
possibly leading to steric constraints on the size of an exon.
Consistent with this idea, most human exons are between 50 and 200 nucleotides (nt) long (30, 67). Reducing exon size to <50
nt can impose a requirement for a splicing enhancer element (25,
32) or require the transient definition of a larger exon intermediate (59). However, a constraint based on maximum
length is less clear (15, 29, 59, 61). A substantial
minority of true exons fall outside this size range, and the close
grouping of false splice sites within introns is such that many of them define pseudoexons that fall within the permissive size range (54). Thus, it seems unlikely that exon size could be a
general factor in the distinction between true and false splice sites.
It has been known for some time that many alternatively spliced exons,
small exons, or exons with weak splice sites rely upon the activity of
enhancers for their inclusion in mRNA (65). These enhancers
are often purine rich and in some cases have been shown to function by
binding SR proteins (24, 39, 60). The SR proteins, in turn,
are thought to act by recruiting additional splicing factors. For
instance, enhancers of splicing at 3' sites have been shown to promote
binding of U2AF65 to the polypyrimidine tract (64). However,
a recent analysis of alternative splicing of immunoglobulin transcripts
showed that enhancers can also act by countering the effect of an
inhibitory element (33), rather than by a positive
recruitment mechanism. Enhancers have also been proposed to act in the
definition of constitutively spliced exons. The constitutively spliced
-globin exon 2 has been shown to contain enhancer elements, with
several discrete sequences interacting with specific SR proteins
(40, 53). The presence of enhancers in
-globin, however,
do not seem to reflect a general requirement for enhancers in all exons
since only a small minority of hundreds of known mammalian splicing
mutants lie outside the splice sites themselves (12, 36, 44, 48,
49, 62).
In addition to sequences that promote exon inclusion, there are
sequences that inhibit splicing, so-called exonic or intronic splicing
silencers. The silencers are less well characterized; they can be
purine or pyrimidine rich and bind a diverse array of proteins. Perhaps
the best understood example of negative regulation is the role of the
Drosophila sxl protein in the sex-specific processing of tra
pre-mRNA, where sxl is thought to block access of U2AF65 to the 3'
splice site by binding to a cis element (63). Polypyrimidine tract binding protein (PTB), also known as hnRNP I, can
function by antagonizing U2AF65 action, as has been shown in the
processing of alpha-tropomyosin and GABA(A) receptor gamma2 pre-mRNAs
(4, 37). Other silencers have been shown to function through
interactions with hnRNP A1 (7, 11, 21), hrp48 (a Drosophila protein in the hnRNP A family) (55),
and hnRNP H (13).
Our incomplete understanding of splicing regulatory elements prevents
us from predicting the presence of exons in a typically long vertebrate
transcript, at least not without searching for open reading frames.
Splicing at some true sites may be stimulated by enhancers, splicing at
some pseudosites may be inhibited by silencers, and some sites may be
defined by the interplay between these two types of elements. Due to
the multitude of pseudo-splice sites within introns, we decided to
search for negatively acting sequences that may be repressing intronic
pseudosites. Early work identified several exonic and intronic
sequences that inhibited splicing when ligated downstream of a 3'
splice site (25, 51).
To look for intron sequences that inhibit splicing, we constructed
several libraries and genetically selected for sequences that could
disrupt splicing when inserted into the central exon of a three-exon
minigene. We used human genomic DNA as a source rich in intron
sequences. A library of human DNA inserts readily yielded sequences
that inhibited exon splicing. A comparative screen of human and
bacterial DNA sequences revealed that over a third of 19 randomly
chosen human inserts caused aberrant processing of the pre-mRNA,
whereas none of 27 bacterial inserts did so. We concluded that the
human genome is rich in specific sequences that inhibit splicing, and
we suggest that such sequences may play a role in silencing
inappropriate splice sites.
 |
MATERIALS AND METHODS |
Constructs.
All libraries were constructed by cloning
restriction fragments into a pD2B-based minigene. pD2B is a three-exon
dhfr minigene (for dihydrofolate reductase [DHFR]) driven
from its own promoter in the vector pSP72 (Promega) and containing an
extra copy of dhfr exon 2 as the internal exon (see Fig. 1,
line 2). The upstream portion of the minigene, from the full promoter
to 91 bp into the second intron, is genomic in sequence. The remaining
181 bp of the second intron is a repeat of genomic dhfr
intron 1. The third exon is made up of exons 2 to 6 from cDNA, followed
by genomic dhfr polyadenylation signals. The construction of
pD2B has been described previously (15). pD2C3SfuI is a
derivative of pD2B that contains XhoI and ApaI
sites on either side of the SfuI site in the central exon.
Human libraries.
Human placental DNA was fragmented with a
cocktail of HinPI, TaqI, and MspI
restriction enzymes; the 50- to 250-bp fraction was purified by gel
electrophoresis. These fragments were ligated into the SfuI
site of pD2B, whose 6-bp recognition site begins at position +16 in the
50-bp internal exon of pD2B. The products of ligation were used to
transform the chemically competent SURE strain of Escherichia
coli (Stratagene). After selection on ampicillin plates, the
resistant colonies were pooled and the DNA was extracted. Redigestion
with SfuI was used to eliminate residual uninserted vector.
A second human library was constructed in the plasmid pD2C3SfuI. Human
placental DNA was fragmented as described above, and the fragments of
60 to 120 bp were purified by gel electrophoresis. The fragments were
ligated into pD2C3SfuI and used to transform the XL-1 Blue strain of
E. coli (Stratagene). In this case, the transformed bacteria
were plated directly after heat shock to reduce the chance of sister
colonies contributing duplicate sequences in the subsequent screen.
A third library was constructed in pCMVD2C3, which carries a
dhfr minigene driven by the cytomegalovirus (CMV) promoter.
pCMVD2C3
was constructed by cloning the
dhfr minigene from
pD2C3, which
is described below. The region from the major
transcriptional
start site (
42) to a position 88 bp
downstream of the translation
termination site in the 3' untranslated
region was cloned between
the
NheI site and the
NotI sites of pEGFP-N1 (Clontech), eliminating
the green
fluorescent protein (GFP) sequence. The resulting construct,
pCMVD2C3,
should produce a transcript starting 14 nt upstream
of the 5' end of
dhfr mRNA and terminating with a simian virus
40 poly(A)
site provided by the vector. Human DNA was fragmented
with a cocktail
of
XhoI and the blunt cutters
AluI,
RsaI, and
HaeIII. The 50- to 150-bp fraction of
the restricted DNA was purified
and isolated as described above. These
fragments were ligated
into the
SmaI-
XhoI sites
of pCMVD2C3. The
SmaI site overlaps the
ApaI site
in the clamp region of the synthetic inserts described
below.
Synthetic library.
The two single stranded 5' phosphorylated
oligomers CGCGGGCCCGGGCTGTGN20TTTATGCTCTCGAGTA
and CGTACTCGAGAGCATAAAN20CACAGCCCGGGCCCG were allowed to anneal. The resulting double-stranded DNA
contained a randomized 20-nt core flanked by clamps containing the
unique restriction sites XhoI and ApaI and capped
by two SfuI-compatible sticky ends. The 51-bp fragments were
ligated into the SfuI site of exon 2 of pD2B as described
above and transformed into the XL-1 Blue strain of E. coli.
About 10,000 transformed colonies were pooled for DNA extraction.
Bacterial library.
E. coli genomic DNA was fragmented
with a cocktail of HinPI, TaqI, and
MspI restriction enzymes, and the 80- to 120-bp fraction was
gel purified. The fragments were ligated into pD2C3SfuI and used to
transform the XL-1 strain of E. coli. The transformed bacteria were plated directly after heat shock to reduce the chance of
sister colonies contributing duplicate sequences in the subsequent screen.
Recloning inserts.
Two isolates (pD2C2 and pD2C3) of the
synthetic library were used for recloning various inserts. The
restriction sites XhoI and ApaI were used for the
recloning. In pD2C3 the XhoI site is upstream of the
ApaI sites, whereas in pD2C2 the ApaI site is upstream of the XhoI site. pD2C3 was used as the vector to
remake the splicing constructs from the inserts found in
dhfr+ recipients of the pD2B human library. The
inhibitory inserts were amplified from genomic DNA and cloned via
XhoI and ApaI sites introduced within the
primers. The 5' primer was GAACGAACTCGAGTACTTC, and the 3'
primer was TGAGGAGGTGGTGGGCCCTCTTT. pD2C2 was used as a host
to invert inserts by recloning XhoI-ApaI
fragments that had been originally cloned in pD2C3. To insert sequences
B11 and B36 into the aprt gene, we cleaved plasmids carrying
these inserts (pB11 and pB36) at Acc113I and
HaeIII restriction sites in the flanking dhfr
sequence and cloned the small fragment into the EcoRV site
in exon 2 of pAPRTWT (34).
Constructs with known binding sites.
The following
double-stranded oligomers were cloned between the XhoI and
the ApaI sites of pD2C2: hnRNP A1, TATGATAGGGACTTAGGGT; hnRNP H, TAAATGTGGGACCTAGA; PTB,
CTGCAGCCTGGAGCTCCTCTCGTGGCC; and U2AF65,
TTTTTTTTTCCTTTTTTTTTCCTTTTTTTTT. The hnRNPA 1 and PTB
sequences were derived from SELEX experiments (9, 58), the
hnRNP H sequence was identified as the hnRNP H binding site in the rat
beta-tropomyosin gene (13), and the U2AF65 sequence contains
the consensus U2AF binding site derived from a panel of SELEX winners
(58).
Transfection.
All transfections were performed with
Lipofectamine (Life Technologies) using the conditions recommended by
the manufacturer for CHO K1 cells, except for the DNA concentrations.
Near-confluent 100-mm plates of dhfr
null CHO
DG44 cells (3 × 106 cells) were transfected with
various amounts of plasmid DNA and enough human genomic DNA to bring
the total to 7 µg. In experiments in which transfectants were
selected for a DHFR+ phenotype, DNA from the pD2B human
library or synthetic library was used in a series of 1:10 dilutions. In
the case of the pD2B human library, the starting plasmid concentration
was 1.38 µg/dish. After a 24-h recovery period, the transfected cells
were trypsinized and transferred to a larger dish for selection in F-12
medium lacking glycine, hypoxanthine, and thymidine and supplemented with 7% dialyzed fetal calf serum. In experiments in which no selection for DHFR was applied, transfectants were selected for G418
resistance conferred by a cotransfecting neo plasmid, pEGFP-N1 (Clontech). DG44 cells (5 × 105) in a 35-mm dish were
cotransfected with 0.5 µg of pEGFP-N1 and approximately 0.5 µg of a
plasmid bearing an insert in the dhfr minigene. After a 24-h
recovery period, cells were transferred to a 100-mm dish and challenged
in F-12 medium containing G418 (400 µg of active compound/ml).
Surviving colonies were pooled for further analysis.
RNA and DNA extraction.
RNA was extracted by the method of
Huang and High (31) for the experiments of Fig. 2. All other
analyses were performed on total RNA isolated with s.n.a.p columns
(Invitrogen) using the manufacturer's recommended procedure. DNA was
extracted with DNAzol (MRC) using the protocol supplied by the manufacturer.
RT-PCR.
Reverse transcriptase (RT) reactions were performed
using approximately 1 µg of total RNA by the random primer protocol
supplied by the manufacturer (Life Technologies). One-fifth of the
20-µl reaction mixture was used in the subsequent PCR. PCR was
performed with HotWax Mg++ beads (Invitrogen) using the conditions
recommended by the manufacturer, except for the inclusion of
radioactive substrate (14). Unless otherwise specified, all
reactions were performed with an annealing temperature of 55°C for 27 cycles. In the case of genomic PCR shown in Fig. 3, 1 µg of DNA was
amplified for 35 cycles. PCR products were separated by electrophoresis
in a 2% modified agarose gel (Trevigel 500; Trevigen). ImageQuant
software was used for the quantitative comparison of spliced products
after phosphorimaging.
 |
RESULTS |
Genetic selection of genomic sequences that inhibit splicing.
Most splicing mutations result in exon skipping (12, 35,
47). We took advantage of that fact to select for sequences that
inhibit splicing. Our strategy was to insert fragments of human genomic
DNA into the central exon of a three-exon dhfr minigene. The
central exon in this minigene is an extra exon; its inclusion into
dhfr mRNA results in a 50-nt insertion that disrupts DHFR enzymatic activity. If an insert inhibits the splicing of this central
exon, the two terminal exons are joined to form dhfr mRNA that codes for the functional enzyme. We have previously used this
minigene, carried in pD2B, to select for a large number of base
substitution mutants deficient in splicing of the central exon
(14).
To create a library of human genomic fragments from which to select
splicing inhibitory sequences, we fragmented human placental
DNA with a
mixture of the three restriction enzymes,
TaqI,
MaeII,
and
HpaI, all of which produce overhangs
complementary to those
produced by
SfuI. Fragments in the
50- to 250-bp range were size
selected and cloned into the unique
SfuI site in the central exon
of the pD2B minigene. After
transfection of pooled plasmid DNA
into a CHO DHFR-deficient mutant,
the cells were challenged in
a selective medium lacking glycine, a
source of purines (e.g.,
hypoxanthine), and thymidine (

GHT medium).
DHFR-deficient cells
cannot grow in this medium, nor can cells that
receive the minigene
that are proficient in splicing in the central
"killer" exon.
CHO cells can grow with <2% of endogenous,
wild-type DHFR activity
(
12), so even a small proportion of
exon skipping yields transfectants
that form colonies in

GHT
(
14). This scheme is depicted in
Fig.
1.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Selection scheme for sequences that inhibit splicing.
The top diagram depicts a basic dhfr minigene (in pDCH1P)
retaining the 300-nt dhfr intron 1 as the sole intron, with
exons 2 through 6 originating from cDNA. This minigene confers a
DHFR+ growth phenotype (ability to grow in the absence of
purines and thymidine) when transfected into DHFR
recipient cells. pDCH1P was modified to produce pD2B, carrying the
minigene shown in the second diagram. This gene has an extra copy of
exon 2 inserted into the intron. This extra 50-nt exon is efficiently
included in the mRNA, resulting in a message that cannot code for a
functional DHFR enzyme. Libraries were constructed by cloning DNA
fragments into the unique SfuI restriction site engineered
into the central exon. Inserts that reduce splicing result in partial
or complete skipping of the central exon, thus restoring the production
of functional mRNA.
|
|
Four transfections were carried out with 10-fold serial dilutions of
the insert library. The frequency of colonies in

GHT
medium decreased
in approximate proportion to the dilution: 1.4
µg yielded
approximately 1,500 colonies, 140 ng yielded 146 colonies,
14 ng
yielded 38 colonies, and 1.4 ng yielded 3 colonies. We isolated
colonies from the two lowest dilutions of plasmid DNA to minimize
the
probability of isolating transfectants with more than a single
copy of
the
dhfr minigene. Forty colonies were expanded, and RNA
was
extracted from five of these for a preliminary check of the
splicing
phenotype. All five expressed
dhfr mRNA that lacked the
central exon, along with various amounts of mRNA that included
this
exon (Fig.
2). In contrast, transfectants
that carry the
uninserted pD2B minigene exhibit very little (<5%)
exon skipping
(
14). The region encompassing the central exon
in 34 transfectants
was amplified from genomic DNA by PCR, and the PCR
products were
analyzed by gel electrophoresis (Fig.
3). Three yielded no central
exon band
and were assumed to have arisen from the elimination
of the killer exon
by intragenic recombination. Six of the PCR
reactions yielded an
artifactual 175-bp band. Seven had inserts
larger than 250 bp. Of the
18 remaining products, 12 with small
inserts were chosen for further
study.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 2.
Inhibition of splicing in transfectants selected for a
DHFR+ growth phenotype. CHO dhfr-deficient cells
were transfected with a plasmid library containing human DNA insertions
in the central exon of a dhfr test minigene, as described in
the text. Colonies that exhibited a DHFR+ growth phenotype
(growth in GHT medium) were expanded and assayed for their splicing
phenotype by RT-PCR, using primers located in exons 1 and 4. A
phosphorimage of an electrophoretic gel is shown. The bracket indicates
the positions of bands corresponding to inclusion of the exons with
inserts of various sizes. Splicing in cells transfected with the
uninserted parental plasmid (pD2B) is also shown.
|
|

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
Distribution of insert sizes in transfectants selected
for dhfr splicing inhibition. Genomic DNA samples from
clones selected for a DHFR+ growth phenotype were PCR
amplified with primers flanking the insert site. The PCR products were
stained with ethidium bromide after electrophoresis in 2% modified
agarose gel. A 175-bp PCR product was sometimes seen. This size
corresponds to a product containing exon 2 without an insert. Since the
template contains a duplication of the intron 2 region (to which the 5'
primer can anneal), such an artifactual product could have arisen by
DNA recombination during PCR.
|
|
Sequencing of the PCR products revealed that some cell lines contained
identical inserts. B11 and B30, for instance, both
carried a 61-bp
fragment of an Alu repeat. A2 and A3 were also
identical. Human DNA is
rich in repeated sequences so, since no
effort was made to remove
repetitive sequences, it is not surprising
that we obtained multiple
hits with highly repeated sequences
such as Alu. Moreover, since the
transfected cells were replated
for selection, some sister colonies may
also have been
present.
It is possible that the selected transfectants could have been skipping
the internal exon for reasons unrelated to the activity
of the insert.
For instance, the inserted plasmid could have suffered
a spontaneous
splice site mutation that caused this exon to be
skipped.
Alternatively, the selected transfectants may have arisen
from cell
clones with increased central exon skipping caused by
heritable changes
in the expression of
trans-acting factors in
the host cell
rather than being caused by the insert. To test
these possibilities,
eight of the inserts were PCR amplified from
the DNA of the
transfectant clones and recloned into the central
exon of the
dhfr minigene vector. The splicing phenotype was then
determined after a secondary transfection into DHFR-deficient
cells.
DHFR-deficient DG44 cells were cotransfected with plasmids
containing
the recloned inserts and a plasmid carrying the
neo gene;
transfectants were selected for resistance to G418 rather
than for DHFR
activity, thereby avoiding any selective pressure
being placed on the
splicing phenotype. G418-resistant colonies
were pooled, expanded, and
tested for
dhfr splicing by RT-PCR.
As can be seen in Fig.
4, all of the constructs retested in this
way displayed a predominant skipping phenotype, verifying that
splicing
inhibition caused by the insert sequences per se had
been the basis of
the original selection.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of splicing in secondary transfectants
carrying minigenes with recloned inserts. Inserts were PCR amplified
from the DNA of eight selected primary transfectants and recloned into
the central exon of the minigene vector. CHO dhfr null cells
were retransfected with each of these plasmids, along with a neo
vector. G418-resistant colonies were pooled and tested for their
dhfr splicing phenotype by RT-PCR as described in the legend
to Fig. 2. In some cases, as indicated, the transfected populations
were selected for a DHFR+ phenotype in parallel with the
G418 selection. The number above the lanes indicates the size of the
RT-PCR product expected for exon inclusion. Below each lane is shown
the proportion of exon skipping versus exon inclusion or cryptic
splicing, as determined by PhosphorImager analysis.
|
|
The inhibitory sequences function in a heterologous context.
It is possible that the insertion of a foreign sequence into
dhfr exon 2 produced an inhibitory effect specific to
dhfr exon 2. For instance, the insert might create an
inhibitory secondary structure, either by sequestering positive signals
or by disrupting the positive secondary structure. If this were the
case, we would expect the splicing inhibitory sequences to be context
specific and not to affect splicing if inserted into an unrelated
pre-mRNA. To test this idea, we inserted the B36 and B11 sequences into position +4 of exon 2 of the cloned genomic aprt gene. Both
B11 and B36 inhibited the correct splicing of aprt exon 2 (Fig. 5). B11 resulted in almost complete
skipping of the exon. B36 also inhibited normal exon 2 splicing but
spliced predominantly to a cryptic site (possibly the 3' splice
site-like sequence, CTTCTCTCCCAACTCCCCGCAG/C) instead of the
aprt 3' splice site. In contrast, insertion of an
arbitrarily chosen 77-bp fragment (starting from position +8 in
dhfr intron 1) at the same position had no effect on the
splicing of this exon (Fig. 5). These results suggest that these
inhibitory sequences can act autonomously.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Sequences selected for inhibition of dhfr
splicing also inhibit aprt splicing. The inserts B11 and B36
were cloned into position +4 in aprt exon 2 in the plasmid
pAPRTWT, which carries the full genomic hamster aprt gene.
The control construct, shown in lane C, is identical to B11 and B36
except that it carries a 77-bp insert derived from dhfr
intron 1 (positions +8 to +84) instead of an inhibitory insert in
position +4 of exon 2. The inserted aprt plasmids, along
with a neo plasmid, were used to transfect CHO U1S, an aprt
double-deletion mutant. Transfectants resistant to G418 were pooled,
expanded, and analyzed for aprt splicing by RT-PCR using
primers located in exons 1 and 4. The letter "i" in the B36 and B11
lanes indicate the expected positions for bands corresponding to the
inclusion of aprt exon 2. The c in lane B36 indicates the
product of cryptic splicing.
|
|
Screening for genomic sequences that inhibit splicing.
The
ease with which inhibitory inserts were isolated from this pool of
human genomic DNA fragments raised the possibility that many sequences
may be inhibitory. We therefore attempted to select for such inhibitory
sequences from a library of random synthetic 20-mers. However, an
experiment carried out on the same scale as that described above for
human genomic fragments yielded no insert-dependent DHFR-positive
colonies. Although some colonies were produced in transfections carried
out with very high concentrations of DNA, all the
dhfr-positive cell clones were carrying minigenes that had
eliminated their central exon (data not shown). They presumably
originated by homologous recombination between the duplicated regions
encompassing dhfr exon 2 in this minigene (14). We concluded that either the 20-mer was not long enough to specify an
inhibitory sequence or the human genome was a richer source of such
sequences than a random library.
To explore this latter possibility, we screened human genomic libraries
for the skipping phenotype, rather than selecting
for it. The 80- to
120-bp size fraction of restriction enzyme-digested
human DNA was
cloned into the central exon of the pD2B minigene
as described above,
and the plasmids from individual
E. coli colonies
were
characterized by sequencing their inserts. Several constructs
contained
inserts derived from highly repeated DNA that were nearly
identical to
each other; only one representative of each insert
was examined.
Nineteen different insert sequences were studied
further, including two
that were purposely produced by inversion
of a given insert. Each
plasmid was transfected into CHO
dhfr-deficient
cells,
together with a plasmid bearing the
neo gene, and pooled
permanent transfectants were selected on the basis of their resistance
to G418. The
dhfr splicing phenotype in these populations
was
then determined by RT-PCR. As can be seen in Fig.
6A, 12 of the
19 clones predominantly
included the central exon (<25% skipping),
5 exhibited substantial
(25 to 100%) exon skipping, and 2 exhibited
cryptic splicing to a site
within the insert. Thus, 7 of 19 inserts
(37%) caused an inhibition of
normal splicing of the central exon;
these 7 inhibitory sequences were
found by scanning our set totaling
1.9 kb of unrelated human DNA
sequences.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 6.
Inhibitory sequences occur more frequently in human than
in E. coli genomic DNA. (A) Pooled permanent transfectants
carrying dhfr minigenes with unique inserts of human DNA
were assayed for splicing by RT-PCR and PAGE. The additional lanes
marked pD2B, pD2CSfu, pD2C2, and pCMVD2C3 are vector controls for the
sample lanes immediately preceding or following them. M is a size
marker (416 bp) for skipped mRNA. The size of this band is also marked
with an arrow. The letter "c" indicates an mRNA produced by
splicing to a cryptic site. The size range of mRNAs that included the
inserted exon is indicated by a bracket in the right margin. Each lane
was quantified using a PhosphorImager and ImageQuant software. The bar
chart shows the percent skipping in black and percent cryptic splicing
in gray. Open bars represent control constructs. (B) Pooled permanent
transfectants carrying dhfr minigenes with unique E. coli DNA inserts were assayed by RT-PCR and PAGE. All inserts were
introduced into pD2C3SfuI, whose splicing phenotype can be seen in both
panels A and B. B36 and pD2C3SfuI provide size controls for skipped
mRNA and included mRNA, respectively. M indicates size markers. Other
features are labeled as for panel A.
|
|
Is this high frequency of inhibition due to the ease with which
splicing can be affected by random sequences of about 100
nt, or are
inhibitory sequences especially prevalent in the human
genome? To
answer this question we repeated the experiment using
E. coli DNA as a source of the inserts. Twenty-seven plasmids
with an
average insert size of 120 nt were isolated, stably transfected
into
CHO
dhfr-deficient cells, and analyzed by RT-PCR. All but
1 of the 27 plasmids spliced normally, with more than 90% exon
inclusion; the exception spliced normally 85% of the time (Fig.
6B).
Thus, fewer than 1 in 27 of the
E. coli DNA inserts was
inhibitory
at the 25% or greater level, or less than 1 in about 3.2 kb
of
bacterial DNA examined. The difference in the frequency of
inhibitory
inserts between the human and bacterial human library is
significant
at the
P = 0.01 level (chi-square test with
Yates correction).
We conclude that sequences that can inhibit splicing
are enriched
in the human
genome.
Effect of recognized inhibitory sequences on minigene transcript
splicing.
The high frequency in the human genome of sequences that
inhibited splicing focused our attention on sequences that are the targets of abundant RNA-binding proteins. We wondered whether much
shorter sequences of this type could also act as inhibitors of
constitutive splicing in this system. We chose sequences known to be
bound by hnRNP A1, hnRNP H, PTB (hnRNP I), and U2AF65 to test the
ability of those factors to inhibit the inclusion of our exon. hnRNP A1
has been shown to inhibit splicing in hnRNP A1 (7), human
immunodeficiency virus (HIV) tat (11), and human fibroblast
growth factor receptor 2 (21) transcripts. The insertion of
a 19-nt sequence selected for tight binding to hnRNP A1 (1,
9) showed some inhibitory activity in dhfr minigene
transcripts but still allowed over 75% exon inclusion (Fig.
7, lane 1). The hnRNP H sequence was that
of the alternatively spliced exon 7 of the rat beta-tropomyosin
transcript; binding of hnRNP H to this sequence correlates with its
exclusion in favor of exon 6 (13). As shown in Fig. 7, lane
2, the insertion of this 17-nt sequence did not inhibit splicing of the
central dhfr exon in pooled permanent transfectants. PTB and
U2AF65 both can bind to polypyrimidine tracts (PPTs), although their
preferred sequences emerge as different from iterative binding
selection procedures (58, 66). To increase the chance of
distinguishing these two activities, we chose a selected version of the
PTB binding sequence (p53.6 in reference 56) that
appeared to have the least overlap with the U2AF65 binding site
consensus (Fig. 7). This 27-nt PTB element was without effect on
splicing in dhfr minigene transcripts (Fig. 7, lane 3). The
31-nt U2AF65 sequence was chosen as a combination of sequences found by
iterative selection for binding (58, 66) and sequences shown
to enhance splicing in a functional assay (19). This
sequence inhibited splicing strongly (91% skipping) (Fig. 7, lane 4).
It should be noted that this sequence is not directly followed by an AG
dinucleotide and so does not constitute a 3' splice site. This last
result indicates that a sequence as short as 31 nt can strongly inhibit
inclusion of this constitutive dhfr exon and suggested
polypyrimidine tracts as potentially active components of our
inhibitory inserts.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of recognized protein binding sequences on
splicing. Four oligomers corresponding to sequences known to bind the
proteins hnRNP A1, hnRNP H, PTB, and U2AF65 were inserted between the
XhoI and ApaI sites near the center of the
central exon of pD2C2. The resulting plasmids were transfected into CHO
cells and pooled permanent transfectants were assayed for splicing by
RT-PCR as indicated. The oligomers were hnRNP A1
TATGATAGGGACTTAGGGT), hnRNP H (TAAATGTGGGACCTAGA),
PTB (CTGCAGCCTGGAGCTCCTCTCGTGGCC), and U2AF65
(TTTTTTTTTCCTTTTTTTTTCCTTTTTTTTT). The numbers beneath the
lanes show the percent skipped.
|
|
Characteristics of sequences.
We sequenced 10 inhibitory
inserts, obtained either by selection or screening. In a search for
possible commonalities, all possible pairs of the 10 sequences were
aligned. FastA was used to search each insert against a local database
of all 10 inserts. The frequency and quality of the matches found was
not different from that expected from a set of random sequences,
suggesting that the inhibitory regions were too small and/or too
degenerate to be detected within such a small group. However, the motif
discovery program MEME (5) found several 10-mer motifs, the
top three being the G-rich sequence GGCAGGGUGG and two pyrimidine-rich
sequences (CUUACUCUUC and UCUUUCACCG). As can be
seen at the bottom of Fig. 8, 6 of the 10 sequences contained good matches to the G-rich consensus sequence. An
examination of the sequences that encompass this motif in the 6 inserts
revealed an abundance of G triplet repeats (Fig. 8). Multiple sequence
alignments with low gap and extension penalties confirmed the presence
of clusters of G triplets, principally within the 5' region of B2, B36,
P16, and B5. G triplets have been proposed as a distinguishing
characteristic of the 5' and 3' edges of many introns (41,
46).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8.
Human genomic sequences that inhibit splicing. Each of
the 10 sequences inhibits splicing of the test exon by at least 25%
(Fig. 6). Polypyrimidine tracts (length of 11 or more with a pyrimidine
content of 85% or more) are underlined. Runs of three or more G's are
in boldface. A G-rich consensus sequence found in 6 of the 10 sequences
is double underlined; the agreements to this consensus are shown at the
bottom of the figure.
|
|
The two pyrimidine-rich motifs are less well conserved and probably
reflect the multiple PPTs found in 8 of the 10 sequences.
Tracts of at
least 11 nt containing at least 85% pyrimidines are
underlined in
Fig.
8. Most of these PPTs are U-rich, and five
of the insert sequences
have an overall U content in the range
of 33 to 43%. It is possible
that these tracts represent binding
sites for the 3' splicing factor
U2AF65. The presence of the G
triplets and PPTs in an insert was not
mutually exclusive, since
four of the sequences contained both of these
elements.
A global comparison of intron and exon sequences for all possible
hexamers has shown that certain hexamers are highly discriminate
for
introns (
67). We wished to examine the inhibitory inserts
for such intron discriminate sequences, but the occurrence of
specific
hexamers was too low to be statistically significant.
We therefore
generated similar data for tetramers, scanning an
annotated database of
over 2,000 exons and introns from nonredundant
human genes (M. Reese,
U. Ohler, D. Kulp, and A. Gentles, Human
Gene Database
[
http://www.fruitfly.org/sequence/human-datasets.html: GENIE gene finding data set, with data taken from
http://whitefly.lbl.gov/seq_tools/datasets/Human/exons_v105 and /introns_v105]). The 25 most discriminate of the 256 tetramers
were highly T rich (58%) and AT rich (91%). The average frequency
of
these top 25 tetramers among the inhibitory sequences shown
in Fig.
8
was 0.49/100 nt but was considerably lower (0.28/100
nt) in a set of
noninhibitory sequences of comparable size (data
not shown). Although
these data sets are too small (ca. 1,000
nt) to be conclusive, the
result is consistent with the idea that
sequences that inhibit splicing
are enriched for sequences that
are more frequent in introns than in
exons.
We used BLAST 2.0 to search human genomic and EST databases for matches
to the 10 sequences. The results are shown in Table
1 for sequences that showed identity or
near identity to a database
sequence. Four of the 10 sequences (7Arev,
B11, P6, and B9) contained
matches to highly repeated sequences (Alu,
PTR5, and human satellite
III). This frequency is not unexpected given
the fact that more
than 30% of the human genome is made up of such
repeated sequences.
Several sequences matched uncharacterized cosmids
in the database.
One sequence, P16, corresponded to an intron in a
recognized gene,
hsk1, which specifies a small conductance
potassium channel (
35).
The inhibitory sequence lies just
upstream (

91 to

10) of the
small (9 nt)
hsk1 exon 9. Interestingly, this small exon is absent
in some isoforms of the
homologous rat mRNA (
35).
 |
DISCUSSION |
Isolation of inhibitory sequences.
We report here the
isolation of sequences capable of inhibiting splicing when placed
within an exon. The target exon, exon 2 of the hamster dhfr
transcript, is flanked by 3' and 5' splice sites that have somewhat
above-average consensus scores (52) of 84 and 86, respectively. There is no detectable skipping of this exon in
endogenous dhfr transcripts and <5% skipping in cells transfected with the minigene used here. We first used a genetic selection to isolate transfectants that had incorporated minigenes containing inhibitory human DNA inserts. Inhibition of splicing to the
extra exon 2 in this construct leads to exon skipping and to the
production of functional DHFR and growth in selective medium. Given the
low frequency of DHFR+ transfectants, we had to consider
the prospect that the skipping phenotype was caused by heritable
variation of a trans-acting factor rather than by
cis inhibition caused by the insert. We ruled out the former
possibility by rescuing the insert from exon-skipping clones,
reinserting it into a fresh minigene and retesting the new construct.
In all of the eight cases tested, the skipping phenotype followed the
insert, indicating that a cis-acting element was responsible
for the exon-skipping phenotype. In all of these selected cases, the
inserts caused >50% exon 2 skipping. It is interesting to note that
although selected for their ability to skip, two of the inserts also
exhibited low levels of cryptic splicing to an unmapped position within
the insert (A1 and A2 in Fig. 4).
Inhibitory sequences are frequent in the human genome and rare in a
bacterial genome.
Perhaps the most striking result of this work
was the prevalence of inhibitory sequences found in human genomic DNA.
More than one-third (7 of 19) of randomly cloned human genomic
restriction fragments proved to be inhibitory in this in vivo splicing
assay. In order to analyze as many distinct sequences as possible, we excluded inserts that were highly related; these amounted to about half
of the original set (14 of 33). If we assume that these discarded sequences produce the same splicing phenotype as their tested homologues, the statistical results would be much the same, with 15 of
33 sequences being inhibitory. In contrast, DNA from two other sources
did not generate inhibitory inserts. The first source was random
20-mers. These synthetic sequences yielded no splicing mutants in
genetic selections that screened an estimated 9,000 different
sequences. Since the short size of these inserts may have limited their
effectiveness, we turned to E. coli as a second source of
control DNA. Of 27 constructs containing E. coli restriction fragments with an average size of 120 nt, none skipped the test exon
more than 15% of the time (Fig. 6B).
The finding that 7 of 19 human inserts with an average size of 100 nt
proved to be inhibitory implies a frequency in the human
genome of
about one inhibitory sequence per 270 nt. This pervasiveness
suggests
that one role of enhancers may be to counteract negative
effects, a
mechanism that has been demonstrated in several systems
(
3,
10,
33,
68,
69).
Sequence analysis of the inhibitory inserts.
Compared to
splicing enhancer sequences, there have been fewer splicing silencer
sequences described. Nevertheless, it is interesting to note that the
inhibitory inserts isolated here contain sequence elements that have
been implicated previously in splicing inhibition.
Eight of the 10 inhibitory inserts contained PPTs, and in six cases an
AG dinucleotide can be found just downstream, such
that these sequences
resemble 3' splice sites. Thus, it is possible
that normal splicing
components are involved in the inhibition.
Moreover, there is evidence
that the PPTs in some of these inserts
can function in splicing, given
a favorable context. First, when
B36 was placed within an
aprt exon, we observed splicing to a
cryptic site within B36
itself (along with inhibition of splicing
at the normal site). Second,
P16 contains part of a natural 3'
splice site at the 3' end of intron 8 in the
hsk1 gene. Third,
B11 corresponds to the Sx family of
Alu repeats; it is present
in the reverse complement orientation. This
orientation of the
Alu repeat contains sequences resembling 3' splice
sites, and
these sites are occasionally used as functional 3' splice
sites,
resulting in the incorporation of Alu sequences into the mRNA
(
2,
6,
8; reviewed in reference
38).
Another feature of the set of inserts is an enrichment for G triplets
and quartets. GGG motifs were found associated with
the 5' and 3' prime
boundaries of primate introns (
23,
46)
and have been shown
to play a role in small intron definition
(
41). In a
construct containing the G triplets flanked by duplicated
5' splice
sites, the G triplets promoted the use of the upstream
splice site. The
function of these G triplets to promote intron
definition when present
within small introns may act to subvert
exon definition when they are
placed within exons, as has been
done here. Later work has shown the G
triplets to bind to U1 snRNP
(A. J. McCullough, personal
communication), so here again we have
a possible role of normal
splicing components in an inhibitory
action.
Alternatively, insert sequences may be binding nonspliceosomal proteins
that are known to antagonize splicing. Thus, the splicing
inhibitor PTB
acts by binding to PPTs. This abundant protein has
been shown to
antagonize splicing in several well-studied systems
(
4,
37,
50,
58). PTB can act from sites distinct from
the 3' splice site
(
26), yet its inhibitory action can be antagonized
by
U2AF65, suggesting a competition between these two factors
for the same
site (
37). However, insertion of one of the winning
PTB-binding sequences isolated by iterative selection did not
inhibit
splicing of our test
exon.
Other hnRNPs are also candidates for splicing inhibitors. Although
hnRNP proteins were originally described as being necessary
for
splicing in vitro (
16,
17,
57), more recent work in
mammalian cells has implicated hnRNP A1 in the inhibition of splicing
in the transcripts of the FGF receptor, hnRNP A1, and HIV tat
genes
(
7,
11,
21). In addition, hrp48, a
Drosophila
hnRNP
belonging to the hnRNPA/B family, plays a role in the inhibition
of P-element exon 3 splicing (
27). In the regulation of its
own message, hnRNP A1 interacts with two intronic binding sites
flanking exon 7b (
7). However, in HIV tat exon 2 and tat
exon
3 (
11) and in the FGF receptor K-SAM exon
(
21) hnRNP A/B or
A1 binds the exon that is being repressed,
a situation that could
apply here. The binding requirements of hnRNP A1
are poorly understood
(
1). However, a consensus sequence
that emerged from a SELEX
selection binds this protein with high
affinity (
9). The core
UAGGGU of this sequence is similar to
that present in the G-rich
consensus sequence GGCAGGGUGG derived from 6 of the 10 inserts
isolated here (Fig.
7), raising the possibility that
hnRNP A1
may be playing a role in many of the cases seen here. However,
a sequence selected for tight binding to hnRNP A1 acted as only
a
modest splicing inhibitor (23% inhibition) when inserted as
a short
(19-nt) oligomer. An hnRNP H binding sequence (
13) did
not
inhibit splicing at
all.
The hnRNP A1, hnRNP H, and PTB binding sequences had at best a weak
effect on this constitutively spliced exon. These inhibitory
sequences
have been identified as such in alternatively spliced
transcripts, and
it is possible that they are too weak to interfere
with strong splicing
signals. Many alternative splicing elements
bind factors (e.g., PTB,
hnRNP A1, and ASF/SF2) whose level varies
in different tissues
(
28) and so they may be ill suited for
a role in determining
constitutive splicing. In contrast, insertion
of a binding site for the
universal splicing factor U2AF65, which
presumably does not vary in
different tissues, strongly inhibited
splicing. Perhaps the U2AF65
binding site is functioning as an
extra splice signal here and can
interfere with the bridging that
underlies exon definition by competing
for the interaction with
the downstream 5' splice site or the upstream
3' site. The end
result in either case would be a new (false) exon that
is defined
in terms of partial or even full spliceosome assembly but
that
is incapable of proceeding through the catalytic steps of
splicing.
It should be noted that the U2AF65 preferred binding sequence
[U
6(U/C)CC(C/U)U
8] includes long runs of U's
(
58). Such runs
of U's are rare in exon sequences, with
U
6 being the least frequent
among 4,096 possible hexamers
(
67). This near absence of U runs
could exclude the ectopic
binding of U2AF65 in
exons.
A negative role for splice-like sites.
Sequences that show
good agreement to the consensus splice site sequences
(pseudosites) far outnumber real splice sites within large
introns (47, 54). A negative role for pseudo-splice sites
would help to explain why these sites in vertebrate introns do not
function as splice sites. It is an intriguing possibility that they are
initially recognized as splice sites, nucleate partial spliceosome
formation, and only fail at the later catalytic steps where they are
discarded in favor of the sites that border real exons. Evidence from
several well-studied systems of negative regulation of splicing
supports the idea that splice-like sites can act as negative elements,
recruiting components of the spliceosome to inappropriate places where
they presumably compete with their legitimate counterpart for
protein-protein interactions that are necessary for either recognition
of an exon or a catalytic step in the splicing reaction. The exonic
splicing silencer in the Drosophila P-element transcript
functions by recruiting U1 snRNP into a nonproductive complex at
pseudo-5' splice sites adjacent to the real 5' splice site
(56). In the HIV tat or rev transcript, catalytically
inactive complexes containing U1 snRNP and U2 snRNP repress exon 2 splicing (22). Rous sarcoma virus inhibits the splicing of
most genomic copies of RNA via an element termed a negative regulator
of splicing (NRS). The intronic NRS has two regions, a 5' purine-rich
region that recruits ASF/SF2 and a 3' region that is capable of
interacting with both U1 snRNP and U11 snRNP. The binding of U1 snRNP
is predominantly responsible for the inhibition (18). The
splicing inhibitor in influenza virus NS1 RNA forms a large complex
containing U1, U2, U4, and U6 snRNPs that never proceeds to a
functional spliceosome (45). U2 snRNP is also present in a
complex associated with the immunoglobulin exon M2 inhibitor. U2AF65
binds to the real 3' splice site, but U2 snRNP is part of the complex
that binds to the inhibitor (33). Mutations in endogenous
genes provide additional support for the idea that pseudo-splice sites
interact with the splicing machinery. In the hamster dhfr
gene, mutations in a pseudo-5' splice site located 90 nt downstream of
the real 5' splice site allow splicing of an otherwise-inactive mutant
form of the site (12).
Several of the inserts isolated here on the basis of promoting exon
skipping also exhibit low levels of internal cryptic splicing.
Furthermore, B36 caused exon skipping when present in
dhfr
exon
2 and cryptic splicing when ligated into
aprt exon 2. The splicing
machinery is obviously interacting with the cryptic sites
in the
inserts; perhaps this interaction underlies the skipping
phenotype
as well. Consistent with this idea, a U2AF binding site
strongly
inhibited splicing, while a PTB site had little effect.
Site-directed
mutagenesis experiments and cell-free splicing
experiments on
a selected subset of these inhibitory sequences should
clarify
the putative roles of the sequence elements described here. The
ultimate test for the role of splicing inhibitors in splice site
selection will be to examine the consequences of deleting these
sequences in their normal
context.
 |
ACKNOWLEDGMENTS |
This work was supported by grant GM-22629 from the National
Institutes of Health.
We thank Hanzhen Sun for useful discussions and a critical reading of
the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Sciences, 912 Fairchild, MC 2433, Columbia University, New York, NY 10027. Phone: (212) 854-4645. Fax: (212) 531-0425. E-mail: lac2{at}columbia.edu.
 |
REFERENCES |
| 1.
|
Abdul-Manan, N., and K. R. Williams.
1996.
hnRNP A1 binds promiscuously to oligoribonucleotides: utilization of random and homo-oligonucleotides to discriminate sequence from base-specific binding.
Nucleic Acids Res.
24:4063-4070[Abstract/Free Full Text].
|
| 2.
|
Adamkiewicz, T. V.,
C. McSherry,
F. H. Bach, and J. P. Houchins.
1994.
Natural killer lectin-like receptors have divergent carboxy-termini, distinct from C-type lectins.
Immunogenetics
39:218[Medline]. (Erratum, 40:318.)
|
| 3.
|
Amendt, B. A.,
D. Hesslein,
L. J. Chang, and C. M. Stoltzfus.
1994.
Presence of negative and positive cis-acting RNA splicing elements within and flanking the first tat coding exon of human immunodeficiency virus type 1.
Mol. Cell. Biol.
14:3960-3970[Abstract/Free Full Text].
|
| 4.
|
Ashiya, M., and P. J. Grabowski.
1997.
A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart.
RNA
3:996-1015[Abstract].
|
| 5.
|
Bailey, T. L., and C. Elkan.
1994.
Fitting a mixture model by expectation maximization to discover motifs in biopolymers.
Ismb
2:28-36.
|
| 6.
|
Barnett, T. R.,
L. Drake, and W. D. Pickle.
1993.
Human biliary glycoprotein gene: characterization of a family of novel alternatively spliced RNAs and their expressed proteins.
Mol. Cell. Biol.
13:1273-1282[Abstract/Free Full Text].
|
| 7.
|
Blanchette, M., and B. Chabot.
1999.
Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization.
EMBO J.
18:1939-1952[CrossRef][Medline].
|
| 8.
|
Brownell, E.,
N. Mittereder, and N. R. Rice.
1989.
A human rel proto-oncogene cDNA containing an Alu fragment as a potential coding exon.
Oncogene
4:935-942[Medline].
|
| 9.
|
Burd, C. G., and G. Dreyfuss.
1994.
RNA binding specificity of hnRNP A1: significance of hnRNP A1 high-affinity binding sites in pre-mRNA splicing.
EMBO J.
13:1197-1204[Medline].
|
| 10.
|
Caputi, M.,
G. Casari,
S. Guenzi,
R. Tagliabue,
A. Sidoli,
C. A. Melo, and F. E. Baralle.
1994.
A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon.
Nucleic Acids Res.
22:1018-1022[Abstract/Free Full Text].
|
| 11.
|
Caputi, M.,
A. Mayeda,
A. R. Krainer, and A. M. Zahler.
1999.
hnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing.
EMBO J.
18:4060-4067[CrossRef][Medline].
|
| 12.
|
Carothers, A. M.,
G. Urlaub,
D. Grunberger, and L. A. Chasin.
1993.
Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in Chinese hamster ovary cells.
Mol. Cell. Biol.
13:5085-5098[Abstract/Free Full Text].
|
| 13.
|
Chen, C. D.,
R. Kobayashi, and D. M. Helfman.
1999.
Binding of hnRNP H to an exonic splicing silencer is involved in the regulation of alternative splicing of the rat beta-tropomyosin gene.
Genes Dev.
13:593-606[Abstract/Free Full Text].
|
| 14.
|
Chen, I. T., and L. A. Chasin.
1993.
Direct selection for mutations affecting specific splice sites in a hamster dihydrofolate reductase minigene.
Mol Cell Biol.
13:289-300[Abstract/Free Full Text].
|
| 15.
|
Chen, I. T., and L. A. Chasin.
1994.
Large exon size does not limit splicing in vivo.
Mol. Cell. Biol.
14:2140-2146[Abstract/Free Full Text].
|
| 16.
|
Choi, Y. D.,
P. J. Grabowski,
P. A. Sharp, and G. Dreyfuss.
1986.
Heterogeneous nuclear ribonucleoproteins: role in RNA splicing.
Science
231:1534-1539[Abstract/Free Full Text].
|
| 17.
|
Cobianchi, F.,
G. Biamonti,
M. Maconi, and S. Riva.
1994.
Human hnRNP protein A1: a model polypeptide for a structural and genetic investigation of a broad family of RNA binding proteins.
Genetica
94:101-114[CrossRef][Medline].
|
| 18.
|
Cook, C. R., and M. T. McNally.
1999.
Interaction between the negative regulator of splicing element and a 3' splice site: requirement for U1 small nuclear ribonucleoprotein and the 3' splice site branch point/pyrimidine tract.
J. Virol.
73:2394-2400[Abstract/Free Full Text].
|
| 19.
|
Coolidge, C. J.,
R. J. Seely, and J. G. Patton.
1997.
Functional analysis of the polypyrimidine tract in pre-mRNA splicing.
Nucleic Acids Res.
25:888-896[Abstract/Free Full Text].
|
| 20.
|
Cote, J.,
J. Beaudoin,
R. Tacke, and B. Chabot.
1995.
The U1 small nuclear ribonucleoprotein/5' splice site interaction affects U2AF65 binding to the downstream 3' splice site.
J. Biol. Chem.
270:4031-4036[Abstract/Free Full Text].
|
| 21.
|
Del Gatto-Konczak, F.,
M. Olive,
M. C. Gesnel, and R. Breathnach.
1999.
hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer.
Mol. Cell. Biol.
19:251-260[Abstract/Free Full Text].
|
| 22.
|
Dyhr-Mikkelsen, H., and J. Kjems.
1995.
Inefficient spliceosome assembly and abnormal branch site selection in splicing of an HIV-1 transcript in vitro.
J. Biol. Chem.
270:24060-24066[Abstract/Free Full Text].
|
| 23.
|
Engelbrecht, J.,
S. Knudsen, and S. Brunak.
1992.
G+C-rich tract in 5' end of human introns.
J. Mol. Biol.
227:108-113[CrossRef][Medline].
|
| 24.
|
Fu, X. D.
1995.
The superfamily of arginine/serine-rich splicing factors.
RNA
1:663-680[Medline].
|
| 25.
|
Furdon, P. J., and R. Kole.
1988.
The length of the downstream exon and the substitution of specific sequences affect pre-mRNA splicing in vitro.
Mol. Cell. Biol.
8:860-866[Abstract/Free Full Text].
|
| 26.
|
Gooding, C.,
G. C. Roberts, and C. W. Smith.
1998.
Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.
RNA
4:85-100[Abstract].
|
| 27.
|
Hammond, L. E.,
D. Z. Rudner,
R. Kanaar, and D. C. Rio.
1997.
Mutations in the hrp48 gene, which encodes a Drosophila heterogeneous nuclear ribonucleoprotein particle protein, cause lethality and developmental defects and affect P-element third-intron splicing in vivo.
Mol. Cell. Biol.
17:7260-7267[Abstract].
|
| 28.
|
Hanamura, A.,
J. F. Caceres,
A. Mayeda,
B. R. Franza, Jr., and A. R. Krainer.
1998.
Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors.
RNA
4:430-444[Abstract].
|
| 29.
|
Haut, D. D., and D. J. Pintel.
1998.
Intron definition is required for excision of the minute virus of mice small intron and definition of the upstream exon.
J. Virol.
72:1834-1843[Abstract/Free Full Text].
|
| 30.
|
Hawkins, J. D.
1988.
A survey on intron and exon lengths.
Nucleic Acids Res.
16:9893-9908[Abstract/Free Full Text].
|
| 31.
|
Huang, M. N., and K. A. High.
1990.
Efficient subcloning of DNA fragments amplified by crude oligonucleotides.
BioTechniques
9:710-711[Medline].
|
| 32.
|
Hwang, D. Y., and J. B. Cohen.
1997.
U1 small nuclear RNA-promoted exon selection requires a minimal distance between the position of U1 binding and the 3' splice site across the exon.
Mol. Cell. Biol.
17:7099-7107[Abstract].
|
| 33.
|
Kan, J. L., and M. R. Green.
1999.
Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor.
Genes Dev.
13:462-471[Abstract/Free Full Text].
|
| 34.
|
Kessler, O.,
Y. Jiang, and L. A. Chasin.
1993.
Order of intron removal during splicing of endogenous adenine phosphoribosyltransferase and dihydrofolate reductase pre-mRNA.
Mol. Cell. Biol.
13:6211-6222[Abstract/Free Full Text].
|
| 35.
|
Kohler, M.,
B. Hirschberg,
C. T. Bond,
J. M. Kinzie,
N. V. Marrion,
J. Maylie, and J. P. Adelman.
1996.
Small-conductance, calcium-activated potassium channels from mammalian brain.
Science
273:1709-1714[Abstract/Free Full Text].
|
| 36.
|
Krawczak, M.,
J. Reiss, and D. N. Cooper.
1992.
The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences.
Hum. Genet.
90:41-54[Medline].
|
| 37.
|
Lin, C. H., and J. G. Patton.
1995.
Regulation of alternative 3' splice site selection by constitutive splicing factors.
RNA
1:234-245[Abstract].
|
| 38.
|
Makalowski, W.,
G. A. Mitchell, and D. Labuda.
1994.
Alu sequences in the coding regions of mRNA: a source of protein variability.
Trends Genet.
10:188-193[CrossRef][Medline].
|
| 39.
|
Manley, J. L., and R. Tacke.
1996.
SR proteins and splicing control.
Genes Dev.
10:1569-1579[Free Full Text].
|
| 40.
|
Mayeda, A.,
G. R. Screaton,
S. D. Chandler,
X. D. Fu, and A. R. Krainer.
1999.
Substrate specificities of SR proteins in constitutive splicing are determined by their RNA recognition motifs and composite pre-mRNA exonic elements.
Mol. Cell. Biol.
19:1853-1863[Abstract/Free Full Text].
|
| 41.
|
McCullough, A. J., and S. M. Berget.
1997.
G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection.
Mol. Cell. Biol.
17:4562-4571[Abstract].
|
| 42.
|
Mitchell, P. J.,
G. Urlaub, and L. Chasin.
1986.
Spontaneous splicing mutations at the dihydrofolate reductase locus in Chinese hamster ovary cells.
Mol. Cell. Biol.
6:1926-1935[Abstract/Free Full Text].
|
| 43.
|
Mount, S. M.
1982.
A catalogue of splice junction sequences.
Nucleic Acids Res.
10:459-472[Abstract/Free Full Text].
|
| 44.
|
Nakai, K., and H. Sakamoto.
1994.
Construction of a novel database containing aberrant splicing mutations of mammalian genes.
Gene
141:171-177[CrossRef][Medline].
|
| 45.
|
Nemeroff, M. E.,
U. Utans,
A. Kramer, and R. M. Krug.
1992.
Identification of cis-acting intron and exon regions in influenza virus NS1 mRNA that inhibit splicing and cause the formation of aberrantly sedimenting presplicing complexes.
Mol. Cell. Biol.
12:962-970[Abstract/Free Full Text].
|
| 46.
|
Nussinov, R.
1988.
Conserved quartets near 5' intron junctions in primate nuclear pre-mRNA.
J. Theor. Biol.
133:73-84[CrossRef][Medline].
|
| 47.
|
Ohshima, Y., and Y. Gotoh.
1987.
Signals for the selection of a splice site in pre-mRNA. Computer analysis of splice junction sequences and like sequences.
J. Mol. Biol.
195:247-259[CrossRef][Medline].
|
| 48.
|
O'Neill, J. P.,
P. K. Rogan,
N. Cariello, and J. A. Nicklas.
1998.
Mutations that alter RNA splicing of the human HPRT gene: a review of the spectrum.
Mutat. Res.
411:179-214[CrossRef][Medline].
|
| 49.
|
Orkin, S. H., and H. H. Kazazian, Jr.
1984.
The mutation and polymorphism of the human beta-globin gene and its surrounding DNA.
Annu. Rev. Genet.
18:131-171[CrossRef][Medline].
|
| 50.
|
Patton, J. G.,
S. A. Mayer,
P. Tempst, and B. Nadal-Ginard.
1991.
Characterization and molecular cloning of polypyrimidine tract-binding protein: a component of a complex necessary for pre-mRNA splicing.
Genes Dev.
5:1237-1251[Abstract/Free Full Text].
|
| 51.
|
Reed, R., and T. Maniatis.
1986.
A role for exon sequences and splice-site proximity in splice-site selection.
Cell
46:681-690[CrossRef][Medline].
|
| 52.
|
Robberson, B. L.,
G. J. Cote, and S. M. Berget.
1990.
Exon definition may facilitate splice site selection in RNAs with multiple exons.
Mol. Cell. Biol.
10:84-94[Abstract/Free Full Text].
|
| 53.
|
Schaal, T. D., and T. Maniatis.
1999.
Multiple distinct splicing enhancers in the protein-coding sequences of a constitutively spliced pre-mRNA.
Mol. Cell. Biol.
19:261-273[Abstract/Free Full Text].
|
| 54.
|
Senapathy, P.,
M. B. Shapiro, and N. L. Harris.
1990.
Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project.
Methods Enzymol.
183:252-278[Medline].
|
| 55.
|
Siebel, C. W.,
A. Admon, and D. C. Rio.
1995.
Soma-specific expression and cloning of PSI, a negative regulator of P element pre-mRNA splicing.
Genes Dev.
9:269-283[Abstract/Free Full Text].
|
| 56.
|
Siebel, C. W.,
L. D. Fresco, and D. C. Rio.
1992.
The mechanism of somatic inhibition of Drosophila P-element pre-mRNA splicing: multiprotein complexes at an exon pseudo-5' splice site control U1 snRNP binding.
Genes Dev.
6:1386-1401[Abstract/Free Full Text].
|
| 57.
|
Sierakowska, H.,
W. Szer,
P. J. Furdon, and R. Kole.
1986.
Antibodies to hnRNP core proteins inhibit in vitro splicing of human beta-globin pre-mRNA.
Nucleic Acids Res.
14:5241-5254[Abstract/Free Full Text].
|
| 58.
|
Singh, R.,
J. Valcarcel, and M. R. Green.
1995.
Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins.
Science
268:1173-1176[Abstract/Free Full Text].
|
| 59.
|
Sterner, D. A., and S. M. Berget.
1993.
In vivo recognition of a vertebrate mini-exon as an exon-intron-exon unit.
Mol. Cell. Biol.
13:2677-2687[Abstract/Free Full Text].
|
| 60.
|
Sun, Q.,
A. Mayeda,
R. K. Hampson,
A. R. Krainer, and F. M. Rottman.
1993.
General splicing factor SF2/ASF promotes alternative splicing by binding to an exonic splicing enhancer.
Genes Dev.
7:2598-2608[Abstract/Free Full Text].
|
| 61.
|
Talerico, M., and S. M. Berget.
1994.
Intron definition in splicing of small Drosophila introns.
Mol. Cell. Biol.
14:3434-3445[Abstract/Free Full Text].
|
| 62.
|
Treisman, R.,
S. H. Orkin, and T. Maniatis.
1983.
Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes.
Nature
302:591-596[CrossRef][Medline].
|
| 63.
|
Valcarcel, J.,
R. Singh,
P. D. Zamore, and M. R. Green.
1993.
The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA.
Nature
362:171-175[CrossRef][Medline].
|
| 64.
|
Wang, Z.,
H. M. Hoffmann, and P. J. Grabowski.
1995.
Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity.
RNA
1:21-35[Abstract].
|
| 65.
|
Watakabe, A.,
K. Tanaka, and Y. Shimura.
1993.
The role of exon sequences in splice site selection.
Genes Dev.
7:407-418[Abstract/Free Full Text].
|
| 66.
|
Wu, S.,
C. M. Romfo,
T. W. Nilsen, and M. R. Green.
1999.
Functional recognition of the 3' splice site AG by the splicing factor U2AF35.
Nature
402:832-835[CrossRef][Medline].
|
| 67.
|
Zhang, M. Q.
1998.
Statistical features of human exons and their flanking regions.
Hum. Mol. Genet.
7:919-932[Abstract/Free Full Text].
|
| 68.
|
Zheng, Z. M.,
P. He, and C. C. Baker.
1996.
Selection of the bovine papillomavirus type 1 nucleotide 3225 3' splice site is regulated through an exonic splicing enhancer and its juxtaposed exonic splicing suppressor.
J. Virol.
70:4691-4699[Abstract].
|
| 69.
|
Zheng, Z. M.,
M. Huynen, and C. C. Baker.
1998.
A pyrimidine-rich exonic splicing suppressor binds multiple RNA splicing factors and inhibits spliceosome assembly.
Proc. Natl. Acad. Sci. USA
95:14088-14093[Abstract/Free Full Text].
|
Molecular and Cellular Biology, September 2000, p. 6816-6825, Vol. 20, No. 18
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Reid, D. C., Chang, B. L., Gunderson, S. I., Alpert, L., Thompson, W. A., Fairbrother, W. G.
(2009). Next-generation SELEX identifies sequence and structural determinants of splicing factor binding in human pre-mRNA sequence. RNA
15: 2385-2397
[Abstract]
[Full Text]
-
Faa, V., Incani, F., Meloni, A., Corda, D., Masala, M., Baffico, A. M., Seia, M., Cao, A., Rosatelli, M. C.
(2009). Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene. J. Biol. Chem.
284: 30024-30031
[Abstract]
[Full Text]
-
Ram, O., Schwartz, S., Ast, G.
(2008). Multifactorial Interplay Controls the Splicing Profile of Alu-Derived Exons. Mol. Cell. Biol.
28: 3513-3525
[Abstract]
[Full Text]
-
Gal-Mark, N., Schwartz, S., Ast, G.
(2008). Alternative splicing of Alu exons--two arms are better than one. Nucleic Acids Res
36: 2012-2023
[Abstract]
[Full Text]
-
Shi, J., Hu, Z., Pabon, K., Scotto, K. W.
(2008). Caffeine Regulates Alternative Splicing in a Subset of Cancer-Associated Genes: a Role for SC35. Mol. Cell. Biol.
28: 883-895
[Abstract]
[Full Text]
-
Schoft, V. K., Schopoff, S., Jantsch, M. F.
(2007). Regulation of glutamate receptor B pre-mRNA splicing by RNA editing. Nucleic Acids Res
35: 3723-3732
[Abstract]
[Full Text]
-
Zhang, X. H.-F., Chasin, L. A.
(2006). Comparison of multiple vertebrate genomes reveals the birth and evolution of human exons. Proc. Natl. Acad. Sci. USA
103: 13427-13432
[Abstract]
[Full Text]
-
Buratti, E., Baralle, M., Baralle, F. E.
(2006). Defective splicing, disease and therapy: searching for master checkpoints in exon definition. Nucleic Acids Res
34: 3494-3510
[Abstract]
[Full Text]
-
Xing, Y., Wang, Q., Lee, C.
(2006). Evolutionary Divergence of Exon Flanks: A Dissection of Mutability and Selection. Genetics
173: 1787-1791
[Abstract]
[Full Text]
-
Kralovicova, J., Vorechovsky, I.
(2006). Position-Dependent Repression and Promotion of DQB1 Intron 3 Splicing by GGGG Motifs. J. Immunol.
176: 2381-2388
[Abstract]
[Full Text]
-
Parmley, J. L., Chamary, J. V., Hurst, L. D.
(2006). Evidence for Purifying Selection Against Synonymous Mutations in Mammalian Exonic Splicing Enhancers. Mol Biol Evol
23: 301-309
[Abstract]
[Full Text]
-
Mercado, P. A., Ayala, Y. M., Romano, M., Buratti, E., Baralle, F. E.
(2005). Depletion of TDP 43 overrides the need for exonic and intronic splicing enhancers in the human apoA-II gene. Nucleic Acids Res
33: 6000-6010
[Abstract]
[Full Text]
-
Baralle, D, Baralle, M
(2005). Splicing in action: assessing disease causing sequence changes. J. Med. Genet.
42: 737-748
[Abstract]
[Full Text]
-
Lei, H., Vorechovsky, I.
(2005). Identification of Splicing Silencers and Enhancers in Sense Alus: a Role for Pseudoacceptors in Splice Site Repression. Mol. Cell. Biol.
25: 6912-6920
[Abstract]
[Full Text]
-
Burnette, J. M., Miyamoto-Sato, E., Schaub, M. A., Conklin, J., Lopez, A. J.
(2005). Subdivision of Large Introns in Drosophila by Recursive Splicing at Nonexonic Elements. Genetics
170: 661-674
[Abstract]
[Full Text]
-
Wagner, E. J., Baraniak, A. P., Sessions, O. M., Mauger, D., Moskowitz, E., Garcia-Blanco, M. A.
(2005). Characterization of the Intronic Splicing Silencers Flanking FGFR2 Exon IIIb. J. Biol. Chem.
280: 14017-14027
[Abstract]
[Full Text]
-
James, P. D., O'Brien, L. A., Hegadorn, C. A., Notley, C. R. P., Sinclair, G. D., Hough, C., Poon, M.-C., Lillicrap, D.
(2004). A novel type 2A von Willebrand factor mutation located at the last nucleotide of exon 26 (3538G>A) causes skipping of 2 nonadjacent exons. Blood
104: 2739-2745
[Abstract]
[Full Text]
-
Expert-Bezancon, A., Sureau, A., Durosay, P., Salesse, R., Groeneveld, H., Lecaer, J. P., Marie, J.
(2004). hnRNP A1 and the SR Proteins ASF/SF2 and SC35 Have Antagonistic Functions in Splicing of {beta}-Tropomyosin Exon 6B. J. Biol. Chem.
279: 38249-38259
[Abstract]
[Full Text]
-
Zhang, X. H-F., Chasin, L. A.
(2004). Computational definition of sequence motifs governing constitutive exon splicing. Genes Dev.
18: 1241-1250
[Abstract]
[Full Text]
-
Sironi, M., Menozzi, G., Riva, L., Cagliani, R., Comi, G. P., Bresolin, N., Giorda, R., Pozzoli, U.
(2004). Silencer elements as possible inhibitors of pseudoexon splicing. Nucleic Acids Res
32: 1783-1791
[Abstract]
[Full Text]
-
Zhang, X. H-F., Heller, K. A., Hefter, I., Leslie, C. S., Chasin, L. A.
(2003). Sequence Information for the Splicing of Human Pre-mRNA Identified by Support Vector Machine Classification. Genome Res
13: 2637-2650
[Abstract]
[Full Text]
-
Gualandi, F, Trabanelli, C, Rimessi, P, Calzolari, E, Toffolatti, L, Patarnello, T, Kunz, G, Muntoni, F, Ferlini, A
(2003). Multiple exon skipping and RNA circularisation contribute to the severe phenotypic expression of exon 5 dystrophin deletion. J. Med. Genet.
40: e100-100
[Full Text]
-
Zavolan, M., Kondo, S., Schonbach, C., Adachi, J., Hume, D. A., RIKEN GER Group, , GSL Members, , Hayashizaki, Y., Gaasterland, T.
(2003). Impact of Alternative Initiation, Splicing, and Termination on the Diversity of the mRNA Transcripts Encoded by the Mouse Transcriptome. Genome Res
13: 1290-1300
[Abstract]
[Full Text]
-
Faustino, N. A., Cooper, T. A.
(2003). Pre-mRNA splicing and human disease. Genes Dev.
17: 419-437
[Full Text]
-
Maquat, L. E.
(2002). NASty effects on fibrillin pre-mRNA splicing: another case of ESE does it, but proposals for translation-dependent splice site choice live on. Genes Dev.
16: 1743-1753
[Full Text]
-
Le Guiner, C., Plet, A., Galiana, D., Gesnel, M.-C., Del Gatto-Konczak, F., Breathnach, R.
(2001). Polypyrimidine Tract-binding Protein Represses Splicing of a Fibroblast Growth Factor Receptor-2 Gene Alternative Exon through Exon Sequences. J. Biol. Chem.
276: 43677-43687
[Abstract]
[Full Text]
-
Caputi, M., Zahler, A. M.
(2001). Determination of the RNA Binding Specificity of the Heterogeneous Nuclear Ribonucleoprotein (hnRNP) H/H'/F/2H9 Family. J. Biol. Chem.
276: 43850-43859
[Abstract]
[Full Text]
-
Wagner, E. J., Garcia-Blanco, M. A.
(2001). Polypyrimidine Tract Binding Protein Antagonizes Exon Definition. Mol. Cell. Biol.
21: 3281-3288
[Full Text]