Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7121-7131, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Role of the Stat4 N Domain in Receptor Proximal
Tyrosine Phosphorylation
Theresa L.
Murphy,
Erik D.
Geissal,
J. David
Farrar, and
Kenneth M.
Murphy*
Department of Pathology and Immunology, Howard Hughes
Medical Institute, Washington University School of Medicine, St.
Louis, Missouri 63110
Received 17 February 2000/Returned for modification 29 March
2000/Accepted 10 July 2000
 |
ABSTRACT |
Stat4 is activated by the cytokines interleukin 12 and alpha
interferon (IFN-
) and plays a significant role in directing development of naïve CD4+ T cells to the Th1
phenotype. Signal transducers and activators of transcription (STAT)
proteins undergo phosphorylation on a conserved tyrosine residue,
resulting in homo- and heterodimerization, nuclear translocation, and
DNA binding. Stat4 can bind to single IFN-
-activated sites (GASs) as
a dimer or bind two tandem GASs as a pair of STAT dimers, or tetramer,
stabilized through N-terminal domain (N domain) interactions between
dimers. We uncovered an unexpected effect of the Stat4 N domain in
controlling the proximal activation of Stat4 by tyrosine
phosphorylation at activated receptor complexes. Mutation of the N
domain at tryptophan residue W37, predicted to interrupt N domain dimer
formation, unexpectedly prevented IFN-
-induced tyrosine
phosphorylation of the Stat4 monomer, blocking dimer formation and
nuclear translocation. Furthermore, N domains appear to exert private
STAT functions, since interchanging the N domains between Stat1 and
Stat4 prevented receptor-mediated tyrosine phosphorylation in one case
and interrupted STAT-specific gene activation in another. Finally,
replacement of the N domain of Stat1 with that of Stat4 abrogated the
normal Stat2 dependence of Stat1 phosphorylation, again suggesting the
domains are not equivalent. Thus, in addition to its role in STAT
tetramerization, the conserved STAT N domain appears to participate in
very proximal steps of receptor-mediated ligand-induced tyrosine phosphorylation.
 |
INTRODUCTION |
The STAT (signal transducers and
activators of transcription) family of transcription factors reside as
latent cytoplasmic monomers which are phosphorylated on a conserved
tyrosine residue in response to ligand-induced receptor activation
(5, 15, 38). Following tyrosine phosphorylation, STAT
proteins undergo homo- and heterodimerization via reciprocal
interactions involving their conserved SH2 domains, followed by STAT
dimer nuclear translocation and participation in transcriptional
regulation of various cytokine responsive genes. STAT dimers bind the
palindromic gamma interferon (IFN-
)-activated sequence (GAS)
TTCNmGAA, where m equals 3 for all STAT proteins except
Stat6 (6, 7, 14, 19). STAT-specific binding site preferences
have been identified involving both the central nucleotide core and
sequences flanking the core palindrome (10, 25, 33, 34).
Furthermore, higher-order interactions between STAT dimers, in which a
tetrameric complex of two STAT dimers cooperatively binds two adjacent
GAS elements, have been described for Stat1, Stat4, and Stat5 (42,
43, 47). It has been suggested that such tetramer formation is
facilitated through interactions between the highly conserved
N-terminal domain (N domain), facilitating STAT dimer binding to
low-affinity, nonconsensus STAT binding sites (47). Other
functions for the N domain have also been suggested, including roles in
nuclear localization and binding to CREB-binding protein, or p300
(39, 48).
The specificity of STAT activation by cytokines is in part mediated by
the selective interaction of their SH2 domains with distinct
tyrosine-containing motifs located within the cytoplasmic domains of
specific cytokine receptors. In addition, each STAT protein has private
physiologic functions exerted presumably by selective activation of
distinct target genes. One important STAT-dependent biologic function
involves T helper differentiation. In particular, Stat4 activation
plays a significant role in directing development of T helper type 1 (Th1) T cells from naive CD4+ precursors (16, 18,
41). Control of Th1 differentiation is exerted both by the
tissue-restricted expression of Stat4 and by the limited activation of
Stat4 by only certain cytokines. Stat4 is activated by interleukin 12 (IL-12) (1, 16), a cytokine which potently induces Th1
development (13, 22) through recruitment to a tyrosine-based
motif in the IL-12 receptor
2 (IL-12R
2) subunit via the Stat4 SH2
domain (26). IL-12 activates Stat4 in all species examined,
and the requirement for Stat4 in Th1 development has been confirmed by
targeted deletion of Stat4 in mice (18, 41). IFN-
also
activates Stat4 and induces Th1 development in human T cells (1,
32), but not mouse T cells (32, 46). Stat4 activation
by IFN-
, however, does not involve direct binding to the cytoplasmic
domain of the IFN-
receptor (IFN-
R), but instead occurs through
an intermediate step (8). First, IFN-
signaling leads to
phosphorylation of a conserved tyrosine in the receptor cytoplasmic
domain that acts to recruit Stat2, which is subsequently phosphorylated
on a conserved tyrosine 690. Stat2 serves as an adapter that binds the
SH2 domains of both Stat1 and Stat4. Stat1 binds to tyrosine 690 of
Stat2; however, Stat4 binds to a distinct region of Stat2, specifically
to the most carboxy-terminal regions of Stat2. In summary, IL-12 and IFN-
each induce Th1 development and activate Stat4, but the Stat4
SH2 domain interaction differs between these receptor pathways.
How Stat4 promotes Th1 development is unclear. Stat4 could directly
regulate activity of the IFN-
gene. Recombinant Stat4 produces a
footprint on specific sites within the IFN-
gene promoter and first
intron, sites which are low affinity and nonconsensus. The cooperative
interaction of adjacent sites with Stat4 dimers binding as a tetramer
via adjacent amino termini was suggested as a mechanism for augmenting
IFN-
gene expression (47), although the requirement for
these sites in regulation of the native IFN-
gene has not been
established. Alternately, Stat4 may regulate expression of other
signaling molecules or transcription factors that act in Th1
development. For example, Stat4 is required for the Th1-specific
expression of the Ets transcription family member ERM (28),
although a role for ERM in IFN-
gene expression has not been demonstrated.
In addressing potential Stat4 tetramer interactions for IFN-
regulation, we became interested in the role of the Stat4 N domain in
mediating STAT dimer-dimer interactions. The structure of the STAT N
domain was determined from the isolated N domain from Stat4, which was
found to naturally pack as a dimer in the crystal (43). In
the Stat4 N domain, composed of eight alpha helices which form a
hook-like structure, a conserved tryptophan residue, W37, was shown to
be engaged in critical internal polar interactions between interacting
helices of reciprocal N domain subunits (43). For functional
analysis, the role of this tryptophan was evaluated in Stat1 rather
than Stat4; however, mutation of this tryptophan prevented tetramer
formation of recombinant Stat1 protein and caused the loss of an
IFN-
augmentation of a synthetic promoter composed of multimerized
GAS elements. Furthermore, mutation of this conserved tryptophan in
Stat5 was recently shown to prevent the ability of Stat5 to undergo
tetramer formation on the adjacent STAT sites present in the IL-2R
chain promoter (17). So far, the role of this
tryptophan-mediated N domain dimerization had not been evaluated for
Stat4 nor evaluated in a system where native physiologic responses to
Stat4 activation could be observed. To this end, we have carried out a
mutational analysis of the Stat4 N domain for IFN-
- and
IL-12-induced Stat4 activation using cell lines that lack Stat4
expression and primary T cells derived from Stat4-deficient mice.
Surprisingly, our results point to additional roles of the Stat4 N
domain beyond mediating tetramer formation on DNA. Our results indicate
that the Stat4 N domain also can influence the ability of STAT proteins
to undergo successful interactions with cytokine receptor complexes.
Importantly, the W37A mutation within the N domain of Stat4 interferes
with IFN-
-induced tyrosine phosphorylation of the Stat4 monomer,
interrupting Stat4 activation before formation of the Stat4 dimer. This
result precludes any conclusions regarding functional tetramer activity
based on this mutation for Stat4. Finally, the data suggest that
N-domains may be involved in targeting certain STATs to receptors,
influencing their suitability as substrates for receptor-dependent kinases.
 |
MATERIALS AND METHODS |
Cytokines, antibodies, and reagents.
Recombinant human
IFN-
A/D was a gift from U. Gubler (Hoffman-LaRoche, Nutley, N.J.).
Recombinant human IFN-
was a gift from R. Schreiber (Washington
University School of Medicine). Polyclonal antisera specific for murine
and human Stat1 and Stat4 were purchased from Santa Cruz Biotechnology
(Santa Cruz, Calif.). The peroxidase-conjugated
antiphosphotyrosine antibody RC20 was purchased from Transduction
Laboratories (Lexington, Ky.). The phycoerythrin (PE)-conjugated
anti-human CD4 (anti-hCD4-PE) antibody used for cell sorting was
purchased from Caltag (Burlingame, Calif.). DNA restriction and
modifying enzymes used in molecular cloning were purchased from New
England Biolabs (Beverly, Mass.). Oligonucleotides were purchased from
Integrated DNA Technologies, Inc. (Coralville, Iowa). The measurement
of cytokines by enzyme-linked immunosorbent assay has been described
previously (12).
Mutants and retroviral constructs.
We analyzed the interface
between the two interacting subunits of the N domain dimer
(43) by using LigPlot (45) to identify residues
involved in dimer formation. This analysis indicated that residues Q36,
W37, T40, and E66 made contacts at the interface, which were also noted
in the first description of the N domain structure reported by
Vinkemeier et al. (43).
The green fluorescent protein (GFP) retroviral vector GFP-RV has been
described previously (31). The complete murine Stat4 cDNA
was placed into GFP-RV by using the oligonucleotides (5'
3') mST4
5' (CAGCTGAGCCTGGACGGAGAGAGAG) and mST4 3'
(CGACAGTCGACTTCCTTCTTTAAAGTGTCC). Stat1 was cloned likewise by
using mST1 5' (CCGCTCGAGGATGTCACAGTGGTTCG) and mST1 3' (CCGCTCGAGTGTCGCCAGAGAGAAATTC).
These oligonucleotides were used to generate a PCR product with Vent
polymerase and the murine Stat1 and Stat4 cDNA as a template,
digested
with
XhoI and
SalI, and cloned into the unique
XhoI site
of GFP-RV.
For site-directed mutagenesis of Stat4, the QuickChange PCR-based
strategy (Stratagene) was used with the following oligonucleotide
sets
(5'

3'): Q36A top (TCCGGCATCTGCTAGCTGCGTGGATTGAGACTCAAG)
and Q36A bot (CTTGAGTCTCAATCCACGCAGCTAGCAGATGCCGGA),
W37A top
(CTGCTAGCTCAGGCGATTGAGACTCAAGAC) and W37A bot
(GTCTTGAGTCTCAATCGCCTGAGCTAGCAG),
T40A top
(GCTCAGTGGATTGAGGCTCAAGACTGGGAAG) and T40A bot
(CTTCCCAGTCTTGAGCCTCAATCCACTGAGC),
and E66A top
(CTAATACAATTGGATGCACAGTTGGGGCGGGTTT) and E66A bot
(AAACCCGCCCCAACTGTGCATCCAATTGTATTAG), and K84A/R85A top
(CACAATCTAGCGGCAATTAGAAAAGTTCTTCAGGGC)
and K84A/R85A bot
(CTAATTGCCGCTAGATTGTGAATCAATAGCAGA).
For mutation of murine Stat1, the following oligonucleotides were used
(5'

3'): mSt1W37A top (TGGCCCAGGCGCTGGAAAAGCAAGACTGGGAG)
and mSt1W37A bot
(TTTTCCAGCGCCTGGGCCAGGTACTGTCTG).
To interchange the N domains of Stat1 and Stat4, we used site-directed
mutagenesis by overlap extension. The Stat1 and Stat4
N domains were
generated first as Vent polymerase PCR products
by using the following
oligonucleotides. For the Stat1 N domain,
we used MST1 5' (same as
above) and S1S4 A8 bot (CTTCCCTTAAGCAGTTGTAGATGATCATGGACATC).
For the Stat4 N domain, we used MST4 5' (same as above) and S4S1
A8 bot
(CTTCCTTCAGACAATTTGAAATTACCACAGCTAC).
The Stat1 and Stat4 carboxy domains were generated with Vent polymerase
by using the following oligonucleotides. For the Stat1
carboxy domain,
we used S4S1 A8 top (TAATTTCAAATTGTCTGAAGGAAGAAAGGAAG)
and
MST1 3' (same as above). For the Stat4 carboxy domain, we
used S1S4 A8
top (CATCTACAACTGCTTAAGGGAAGAGAGGAG) and MST4 3'
(same as
above).
These PCR products were isolated and mixed in equimolar amounts and
reamplified with MST1 5' and MST4 3' for the N1-C4 chimera
and MST4 5'
and MST1 3' for the N4-C1 chimera. These PCR products
were digested
with
SalI and
XhoI and cloned into the unique
XhoI
site of GFP-RV. All mutations were confirmed by direct
sequencing.
T-cell culture and retroviral transduction.
Methods for
activation and passage of DO11.10 T cells have been described
previously (11-13). The Phoenix-Ampho or Phoenix-Eco packaging cell lines were transfected with the retroviral vectors described above by calcium phosphate precipitation (29).
Twenty-four hours following transfection, the medium was replaced, and
the retroviral supernatant was generated by culturing the cells at 32°C for 24 h. The Stat2-deficient U6A (20) and the
Stat1-deficient U3A (23) cell lines were maintained in
complete Iscove's minimal essential medium as previously described
(23). The U3A and U6A cell lines were infected by spinning
retroviral culture supernatants containing 4 µg of Polybrene
(1,5-dimethyl-1,5-diazaundecamethylene polymethobromide; Sigma) per ml
onto monolayers at 1,800 rpm for 30 min, followed by overnight culture.
Infected cells were purified by fluorescence-activated cell sorting for
GFP and/or hCD4 expression with anti-hCD4-PE secondary antibody. Sorted
cells were expanded, were >90% pure, and stably expressed the
retroviral marker by postsort analysis. T cells were infected as
described previously (29).
Immunoprecipitation and immunoblotting.
Analysis of
phosphotyrosine-containing STAT proteins was performed as described
previously (16). Briefly, monolayers of fibroblasts were
incubated with IFN-
A/D (1,000 U/ml) or IFN-
(1,000 U/ml) for 20 min at 37°C. Whole-cell lysates were prepared, and STAT molecules
were precipitated with specific polyclonal antibodies and protein
G-Sepharose (Pharmacia, Piscataway, N.J.). Immunoprecipitates were
resolved by denaturing sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and were transferred to nitrocellulose.
Phosphotyrosine-containing proteins were detected by blotting with the
peroxidase-conjugated RC20 antibody followed by enhanced
chemiluminescence with the ECL system (Amersham, Arlington Heights,
Ill.). The membranes were then stripped and reprobed with anti-Stat
polyclonal antibodies followed by detection with peroxidase-conjugated
goat anti-rabbit immunoglobulin (Jackson Immuno Research, West Grove,
Pa.).
EMSA.
Electrophoretic mobility shift analysis (EMSA) was
performed as follows. Nuclear extracts were prepared from
cytokine-treated cells as previously described (16). Binding
reactions consisted of 3 µg of nuclear extract, 1 µg of poly(dI-dC)
(Pharmacia), 10 mM Tris-Cl (pH 7.5), 50 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA, 5% (vol/vol) glycerol, and 2.5 × 104 cpm of
Klenow-labeled probe in 20-µl reaction volumes. Reaction mixtures
were incubated at room temperature for 30 min. DNA-binding complexes
were resolved by nondenaturing 4.5% polyacrylamide gel electrophoresis
for 2 h at 150 V followed by autoradiography. The following DNA
probes were used in this study: M67SIE (44) (GTCGACATTTCCCGTAAATCGTCGA), Site 2+3 (47)
(CGCGAAAATTTTAAGTGAATTTTTTGAGTTTCTTTTAAAATTTT), GAS c+n
(24)
(GTGCAGTTTCTTCTGAGAAGTACCAGACATTTCTGATAAGAGAG), E
Y-box (40)
(TCGACATTTTTCTGATTGGTTAAAAGTC), GAS c*+n (24) (GTGCAGTTTCTTCGTCTAAGTACCAGACATTTCTGATAAGAGAG
[mutated bases are underlined]), and GAS c+n* (24)
(GTGCAGTTTCTTCTGAGAAGTACCAGACATGGAGTCGCCGAGAG [mutated bases are underlined]).
 |
RESULTS |
Selective N domain mutations interfere with
IFN-
-receptor-mediated Stat4 DNA binding.
Functional data
supporting formation of STAT tetramers was based on mutation of an
invariant tryptophan residue, W37, which contacts the paired N domain
residues E66 and Q63 (43). However, this mutation was made
in Stat1 and Stat5 (17), but not Stat4, which was used for N
domain structure analysis. To test functional activity in Stat4, we
generated a larger series of mutations within the Stat4 N domain based
on the predicted participation of residues in contacts at the
interacting faces between the two N domain dimer subunits (Fig.
1A). In addition to the invariant
tryptophan residue W37, residues Q36, T40, and E66 make contacts
between the interacting N domain alpha helices surrounding W37. Thus, we made a series of single and double residue mutations of these residues in the context of full-length Stat4 and expressed these mutants by retroviral transduction to determine their functional effects on ligand-induced Stat4 activation and DNA binding (Fig. 1B).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Selective loss of Stat4 DNA binding from mutations in
the alpha 4 and alpha 6 N-domain helices. (A) Location of selected
Stat4 N domain mutations. The schematic shows the sequence of the Stat4
N domain with the helical domains shown above the sequence. Underlined
residues were selected for mutation to alanine. The numbers above the
residue indicate its position relative to the initiation methionine.
(B) EMSA activities of selected N domain mutations. U3A cells were left
uninfected (uninfected) or infected with retrovirus expressing
wild-type Stat4 (wt) or the indicated Stat4 mutants (Stat4 mut).
Retrovirally infected cells were purified by cell sorting to >95%.
Cells were treated with IFN- , nuclear extracts were prepared, and
EMSA was performed with the indicated probes. Arrowheads are positioned
to indicate the relative migration positions between gels: solid
arrowheads indicate lower mobility, and open arrowheads indicate higher
mobility. Similar data were obtained in three independent experiments.
(C) U3A cells infected with retrovirus expressing wild-type Stat4 were
treated with IFN- , nuclear extracts were prepared, and EMSA was
performed with the indicated probes in the presence of 1 µg of normal
rabbit serum (NRS) or the indicated anti-STAT antibody. (D) U3A cells
infected with retrovirus expressing wild-type Stat4 or Stat4 containing
a double mutation, T40A E66A, were treated with IFN- , nuclear
extracts were prepared, and EMSA was performed with the indicated
wild-type probes (M67SIE, Site 2+3, and GAS c+n) or the GAS c+n probe
mutated at either the consensus (GAS c*+n) or nonconsensus (GAS c+n*)
site.
|
|
Wild-type and Stat4 mutants were expressed in U3A cells, a cell line
that lacks expression of Stat1 due to a mutation (
23)
and
which also lacks expression of endogenous Stat4. IFN-

-induced
Stat4
activation was first analyzed by EMSA analysis with several
STAT-specific DNA binding probes (Fig.
1B). The M67SIE probe contains
a
single high-affinity consensus STAT site (
44) whose STAT
binding
should be unaffected by N domain-mediated tetramerization. Two
additional probes were used to analyze potential tetramer interactions.
The second probe, Site 2+3, is from the human IFN-

first intron
and
contains two adjacent STAT sites, one of which is a STAT consensus
and
the second of which is a nonconsensus STAT site (
47). The
third probe, GAS c+n, from the murine IL-2R

enhancer, was recently
shown to contain two adjacent STAT complexes that could interact
with
Stat5 as a tetramer (
17,
24). Probe E

Y-box was used
as a
positive control for the nuclear
extracts.
IFN-

treatment of U3A cells expressing Stat4 induced the formation
of EMSA complexes using each of the STAT probes (Fig.
1B, lane 2).
These complexes were not present in extracts of IFN-

-treated
control
U3A cells, which do not express Stat1 or Stat4 (Fig.
1B,
lane 1),
implying the complexes are specific to Stat4-expressing
cells.
Furthermore, supershift analysis revealed that the complexes
were
shifted only by Stat4 antibody (Fig.
1C, lane 5) and not
by any other
antibody to STATs potentially activated by IFN-
in these cells (Fig.
1C, lanes 1 to 4). Thus, these complexes
are composed either
exclusively of Stat4 or of Stat4 associated
with other factors, but not
factors entirely excluding Stat4.
Stat4 binds the M67SIE probe as both
a more rapidly migrating
complex (Fig.
1D, top panel, lane 1),
presumably the Stat4 dimer,
and a more slowly migrating complex,
consistent with Stat4 tetramers
described earlier (
47).
Using the Site 2+3 and the GAS c+n probes
(Fig.
1D, top panel, lanes 2 and 3), Stat4 binds only as the more
slowly migrating complex,
consistent with exclusive tetramer binding
to these probes as described
previously (
17,
47). Mutation
of either the nonconsensus
(Fig.
1D, top panel, lane 4) or consensus
(Fig.
1D, top panel, lane 5)
site within the GAS c+n probe abrogated
binding of Stat4. This confirms
that both STAT sites are necessary
for Stat4 binding and strongly
suggests that the low-mobility
complex represents a tetramer. Identical
results were obtained
with the Stat4 T40 E66A mutant (Fig.
1D, lower
panel, lanes 1
to 5), suggesting that mutation of these residues at the
N domain
dimer interface is not sufficient to disrupt tetramer
formation.
Surprisingly, mutation of the invariant tryptophan to alanine (W37A)
caused the loss of all DNA binding (Fig.
1B, lane 4),
inhibiting
formation of complexes not only with the Site 2+3 and
GAS c+n probes,
but also with M67SIE, which contains only one
high-affinity STAT
binding site. In contrast, mutations of other
residues at the
dimer-dimer contact face (Q36A, T40A, E66A, and
T40A E66A) did not
block DNA binding, but appeared similar to
wild-type Stat4 for each
probe tested (Fig.
1B, lanes 3, 5, 6,
and 7). Furthermore, mutation of
the lysine and arginine residues
K84A R85A present on the outer face of
the alpha 8 helix of the
N domain blocked IFN-

-induced EMSA
complexes, similar to the
W37A mutation (Fig.
1B, lane 8). Selective
interruption of N domain-mediated
tetramer formation would predict the
loss of tetramer binding
to the Site 2+3 and GAS c+n probes, but not
necessarily that of
dimers to the M67SIE probe. However, we
surprisingly observed
that mutations W37A and K84A R85A produced a more
general inactivation
of STAT DNA
binding.
Selective N domain mutations interfere with
IFN-
-receptor-mediated Stat4 tyrosine phosphorylation.
Conceivably, the general inhibition of DNA binding of the W37A Stat4
mutation resulted from a more general STAT inactivation, and not the
selective loss of N domain-mediated tetramer formation. To test this
hypothesis, we reexamined these mutants for early steps in STAT
activation, beginning with tyrosine phosphorylation induced by the
IFN-
receptor (Fig. 2). Wild-type U3A
cells or U3A cells stably expressing wild-type or mutant Stat4 proteins were left untreated (Fig. 2A) or were treated with IFN-
for 20 min
(Fig. 2B). Whole-cell extracts were prepared and immunoprecipitated with an antibody to the mouse Stat4 carboxy terminus, and Western blots
were developed for phosphotyrosine. Wild-type Stat4 undergoes strong
tyrosine phosphorylation in response to IFN-
(Fig. 2A, lane 0), as
expected, migrating as a closely spaced doublet, possibly due to
phosphoserine content. No Stat4 mutation tested here resulted in
constitutive phosphorylation in unstimulated cells (Fig. 2A, lanes 2 to
8). This implies that these mutations did not interfere with potential
phosphatase interactions, as was observed for the R31A mutation of
Stat1 (35). In addition, Stat4 mutants Q36A, T40A, E66A, and
T40A E66A (Fig. 2B, lanes 3, 5, 6, and 7) undergo tyrosine
phosphorylation in response to IFN-
treatment, indicating successful
receptor recruitment. Minor differences in the level of phosphorylation
of these Stat4 mutants are likely due to slight differences in the
level of purity of the sorted reconstituted cells, resulting in slight
differences in Stat4 mutant input into the immunoprecipitation.
Unexpectedly, the W37A Stat4 mutant completely lacked IFN-
-induced
tyrosine phosphorylation (Fig. 2B, lane 4), indicating a block at this
earliest point in STAT activation. Furthermore, the K84A R85A mutant,
inactive in the DNA binding mentioned above, also lacked tyrosine
phosphorylation (Fig. 2B, lane 8). These results indicate that the loss
of DNA binding by the W37A and K84 R85 Stat4 mutants stems from their
inability to undergo IFN-
-induced tyrosine phosphorylation, causing
failure to even form STAT dimers.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Loss of IFN- -induced Stat4 tyrosine phosphorylation
from selective mutations in the Stat4 N domain. (A) U3A cells prepared
with the retroviruses described in the legend to Fig. 1 were treated
with IFN- for 20 min (+) or left untreated ( ), and whole-cell
extracts were prepared and immunoprecipitated (IP) with 2 µg of
antibody specific to the C terminus of murine Stat4. Phosphotyrosine
(p-tyr) incorporation was determined with the antiphosphotyrosine
antibody RC20, and blots were stripped and probed with an antimurine
Stat4 antibody. (B) U3A cells prepared with the retroviruses described
in the legend to Fig. 1 were treated with IFN- for 20 min, and
whole-cell extracts were prepared. Phosphotyrosine incorporation into
Stat4 was determined as described for panel A.
|
|
N domains of Stat1 and Stat4 are not functionally
interchangeable.
Reliable application of functional results of N
domain mutations in Stat1 (43) or Stat5 (17) to
Stat4 presumes some functional equivalence between the N domains of
these proteins. To directly test this, we interchanged the N domains of
Stat1 and Stat4, either placing the Stat4 N domain into Stat1 (Fig.
3A, N4-C1) or placing the Stat1 N domain
into Stat4 (Fig. 3A, N1-C4). The chimeric splice was made in the alpha
8 helix of the N domain, since this region is highly conserved between
Stat1 and Stat4 and is positioned on the opposite side of the structure
from the dimer interaction face (43).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Functional noninterchangeability of Stat1 and Stat4 N
domains. (A) Schematic of STAT structure showing the general positions
of several domains (3). Below are diagrams of wild-type
Stat4 (Stat4 wt) and Stat1 (Stat1 wt) and of two chimeras. In the N1-C4
chimera, the N domain of Stat1 (Stat1-N) is placed onto the Stat4
carboxy terminus (Stat4-C); in the N4-C1 chimera, the N domain of Stat4
(Stat4-N) is placed onto the Stat1 carboxy terminus (Stat1-C). cDNAs
encoding these chimeras were placed into the retrovirus used for
expression of the Stat4 mutants as described in Fig. 1. (B) U3A cells
were infected with retroviruses expressing wild-type Stat4 (Stat4 wt)
or Stat1 (Stat1 wt) and the N1-C4 and N4-C1 chimeras as indicated.
Retrovirally infected cells were purified by cell sorting, treated with
IFN- , and nuclear extracts were prepared and analyzed by EMSA with
the indicated probes as described in the legend to Fig. 1B. Arrowheads
are positioned to indicate the relative migration positions between
gels: solid arrowheads indicate lower mobility, and open arrowheads
indicate higher mobility. Similar data were obtained in two other
independent experiments. (C) The cells described for panel B were
treated with IFN- . Whole-cell extracts were prepared and
immunoprecipitated with antibody to the Stat4 carboxy terminus (IP
Stat4-C) or with antibody to the Stat1 carboxy terminus (IP Stat1-C) as
indicated, and Western analysis was done for phosphotyrosine
incorporation with the antiphosphotyrosine antibody RC20 (p-Tyr) as
described above. Blots were stripped and reprobed with antimurine Stat4
antibody (Stat4-C) and antimurine Stat1 antibody (Stat1-C). (D) The
cells described in the legend to panel B were treated with IFN-
(1,000 U/ml) for 20 min. Nuclear extracts were prepared and analyzed by
EMSA with the indicated probes.
|
|
Wild-type Stat1, Stat4, and both chimeric STAT proteins were stably
expressed in U3A cells and activated by IFN-

, and their
DNA binding
was analyzed by EMSA with probes described in Fig.
1. Wild-type Stat1
and Stat4 bind with clearly distinguishable
characteristics to these
three probes. First, with the M67SIE
probe, Stat4 forms complexes of
both low and high mobility (Fig.
3B, upper panel, lane 1), whereas
Stat1 forms only complexes of
high mobility (lane 2). The high-mobility
Stat4 complexes have
been shown to represent dimers, and the
low-mobility complexes
represent tetramers (
43).
Furthermore, with the Site 2+3 and
GAS c+n probes, Stat4 forms only
low-mobility complexes, consistent
with exclusive tetramer formation,
whereas Stat1 does not form
complexes at all with these probes (Fig.
3B). Notably, replacement
of the Stat1 N domain with the Stat4 N domain
(N4-C1) does not
generate the lower-mobility complexes seen with
wild-type Stat4
(Fig.
3B, lane 4), as would be predicted by strict
interchangeability
of the N domains. Rather, using the M67SIE probe,
the N4-C1 chimera
forms only high-mobility complexes migrating as a
doublet, perhaps
due to heterodimer formation (Fig.
3B, lane 4), and
fails to form
any complexes with the Site 2+3 or GAS c+n probes.
Identical results
were obtained when the chimeric junction was in the
alpha 7 helix
of the N domain (data not
shown).
Further analysis of the N1-C4 chimera suggests a role for the Stat4 N
domain in proximal receptor interactions regulating
tyrosine
phosphorylation of STATs, as suggested in Fig.
2. Placement
of the
Stat1 N domain into Stat4 (N1-C4) caused a complete loss
of DNA binding
with all of these probes (Fig.
3B, lane 3), potentially
caused by loss
of tyrosine phosphorylation similar to the W37A
mutation. To test this,
we examined both chimeras for IFN-

-induced
tyrosine phosphorylation
(Fig.
3C). As positive controls, Stat1
and Stat4 both undergo
IFN-

-induced tyrosine phosphorylation
as expected (Fig.
3C, lanes 1 and 2). In addition, N4-C1 undergoes
tyrosine phosphorylation,
consistent with its ability to bind
the M67SIE probe (Fig.
3C, lane 4).
In contrast, however, the
N1-C4 chimera does not undergo
IFN-

-induced tyrosine phosphorylation
(Fig.
3C, lane 3). As further
positive controls, we carried out
direct Western analysis to ensure
proper protein expression. The
N1-C4 chimera is detected at the
expected position by antisera
to the C terminus of Stat4, and the N4-C1
chimera is detected
by antisera to the C terminus of Stat1 (Fig.
3C,
middle and lower
panels). Thus, the N1-C4 chimera is properly expressed
at the
level of protein, but fails to become tyrosine phosphorylated,
explaining its inability to bind all EMSA probes (Fig.
3B).
We next tested whether the Stat4 and Stat1 chimeras could be activated
by IFN-

(Fig.
3D) as measured by EMSA with probe M67.
As expected,
wild-type Stat4 was not activated by IFN-

, whereas
Stat1 was
activated and bound to M67 as a high-mobility complex
(Fig.
3D, lanes 1 and 2). Similar to IFN-

stimulation, the N1-C4
chimera was not
activated by IFN-

stimulation, likely due to
the inability of the
Stat4 SH2 domain to interact with the IFN-
receptor. Surprisingly,
the N4-C1 chimera produced both the low-mobility
and high-mobility
complexes on M67. This provides the first functional
evidence that the
Stat4 N domain can participate in tetramer formation
in the context of
N4-C1 homodimers induced by IFN-

, but perhaps
not in the context of
N4-C1-Stat2-p48 complexes induced by IFN-

.
Transfer of the Stat4 N domain onto Stat1 (N4-C1) produced EMSA
complexes with mobility similar to that of wild-type Stat1
following
IFN-

stimulation (Fig.
3B, compare lanes 2 and 4),
but produced
additional complexes with low mobility similar to
that of wild-type
Stat4 following IFN-

stimulation (Fig.
3D,
compare lanes 2 and 4).
To test for potential functional changes
in the N4-C1 chimera, we
analyzed IFN-

- and IFN-

-induced expression
of major
histocompatibility complex (MHC) class I in U3A cells
transfected to
stably express Stat1, Stat4, or the N4-C1 chimera
(Fig.
4). Since U3A cells lack Stat1,
uninfected cells show no
MHC class I induction by IFN-

or IFN-

,
as expected. Expression
of Stat1, but not Stat4, restores IFN-

- and
IFN-

-induced expression
of MHC class I, showing that this effect is
specific to Stat1.
Surprisingly, expression of the N4-C1 chimera in U3A
cells failed
to restore IFN-

-induced MHC class I expression (Fig.
4,
left
panel), despite the ability of this chimera to form EMSA complexes
similar to those of wild-type Stat1. However, the N4C1 chimera
was
fully functional for IFN-

-induced MHC class I induction (Fig.
4,
right panel). This result suggests that the N domains of Stat1
and
Stat4 are not fully functionally interchangeable for gene-specific
transactivation events.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Functional nonequivalence of the Stat4 and Stat1 N
domains. (Left panels) Uninfected U3A cells (uninfected) or U3A cells
expressing murine Stat1 (mStat1), the N4-C1 chimeric Stat protein
(N4-C1), or wild-type Stat4 (mStat4) as described in the legend to Fig.
3 were either left untreated (light lines) or were treated with IFN-
(bold lines) for 48 h. (Right panels) Cells were left untreated
(light lines) or treated with IFN- (bold lines) for 48 h.
Results were analyzed by flow cytometry with a Becton Dickinson FACScan
for surface expression of MHC class I by using a PE-conjugated
anti-class I-specific antibody, clone Tu149 (Caltag).
|
|
Inhibition of tyrosine phosphatase does not rescue
phosphorylation-defective mutants.
We wondered whether
tyrosine phosphorylation of the W37A and K84A R85A Stat4 mutants and
the N1-C4 chimera could be achieved independently of receptor
signaling. Therefore, we treated U3A cells expressing wild-type or
mutant STATs with sodium pervanadate to inhibit phosphatases
(9). Nuclear extracts were prepared and analyzed by EMSA
(Fig. 5). Pervanadate treatment of U3A
cells containing wild-type Stat4 resulted in formation of a complex with mobility equal to that of the high-mobility complex generated by
IFN-
treatment (Fig. 5, compare lanes 1 and 4), but did not generate
the low-mobility tetramer complex. A complex of intermediate mobility
was also observed, but it was not supershifted with an antibody to
Stat4 (Fig. 5, lanes 4 and 5) and was present in uninfected U3A cells
(Fig. 5, lanes 6 and 7), indicating that it does not contain Stat4.
Neither the W37A nor the K84A R85A mutations of Stat4 produced a
Stat4-containing complex after pervanadate treatment (Fig. 5, lanes 8 to 11). In addition, pervanadate treatment of U3A cells containing
wild-type Stat1 produced a high-mobility complex (Fig. 5, lane 12),
while treatment of cells containing the N1-C4 chimera produced no
complexes (Fig. 5, lane 13), and treatment of cells containing the
N4-C1 chimera produced a very weak high-mobility complex (Fig. 5, lane
14). Thus, the inability of various mutants to be activated by receptor
ligation cannot be overcome by inhibition of phosphatase, suggesting a
primary defect in their ability to become tyrosine phosphorylated at
all, perhaps due to a lack of recognition by an appropriate kinase.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of tyrosine phosphatase does not rescue
phosphorylation-defective mutants. U3A cells either uninfected or
expressing the indicated proteins were treated with IFN- for 20 min
(IFN- ), 500 µM H2O2 (mock), or 500 µM
H2O2-500 µM NaVO4
(VO4) for 30 min as described previously (9).
Nuclear extracts were prepared and analyzed by EMSA with the indicated
probes in the absence ( ) or presence (+) of antibody to the Stat4
carboxy terminus. wt, wild type; ND, not determined.
|
|
N domain mutations influence IL-12R-induced Stat4 tyrosine
phosphorylation.
Since the W37A mutation of the Stat4 N-domain
blocked tyrosine phosphorylation induced by IFN-
, we wondered
whether this mutation would also block activation induced by IL-12. For
this, we used Stat4-deficient T cells, which express IL-12Rs, but lack endogenous Stat4 (29, 41). Wild-type and Stat4-deficient
DO11.10 T-cell receptor (TCR) transgenic cells were infected with
control retrovirus or retrovirus expressing wild-type, W37A, or T40A
E66A Stat4 proteins, purified by cell sorting, and analyzed for
IL-12-induced Stat4 nuclear translocation (Fig.
6A). Since relatively small numbers of
cells can be obtained in the infections of primary T cells, we used
nuclear translocation as a surrogate assay for Stat4 tyrosine
phosphorylation. As a further control, we examined nuclear
translocation of Stat1, which is also activated by IL-12 (16). IL-12-treated wild-type T cells showed strong nuclear translocation of Stat4 (Fig. 6A, lane 1). Stat4-deficient T cells infected with control retrovirus (GFP-RV) showed only Stat1 nuclear location, but no Stat4 nuclear localization (Fig. 6A, lane 2), as
expected. Stat4-deficient T cells infected with wild-type Stat4 showed
IL-12-induced Stat4 nuclear translocation (Fig. 6A, lane 3), as
expected, as did the T40A E66A mutant (lane 5). In contrast, the W37A
Stat4 mutant showed no IL-12-induced nuclear translocation, implying an
inability to undergo tyrosine phosphorylation by IL-12. Thus, these
data suggest that the W37 mutation in the Stat4 N domain also disrupts
activation induced by IL-12 signaling, as it did for IFN-
signaling.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6.
Loss of IL-12-induced Stat4 nuclear translocation and
Stat4-dependent IFN- production from mutations in the Stat4 N
domain. (A) DO11.10 TCR transgenic T cells from wild-type
(Stat4+/+) or Stat4-deficient (Stat4 / ) mice
were activated as described previously (29) and infected
with empty GFP-RV retrovirus (GFP-RV) or retrovirus expressing
wild-type Stat4 (Stat4 wt) or W37A or T40A E66A N domain mutations as
indicated. Cells were grown in the presence of 10 U of IL-12 per ml and
expanded for 7 days, and the infected T cells were purified by positive
cell sorting for expression of GFP and murine CD4. Purified T cells
were expanded by restimulation with irradiated BALB/c splenocytes and
ovalbumin and treated with IL-12, nuclear extracts were prepared, and
direct Western analysis was done for Stat4 and Stat1. Similar results
were obtained in two independent experiments. (B) T cells derived and
purified as for panel A were analyzed for the production of IFN- in
response to IL-12-IL-18 combined treatment. T cells were placed at
106 cells per well of a 48-well plate in 1 ml of medium and
treated with IL-12 (10 U/ml) and IL-18 (100 U/ml) for 48 h,
supernatants were harvested, and IFN- was measured by enzyme-linked
immunosorbent assay.
|
|
IFN-

production induced by IL-12 or IL-18 in CD4
+ T
cells is a Stat4-dependent activity (
2). N domain
interactions between
Stat4 dimers bound to adjacent low-affinity,
nonconsensus sites
within the IFN-

gene promoter and first intron
were suggested
as a mechanism for augmenting IFN-

gene expression
(
47). Thus,
to check for functional consequences of the W37A
and T40A E66A
mutations in IL-12-induced Stat4 activation, we analyzed
these
T cells for IFN-

production (Fig.
6B). Stably infected T cells
expressing the constructs shown in Fig.
5A were harvested and
treated
with IL-12 and IL-18 for 48 h, and supernatants were analyzed
for
IFN-

production by ELISA (Fig.
6B). Stat4-deficient T cells
infected
with empty retrovirus failed to produce IFN-

in response
to IL-12
and IL-18 treatment (Fig.
6B), as expected, since Stat4
is required for
Th1 development (
18,
41). Reconstitution of
Stat4-deficient
T cells with wild-type Stat4 produced significantly
higher IFN-

at
approximately 800 ng/ml following IL-12 and IL-18
treatment. In
contrast, the W37A Stat4 mutant failed to restore
IFN-

production,
whereas the T40 E66 Stat4 mutation reconstituted
IFN-

production to
levels similar to those of wild-type Stat4
(Fig.
6B). Thus, the T40 E66
Stat4 mutation, although predicted
by the crystal structure to be
likely to disrupt N domain interactions,
nonetheless functions normally
for IFN-

production. Thus, the
W37A mutation in the Stat4 N domain
generated a functional deficit
in a Stat4-dependent response to IL-12
signaling, consistent with
the observed loss of IL-12-induced nuclear
translocation.
The Stat4 N domain allows Stat2-independent Stat1 activation.
The W37A and K84A R85A mutations in the Stat4 N domain, as well as a
Stat4 N domain-Stat1 chimera, are unable to become phosphorylated in
response to IFN-
(Fig. 2B and 3C). One possible explanation is that
the Stat4 N domain is involved in the presentation of Stat4 to the
receptor before ligand-mediated activation. In fact, a similar role for
the Stat2 N domain has been suggested (21) based on the
following observations. In U6A cells, phosphorylation of Stat1 is very
weak, but can be restored by reintroducing Stat2. Furthermore,
replacement of the N-terminal third of Stat1 with that of Stat2 allowed
Stat1 to preassociate with the IFN-
R2 chain and become
phosphorylated efficiently (21, 37). Therefore, we wondered
if the Stat4 N domain could perform a similar function to the Stat2 N
domain in allowing Stat1 to preassociate with the IFN-
R2 and become phosphorylated.
To test this, we expressed Stat1 and the N4-C1 chimera into U6A cells
lacking Stat2 or into U6A cells reconstituted with Stat2
(Fig.
7). We then examined the requirement for
Stat2 in Stat1
activation and in activation of the N4-C1 chimera. Cells
were
treated with IFN-

, and phosphotyrosine incorporation was
assessed
by immunoprecipitating cell lysates with antisera specific to
the Stat1 carboxy terminus (Fig.
7, lanes 1 to 4) or the Stat4
amino
terminus (lanes 5 to 8). IFN-

-induced Stat1 phosphorylation
was very
weak in U6A cells lacking Stat2 (Fig.
7, lane 1), as
expected, but was
significantly increased upon coexpression of
Stat2 (Fig.
7, lane 2), in
agreement with earlier reports (
20,
30). In contrast, the
N4-C1 chimera showed tyrosine phosphorylation
that was independent of
Stat2 expression (Fig.
7, lanes 7 and
8). As controls, direct Western
blots were done to show the expected
expression of the Stat4 N domain
under only those conditions in
which the N4-C1 chimera was expressed
(Fig.
7, middle panels)
and to show the expression of the Stat1 C
terminus under the conditions
expected (lower panels). Thus, the N
domain of Stat4 conferred
to Stat1 an ability to undergo
IFN-

-induced tyrosine phosphorylation
in a manner independent of
Stat2. Since Stat1 and the N4-C1 chimera
have identical SH2 domains,
this suggests that the Stat4 N domain
may provide Stat1 with the
ability to preassociate with the receptor,
a requirement normally
provided by Stat2.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 7.
N domain involvement in Stat2-dependent Stat1
activation. U6A cells, which lack Stat2 expression, were infected (+)
with bicistronic retrovirus expressing human Stat2 (hStat2) and human
CD4 with truncation of the cytoplasmic domain, infected (+) with a
bicistronic retrovirus expressing the N4-C1 STAT chimera (Fig. 3A) and
GFP, infected with both viruses, or left uninfected ( ) as indicated.
Cells were purified to >95% by sorting of surface expression of the
human CD4 marker for the hStat2 construct with an
anti-hCD4-PE-conjugated antibody or by sorting for GFP expression for
the N4-C1 STAT chimera, and doubly infected U6A cells were purified by
sorting coexpression of both markers. Purified cells were treated with
IFN- for 20 min, and whole-cell extracts were prepared and
immunoprecipitated with an antibody specific to the carboxy terminus of
Stat1 (IP: Stat1-C) or the N terminus of Stat4 (IP: Stat4-N). Western
analysis was done for phosphotyrosine with RC20 (p-tyr). Blots were
stripped and reprobed with an antibody specific for the N terminus of
Stat4 (Stat4-N) or carboxy terminus of Stat1 (Stat1-C).
|
|
W37A mutation of the Stat1 N domain interferes with
IFN-
-mediated Stat1 DNA binding.
Previously, the importance of
the invariant residue W37 in N domain dimers seen for Stat4 was tested
by gel mobility shift assay with a W37A mutation of Stat1 purified from
baculovirus-infected insect cells and in vitro phosphorylated by
immunoprecipitated activated epidermal growth factor receptor kinase
(43). To test the effect on DNA binding of this Stat1
mutation in a more physiologic system, we reconstituted U3A cells with
the W37A Stat1 mutation and determined IFN-
-induced Stat1 activation
by EMSA (Fig. 8). Wild-type Stat1 binds
to probe M67SIE as a high-mobility complex, consistent with exclusive
dimer binding to this single site probe (Fig. 8, lane 1), while the
W37A mutant does not produce an EMSA complex (Fig. 8, lane 2). Since
Stat1 appears to bind only as a dimer to this probe, the lack of
binding of the mutant is not due to loss of the tetramer, but rather an
earlier step in Stat1 activation. Thus, this role for the N domain may
be conserved between various STATs.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 8.
W37A mutation of Stat1 causes loss of IFN- -induced
DNA binding. U3A cells were infected with wild-type Stat1 (wt) or Stat1
with a W37A mutation. Retrovirally infected cells were purified by cell
sorting and treated with IFN- for 20 min. Nuclear extracts were
prepared, and EMSA was performed with the indicated probes. Arrowheads
are positioned to indicate the relative migration positions between
gels: solid arrowheads indicate lower mobility and open arrowheads
indicate higher mobility.
|
|
 |
DISCUSSION |
To test whether N domain-mediated tetramerization is important for
the authentic physiologic actions of Stat4, we mutated residues in the
Stat4 N domain that were structurally implicated in dimer formation and
tested their activities by expression in Stat4-deficient cells. We
first generated a mutation in Stat4 corresponding to one previously
analyzed for Stat1 (43) or Stat5 (17) and
interpreted as disrupting Stat1 tetramer formation. In particular,
mutation of the invariant tryptophan residue W37 in Stat1 was found to
block IFN-
-induced activity of a synthetic luciferase reporter
containing tandem STAT-binding sites as an enhancer (43).
The same mutation in Stat5a and Stat5b led to significant reduction in
IL-2-induced activity of a luciferase reporter driven by the PRRIII
enhancer of the IL-2R
chain (17). In addition to mutating
W37 of Stat4, we also mutated E66, which makes an important
water-mediated contact with W37 in the N domain dimer interface and is
spatially related to the K70A mutation reported by John et al.
(17) for Stat5. We also mutated residue Q36, which makes
reciprocal contacts with Q36 in the adjoining dimer, and T40 which
contacts Q41, Q67, and R70 of the paired N domain dimer. Finally, we
mutated the pair of basic residues K84 and R85 based on the slight
similarity of this region to nuclear localization sequences
(4), not expecting this mutation to influence tetramer
formation. Surprisingly, the analysis of these mutations in Stat4
revealed that the Stat4 N domain likely plays an additional role beyond
tetramer formation, acting in receptor-proximal interactions of Stat4
as a substrate for receptor-associated kinases.
Since tetramer formation can be analyzed by EMSA (17, 47),
we began by comparing the EMSA complexes generated by wild-type and
mutant Stat4 proteins. U3A cells were used, since they lack expression
of Stat1 by a mutation (23) and do not express endogenous Stat4 (8). Wild-type Stat4 generated complexes on a single high-affinity STAT site probe, M67SIE, whose mobilities were consistent with the formation of both dimers and tetramers, as previously described (17, 47). In contrast, with probes Site 2+3 and GAS c+n, each containing adjacent STAT sites, wild-type Stat4 generated
only the complex whose mobility was consistent with the formation of a
tetramer. Several mutations that were predicted to disrupt potential
tetramer interactions based on the crystal structure of the Stat4 N
domain dimer had no effect on binding to any of the three probes used
in this study. For the W37A mutation, however, we observed loss of
binding to the Site 2+3 and GAS c+n probes, consistent with the loss of
tetramer formation. However, we also unexpectedly observed loss of both
the lower- and higher-mobility complexes using the M67SIE probe,
indicating loss of dimer formation as well.
Therefore, as a control, we examined the capacity for these Stat4
mutants to undergo IFN-
-induced tyrosine phosphorylation (Fig. 2).
Surprisingly, the W37A Stat4 mutation had lost IFN-
-induced phosphotyrosine incorporation, suggesting a much earlier defect in
activation caused by this mutant, but nonetheless explaining the loss
of both tetramer and dimer formation. Mutations of the other residues
within the dimer interface did not cause this loss of tyrosine
phosphorylation. Thus, the W37A mutation of the Stat4 N domain
prevented the STAT monomer from becoming a suitable substrate for the
receptor-associated kinase during STAT activation.
Leonard and colleagues examined similar mutations in the N domain for
Stat5 regulation of the IL-2R
chain enhancer (17). In
Stat5, the W37A and K70A mutations, as well as the W37A K70A double
mutation, suggested a role for these residues in IL-2 induction via
Stat5 activation of enhancer activity. The mutations were found to
allow nuclear localization of Stat5 and thus were presumably phosphorylated, since phosphorylation is thought to be a prerequisite for STAT nuclear localization. However, that study did not explicitly examine phosphorylation of Stat5 mutants by Western blotting. In
contrast, the W37A mutation in Stat4 blocked activation induced by both
IL-12 and IFN-
.
We were surprised to find that mutation of Stat4 predicted by the
crystal structure to disrupt N domain dimerization (i.e., T40A E66A)
still bound DNA as a tetramer and was fully functional for
Stat4-dependent IFN-
production in developing T cells. This indicates that other residues may contribute to this apparently quite
stable Stat4 tetramer. Interestingly, DNA binding site selection of
dimeric and tetrameric Stat5 revealed that the most favorable inter-GAS
spacing was 6 bp for Stat5a (36). This spacing positions the
two Stat5 dimers on opposite sides of the DNA and allowed for
additional stabilizing interactions between Stat5a core sequences according to a model based on the Stat1 structure. In our double site
probes, the spacing of 11 bp between GAS elements would be predicted to
position Stat4 dimers on the same side of the DNA and seemingly too far
apart to allow interaction between core sequences. Optimal sites for
Stat4 tetramer binding have not been determined, nor are examples of
Stat4-dependent promoters currently known in which to carefully examine
these issues. In essence, the role of the N domain for STAT-tetramer
formation is still uncertain, and tetramer formation may involve
interactions between other regions of the STAT molecule.
We noticed that in the alpha 7 helix of the Stat4 N domain, outside the
dimer interaction face, a series of residues, KRIRKVL, exhibited some
similarity to a monopartite nuclear localization signal (4).
This region of the N domain is not well conserved between the STATs,
and so may not be the location of elements that are generally involved
in STAT nuclear translocation. However, we found that mutating two
basic residues in this region, K84A and R85A, led to an unpredicted
loss of tyrosine phosphorylation in response to IFN-
. A recent study
(39) showed that deletion of the N domain of Stat1, as well
as swapping the Stat2 N domain into Stat1 (CH2/1), resulted in
defective nuclear translocation not attributed to lack of
phosphorylation. Notably, in that study, the mutated STAT proteins were
activated to undergo tyrosine phosphorylation by using an artificial
receptor consisting of the extracellular domain of the human
granulocyte colony-stimulating factor receptor fused to the
transmembrane and intracellular domains of the IFN-
R
chain,
fused to the Stat1 recruitment site ("y" motif). The use of this
artificial receptor, which is very different in structure from the
native IFN-
R used in our study, could potentially produce differences in requirements for receptor-induced tyrosine
phosphorylation. Our chimeric protein, N4-C1, appears to be functional
for nuclear translocation, since our EMSA studies were all performed
with nuclear extracts. However, using the native IFN-
R, we see
differences in tyrosine phosphorylation in the simple swap of N domains
between Stat1 and Stat4, suggesting that there may be subtle
interactions determining whether a molecule is a suitable substrate for
the receptor-associated kinase.
We observed that in nuclear extracts from cytokine-activated cells,
Stat4 binds to a high-affinity STAT site, M67SIE, as both low- and
high-mobility complexes, whereas Stat1 binds only as a high-mobility
complex. Furthermore, two probes containing adjacent STAT sites bind
Stat4, but not Stat1. Since the DNA binding preference of Stat4
determined by random binding site selection is identical to that for
Stat1 (47), we wondered whether the difference in probe
binding could be explained by tetramer formation in the case of Stat4
and lack of tetramerization for Stat1. We found that a chimera
containing the Stat4 N domain and Stat1 carboxy domain (N4-C1) still
cannot bind to adjacent site probes, nor produces the low-mobility
complex on M67SIE when activated by IFN-
treatment. However the same
chimera does produce tetrameric complexes when activated by IFN-
treatment. This suggests that tetramerization is a possible explanation
for the difference in Stat4 and Stat1 binding to these probes at least
for homodimer formation in the context of IFN-
stimulation.
Interestingly, we found that a chimera containing the Stat1 N domain
and Stat4 carboxy domain (N1-C4) was unable to be phosphorylated after
IFN-
or IFN-
treatment, demonstrating that the N domains of STATs are not functionally interchangeable.
Since IL-12 as well as IFN-
activates Stat4, we asked whether N
domain mutations would respond similarly to both stimuli. For the
IL-12R complex, the Stat4 SH2 domain is directly recruited to a
tyrosine motif Y800 (YLPSNID) in the IL-12R
2 subunit cytoplasmic domain (26). For the human IFN-
R complex, the Stat4 SH2
domain binds to activated Stat2 rather than to the receptor itself. We found that the W37A mutation of Stat4 blocked activation by both IL-12
and IFN-
, suggesting that although the SH2 domain interactions with
either IFN-
and IL-12R complexes are different, there may be a
preceding step in Stat4 activation common to both receptor pathways.
Stark and colleagues have shown that Stat1 and Stat2 may be
preassociated with the R2 subunit of the IFN-
R (IFNAR2) through the
Stat2 amino terminus (21). No evidence for preassociation of
Stat4 with either the IFN-
or IL-12R complex has yet been published.
Our data showing that phosphorylation of the N4-C1 chimera is
independent of Stat2 suggest that the Stat4 N domain may allow the
preassociation of Stat1 with the IFNAR2, a role normally provided by
Stat2. Interestingly, Ndubuisi et al. (27) found that the
cytoplasmic pool of Stat3 resides in high-molecular-mass complexes
termed "statosomes," in which Stat3 may associate with the
chaperone GRP58, rather than residing as a monomer. Conceivably, the
Stat4 N domain interacts directly with cytokine receptors before
activation, similar to Stat2, or alternately, adapter proteins may
interact with the Stat4 N domain to regulate either preassociation with
cytokine receptors or its participation in statosomes.
In summary, this study demonstrates that mutations in the Stat4 N
domain can interrupt the proximal process of tyrosine phosphorylation by activated receptors. For Stat4, the W37A mutation prevents activation by interfering with the earliest step, before the formation of STAT dimers, preventing an in vivo analysis of tetramer formation. Studies of N domain interchange further indicate that N domains may not
be freely interchangeable between different STATs for physiologic
activation by cytokine receptors. Together, these results suggest that
private activities mediated by some STAT N domains could influence
association with the receptor or the ability to become a substrate for
receptor-associated kinases.
 |
ACKNOWLEDGMENTS |
We thank George Stark and Stewart Leung for cell lines, Dominic
Fenoglio for help with cell sorting, Kathy Frederick for animal husbandry, and Michael Martin Murphy for technical help.
This work was supported by AI34580 and AI/DK39676 and a grant from the
Juvenile Diabetes Foundation. K.M.M. is an associate investigator of
the Howard Hughes Medical Institute.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, Washington University School of Medicine, 660 S. Euclid
Ave., St. Louis, MO 63110. Phone: (314) 362-2009. Fax: (314) 747-4888. E-mail: murphy{at}immunology.wustl.edu.
 |
REFERENCES |
| 1.
|
Bacon, C. M.,
E. F. Petricoin,
J. R. Ortaldo,
R. C. Rees,
A. C. Larner,
J. A. Johnston, and J. J. O'Shea.
1995.
Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes.
Proc. Natl. Acad. Sci. USA
92:7307-7311[Abstract/Free Full Text].
|
| 2.
|
Carter, L. L., and K. M. Murphy.
1999.
Lineage-specific requirement for signal transducer and activator of transcription (Stat)4 in interferon gamma production from CD4(+) versus CD8(+) T cells.
J. Exp. Med.
189:1355-1360[Abstract/Free Full Text].
|
| 3.
|
Chen, X.,
U. Vinkemeier,
Y. Zhao,
D. Jeruzalmi,
J. E. Darnell, Jr., and J. Kuriyan.
1998.
Crystal structure of a tyrosine phosphorylated STAT-1 dimer bound to DNA.
Cell
93:827-839[CrossRef][Medline].
|
| 4.
|
Conti, E.,
M. Uy,
L. Leighton,
G. Blobel, and J. Kuriyan.
1998.
Crystallographic analysis of the recognition of a nuclear localization signal by the nuclear import factor karyopherin alpha.
Cell
94:193-204[CrossRef][Medline].
|
| 5.
|
Darnell, J. E., Jr.,
I. M. Kerr, and G. R. Stark.
1994.
Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins.
Science
264:1415-1421[Abstract/Free Full Text].
|
| 6.
|
Darnell, J. E., Jr.
1997.
STATs and gene regulation.
Science
277:1630-1635[Abstract/Free Full Text].
|
| 7.
|
Decker, T.,
P. Kovarik, and A. Meinke.
1997.
GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression.
J. Interferon Cytokine Res.
17:121-134[Medline].
|
| 8.
|
Farrar, J. D.,
J. D. Smith,
T. L. Murphy, and K. M. Murphy.
2000.
Recruitment of Stat4 to the human interferon-alpha/beta receptor requires activated Stat2.
J. Biol. Chem.
275:2693-2697[Abstract/Free Full Text].
|
| 9.
|
Haque, S. J.,
V. Flati,
A. Deb, and B. R. Williams.
1995.
Roles of protein-tyrosine phosphatases in Stat1 alpha-mediated cell signaling.
J. Biol. Chem.
270:25709-25714[Abstract/Free Full Text].
|
| 10.
|
Horvath, C. M.,
Z. Wen, and J. E. Darnell, Jr.
1995.
A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain.
Genes Dev.
9:984-994[Abstract/Free Full Text].
|
| 11.
|
Hsieh, C. S.,
A. B. Heimberger,
J. S. Gold,
A. O'Garra, and K. M. Murphy.
1992.
Differential regulation of T helper phenotype development by interleukins 4 and 10 in an alpha beta T-cell-receptor transgenic system.
Proc. Natl. Acad. Sci. USA
89:6065-6069[Abstract/Free Full Text].
|
| 12.
|
Hsieh, C. S.,
S. E. Macatonia,
A. O'Garra, and K. M. Murphy.
1993.
Pathogen-induced Th1 phenotype development in CD4+ alpha beta-TCR transgenic T cells is macrophage dependent.
Int. Immunol.
5:371-382[Abstract/Free Full Text].
|
| 13.
|
Hsieh, C. S.,
S. E. Macatonia,
C. S. Tripp,
S. F. Wolf,
A. O'Garra, and K. M. Murphy.
1993.
Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages.
Science
260:547-549[Abstract/Free Full Text].
|
| 14.
|
Ihle, J. N.
1996.
STATs: signal transducers and activators of transcription.
Cell
84:331-334[CrossRef][Medline].
|
| 15.
|
Ihle, J. N., and I. M. Kerr.
1995.
Jaks and Stats in signaling by the cytokine receptor superfamily.
Trends Genet.
11:69-74[CrossRef][Medline].
|
| 16.
|
Jacobson, N. G.,
S. J. Szabo,
R. M. Weber-Nordt,
Z. Zhong,
R. D. Schreiber,
J. E. Darnell, Jr., and K. M. Murphy.
1995.
Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4.
J. Exp. Med.
181:1755-1762[Abstract/Free Full Text].
|
| 17.
|
John, S.,
U. Vinkemeier,
E. Soldaini,
J. E. Darnell, Jr., and W. J. Leonard.
1999.
The significance of tetramerization in promoter recruitment by Stat5.
Mol. Cell. Biol.
19:1910-1918[Abstract/Free Full Text].
|
| 18.
|
Kaplan, M. H.,
Y. L. Sun,
T. Hoey, and M. J. Grusby.
1996.
Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice.
Nature
382:174-177[CrossRef][Medline].
|
| 19.
|
Leonard, W. J., and J. J. O'Shea.
1998.
Jaks and STATs: biological implications.
Annu. Rev. Immunol.
16:293-322[CrossRef][Medline].
|
| 20.
|
Leung, S.,
S. A. Qureshi,
I. M. Kerr,
J. E. Darnell, Jr., and G. R. Stark.
1995.
Role of STAT2 in the alpha interferon signaling pathway.
Mol. Cell. Biol.
15:1312-1317[Abstract].
|
| 21.
|
Li, X.,
S. Leung,
I. M. Kerr, and G. R. Stark.
1997.
Functional subdomains of STAT2 required for preassociation with the alpha interferon receptor and for signaling.
Mol. Cell. Biol.
17:2048-2056[Abstract].
|
| 22.
|
Manetti, R.,
P. Parronchi,
M. G. Giudizi,
M. P. Piccinni,
E. Maggi,
G. Trinchieri, and S. Romagnani.
1993.
Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells.
J. Exp. Med.
177:1199-1204[Abstract/Free Full Text].
|
| 23.
|
McKendry, R.,
J. John,
D. Flavell,
M. Muller,
I. M. Kerr, and G. R. Stark.
1991.
High-frequency mutagenesis of human cells and characterization of a mutant unresponsive to both alpha and gamma interferons.
Proc. Natl. Acad. Sci. USA
88:11455-11459[Abstract/Free Full Text].
|
| 24.
|
Meyer, W. K.,
P. Reichenbach,
U. Schindler,
E. Soldaini, and M. Nabholz.
1997.
Interaction of STAT5 dimers on two low affinity binding sites mediates interleukin 2 (IL-2) stimulation of IL-2 receptor alpha gene transcription.
J. Biol. Chem.
272:31821-31828[Abstract/Free Full Text].
|
| 25.
|
Mikita, T.,
D. Campbell,
P. Wu,
K. Williamson, and U. Schindler.
1996.
Requirements for interleukin-4-induced gene expression and functional characterization of Stat6.
Mol. Cell. Biol.
16:5811-5820[Abstract].
|
| 26.
|
Naeger, L. K.,
J. McKinney,
A. Salvekar, and T. Hoey.
1999.
Identification of a STAT4 binding site in the interleukin-12 receptor required for signaling.
J. Biol. Chem.
274:1875-1878[Abstract/Free Full Text].
|
| 27.
|
Ndubuisi, M. I.,
G. G. Guo,
V. A. Fried,
J. D. Etlinger, and P. B. Sehgal.
1999.
Cellular physiology of STAT3: where's the cytoplasmic monomer?
J. Biol. Chem.
274:25499-25509[Abstract/Free Full Text].
|
| 28.
|
Ouyang, W.,
N. G. Jacobson,
D. Bhattacharya,
J. D. Gorham,
D. Fenoglio,
W. C. Sha,
T. L. Murphy, and K. M. Murphy.
1999.
The Ets transcription factor ERM is Th1-specific and induced by IL-12 through a Stat4-dependent pathway.
Proc. Natl. Acad. Sci. USA
96:3888-3893[Abstract/Free Full Text].
|
| 29.
|
Ouyang, W.,
S. H. Ranganath,
K. Weindel,
D. Bhattacharya,
T. L. Murphy,
W. C. Sha, and K. M. Murphy.
1998.
Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism.
Immunity
9:745-755[CrossRef][Medline].
|
| 30.
|
Qureshi, S. A.,
S. Leung,
I. M. Kerr,
G. R. Stark, and J. E. Darnell, Jr.
1996.
Function of Stat2 protein in transcriptional activation by alpha interferon.
Mol. Cell. Biol.
16:288-293[Abstract].
|
| 31.
|
Ranganath, S.,
W. Ouyang,
D. Bhattarcharya,
W. C. Sha,
A. Grupe,
G. Peltz, and K. M. Murphy.
1998.
GATA-3-dependent enhancer activity in IL-4 gene regulation.
J. Immunol.
161:3822-3826[Abstract/Free Full Text].
|
| 32.
|
Rogge, L.,
D. D'Ambrosio,
M. Biffi,
G. Penna,
L. J. Minetti,
D. H. Presky,
L. Adorini, and F. Sinigaglia.
1998.
The role of Stat4 in species-specific regulation of Th cell development by type I IFNs.
J. Immunol.
161:6567-6574[Abstract/Free Full Text].
|
| 33.
|
Schindler, U.,
P. Wu,
M. Rothe,
M. Brasseur, and S. L. McKnight.
1995.
Components of a Stat recognition code: evidence for two layers of molecular selectivity.
Immunity
2:689-697[CrossRef][Medline].
|
| 34.
|
Seidel, H. M.,
L. H. Milocco,
P. Lamb,
J. E. J. Darnell,
R. B. Stein, and J. Rosen.
1995.
Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity.
Proc. Natl. Acad. Sci. USA
92:3041-3045[Abstract/Free Full Text].
|
| 35.
|
Shuai, K.,
J. Liao, and M. M. Song.
1996.
Enhancement of antiproliferative activity of gamma interferon by the specific inhibition of tyrosine dephosphorylation of Stat1.
Mol. Cell. Biol.
16:4932-4941[Abstract].
|
| 36.
|
Soldaini, E.,
S. John,
S. Moro,
J. Bollenbacher,
U. Schindler, and W. J. Leonard.
2000.
DNA binding site selection of dimeric and tetrameric Stat5 proteins reveals a large repertoire of divergent tetrameric Stat5a binding sites.
Mol. Cell. Biol.
20:389-401[Abstract/Free Full Text].
|
| 37.
|
Stancato, L. F.,
M. David,
C. Carter-Su,
A. C. Larner, and W. B. Pratt.
1996.
Preassociation of STAT1 with STAT2 and STAT3 in separate signalling complexes prior to cytokine stimulation.
J. Biol. Chem.
271:4134-4137[Abstract/Free Full Text].
|
| 38.
|
Stark, G. R.,
I. M. Kerr,
B. R. Williams,
R. H. Silverman, and R. D. Schreiber.
1998.
How cells respond to interferons.
Annu. Rev. Biochem.
67:227-264[CrossRef][Medline].
|
| 39.
|
Strehlow, I., and C. Schindler.
1998.
Amino-terminal signal transducer and activator of transcription (STAT) domains regulate nuclear translocation and STAT deactivation.
J. Biol. Chem.
273:28049-28056[Abstract/Free Full Text].
|
| 40.
|
Szabo, S. J.,
J. S. Gold,
T. L. Murphy, and K. M. Murphy.
1993.
Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc.
Mol. Cell. Biol.
13:4793-4805[Abstract/Free Full Text]. (Erratum, 13:5928.)
|
| 41.
|
Thierfelder, W. E.,
J. M. van Deursen,
K. Yamamoto,
R. A. Tripp,
S. R. Sarawar,
R. T. Carson,
M. Y. Sangster,
D. A. Vignali,
P. C. Doherty,
G. C. Grosveld, and J. N. Ihle.
1996.
Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells.
Nature
382:171-174[CrossRef][Medline].
|
| 42.
|
Vinkemeier, U.,
S. L. Cohen,
I. Moarefi,
B. T. Chait,
J. Kuriyan, and J. E. Darnell, Jr.
1996.
DNA binding of in vitro activated Stat1 alpha, Stat1 beta and truncated Stat1: interaction between NH2-terminal domains stabilizes binding of two dimers to tandem DNA sites.
EMBO J.
15:5616-5626[Medline].
|
| 43.
|
Vinkemeier, U.,
I. Moarefi,
J. E. Darnell, Jr., and J. Kuriyan.
1998.
Structure of the amino-terminal protein interaction domain of STAT-4.
Science
279:1048-1052[Abstract/Free Full Text].
|
| 44.
|
Wagner, B. J.,
T. E. Hayes,
C. J. Hoban, and B. H. Cochran.
1990.
The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter.
EMBO J.
9:4477-4484[Medline].
|
| 45.
|
Wallace, A. C.,
R. A. Laskowski, and J. M. Thornton.
1995.
LIGPLOT: a program to generate schematic diagrams of protein-ligand interactions.
Protein Eng.
8:127-134[Abstract/Free Full Text].
|
| 46.
|
Wenner, C. A.,
M. L. Guler,
S. E. Macatonia,
A. O'Garra, and K. M. Murphy.
1996.
Roles of IFN-gamma and IFN-alpha in IL-12-induced T helper cell-1 development.
J. Immunol.
156:1442-1447[Abstract].
|
| 47.
|
Xu, X.,
Y. L. Sun, and T. Hoey.
1996.
Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain.
Science
273:794-797[Abstract].
|
| 48.
|
Zhang, J. J.,
U. Vinkemeier,
W. Gu,
D. Chakravarti,
C. M. Horvath, and J. E. Darnell, Jr.
1996.
Two contact regions between Stat1 and CBP/p300 in interferon gamma signaling.
Proc. Natl. Acad. Sci. USA
93:15092-15096[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 2000, p. 7121-7131, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Karpuzoglu, E., Phillips, R. A., Dai, R., Graniello, C., Gogal, R. M. Jr., Ahmed, S. A.
(2009). Signal Transducer and Activation of Transcription (STAT) 4{beta}, a Shorter Isoform of Interleukin-12-Induced STAT4, Is Preferentially Activated by Estrogen. Endocrinology
150: 1310-1320
[Abstract]
[Full Text]
-
Hou, T., Ray, S., Brasier, A. R.
(2007). The Functional Role of an Interleukin 6-inducible CDK9{middle dot}STAT3 Complex in Human {gamma}-Fibrinogen Gene Expression. J. Biol. Chem.
282: 37091-37102
[Abstract]
[Full Text]
-
Persky, M. E., Murphy, K. M., Farrar, J. D.
(2005). IL-12, but Not IFN-{alpha}, Promotes STAT4 Activation and Th1 Development in Murine CD4+ T Cells Expressing a Chimeric Murine/Human Stat2 Gene. J. Immunol.
174: 294-301
[Abstract]
[Full Text]
-
Chen, W., Daines, M. O., Hershey, G. K. K.
(2004). Methylation of STAT6 Modulates STAT6 Phosphorylation, Nuclear Translocation, and DNA-Binding Activity. J. Immunol.
172: 6744-6750
[Abstract]
[Full Text]
-
Schroder, M., Kroeger, K. M., Volk, H.-D., Eidne, K. A., Grutz, G.
(2004). Preassociation of nonactivated STAT3 molecules demonstrated in living cells using bioluminescence resonance energy transfer: a new model of STAT activation?. J. Leukoc. Biol.
75: 792-797
[Abstract]
[Full Text]
-
Braunstein, J., Brutsaert, S., Olson, R., Schindler, C.
(2003). STATs Dimerize in the Absence of Phosphorylation. J. Biol. Chem.
278: 34133-34140
[Abstract]
[Full Text]
-
Chang, H.-C., Zhang, S., Oldham, I., Naeger, L., Hoey, T., Kaplan, M. H.
(2003). STAT4 Requires the N-terminal Domain for Efficient Phosphorylation. J. Biol. Chem.
278: 32471-32477
[Abstract]
[Full Text]
-
Zhang, T., Seow, K. T., Ong, C. T., Cao, X.
(2002). Interdomain Interaction of Stat3 Regulates Its Src Homology 2 Domain-mediated Receptor Binding Activity. J. Biol. Chem.
277: 17556-17563
[Abstract]
[Full Text]
-
Zhang, X., Darnell, J. E. Jr.
(2001). Functional Importance of Stat3 Tetramerization in Activation of the alpha 2-Macroglobulin Gene. J. Biol. Chem.
276: 33576-33581
[Abstract]
[Full Text]