Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7238-7246, Vol. 20, No. 19
Institute of Cell and Molecular Biology, The
University of Edinburgh, Edinburgh EH9 3JR, Scotland
Received 20 April 2000/Returned for modification 23 May
2000/Accepted 18 July 2000
Putative RNA helicases are involved in most aspects of gene
expression. All previously characterized members of the DEAH-box family
of putative RNA helicases are involved in pre-mRNA splicing. Here we
report the analysis of two novel DEAH-box RNA helicases, Dhr1p and
Dhr2p, that were found to be predominantly nucleolar. Both genes are
essential for viability, and MET-regulated alleles were
therefore created. Depletion of Dhr1p or Dhr2p had no detectable effect
on pre-mRNA splicing in vivo or in vitro. Both Dhr1p and Dhr2p were,
however, required for 18S rRNA synthesis. Depletion of Dhr2p inhibited
pre-rRNA cleavage at sites A0, A1, and
A2, while Dhr1p depletion inhibited cleavage at sites
A1 and A2. No coprecipitation of snoRNAs was
detected with ProtA-Dhr2p, but Dhr1p-ProtA was stably associated with
the U3 snoRNA. Depletion of Dhr1p inhibited processing steps that
require base pairing of U3 to the 5' end of the 18S rRNA. We speculate
that Dhr1p is targeted to the preribosomal particles by the U3-18S rRNA
interaction and is required for the structural reorganization of the
rRNA during formation of the central pseudoknot.
Putative ATP-dependent RNA helicases
are ubiquitous, being present in RNA and DNA viruses, bacteria,
archaea, and eukaryotes. It is generally assumed that many or all
members of the family are capable of ATP-dependent RNA helicase
activity, but this has been formally demonstrated in only a few cases
(reviewed in references 13 and
58). These proteins are predicted to act as
modulators of RNA structures (16) and are therefore expected
to play key roles in all cellular processes involving structural
isomerization of RNA. Putative RNA helicases have been implicated in
many aspects of gene expression, including transcription, nuclear and
mitochondrial RNA splicing, ribosome synthesis (pre-rRNA processing and
ribosomal assembly), translation, RNA editing, mRNA export, and mRNA
turnover (reviewed in references 13 and
37). However, in most cases the precise substrate,
and hence the function, of these proteins is not known.
The putative RNA helicases share a conserved central core domain (ca.
290 to 360 residues in length) that consists of eight highly conserved
motifs (reviewed in references 13 and
49). These include the eponymous DEAH or DEAD box
(reviewed in reference 37) and are implicated in the
basic functions of the proteins: binding to the ATP and RNA cofactors,
ATP hydrolysis, and RNA helicase activity (reviewed in reference
37). The core region is typically flanked by poorly
conserved amino- and carboxy-terminal extensions. Analysis of the
DEAH-box helicase Prp16p indicated that the nonconserved extensions
confer substrate specificity (70).
RNA helicases can be grouped into four distinct families based on
conserved sequence elements in the core domain. The largest group, the
DEAD-box proteins, includes the archetypal helicase eIF4-A that is
involved in translation initiation, as well as several proteins
required for pre-mRNA splicing and, remarkably, 13 proteins that are
needed for different steps in ribosome synthesis. The DExH-box
helicases include Ski2p, which is required during 3' degradation of
mRNA by the exosome complex (20), and Dob1p/Mtr4p, which
functions as a cofactor for the exosome during nuclear RNA processing
and degradation (14). The Upf1p-related family includes Upf1p itself, which is required for nonsense-mediated mRNA decay (11, 33, 44), and Sen1p which is implicated in several
nuclear RNA processing activities, including tRNA splicing (47,
64, 65), and is weakly associated with several small nucleolar
RNAs (snoRNAs) and snRNAs (65). The remaining group is the
DEAH-box family. The four previously characterized DEAH-box proteins
each function in pre-mRNA splicing. Prp2p and Prp16p are required for the first and second trans-esterification steps,
respectively (36, 45, 51, 59). Prp22p and Prp43p are
involved in the release of spliced mRNA products from the spliceosome
and the disassembly-recycling of spliceosomal components (2,
10). Prp16p and Prp22p show ATP-dependent RNA duplex unwinding
activity in vitro, indicating that the DEAH-box proteins may modify RNA structure directly (50, 68, 71).
Eukaryotic nucleoli contain large numbers of snoRNAs, which are
associated with proteins in small nucleolar ribonucleoprotein (snoRNP)
particles (reviewed in references 24 and
67). The bulk of the snoRNAs are involved in
selection of the sites of modification in the pre-rRNAs. Sites of
2'-O-methylation and pseudouridylation are selected by the
box C+D and box H+ACA families of snoRNAs, respectively (reviewed in
references 26 and 57). A small
number of snoRNA species are required for processing of the large
pre-rRNA to the mature rRNAs (Fig. 1)
(19, 34, 40, 60). The best characterized of these is the box
C+D snoRNA U3, which is required for pre-rRNA cleavage in the 5'
external transcribed spacer (5'-ETS) and internal transcribed spacer 1 (ITS1) regions in yeast, in Xenopus oocytes, and for in
vitro cleavage of the mouse 5'-ETS (19, 23, 41). Yeast U3 is
required for cleavage at sites A0, A1, and
A2 (Fig. 1) and base pairs to the pre-rRNA at two sites: in
the 5'-ETS and at the 5' end of the 18S rRNA region (5, 54).
The U3-5'-ETS interaction is required for cleavage at sites
A0, A1, and A2, while the U3-18S
interaction is required for cleavage only at sites A1 and
A2 (Fig. 1). All box C+D snoRNAs are associated with a set
of common proteins specific to this class of RNA: Nop1p, Nop56p, and
Nop5p/Nop58p in yeast (29, 30, 48, 74). In addition, several
proteins appear to be specifically associated with the U3 snoRNP:
Sof1p, Mpp10p, Imp3p, Imp4p, Lcp5p, Rcl1p, and Rrp9p (7, 15,
22, 32, 73; J. Venema, personal communication).
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Dhr1p, a Putative DEAH-Box RNA Helicase, Is
Associated with the Box C+D snoRNP U3
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
View larger version (20K):
[in a new window]
FIG. 1.
Pre-rRNA processing pathway in yeast. (A) Structure of
the rRNA gene operon and location of the oligonucleotides used in this
work. The mature 18S, 5.8S, and 25S rRNAs (bold lines) are released
from the 35S primary transcript following cleavages in the 5'-ETS and
3'-ETS and ITS1 and ITS2. Cleavage sites are indicated by uppercase
letters (A0 to D). Oligonucleotides used for the Northern
blot hybridization and primer extension experiments are indicated by
lowercase letters (a to h). (B) Pre-rRNA processing pathway. The 35S
pre-rRNA is successively cleaved in the 5'-ETS at site A0
(generating the 33S RNA), at site A1, the 5' end of the
mature 18S rRNA (generating the 32S RNA), and at site A2 in
ITS1 (generating the 20S and 27SA2 pre-rRNAs). The 20S is
dimethylated by Dim1p and cleaved at site D to generate the mature 18S
rRNA. The 27SA2 is matured to the 5.8S and 25S rRNAs
following two alternative pathways. Eighty-five percent of the
27SA2 population is cleaved at site A3 in ITS1
by RNase MRP; this is rapidly followed by 5'-to-3' trimming to site
B1S by Xrn1p and Rat1p. Fifteen percent of
27SA2 is cleaved at site B1L. Cleavage at site
B2 occurs concomitantly with cleavage at site
B1. The two forms of 27SB (27SBS and
27SBL) are matured following identical pathways involving
cleavage at sites C1 and C2 and 3'-to-5'
exonucleolytic digestion to site E by the exosome. Both Dhr1p and Dhr2p
are required for cleavages at sites A1 and A2;
Dhr2p is also required for cleavage at site A0. Base
pairing between U3 and the pre-rRNA in the 5'-ETS and 18S regions is
required for cleavage at sites A1 and A2; the
U3-5'-ETS interaction is also required for cleavage at site
A0. (C) Structure of aberrant pre-rRNA processing
intermediates detected on depletion of Dhr1p and Dhr2p. Premature
cleavage of the 35S pre-rRNA at site A3 in ITS1 generates
the 23S RNA. The 22.5S RNA results from cleavage of pre-rRNA molecules
at site D in the absence of cleavage at sites A0 and
A1. The 22S RNA is accumulated when cleavages occur at
sites A0 and A3 in the absence of cleavage at
sites A1 and A2.
Here we report the characterization of two new members of the DEAH family of putative RNA helicases. Despite strong homology to Prp22p and related splicing factors, Dhr1p and Dhr2p were required for pre-rRNA processing rather than for pre-mRNA splicing. Furthermore, Dhr1p was found to be stably associated with the U3 snoRNP, suggesting a function in restructuring of the pre-rRNA.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Plasmids. The plasmids used in this study were pRS313 (56), pTL27 (25), pTL54 (27), and pUC18-55-HA(n) (a kind gift of R. van Nues).
Yeast genetics.
All strains were constructed using one-step
PCR-based technology (3, 25). The yeast strains used in this
study were BMA38 (a/
trp1
1/trp11
his3200/his3200 ura3-1/ura3-1
leu2-3,112/leu2-3,112 ade2-1/ade2-1
can1-100/can1-100) and BMA64 (a trp11
his3-11,15 ura3-1 leu2-3,112 ade2-1
can1-100) (kind gifts of B. Dujon and F. Lacroute).
Gene disruption. The DHR1, DHR2, and YLR419w open reading frames (ORFs) were precisely deleted from the genome and replaced with the HIS3 marker. The oligonucleotides used for amplification with plasmid pRS313 were 1 and 2 (DHR1), 3 and 4 (DHR2), and 12 and 13 (YLR419w). PCR products were transformed in a diploid wild-type strain (BMA38). Transformants were selected on minimal medium lacking histidine. Correct integration was checked by PCR on yeast colonies and/or Southern blot analysis. Diploids were sporulated at 23°C.
Construction of MET-regulated alleles of DHR1 and DHR2. Conditional alleles of DHR1 and DHR2 were constructed by placing their expression under the control of a MET-regulated promoter (pMET3). Transcription driven from MET3 promoters is strongly repressed on addition of methionine to the growth medium (9). TRP1-pMET3::HA cassettes were PCR amplified from plasmid pUC18-55-HA(n) with oligonucleotides 5 and 6 (for DHR1) and oligonucleotides 7 and 8 (for DHR2). PCR products were transformed in a wild-type haploid strain (BMA64). In addition to the fusion to pMET3, integration at the correct locus results in HA epitope tagging of the ORF. HA is a nonapeptide antigen (YPYDVPDYA) from the human influenza virus hemagglutinin protein. Transformants were selected on minimal medium lacking tryptophan and were screened by PCR on yeast colonies, methionine dependence for growth, and Western blot analysis.
Time course and RNA analysis. MET-regulated strains were pregrown to mid-log phase in minimal medium lacking tryptophan. Depletion was achieved by the addition of methionine to a final concentration of 20 mM. Total RNA was extracted as described previously (63) and resolved on 1.2 and 2% agarose-formaldehyde gels for pre-rRNA and splicing analysis, respectively, and on 8% polyacrylamide gels for low-molecular-weight pre-rRNA and snoRNA analysis. Primer extension and in vitro splicing reactions were performed as previously described (6, 45).
Western blot analysis. For protein extraction, cells equivalent to an optical density at 600 nm (OD600) of 10 were processed as previously described (25). Supernatants equivalent to a cell OD600 of 0.375 were loaded per lane. Samples were subjected to sodium dodecyl sulfate (SDS)-8% (Dhr1p) or 15% (Dhr2p) polyacrylamide gel electrophoresis (PAGE) and blotted in accordance with standard procedures. The following antibodies were used: PAP (peroxidase-antiperoxidase; P-2026; Sigma), anti-HA Y-11 (cat_sc-805; Santa Cruz Biotech; rabbit polyclonal immunoglobulin G [IgG]; dilution, 1:1,000), anti-Nop1p (mouse monoclonal mA66; dilution, 1:200; J. Aris, University of Florida), anti-Srp14p and anti-Srp68p (rabbit polyclonal; dilution, 1:500; J. Brown, University of Edinburgh), anti-Mpp10p (rabbit polyclonal; dilution, 1:20,000; S. Baserga, Yale School of Medicine), and anti-Rcl1p (rabbit polyclonal; dilution, 1:500; E. Billy and W. Filipowicz, Friedrich Miescher-Institut).
Immunoprecipitation of ProtA epitope-tagged Dhr1p and Dhr2p. For the immunoprecipitation experiments, Dhr1p and Dhr2p were fused to a high-affinity tag. A repeat of the z domain of the protein A (ProtA) epitope from Staphylococcus aureus was fused either to the carboxyl (Dhr1p) or to the amino (Dhr2p) end of the proteins. For Dhr1p, a ProtA-K1URA3 cassette was generated by PCR from plasmid pTL54 with oligonucleotides 9 and 10. For Dhr2p, a HIS3-pGAL10-ProtA cassette was PCR amplified from plasmid pTL27 with oligonucleotides 3 and 11. The PCR cassettes were transformed in a haploid strain (BMA64a). Dhr1p-ProtA and ProtA-Dhr2p strains showed no growth impairment under any of the conditions tested, indicating that both fusions are functional. Transformants were screened as described above. The GAL::ProtA-DHR2 allele allowed high levels of residual expression on glucose medium and was not galactose dependent.
Immunoprecipitations were performed on IgG-agarose beads with yeast whole-cell extracts prepared as previously described (53). Lysates were made in buffer A150 (150 mM K acetate, 20 mM Tris HCl [pH 8.0], 5 mM MgCl2, 1 mM dithiothreitol, 0.2% Triton X-100, 0.5 mM phenylmethylsulfonyl fluoride), and cleared by centrifugation (12,000 × g, 4°C, 20 min). Lysates equivalent to a cell OD600 of 120 were incubated on a rotating wheel for 2 h at 4°C with 20 µl of IgG-agarose beads (A2909; Sigma), prewashed in buffer A150, in a total volume of 400 µl. Pellets were washed four times for 20 min (each time) in 1 ml of buffer A150. RNA were either analyzed by Northern blot assay or directly labeled at the 3' end with pCp. For Northern blot analysis, each gel lane (total, supernatant, or pellet) was loaded with RNA from a fraction of the preparation equivalent to a cell OD600 of 15 (1:1:1 ratio). For 3'-end labeling, RNA from the pellet fractions equivalent to a cell OD600 of 15 was incubated overnight at 4°C with T4 RNA ligase (New England Biolabs) and pCp in accordance with the recommendations of the manufacturer. For protein analysis, pellets were submitted to four additional washes in buffer NET150 (50 mM Tris HCl [pH 7.5], 150 mM NaCl, 0.05% NP-40, 0.5 mM phenylmethylsulfonyl fluoride), resuspended in SDS loading buffer, and boiled for 5 min with occasional vortexing. Dhr1p is a large protein (144,935 kDa) which appeared to be highly sensitive to proteolytic degradation, and in this case, pellet lanes were loaded with an excess of material (1:1:35 ratio of the total, supernatant, and pellet fractions, respectively).Immunofluorescence analysis. Immunofluorescence experiments were performed in accordance with standard procedures (46). HA epitope-tagged proteins were detected with a rat monoclonal antibody (3F10; Boehringer) used at a dilution of 1:200, followed by a fluorescein isothiocyanate (FITC)-coupled goat anti-rat antibody (1:200; ICN). As a nucleolar marker, Nop1p was detected with a mouse monoclonal antibody (mA66; J. Aris, University of Florida) at a dilution of 1:200, followed by an anti-mouse Cy3-coupled donkey antibody (1:2,000; Jackson Immunoresearch).
Oligonucleotides. For the construction of yeast strains, we used oligonucleotides 1 (ATTACAACCCAATACTAATAATAGAGTGTCTTAAGAAATATAAGTACTCTTGGCCTCCTCTAG), 2 (TATGTTCTTATATAATGAAACTCTATTTCTATAATACCAGCGCATCGTTCAGAATGACACGTA), 3 (GAAAATAAAAAATTCTGCTCGATGAGATGAGATGAGGTTATGATACTCTTGGCCTCCTCTAGT), 4 (AATGCCTTTATATACAATAAAAATGCGCTAAGAGTAGGTGACTTATCGTTCAGAATGACACG), 5 (GCTATATGCTATAAAAATGCAATTACAACCCAATACTAATAATAGACTTAAATAAATACTACTC), 6 (GCCGGATCTGGCTTTTTCATTAAACCTTTTTCTGTAAGTACCCATACGAGCTCCAGCGTAATCTGGAA), 7 (TGCTGACTGAAAGATGTACTTTTCTTCTACCGTTTTTCTTCGGCGGCCTTAAATAAATACTACTC), 8 (AGAAGTATGGTTTGATGCAACTCTACTATTGCTATTTGCTGCCATACGAGCTCCAGCGTAATCTGG), 9 (AAGGGCTTCCAGACCATCACAGGTGAAGAGAAAGAAAAAAAAGGCGTGGACAACAAATTC), 10 (AAGTGGTTGCAATTATTTGATGCCCTAGATAGGAATAATGTACTGGGTAGAAGATCGGTC), 11 (AGAAGTATGGTTTGATGCAACTCTACTATTGCTATTTGCTGCCATATTCGCGTCTACTTTCGG), 12 (TCACTTTATACTTTACATCGCAATTGCTTTCATTAATTTTTGATAACTCTTGGCCTCCTCTAGT), and 13 (TGAAGATGATAATTATTATACAGGGACTACAGTAGGAACTGATTATCGTTCAGAATGACACG.
Oligonucleotides a to h, used for pre-rRNA analysis, were described in reference 29. The sequence of oligonucleotide i is GCTCTCATGCTCTTGCC. Oligonucleotides anti-U3, -U14, -U24, and -snR190 (box C+D) and oligonucleotides anti-snR10, -snR30, -snR31, -snR33, and -snR37 (box H+ACA), used for detection of snoRNA, were described in reference 29. For detection of mRNAs, oligonucleotides anti-ACT1 (TCAATAACCAAAGCAGCAAC) and anti-CYH2 (GTGCTTTCTGTGCTTACCGATACGACCTTTACCG) were used.| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Dhr1p and Dhr2p are essential for growth. When these experiments were commenced, the yeast genome contained three uncharacterized, predicted ORFs that were homologous to the DEAH-box family of splicing factors (13). These were YMR128w/Ecm16p (now DHR1 for DEAH-box protein involved in ribosome synthesis), YKL078w/JA2 (now DHR2), and YLR419w. Each ORF was individually deleted from the genome of diploid wild-type strains and replaced with the HIS3 marker using a one step PCR-based strategy (see Materials and Methods). Heterozygous diploids were sporulated, and 20 tetrads of each strain were dissected. For Dhr1p and Dhr2p, all tetrads showed a 2:2 segregation for growth and no His+ spores were recovered, showing that both genes are essential, at least for spore germination. For YLR419w, all spores were viable with a 2:2 segregation for His+, showing the gene to be nonessential, as previously reported (55). YLR419w has not yet been further characterized.
Despite strong conservation in their core domains, Dhr1p and Dhr2p differ substantially in size (1,267 amino acids for Dhr1p and 735 amino acids for Dhr2p) and diverge outside the core region. Overexpression of Dhr2p failed to suppress the growth defect in a strain depleted of Dhr1p (data not shown).Dhr1p and Dhr2p are not required for pre-mRNA splicing. To test the requirements for Dhr1p and Dhr2p in pre-mRNA splicing, conditional alleles were constructed. A one-step PCR technique was used to replace the chromosomal DHR1 or DHR2 promoter with a pMET::HA cassette (see Materials and Methods). Correct integration resulted in expression of fusion constructs with the HA nonapeptide from the human influenza virus hemagglutinin, under the control of the MET promoter, which is strongly repressed by addition of methionine to the growth medium (9).
MET::HA-dhr1 and MET::HA-dhr2 strains were pregrown in minimal medium lacking methionine. At mid-log phase, methionine was added to the medium to a final concentration of 20 mM and the OD600 was measured at regular intervals (Fig. 2A). Cells were maintained in exponential growth by dilution with prewarmed medium. Following addition of methionine to the medium, the growth rate of both the MET::HA-dhr1 and MET::HA-dhr2 strains was severely affected. For Dhr1p, the effects of methionine addition were rapid and growth was clearly slowed within 2 h. For Dhr2p, a major increase in doubling time occurred between 10 and 12 h after addition of methionine (Fig. 2A).
|
Dhr1p and Dhr2p are localized to the nucleolus.
To gain an
insight into the function of Dhr1p and Dhr2p, their subcellular
localization was analyzed by indirect immunofluorescence microscopy.
Strains expressing either the HA-Dhr1p or HA-Dhr2p fusion were grown to
mid-log phase and processed for immunofluorescence (see Materials and
Methods). Spheroplasts were incubated with a rat monoclonal anti-HA
antibody, followed by FITC staining (Fig. 3, green channel). As a nucleolar marker,
Nop1p was decorated with a mouse monoclonal antibody in combination
with Cy3 staining (red channel). The signal for HA-Dhr1p and HA-Dhr2p
was exclusively nuclear with strong enrichment in a crescent-shaped
region which colocalized with Nop1p (yellow in merged panels). In
yeast, the nucleolus normally occupies a crescent-shaped region
covering around a third of the nuclear space and is largely resolved
from the chromosomal DNA (stained in blue with
4',6'-diamidino-2-phenylindole [DAPI], merged panels).
|
Dhr1p and Dhr2p are required for 18S rRNA synthesis. The nucleolar localization of Dhr1p and Dhr2p prompted us to analyze the requirement for these proteins in pre-rRNA processing.
In eukaryotes, three of the four rRNAs (the 18S, 5.8S, and 25S rRNAs) are produced from a single high-molecular-weight precursor (35S pre-rRNA in yeast) by a complex processing pathway involving both endonuclease and exonuclease digestion (reviewed in references 24 and 67). The legend to Fig. 1 contains a complete description of the pathway. Pre-rRNA processing was analyzed by Northern blot hybridization and primer extension using the MET-regulated alleles. Total RNA was extracted from MET::dhr1 and MET::dhr2 strains grown in medium lacking methionine (0-h samples) and at time points after methionine addition. An isogenic wild-type strain was used as a control. Hybridization with oligonucleotides specific for the mature rRNA species (oligonucleotides a, f, and h) revealed that depletion of either Dhr1p or Dhr2p led to reduced levels of 18S rRNA (Fig. 4X). The steady-state levels of the 25S (Fig. 4VI) and 5.8S (Fig. 5II) rRNAs were mostly unaffected (see below).
|
|
5' exonucleases (1) and the level of this
intermediate may not well reflect the relative flux through the pathway
in different strains.
Processing of pre-rRNAs on the pathway of 5.8S and 25S rRNA synthesis
appeared to be mostly unaffected by depletion of Dhr1p or Dhr2p. At
late time points, some reduction in the levels of the 27SB (Fig. 4III)
and 7S (Fig. 5I) pre-rRNAs was seen. However, the 35S rRNA was also
reduced at these times and this is probably a consequence of the
reduced growth of the strains. No alteration was seen in the
5.8SL:5.8SS rRNA ratio (Fig. 5II), indicating that relative processing at sites B1S and B1L
was unaffected.
Cleavage in the 5'-ETS and ITS1 was also analyzed by primer extension
(Fig. 6). Primer extension from
oligonucleotide e, complementary to the 5' end of ITS2, revealed that
depletion of either Dhr1p or Dhr2p strongly inhibited cleavage at site
A2 while not affecting processing at sites A3
and B1L or B1S. Primer extension from
oligonucleotide a, complementary to the 5' end of the 18S rRNA, showed
an increase in the stop at +1, the 5' end of the 35S pre-rRNA, that was
in good agreement with the results of Northern hybridization, with stronger accumulation on Dhr2p than on Dhr1p depletion. The primer extension stop at A0, the 5' end of the 33S pre-rRNA, was
strongly reduced on depletion of Dhr2p, indicating a greatly reduced
level of the 33S pre-rRNA, which is not readily detected by Northern hybridization. In contrast, the primer extension stop at site A0 was greatly increased on depletion of Dhr1p (Fig. 6; in
the panel showing the stop at site A0, lanes 1 to 6 were
exposed sixfold less than the other lanes). Much of this increase is
likely due to the appearance of the 22S RNA (Fig. 4IX) that extends
from A0 to A3 (Fig. 1C). In keeping with the
onset of growth inhibition, pre-rRNA processing was clearly inhibited
in the MET::dhr1 strain 2 h after
methionine addition, as shown by the decreased primer extension stop at
site A2 and the increase at site A0, whereas a
slower onset was seen in the MET::dhr2
strain.
|
Dhr1p is associated with the U3 snoRNA. The pre-rRNA processing defects reported on Dhr1p and Dhr2p depletion resemble phenotypes associated with depletion and conditional inactivation of several snoRNP components (24, 67). This prompted us to test for physical interactions between Dhr1p or Dhr2p and the snoRNAs and to test for their requirements in snoRNA accumulation.
Interactions between the putative helicases and snoRNAs were addressed by immunoprecipitation. For this, Dhr1p and Dhr2p were each fused to two copies of the z domain of S. aureus ProtA using a one-step PCR transformation procedure in haploid strains (see Materials and Methods). In each case, the ProtA fusion construct was the only copy of the gene and supported wild-type growth, showing the fusion proteins to be fully functional. Lysates were prepared from strains expressing Dhr1p-ProtA or ProtA-Dhr2p, and the fusion proteins were bound to IgG-agarose beads. Two independently isolated Dhr1p-ProtA strains were used. Coprecipitating RNAs were extracted from the total, supernatant, and pellet fractions, and cell-equivalent amounts of each fraction were separated on 8% polyacrylamide gels. Hybridization with oligonucleotides specific to several box C+D and box H+ACA snoRNAs revealed that box C+D snoRNA U3 specifically coprecipitated with the Dhr1p-ProtA fusion (Fig. 7A, compare lanes 3 and 6 with lane 9). The efficiency of precipitation (~30%) was in the same range as that observed for the core box C+D snoRNP protein Nop56p (30). No coprecipitation with Dhr1p-ProtA was observed for the other snoRNAs tested: U14 and snR190 (box C+D), snR10, snR30, snR31, snR33, and snR37 (box H+ACA) (Fig. 7A and data not shown). No coprecipitation of these snoRNAs was detected with ProtA-Dhr2p (Fig. 7B) or with the otherwise isogenic wild-type control strains (Fig. 7A, lanes 7 to 9, and B, lanes 1 to 3). Immunoprecipitation of the fusion proteins was analyzed in parallel by Western blot assay. The two fusion proteins were detected with similar efficiencies in the pellet fractions, indicating that the apparent lack of snoRNA association with ProtA-Dhr2p is not due to a failure in precipitation (data not shown).
|
|
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Here we report the functional characterization of Dhr1p and Dhr2p, two novel members of the DEAH subfamily of putative RNA helicases. Both proteins were initially predicted to be required for pre-mRNA splicing, based on strong homology to splicing factors Prp2p, Prp16p, Prp22p, and Prp43p. However, genetic depletion of neither Dhr1p nor Dhr2p detectably inhibited pre-mRNA splicing in vivo or in vitro.
HA epitope-tagged Dhr1p and Dhr2p fusions were found to colocalize with the nucleolar antigen Nop1p, and consistent with this subcellular localization, both proteins were required for ribosome synthesis. Depletion of either Dhr1p or Dhr2p inhibited pre-rRNA processing at sites A1 and A2 on the pathway of 18S rRNA synthesis but had little, if any, effect on the synthesis of the 5.8S and 25S rRNAs. Interestingly, the requirements for Dhr1p and Dhr2p in cleavage at site A0 were markedly different. A0 cleavage showed little requirement for Dhr1p but was strongly dependent on Dhr2p.
Pre-rRNA processing at sites A1 and A2 also requires the U3, U14, snR10, and snR30 snoRNAs (19, 34, 40, 61). Interaction with the snoRNAs was therefore tested by coprecipitation experiments with ProtA-tagged fusion proteins. The U3 snoRNA was specifically and efficiently (~30%) coprecipitated with Dhr1p-ProtA, whereas no snoRNA was detected in association with ProtA-Dhr2p. Dhr1p is the first putative RNA helicase to be found stably associated with a snoRNA. The DEAD-box helicases Dpb4p and Rok1p interact genetically with snoRNAs but are not detectably in physical association (35, 66). In contrast, Sen1p interacts weakly (with ~1% efficiency) with several snoRNA species, possibly reflecting transient interactions at some stages in their biosynthetic pathways (47, 65), and this may also be the case for the nucleoplasmic helicases p50 and p55 (42). Depletion of Dhr1p or Dhr2p did not affect the accumulation of U3 or the other snoRNA species tested, including U14, snR10, and snR30.
In addition to the common box C+D snoRNP proteins Nop1p, Nop56p, and Nop5p/Nop58p (29, 30, 48, 74), several proteins have been detected in specific association with U3 (7, 15, 22, 32, 73; J. Venema, personal communication; this work). Two of these, Mpp10p and Rcl1p (7, 15), were shown to efficiently coprecipitate with Dhr1p-ProtA. Genetic depletion of the U3 snoRNA or any of the previously characterized U3 snoRNP components inhibited cleavage at site A0 in addition to sites A1 and A2 (7, 15, 19, 22, 32, 73). In contrast, depletion of Dhr1p had only a mild effect on A0 cleavage while strongly inhibiting A1 and A2 cleavage. This led to strong accumulation of the 22S pre-rRNA that extends from site A0 to site A3. A similar phenotype was previously seen in strains carrying a partial C-terminal truncation of Mpp10p (31), suggesting that this domain functions together with Dhr1p.
Several sites of interaction between U3 and the pre-rRNAs have been mapped by chemical cross-linking experiments and/or inferred from sequences with potential complementarity and phylogenetically conserved substitutions (6, 8, 17, 18, 38, 39). In yeast, U3 makes two functionally distinct interactions with the pre-rRNAs, at site +470 (in the 5'-ETS) and with the loop of a stem structure located at the 5' end of the 18S rRNA (5, 54) (Fig. 1B). Analysis of compensatory mutations demonstrated that both of these interactions involve the formation of several consecutive Watson-Crick base pairs and both interactions are required for pre-rRNA cleavage at sites A1 and A2. However, cleavage at site A0 requires the interaction of U3 with the 5'-ETS but not the interaction with the 18S rRNA region (4, 54) (Fig. 1B). This suggested that the U3 snoRNP carries out distinct functions in ribosome synthesis by base pairing to these two sites. This model was supported by the uncoupling of these cleavages on truncation of Mpp10p (31). Since Dhr1p was required for cleavage at sites A1 and A2 but not at site A0, it is likely to mediate the function of the U3 snoRNP at the 5' end of 18S rRNA rather than the 5'-ETS.
The interaction of U3 with the stem-loop structure at the 5' end of the 18S rRNA region is mutually exclusive with the formation of the central pseudoknot (18, 39, 54). This is a highly conserved, long-range interaction within the mature small-subunit rRNA that is a key feature in the overall folding of the molecule. We speculate that the U3-18S interaction targets Dhr1p to the pre-rRNA, where it functions in the formation of the pseudoknot structure. Formation of the central pseudoknot in the Escherichia coli rRNA precursor is also prevented by a base-paired interaction, which occurs in cis between the 5' end of the 16S rRNA and the 5'-ETS. A mutation which blocks the isomerization of this structure prevents processing of the 5' end of the 16S rRNA, showing the two events to be coupled (12). In both yeast and E. coli, these base-paired interactions are likely to delay the formation of the central pseudoknot, a potentially irreversible step in ribosome assembly. This may be important to allow sufficient time for the binding of ribosomal proteins and other trans-acting factors. We speculate that in strains lacking Dhr1p, this structural rearrangement does not take place, leading to the inhibition of cleavage at sites A1 and A2.
There is an obvious analogy between the model we present here for the role of U3 in targeting an RNA helicase to its site of action and the functions of the bulk of the snoRNAs as modification guides. Other box C+D snoRNAs base pair with the pre-rRNAs to select sites of 2'-O-methylation, which is likely to be carried out by the snoRNP protein Nop1p (43, 62, 69). Similarly the H+ACA snoRNAs select sites for pseudouridine formation by the snoRNA-associated pseudouridine synthase Cbf5p (27, 72, 75). In each case, the snoRNA not only carries the rRNA-modifying enzyme to the rRNA but, by specific base pairing, creates the enzyme recognition site. Similarly, we envisage that the U3-18S base pairing delivers Dhr1p to the site of formation of the central pseudoknot, where it catalyzes the structural isomerization of the rRNA.
| |
ACKNOWLEDGMENTS |
|---|
We thank J. Aris (University of Florida), S. Baserga (Yale School of Medicine), J. Brown (University of Edinburgh), E. Billy, and W. Filipowicz (Friedrich Miescher-Institut) for their generous gift of antibodies and R. van Nues for plasmid pUC18-55-HA(n).
This work was supported by the European commission (grant Ct95-0009 to the TAPIR project) (A.C. and J.D.B.), the Royal Society (J.D.B.), and the Wellcome Trust (D.L.J.L. and D.T.). D.L.J.L. is on leave from the FNRS.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institute of Cell and Molecular Biology, Swann Building, King's Buildings, The University of Edinburgh, Mayfield Rd., EH9 3JR Edinburgh, Scotland. Phone: 44 131 650 7093. Fax: 44 131 650 7040 or 8650. E-mail: denis.lafontaine{at}ed.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Allmang, C.,
P. Mitchell,
E. Petfalski, and D. Tollervey.
2000.
Degradation of ribosomal RNA precursors by the exosome.
Nucleic Acids Res.
28:1684-1691 |
| 2. |
Arenas, J. E., and J. N. Abelson.
1997.
Prp43: an RNA helicase-like factor involved in spliceosome disassembly.
Proc. Natl. Acad. Sci. USA
94:11798-11802 |
| 3. |
Baudin, A.,
O. Ozier-Kalogeropoulos,
A. Denouel,
F. Lacroute, and C. Cullin.
1993.
A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae.
Nucleic Acids Res.
21:3329-3330 |
| 4. |
Beltrame, M.,
Y. Henry, and D. Tollervey.
1994.
Mutational analysis of an essential binding site for the U3 snoRNA in the 5' external transcribed spacer of yeast pre-rRNA.
Nucleic Acids Res.
22:5139-5147 |
| 5. | Beltrame, M., and D. Tollervey. 1995. Base pairing between U3 and the pre-ribosomal RNA is required for 18S rRNA synthesis. EMBO J. 14:4350-4356[Medline]. |
| 6. | Beltrame, M., and D. Tollervey. 1992. Identification and functional analysis of two U3 binding sites on yeast pre-ribosomal RNA. EMBO J. 11:1531-1542[Medline]. |
| 7. | Billy, E., T. Wegierski, F. Nasr, and W. Filipowicz. 2000. Rcl1p, the yeast protein similar to the RNA 3'-phosphate cyclase, associates with U3 snoRNP and is required for 18S rRNA biogenesis. EMBO J. 19:2115-2126[CrossRef][Medline]. |
| 8. | Calvet, J. P., and T. Pederson. 1981. Base-pairing interactions between small nuclear RNAs and nuclear RNA precursors as revealed by psoralen cross-linking in vivo. Cell 26:363-370[CrossRef][Medline]. |
| 9. | Cherest, H., P. Kerjan, and Y. Surdin-Kerjan. 1987. The Saccharomyces cerevisiae MET3 gene: nucleotide sequence and relationship of the 5' non-coding region to that of MET25. Mol. Gen. Genet. 210:307-313[CrossRef][Medline]. |
| 10. | Company, M., J. Arenas, and J. Abelson. 1991. Requirement of the RNA helicase-like protein PRP22 for release of messenger RNA from spliceosomes. Nature 349:487-493[CrossRef][Medline]. |
| 11. | Czaplinski, K., Y. Weng, K. W. Hagan, and S. W. Peltz. 1995. Purification and characterization of the Upf1 protein: a factor involved in translation and mRNA degradation. RNA 1:610-623[Abstract]. |
| 12. |
Dammel, C. S., and H. F. Noller.
1993.
A cold-sensitive mutation in 16S rRNA provides evidence for helical switching in ribosome assembly.
Genes Dev.
7:660-670 |
| 13. | de la Cruz, J., D. Kressler, and P. Linder. 1999. Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24:192-198[CrossRef][Medline]. |
| 14. | de la Cruz, J., D. Kressler, D. Tollervey, and P. Linder. 1998. Dob1p (Mtr4p) is a putative ATP-dependent RNA helicase required for the 3' end formation of 5.8S rRNA in Saccharomyces cerevisiae. EMBO J. 17:1128-1140[CrossRef][Medline]. |
| 15. | Dunbar, D. A., S. Wormsley, T. M. Agentis, and S. J. Baserga. 1997. Mpp10p, a U3 small nucleolar ribonucleoprotein component required for pre-18S rRNA processing in yeast. Mol. Cell. Biol. 17:5803-5812[Abstract]. |
| 16. | Fuller-Pace, F. V. 1994. RNA helicases: modulators of RNA structure. Trends Cell Biol. 4:271-274[CrossRef][Medline]. |
| 17. |
Hartshorne, T.
1998.
Distinct regions of U3 snoRNA interact at two sites within the 5' external transcribed spacer of pre-rRNAs in Trypanosoma brucei cells.
Nucleic Acids Res.
26:2541-2553 |
| 18. | Hughes, J. M. 1996. Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA. J. Mol. Biol. 259:645-654[CrossRef][Medline]. |
| 19. | Hughes, J. M., and M. Ares, Jr. 1991. Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA. EMBO J. 10:4231-4239[Medline]. |
| 20. | Jacobs, J. S., A. R. Anderson, and R. P. Parker. 1998. The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J. 17:1497-1506[CrossRef][Medline]. |
| 21. | Jacquier, A., J. R. Rodriguez, and M. Rosbash. 1985. A quantitative analysis of the effects of 5' junction and TACTAAC box mutants and mutant combinations on yeast mRNA splicing. Cell 43:423-430[CrossRef][Medline]. |
| 22. | Jansen, R., D. Tollervey, and E. C. Hurt. 1993. A U3 snoRNP protein with homology to splicing factor PRP4 and G beta domains is required for ribosomal RNA processing. EMBO J. 12:2549-2558[Medline]. |
| 23. | Kass, S., K. Tyc, J. A. Steitz, and B. Sollner-Webb. 1990. The U3 small nucleolar ribonucleoprotein functions in the first step of preribosomal RNA processing. Cell 60:897-908[CrossRef][Medline]. |
| 24. |
Kressler, D.,
P. Linder, and J. de la Cruz.
1999.
Protein trans-acting factors involved in ribosome biogenesis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:7897-7912 |
| 25. |
Lafontaine, D., and D. Tollervey.
1996.
One-step PCR mediated strategy for the construction of conditionally expressed and epitope tagged yeast proteins.
Nucleic Acids Res.
24:3469-3471 |
| 26. | Lafontaine, D. L., and D. Tollervey. 1998. Birth of the snoRNPs: the evolution of the modification-guide snoRNAs. Trends Biochem. Sci. 23:383-388[CrossRef][Medline]. |
| 27. |
Lafontaine, D. L. J.,
C. Bousquet-Antonelli,
Y. Henry,
M. Caizergues-Ferrer, and D. Tollervey.
1998.
The box H + ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase.
Genes Dev.
12:527-537 |
| 28. |
Lafontaine, D. L. J.,
T. Preiss, and D. Tollervey.
1998.
Yeast 18S rRNA dimethylase Dim1p: a quality control mechanism in ribosome synthesis?
Mol. Cell. Biol.
18:2360-2370 |
| 29. | Lafontaine, D. L. J., and D. Tollervey. 1999. Nop58p is a common component of the box C+D snoRNPs that is required for snoRNA stability. RNA 5:455-467[Abstract]. |
| 30. |
Lafontaine, D. L. J., and D. Tollervey.
2000.
Synthesis and assembly of the box C+D small nucleolar RNPs.
Mol. Cell. Biol.
20:2650-2659 |
| 31. |
Lee, S. J., and S. J. Baserga.
1997.
Functional separation of pre-rRNA processing steps revealed by truncation of the U3 small nucleolar ribonucleoprotein component, Mpp10.
Proc. Natl. Acad. Sci. USA
94:13536-13541 |
| 32. |
Lee, S. J., and S. J. Baserga.
1999.
Imp3p and Imp4p, two specific components of the U3 small nucleolar ribonucleoprotein that are essential for pre-18S rRNA processing.
Mol. Cell. Biol.
19:5441-5452 |
| 33. |
Leeds, P.,
J. M. Wood,
B.-S. Lee, and M. R. Culbertson.
1992.
Gene products that promote mRNA turnover in Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:2165-2177 |
| 34. |
Li, H. V.,
J. Zagorski, and M. J. Fournier.
1990.
Depletion of U14 small nuclear RNA (snR128) disrupts production of 18S rRNA in Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:1145-1152 |
| 35. | Liang, W.-Q., J. A. Clark, and M. J. Fournier. 1997. The rRNA-processing function of the yeast U14 small nucleolar RNA can be rescued by a conserved RNA helicase-like protein. Mol. Cell. Biol. 17:4124-4132[Abstract]. |
| 36. |
Lin, R. J.,
A. J. Lustig, and J. Abelson.
1987.
Splicing of yeast nuclear pre-mRNA in vitro requires a functional 40S spliceosome and several extrinsic factors.
Genes Dev.
1:7-18 |
| 37. | Luking, A., U. Stahl, and U. Schmidt. 1998. The protein family of RNA helicases. Crit. Rev. Biochem. Mol. Biol. 33:259-296[CrossRef][Medline]. |
| 38. |
Maser, R. L., and J. P. Calvet.
1989.
U3 small nuclear RNA can be psoralen-cross-linked in vivo to the 5' external transcribed spacer of pre-ribosomal-RNA.
Proc. Natl. Acad. Sci. USA
86:6523-6527 |
| 39. | Mereau, A., R. Fournier, A. Gregoire, A. Mougin, P. Fabrizio, R. Luhrmann, and C. Branlant. 1997. An in vivo and in vitro structure-function analysis of the Saccharomyces cerevisiae U3A snoRNP: protein-RNA contacts and base-pair interaction with the pre-ribosomal RNA. J. Mol. Biol. 273:552-571[CrossRef][Medline]. |
| 40. |
Morrissey, J. P., and D. Tollervey.
1993.
Yeast snR30 is a small nucleolar RNA required for 18S rRNA synthesis.
Mol. Cell. Biol.
13:2469-2477 |
| 41. |
Mougey, E. B.,
L. K. Pape, and B. Sollner-Webb.
1993.
A U3 small nuclear ribonucleoprotein-requiring processing event in the 5' external transcribed spacer of Xenopus precursor rRNA.
Mol. Cell. Biol.
13:5990-5998 |
| 42. | Newman, D. R., J. F. Kuhn, G. M. Shanab, and E. S. Maxwell. 2000. Box C/D snoRNA-associated proteins: two pairs of evolutionarily ancient proteins and possible links to replication and transcription. RNA 6:861-879[Abstract]. |
| 43. |
Niewmierzycka, A., and S. Clarke.
1999.
S-Adenosylmethionine-dependent methylation in Saccharomyces cerevisiae: identification of a novel protein arginine methyltransferase.
J. Biol. Chem.
274:814-824 |
| 44. |
Peltz, S. W.,
A. H. Brown, and A. Jacobson.
1993.
mRNA destabilization triggered by premature translational termination depends on at least three cis-acting sequence elements and one trans-acting factor.
Genes Dev.
7:1737-1754 |
| 45. | Plumpton, M., M. McGarvey, and J. D. Beggs. 1994. A dominant negative mutation in the conserved RNA helicase motif `SAT' causes splicing factor PRP2 to stall in spliceosomes. EMBO J. 13:879-887[Medline]. |
| 46. | Pringle, J. R., A. E. Adams, D. G. Drubin, and B. K. Haarer. 1991. Immunofluorescence methods for yeast. Methods Enzymol. 194:565-602[Medline]. |
| 47. |
Rasmussen, T. P., and M. R. Culbertson.
1998.
The putative nucleic acid helicase Sen1p is required for formation and stability of termini and for maximal rates of synthesis and levels of accumulation of small nucleolar RNAs in Saccharomyces cerevisiae.
Mol. Cell. Biol.
18:6885-6896 |
| 48. | Schimmang, T., D. Tollervey, H. Kern, R. Frank, and E. C. Hurt. 1989. A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar RNA and is essential for viability. EMBO J. 8:4015-4024[Medline]. |
| 49. | Schmid, S. R., and P. Linder. 1992. D-E-A-D protein family of putative RNA helicases. Mol. Microbiol. 6:283-291[Medline]. |
| 50. | Schwer, B., and C. H. Gross. 1998. Prp22, a DExH-box RNA helicase, plays two distinct roles in yeast pre-mRNA splicing. EMBO J. 17:2086-2094[CrossRef][Medline]. |
| 51. | Schwer, B., and C. Guthrie. 1991. PRP16 is an RNA-dependent ATPase that interacts transiently with the spliceosome. Nature 349:494-499[CrossRef][Medline]. |
| 52. | Seraphin, B., L. Kretzner, and M. Rosbash. 1988. A U1 snRNA:pre-mRNA base pairing interaction is required early in yeast spliceosome assembly but does not uniquely define the 5' cleavage site. EMBO J. 7:2533-2538[Medline]. |
| 53. | Séraphin, B., and M. Rosbash. 1989. Identification of functional U1 snRNA-pre-mRNA complexes committed to spliceosome assembly and splicing. Cell 59:349-358[CrossRef][Medline]. |
| 54. |
Sharma, K., and D. Tollervey.
1999.
Base pairing between U3 small nucleolar RNA and the 5' end of 18S rRNA is required for pre-rRNA processing.
Mol. Cell. Biol.
19:6012-6019 |
| 55. | Shiratori, A., T. Shibata, M. Arisawa, F. Hanaoka, Y. Murakami, and T. Eki. 1999. Systematic identification, classification, and characterization of the open reading frames which encode novel helicase-related proteins in Saccharomyces cerevisiae by gene disruption and Northern analysis. Yeast 15:219-253[CrossRef][Medline]. |
| 56. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 57. | Smith, C. M., and J. A. Steitz. 1997. Sno storm in the nucleolus: new roles for myriad small RNPs. Cell 89:669-672[CrossRef][Medline]. |
| 58. | Staley, J. P., and C. Guthrie. 1998. Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92:315-326[CrossRef][Medline]. |
| 59. | Teigelkamp, S., M. McGarvey, M. Plumpton, and J. D. Beggs. 1994. The splicing factor PRP2, a putative RNA helicase, interacts directly with pre-mRNA. EMBO J. 13:888-897[Medline]. |
| 60. | Tollervey, D. 1987. A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA. EMBO J. 6:4169-4175[Medline]. |
| 61. | Tollervey, D., and C. Guthrie. 1985. Deletion of a yeast small nuclear RNA gene impairs growth. EMBO J. 4:3873-3878[Medline]. |
| 62. | Tollervey, D., H. Lehtonen, R. Jansen, H. Kern, and E. C. Hurt. 1993. Temperature-sensitive mutations demonstrate roles for yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, and ribosome assembly. Cell 72:443-457[CrossRef][Medline]. |
| 63. | Tollervey, D., and I. W. Mattaj. 1987. Fungal small nuclear ribonucleoproteins share properties with plant and vertebrate U-snRNPs. EMBO J. 6:469-476[Medline]. |
| 64. | Ursic, D., D. J. DeMarini, and M. R. Culbertson. 1995. Inactivation of the yeast Sen1 protein affects the localization of nucleolar proteins. Mol. Gen. Genet. 249:571-584[CrossRef][Medline]. |
| 65. |
Ursic, D.,
K. L. Himmel,
K. A. Gurley,
F. Webb, and M. R. Culbertson.
1997.
The yeast SEN1 gene is required for the processing of diverse RNA classes.
Nucleic Acids Res.
25:4778-4785 |
| 66. | Venema, J., C. Bousquet-Antonelli, J. P. Gelugne, M. Caizergues-Ferrer, and D. Tollervey. 1997. Rok1p is a putative RNA helicase required for rRNA processing. Mol. Cell. Biol. 17:3398-3407[Abstract]. |
| 67. | Venema, J., and D. Tollervey. 1999. Ribosome synthesis in Saccharomyces cerevisiae. Annu. Rev. Genet. 33:261-311[CrossRef][Medline]. |
| 68. | Wagner, J. D., E. Jankowsky, M. Company, A. M. Pyle, and J. N. Abelson. 1998. The DEAH-box protein PRP22 is an ATPase that mediates ATP-dependent mRNA release from the spliceosome and unwinds RNA duplexes. EMBO J. 17:2926-2937[CrossRef][Medline]. |
| 69. | Wang, H., D. Boisvert, K. K. Kim, R. Kim, and S. H. Kim. 2000. Crystal structure of a fibrillarin homologue from Methanococcus jannaschii, a hyperthermophile, at 1.6 Å resolution. EMBO J. 19:317-323[CrossRef][Medline]. |
| 70. | Wang, Y., and C. Guthrie. 1998. PRP16, a DEAH-box RNA helicase, is recruited to the spliceosome primarily via its nonconserved N-terminal domain. RNA 4:1216-1229[Abstract]. |
| 71. | Wang, Y., J. Wagner, and C. Guthrie. 1998. The DEAH-box splicing factor Prp16 unwinds RNA duplexes. Curr. Biol. 8:441-451[CrossRef][Medline]. |
| 72. | Watkins, N. J., A. Gottschalk, G. Neubauer, B. Kastner, P. Fabrizio, M. Mann, and R. Luhrmann. 1998. Cbf5p, a potential pseudouridine synthase, and Nhp2p, a putative RNA-binding protein, are present together with Gar1p in all H BOX/ACA-motif snoRNPs and constitute a common bipartite structure. RNA 4:1549-1568[Abstract]. |
| 73. | Wiederkehr, T., R. F. Pretot, and L. Minvielle-Sebastia. 1998. Synthetic lethal interactions with conditional poly(A) polymerase alleles identify LCP5, a gene involved in 18S rRNA maturation. RNA 4:1357-1372[Abstract]. |
| 74. |
Wu, P.,
J. S. Brockenbrough,
A. C. Metcalfe,
S. Chen, and J. P. Aris.
1998.
Nop5p is a small nucleolar ribonucleoprotein component required for pre-18S rRNA processing in yeast.
J. Biol. Chem.
273:16453-16463 |
| 75. |
Zebarjadian, Y.,
T. King,
M. J. Fournier,
L. Clarke, and J. Carbon.
1999.
Point mutations in yeast CBF5 can abolish in vivo pseudouridylation of rRNA.
Mol. Cell. Biol.
19:7461-7472 |
Molecular and Cellular Biology, October 2000, p. 7238-7246, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Segerstolpe, A., Lundkvist, P., Osheim, Y. N., Beyer, A. L., Wieslander, L.
(2008). Mrd1p binds to pre-rRNA early during transcription independent of U3 snoRNA and is required for compaction of the pre-rRNA into small subunit processomes. Nucleic Acids Res
36: 4364-4380
[Abstract] [Full Text] -
Eki, T., Ishihara, T., Katsura, I., Hanaoka, F.
(2007). A Genome-wide Survey and Systematic RNAi-based Characterization of Helicase-like Genes in Caenorhabditis elegans. DNA Res
0: dsm016v1-17
[Abstract] [Full Text] -
Martin-Marcos, P., Hinnebusch, A. G., Tamame, M.
(2007). Ribosomal Protein L33 Is Required for Ribosome Biogenesis, Subunit Joining, and Repression of GCN4 Translation. Mol. Cell. Biol.
27: 5968-5985
[Abstract] [Full Text] -
Granneman, S., Bernstein, K. A., Bleichert, F., Baserga, S. J.
(2006). Comprehensive Mutational Analysis of Yeast DEXD/H Box RNA Helicases Required for Small Ribosomal Subunit Synthesis. Mol. Cell. Biol.
26: 1183-1194
[Abstract] [Full Text] -
Lebaron, S., Froment, C., Fromont-Racine, M., Rain, J.-C., Monsarrat, B., Caizergues-Ferrer, M., Henry, Y.
(2005). The Splicing ATPase Prp43p Is a Component of Multiple Preribosomal Particles. Mol. Cell. Biol.
25: 9269-9282
[Abstract] [Full Text] -
Rocak, S., Emery, B., Tanner, N. K., Linder, P.
(2005). Characterization of the ATPase and unwinding activities of the yeast DEAD-box protein Has1p and the analysis of the roles of the conserved motifs. Nucleic Acids Res
33: 999-1009
[Abstract] [Full Text] -
Gallagher, J. E.G., Dunbar, D. A., Granneman, S., Mitchell, B. M., Osheim, Y., Beyer, A. L., Baserga, S. J.
(2004). RNA polymerase I transcription and pre-rRNA processing are linked by specific SSU processome components. Genes Dev.
18: 2506-2517
[Abstract] [Full Text] -
Leary, D. J., Terns, M. P., Huang, S.
(2004). Components of U3 snoRNA-containing Complexes Shuttle between Nuclei and the Cytoplasm and Differentially Localize in Nucleoli: Implications for Assembly and Function. Mol. Biol. Cell
15: 281-293
[Abstract] [Full Text] -
Senapin, S., Clark-Walker, G. D., Chen, X. J., Seraphin, B., Daugeron, M.-C.
(2003). RRP20, a component of the 90S preribosome, is required for pre-18S rRNA processing in Saccharomyces cerevisiae. Nucleic Acids Res
31: 2524-2533
[Abstract] [Full Text] -
Chen, W., Bucaria, J., Band, D. A., Sutton, A., Sternglanz, R.
(2003). Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis. Nucleic Acids Res
31: 690-699
[Abstract] [Full Text] -
Granneman, S., Pruijn, G. J. M., Horstman, W., van Venrooij, W. J., Luhrmann, R., Watkins, N. J.
(2002). The hU3-55K Protein Requires 15.5K Binding to the Box B/C Motif as Well as Flanking RNA Elements for Its Association with the U3 Small Nucleolar RNA in Vitro. J. Biol. Chem.
277: 48490-48500
[Abstract] [Full Text] -
Wehner, K. A., Gallagher, J. E. G., Baserga, S. J.
(2002). Components of an Interdependent Unit within the SSU Processome Regulate and Mediate Its Activity. Mol. Cell. Biol.
22: 7258-7267
[Abstract] [Full Text] -
Jin, S.-B., Zhao, J., Bjork, P., Schmekel, K., Ljungdahl, Per. O., Wieslander, L.
(2002). Mrd1p Is Required for Processing of Pre-rRNA and for Maintenance of Steady-state Levels of 40 S Ribosomal Subunits in Yeast. J. Biol. Chem.
277: 18431-18439
[Abstract] [Full Text] -
King, T. H., Decatur, W. A., Bertrand, E., Maxwell, E. S., Fournier, M. J.
(2001). A Well-Connected and Conserved Nucleoplasmic Helicase Is Required for Production of Box C/D and H/ACA snoRNAs and Localization of snoRNP Proteins. Mol. Cell. Biol.
21: 7731-7746
[Abstract] [Full Text] -
Borovjagin, A. V., Gerbi, S. A.
(2001). Xenopus U3 snoRNA GAC-Box A' and Box A Sequences Play Distinct Functional Roles in rRNA Processing. Mol. Cell. Biol.
21: 6210-6221
[Abstract] [Full Text] -
Daugeron, M.-C., Linder, P.
(2001). Characterization and mutational analysis of yeast Dbp8p, a putative RNA helicase involved in ribosome biogenesis. Nucleic Acids Res
29: 1144-1155
[Abstract] [Full Text] -
GERBI, S.A., BOROVJAGIN, A.V., EZROKHI, M., LANGE, T.S.
(2001). Ribosome Biogenesis: Role of Small Nucleolar RNA in Maturation of Eukaryotic rRNA. Cold Spring Harb Symp Quant Biol
66: 575-590
[Abstract]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»