Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7319-7331, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Transcriptional Regulation of the CLC-K1 Promoter by
myc-Associated Zinc Finger Protein and Kidney-Enriched
Krüppel-Like Factor, a Novel Zinc Finger Repressor
Shinichi
Uchida,1,*
Yujiro
Tanaka,1
Hiroshi
Ito,1
Fumiko
Saitoh-Ohara,2
Johji
Inazawa,2
Kazunari K.
Yokoyama,3
Sei
Sasaki,1 and
Fumiaki
Marumo1
Second Department of Internal Medicine,
School of Medicine,1 and Department of
Molecular Cytogenetics, Medical Research
Institute,2 Tokyo Medical and Dental University,
Tokyo, and Tukuba Institute, RIKEN (The Institute of
Physical and Chemical Research), Ibaraki,3 Japan
Received 15 May 2000/Accepted 21 June 2000
 |
ABSTRACT |
The expression of CLC-K1 and CLC-K2, two kidney-specific CLC
chloride channels, is transcriptionally regulated on a tissue-specific basis. Previous studies have shown that a GA element near their transcriptional start sites is important for basal and cell-specific activities of the CLC-K1 and CLC-K2 gene promoters. To identify the
GA-binding proteins, the human kidney cDNA library was screened by a
yeast one-hybrid system. A novel member of the Cys2-His2 zinc finger
gene designated KKLF (for "kidney-enriched Krüppel-like factor") and the previously isolated MAZ (for "myc-associated zinc
finger protein") were cloned. KKLF was found to be abundantly expressed in the liver, kidneys, heart, and skeletal muscle, and immunohistochemistry revealed the nuclear localization of KKLF protein
in interstitial cells in heart and skeletal muscle, stellate cells, and
fibroblasts in the liver. In the kidneys, KKLF protein was localized in
interstitial cells, mesangial cells, and nephron segments, where CLC-K1
and CLC-K2 were not expressed. A gel mobility shift assay revealed
sequence-specific binding of recombinant KKLF and MAZ proteins to the
CLC-K1 GA element, and the fine-mutation assay clarified that the
consensus sequence for the KKLF binding site was GGGGNGGNG. In a
transient-transfection experiment, MAZ had a strong activating effect
on transcription of the CLC-K1-luciferase reporter gene. On the other
hand, KKLF coexpression with MAZ appeared to block the activating
effect of MAZ. These results suggest that a novel set of zinc finger
proteins may help regulate the strict tissue- and nephron
segment-specific expression of the CLC-K1 and CLC-K2 channel genes
through their GA cis element.
 |
INTRODUCTION |
CLC-K1 and CLC-K2 are two
kidney-specific members of the CLC chloride channel family (1,
35). Both are present in the plasma membranes of tubular cells in
the kidney (36, 37), and it has been speculated that both
serve as routes for transepithelial chloride transport. Mutations of
CLCNKB (the human homologue of rat CLC-K2) were recently found in
patients with Bartter's syndrome (30), and the CLC-K1 gene
knockout in mice results in nephrogenic diabetes insipidus
(21), confirming the important role of these channels in
chloride transport in the kidneys. Although the two clones are highly
homologous (80% amino acid identity in the rat sequence and 90% in
the human sequence), their intrarenal localizations are completely
different (39). Accordingly, the analysis of transcriptional
regulation of these two genes is expected to elucidate mechanisms of
kidney-specific and nephron segement-specific gene expression. To this
end, we previously isolated the promoters of the rat CLC-K1
(34) and CLC-K2 (26) genes. Surprisingly, proximal 5'-flanking regions that include the transcriptional start
sites are highly homologous and characterized by a GA element, GGGGAGGGGAGGGGGAGGG (26). Reporter gene assays
and gel retardation assays (26, 34) revealed that this GA
element is indispensable for the basal promoter activities of both
genes, suggesting that one or more proteins binding to this element may
be involved in the kidney-specific expression of the CLC-K1 and CLC-K2 genes.
In the present study, we isolated two cDNAs that bind to the GA
element, i.e., MAZ, the previously isolated myc-associated zinc finger
protein, and KKLF, a novel kidney-enriched Krüppel-like factor.
MAZ and KKLF have opposite effects on the CLC-K1 promoter activity,
suggesting that the kidney-specific expression of CLC-K genes may be
regulated by a series of zinc finger proteins through the GA element.
The spatial pattern of KKLF expression overlapped with negative
expressions of CLC-K1 and CLC-K2 in the kidneys, supporting the idea
that KKLF may contribute to the strict nephron segment-specific
expression of the CLC-K genes in vivo. Furthermore, we also found that
KKLF repressed the promoter activity of the
2(I) collagen gene.
Given the localization of KKLF in interstitial fibroblasts in cardiac
and skeletal muscle and in potentially fibrogenic cells such as the
mesangial cells in the kidneys or stellate cells in the liver, it is
reasonable to assume that KKLF may be involved in the fibrogenesis in
these organs. In a unilateral ureteral obstruction (UUO) model of mouse
kidney, a well-characterized model of progressive tubulointerstitial
fibrosis, a rapid decrease of KKLF and subsequent increase of
2(I)
collagen expression were observed, suggesting that KKLF is
involved in type I collagen synthesis and tissue fibrosis.
 |
MATERIALS AND METHODS |
Yeast one-hybrid screening.
cDNA encoding proteins binding
to the GA element of the rat CLC-K1 gene (34) was cloned
using a yeast one-hybrid system (MATCHMAKER One-Hybrid System;
Clontech, Palo Alto, Calif.). Briefly, sense and antisense strands of
three tandem repeats of the GA element
(AGCCGGGGAGGGGGAGGGGAGGGTGTTG) were synthesized, annealed, and cloned into the pHISi-1 vector (GA-pHISi-1). The yeast strain YM4271 transformed with GA-pHISi-1 was selected on synthetic dropout medium minus histidine (SD/
His) and used as a parent cell for library
screening. Plasmid DNA (20 µg) in the pACT2 vector was prepared from
a human kidney cDNA (106 colonies) library having the GAL4
activation domain (Clontech) and then introduced into
GA-pHISi-1-transformed YM4271 cells and selected on an SD/
His/
Leu
plate with 15 mM 3-aminotriazole. Plasmid DNA was rescued from selected
yeast colonies, and the sequences of isolated cDNAs were compared with
those in GenBank. To clone a rat homologue of isolated cDNAs, a rat
kidney cDNA library (35) was screened by plaque
hybridization as described previously (35) using each
isolated human cDNA as a probe.
Recombinant KKLF and MAZ protein expression and electrophoretic
mobility shift assay (EMSA).
Human and rat KKLF sequences
(including amino acid residues 305 to 415) were subcloned into the
pGEX6P-1 vector (Amersham Pharmacia Biotech), and five zinc finger
domains of MAZ (including amino acid residues 298 to 497) were cloned
into the pGEX4T vector. Recombinant glutathione
S-transferase (GST), GST-KKLF, and GST-MAZ were expressed in
Escherichia coli BL21(DE3). Briefly, transformed bacteria
grown at 37°C overnight in Luria broth medium containing ampicillin
(LB ampicillin) (50 µg/ml) were diluted 1:100 in fresh LB ampicillin
and incubated for 2 h at 37°C. Recombinant protein expression
was induced for an additional 3 h in the presence of 1 mM
isopropyl-1-thio-
-galactoside. Extracts were prepared by sonication
and purified by glutathione-Sepharose affinity binding. Gel mobility
shift assays were performed as described previously (26,
34). Briefly, synthesized sense
(AGCCGGGGAGGGGGAGGGGAGGGTGTTG) and antisense
oligonucleotides were annealed and radiolabeled at the 5' end with
polynucleotide kinase and [
-32P]ATP. After GST fusion
proteins (1 to 50 ng) or tissue nuclear extracts (~10 µg) were
incubated with 0.5 ng of radiolabeled DNA at room temperature for 30 min in a buffer containing 25 mM HEPES-KOH (pH 7.9), 90 mM KCl, 0.5 mM
EDTA-NaOH (pH 8.0), 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl
fluoride, 10% glycerol, 1 µg of poly(dI-dC), and, if indicated,
competitors, they were electrophoresed through 6 or 4% nondenaturing
polyacrylamide gels (19:1 acrylamide-to-bisacrylamide ratio) containing
10% glycerol in TGE buffer (50 mM Tris-HCl [pH 8.5], 380 mM glycine,
2 mM EDTA-NaOH [pH 8.0]) for 2 h at 4°C. Upon completion of
electrophoresis, the gels were dried and the protein-DNA complexes were
visualized by autoradiography. For the supershift assay using anti-KKLF
antibody, 2 µl of affinity purified antibody was included in the
binding-reaction mixture.
Plasmid, transient transfection, and reporter gene assay.
Isolated cDNA clones were subcloned into the pCDNA3 vector for the
transactivation assay. Luciferase reporter plasmids (10 µg) in the
pGL2 vector (Promega) containing the various 5'-flanking regions of the
rat CLC-K1 gene (34), the pCDNA3 vector containing an
isolated cDNA insert, and the pSV-
-gal vector (5 µg) (Promega) were introduced into cultured mammalian cells by electroporation. When
cells plated on 150-mm plastic dishes reached 60 to 70% confluence, they were detached with 0.25% trypsin-EDTA, neutralized with complete medium, pelleted by brief centrifugation, resuspended in 500 µl of
K-PBS buffer (30.8 mM NaCl, 120.7 mM KCl, 1.46 mM
KH2PO4, 8.1 mM Na2HPO4,
10 mM MgCl2) containing plasmid DNAs, transferred to a
cuvette (0.4 mm wide), and electroporated at settings of 370 V and 960 µF. At 10 min after electroporation, the cells were resuspended in
prewarmed complete medium and seeded in a 60-mm-diameter dish. At
48 h after transfection, the cells were harvested for the
luciferase and
-galactosidase assay (Promega). Transfection efficiency was corrected using
-galactosidase activity. The human
2(I) collagen promoter was isolated by PCR (11) and
ligated to the pGL-2 basic vector.
Northern blot and dot blot analysis of KKLF.
The
poly(A)+ RNA Northern blot membrane for human tissues and
RNA Master Blot were purchased from Clontech and probed with the whole
human KKLF.
Generation of anti-KKLF antiserum, Western blotting, and
immunohistochemistry.
The carboxyl-terminal peptide of rat KKLF
(14 residues, CHRFPRSSRAVRAIN-COOH) was synthesized, conjugated with
keyhole limpet hemocyanin at an additional cysteine residue of the
amino terminus, and used to raise a rabbit polyclonal antiserum which
was affinity purified soon thereafter. In vitro-translated KKLF using
TnT-coupled wheat germ extract (Promega) (10 µl) and tissue extracts
(10 µg) was subjected to sodium dodecyl sulfate (SDS)-polyacrylamide
gel electrophoresis, transferred to nitrocellulose membranes, and immunoblotted with rabbit anti-KKLF affinity-purified antiserum (1:200
dilution) or preimmune serum. Following incubation with horseradish
peroxidase-conjugated goat anti-rabbit immunoglobulins (Dako), KKLF was
visualized by enhanced chemiluminescence (Amersham Corp.). Tissue
samples from the liver, heart, and kidneys of rats were prepared as
follows. Samples (~500 mg) of tissues homogenized in 1.5 ml of
phosphate-buffered saline containing 1% Igepal CA-630 (Sigma), 0.5%
sodium deoxycholate, 0.1% SDS, and 0.1 mg of phenylmethylsulfonyl fluoride were centrifuged at 15,000 × g, and the
supernatant was recovered as total-cell lysate.
Immunohistochemistry was performed using a TSA-Indirect kit (NEN) as
specified by the manufacturer. Anti-KKLF antiserum was used at a
dilution of 1:100. KKLF was double stained with each marker protein by
introducing its antiserum into the final reaction mixture of the
TSA-Indirect system. These marker proteins were detected by a 1:200
dilution of Cy3-conjugated anti-rabbit or anti-mouse immunoglobulin
antibody (Sigma) and visualized by confocal microscopy (LMS-510
instrument; Carl Zeiss). Although anti-KKLF antibody was also generated
in rabbits, a preliminary experiment confirmed that the KKLF protein
could be detected only by the TSA-Indirect system and not by the usual
indirect-immunofluorescence method using Cy3-conjugated anti-rabbit
immunoglobulin antibody as a secondary antibody. Anti-rat major
histocompatibility complex class II (MHC-II) antibody and anti-CD 73 (ecto-5'-nucleotidase) were purchased from Antigen America Inc. and
Alexis Biochemicals, respectively. Anti-desmine monoclonal antibody was
from Oncogene Research Products, and anti-von Willebrand factor
monoclonal antibody and anti-ED 2 monoclonal antibody were from Dako
and BMA, respectively.
RT-PCR analysis of MAZ expression along rat nephron
segments.
Microdissection of rat nephron segments was performed as
described previously (32). Reverse-transcribed cDNA from
dissected nephrons was divided for use with PCR templates of rat MAZ,
rat KKLF, rat CLC-K1, rat CLC-K2, and
-actin. PCR was performed with the following profile: 94°C for 30 s, 60°C for 30 s, and
72°C for 30 s for 30 cycles. CGACATAAGCTGTCGCATTCG
and AAGCTGAGCTCAGCATCTTGC were used as PCR primers to
detect rat MAZ, and TCTCCAGGACATCTTGGCAGG and
CTGTTCTGACCCCAACGCTG were used to detect rat CLC-K1. PCR
primers for rat CLC-K1 covered nucleotides 1894 to 2129 (35)
and were individually designed in different exons (exons 17 and 19) to prevent amplification from genomic DNA. PCR primers for rat MAZ were
designed based on the partial cDNA sequence of rat MA Z obtained by
screening the rat kidney cDNA library with human MAZ as a probe. The
amplified region of rat MAZ corresponded to nucleotides 908 to 1236 of
human MAZ (3). We confirmed that there was no amplification from genomic DNA by using this primer set in a preliminary experiment. The primers for rat CLC-K2 were TGTTCGTGACGTCACGAGGC and
CCAAGGGTCCGATGTGACAG, which together produced a 257-bp PCR
product corresponding to nucleotides 2040 to 2297 of rat CLC-K2 cDNA
(1). The rat KKLF primers for reverse transcription-PCR
(RT-PCR) were TGCGAATTGCGCCTGTGCCCATTG and
GTACTGCGCGGCTGCTTCGTG, which together covered nucleotides 1111 to 1512 of the cDNA.
-Actin primers for RT-PCR were purchased from Clontech. To confirm the specificity of the PCR products of rat
MAZ and rat KKLF, Southern hybridization was performed using primers
GGACGAGAAGCCCTACCAGTG for MAZ and CCTAGGGATCCTGAGCCAATA for KKLF.
UUO of mouse kidney.
To provide the UUO model, the left
ureter was ligated as described previously (10) and total
RNA was harvested from the ureter-obstructed kidney and contralateral
kidney on days 1, 3, 5, 7, and 10. Total RNA was also obtained from
kidneys of sham-operated mice.
Nucleotide sequence accession numbers.
The accession numbers
of human and rat KKLF are AB029254 and AB020597, respectively.
 |
RESULTS |
KKLF and MAZ cloning.
Screening of 106 clones from
human kidney cDNA library resulted in the growth of several colonies on
the SD/
His/
Leu plate with 15 mM 3-aminotriazole. Plasmids were
rescued into DH5
competent cells, subcloned into the pcDNA3 vector,
and sequenced. One clone contained a ~2.5-kb insert that was shown by
partial sequencing to be the same as the cDNAs previously isolated as
human MAZ (3) or hamster Pur-1 (13). Sequencing
of the total insert confirmed that it contained the whole open reading
frame. Another isolated clone, which we later named KKLF, contained a
~2.5-kb insert. The KKLF cDNA contained a single open reading frame
of 1,245 bp which encoded a polypeptide of 415 amino acids with a
predicted molecular mass of 44 kDa (Fig.
1a). The sequence around the ATG codon,
ccagcAUGg, almost completely matched (8 of 9 nucleotides) the consensus sequence [cc(g/a)ccAUGg] proposed by Kozak
(16, 17). The deduced KKLF amino acid sequence contained
three zinc finger motifs (Cys2-His2) at the carboxyl terminus which
were separated by a 7-amino-acid interfinger spacer similar to the H/C
link consensus sequence, (T/S)GEKP(Y/F)X. Based on these features, KKLF
can be classified as a member of the Krüppel family of proteins. A BLAST search of the GeneBank database also revealed that KKLF has
zinc fingers similar to those of EKLF, LKLF, GKLF/EZF, BKLF, CPBP/Zf9,
BTEB-2, and UKLF (2, 5, 8, 15, 20, 22, 27, 29, 31), as shown
in Fig. 1b. Apart from the zinc finger domains, there was no known
motif in the amino acid sequence of KKLF, but there were serine-rich
and proline-rich stretches at amino acid residues 47 to 57 and 194 to
216, respectively. In addition to these clusters, KKLF was rich in
proline and serine residues. In fact, proline and serine residues
constitute 14 and 11% of the amino acid residues outside the zinc
finger domains, respectively. There were also clusters of negatively
charged amino acids at amino acid residues 41 to 45 and 142 to 150. To
simplify the following immunohistochemical study to localize KKLF in
vivo, the rat homologue of KKLF was obtained by screening a rat kidney cDNA library with human KKLF as a probe. This homologue also had a
~2.5-kb insert and encoded a 415-amino-acid sequence that showed an
84% nucleotide and amino acid identity to human KKLF (Fig. 1c). Human
chromosome mapping was also performed using human KKLF cDNA as a probe.
Human KKLF was mapped at 3q21-q22 (data not shown).



View larger version (164K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence of the KKLF cDNA and protein. (a) Sequence of
the human KKLF cDNA and deduced amino acid sequence. Three zinc finger
domains are underlined. H-C linkers are double underlined. The
proline-rich domain (amino acid residues 194 to 216) is in boldface.
The serine-rich domain (amino acid residues 47 to 57) is in boldface
and underlined. Acidic domains are shown in italics. (b) Comparison of
the amino acid sequence of human KKLF with amino acid sequences of
related zinc finger proteins. The numbers to the left of the sequences
indicate the identity to the amino acid sequence of KKLF. (c) Amino
acid sequence of rat KKLF and its alignment with human KKLF. Identical
amino acids are highlighted.
|
|
Gel mobility shift assay of recombinant MAZ and KKLF proteins.
To confirm that MAZ and KKLF could bind to the GA element, three zinc
fingers of human and rat KKLF and five zinc fingers of human MAZ were
expressed as fusion proteins with GST, incubated with the
32P-labeled GA element, and electrophoresed in a
nondenaturing polyacrylamide gel. As shown in Fig.
2A panel a, incubation
of human and rat KKLF fusion proteins with the GA element resulted in
the formation of retarded complexes (lane 1 and 5) that could be
competed with a 100-fold molar excess of unlabeled GA element (lane 2 and 6). A 100-fold molar excess of cold SpI oligonucleotide (lane 3)
did not compete with the GA element, suggesting that KKLF could not bind to the SpI site (GGCGGG). Inclusion of anti-rat KKLF
antibody in the EMSA reaction mixture shifted the rat KKLF-GA element
complex (lane 7, indicated by an arrow), confirming that the antibody described in this study could truly bind to rat KKLF and be used for
the supershift assay. Since the full-length KKLF-GA complex migrated
very slowly in the 6% gel, we used a 4% gel and ran it for 6 h
in EMSA. Fig. 2A panel c shows that the kidney and liver nuclear
extracts produced faint retarded bands with the GA element (lanes 1 and
4) that were competed with a 100-fold molar excess of the cold probe
(lanes 2 and 5) and supershifted with anti-KKLF antibody (lanes 3 and
6). These results clearly indicated that a native KKLF from kidney and
liver could bind the GA element of the CLC-K1 promoter.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Gel mobility shift assay with the CLC-K1 GA
element and recombinant extracts of MAZ-GST and KKLF-GST proteins.
(Panel a) Purified human and rat KKLF-GST extracts (30 ng) were mixed
with the 32P-labeled GA element
(AGCCGGGGAGGGGGAGGGGAGGGTGTTG) of the CLC-K1 gene promoter
(34) and electrophoresed in a 6% nondenaturing
polyacrylamide gel. hKKLF-GST (lanes 1 to 4) and rKKLF-GST (lanes 5 to
7) have 30 ng of human and rat KKLF-GST in the reaction, respectively.
Lanes 1 and 5, without the cold competitor; lanes 2 and 6, with a
100-fold molar excess of cold competitor; lane 3, with a 100-fold molar
excess of SpI probe (Promega); lanes 4 and 6, with anti-rat KKLF
antiserum added. (Panel b) Purified human MAZ-GST extracts (30 ng) were
mixed with the 32P-labeled GA element (lane 1). The
formation of DNA-MAZ complexes was abolished with a 100-molar excess of
cold probe (lane 2), ME1a1 probe (GAAAAAGAAGGGAGGGGAGGGATC)
(lane 4), or CD4 probe (CTGGGGGTGGGAGGGAGGGACTCCT)
(lane 5). In lane 3, the m4 probe with four mutations (Fig. 2B
panel d) in the wild GA-element was labeled with 32P and
used for EMSA. The MAZ binding was reduced by the mutations. (Panel c)
Rat kidney and liver nuclear extracts were incubated with the
32P-labeled GA element (lanes 1 and 4) and resolved in a
4% polyacrylamide gel. The faint retarded bands were observed. These
bands were competed with the cold probe (lanes 2 and 5) and
supershifted by the anti-rat KKLF antiserum (lanes 3 and 6). (B)
Mutational analysis of the KKLF binding site in the GA element. Mutants
m1 and m4 (panel a), m3 (panel b), and m2 (panel c) were used. The
structure of each mutant probe is shown in panel d. All probes were
labeled with 32P, and equal radioactivity was included in
the binding reaction mixtures. (C) Competitive binding of KKLF and MAZ
at the GA element. In all reactions, a constant amount of MAZ-GST (30 ng) was incubated with increasing amounts of human KKLF-GST (lane 1, 0 ng; lane 2, 1 ng; lane 3, 3 ng; lane 4, 30 ng; lane 5, 50 ng).
|
|
Previous studies revealed that MAZ binds to GGGGAGGGG
sequences (3, 9, 24), i.e., sequences identical to the
GA element of the CLC-K1 promoter. Accordingly, it stands to reason
that the GA element forms the retarded band with MAZ-GST shown in Fig. 2A panel b (lane 1). These two bands (Fig. 2A-b) were completely blocked by the 100-fold molar excess of cold probe (lane 2). The ME1a1
probe (3) (lane 4) or the CD4 promoter probe (6)
(lane 5), previously shown to bind to MAZ, also blocked the formation of the retarded bands. In lane 3 of Fig. 2A panel b, m4 probe containing four mutations (underlined) introduced into the wild-type GA
element
(AGCCGGtGAGGtGGAGtGGAGtGTGTTG)
(Fig. 2B panel d) was labeled with 32P and used for
EMSA. A significant decrease of binding was observed in EMSA using the
m4 probe, which was consistent with the previously reported consensus
sequence for the MAZ binding site (3, 9, 24).
To determine the KKLF binding-site consensus sequence, a series of
mutations was introduced into the wild-type GA element (Fig. 2B panel
d) and the binding ability of the mutations was determined by EMSA.
Figure 2B panel a shows that the m4 probe with four mutations (sites 1, 2, 3, and 4, [Fig. 2B panel d]) had a significantly reduced binding
ability just as for MAZ (Fig. 2A panel b, lane 3). However, probes that
had a single mutation at any one of these four sites (m1-1 to m1-4)
could bind to KKLF. Next, we restored a mutation of the m4 probe at
site 4. This m3 probe, which had three mutations, at sites 1, 2, and 3, still showed a significantly reduced ability to bind to KKLF, just as for the m4 probe (Fig. 2B panel b). Next, we further restored the
mutation of the m3 probe at site 1 and named the new probe m2 (Fig. 2B
panel b, lane 3). Surprisingly, the binding ability of m2 was almost
equal to that of the wild-type probe (lanes 1 and 3), suggesting that
this G residue at site 1 was located at a crucial position in the m2
probe in terms of KKLF binding. According to the report by Klevit, KKLF
is supposed to have a consensus sequence, NNGGNGNGG (14). To
verify this, we introduced seven kinds of single mutations into the m2
probe around site 1. A single mutation at any site significantly
reduced the binding of KKLF, as shown in Fig. 2B panel c. Based on
these data, GGGGNGGNG was determined experimentally to be a consensus
KKLF binding sequence (Fig. 2B panel d).
Since the consensus KKLF binding sequence was found to be similar to
the MAZ binding sequence, we tested whether MAZ and KKLF competitively
bind to the GA element. As shown in Fig. 2C, the incubation of an
increasing amount of KKLF-GST with a constant amount of MAZ abolished
MAZ binding to the GA element. Tenfold less KKLF than MAZ was enough to
abolish the MAZ binding, indicating that KKLF had a higher affinity to
the GA element than did MAZ.
Transactivation assay.
To assay the transactivating effect of
cloned cDNAs, we selected NIH 3T3 as the host cell of transfection
since the CLC-K1 promoter activities in NIH 3T3 cells were minimal in
our previous study (34). As shown in Fig.
3a, cotransfection of MAZ resulted in a
clear stimulation of the CLC-K1 promoter (positions
51 to +75). The
construct which did not contain the GA element (positions
29 to +75)
did not respond to the cotransfection of MAZ, suggesting that MAZ
transactivated the CLC-K1 promoter through the GA element. MAZ
activation of CLC-K1 promoter was also significantly reduced in the
mutant CLC-K1 promoter (m4) that had four mutations in the GA element,
which was consistent with the reduced binding in the EMSA study (Fig.
2A panel b). On the other hand, cotransfection of KKLF did not affect
the baseline promoter activity in NIH 3T3 cells. As shown previously
(34), the proximal CLC-K1 promoter (positions
51 to +75)
showed basal promoter activity in some cell lines. In the preliminary
experiment using MDCK cells, cotransfection of KKLF almost completely
repressed the basal promoter activity of the CLC-K1 promoter (data not
shown), and on this basis KKLF did appear to act as a repressor. In
addition, EMSA confirmed the competitive binding of MAZ and KKLF to the
GA element (Fig. 2C). Accordingly, we tested whether KKLF inhibited MAZ
activity by transfecting expression plasmids for both into NIH 3T3
cells. As shown in Fig. 3b, when the two expression vectors were
transfected in equivalent amounts, the MAZ-induced transactivation was
inhibited to ~40%. Increasing the amounts of KKLF further diminished
and completely blocked the MAZ effect. This repressive effect of KKLF on MAZ activity was also observed in the m4 construct (Fig. 3b). Although EMSA showed a significant decrease of KKLF binding to the m4
probe, as with MAZ (Fig. 2B panel a), a faint retarded band was still
observed, which may account for the repressive effect of KKLF in the m4
construct. These results indicated that KKLF acted as a functional
competitor of MAZ through the competitive binding to the GA element.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Transfection of NIH 3T3 cells with MAZ and KKLF
expression vectors and CLC-K1-luciferase reporter plasmids. (a) Human
MAZ and KKLF in pCDNA3 (10 µg) were transfected with 51, 29, or
mutant (m4) CLC-K1-luciferase reporter plasmids (34) (10 µg) and pSV- -Gal (3 µg). Empty vector (pCDNA3) was cotransfected
to maintain equivalent total plasmid amounts in each transfection. The
51 CLC-K1 luciferase reporter contains the GA element, but the 29
reporter does not. The m4 CLC-K1 luciferase reporter contains the four
mutations in the 51 GA CLC-K1 luciferase plasmid. Luciferase and
-galactosidase reporter gene activities were measured 48 h
after transfection. Data are relative light units divided by
-galactosidase activity from three different experiments (mean and
standard error of the mean). (b) MAZ expression vector (8 µg) was
cotransfected with different amounts (2 to 16 µg) of KKLF expression
vector, 51 wild or m4CLC-K1 luciferase reporter plasmids (8 µg),
and pSV- -Gal (3 µg). Numbers in parentheses indicate the amounts
of plasmids used for transfection.
|
|
Tissue distribution of human KKLF.
To determine the tissue
distribution of KKLF, Northern blot analysis was performed using a
full-length KKLF cDNA as a probe. As shown in Fig.
4a, a 2.5-kb mRNA was detected and its
highest expression was observed in the liver. Moderate levels were also noted in the kidneys, heart, and skeletal muscle. Based on a
quantitative dot blot analysis of the relative expression of KKLF using
a human RNA Master Blot kit (Clontech), we obtained information on a
more detailed pattern of KKLF expression among human tissues (Fig. 4b).
As shown in the Northern analysis, the liver showed the highest expression among the tissues examined. In contrast to EKLF, KKLF expression was not detected in bone marrow and lymphoid tissues. Since
the gene name LKLF is already used to designate lung enriched Krüppel-like factor, we called this liver-enriched
Krüppel-like factor "Kidney-enriched Krüppel-like
factor" (KKLF) in consideration of its isolation from the kidneys and
high level of expression in that organ. Additional examination of the
tissue distribution of rat KKLF by Northern analysis and RNase
protection assay showed tissue distributions quite similar to those of
human KKLF (data not shown).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Tissue distribution of human KKLF. (a) Northern analysis
of human KKLF. Each lane contains polyA(+) RNAs (2 µg) from various
human tissues. Lanes: 1, brain; 2, heart; 3, skeletal muscle; 4, colon;
5, thymus; 6, spleen; 7, kidney; 8, liver; 9, small intestine; 10, placenta; 11, lung; 12, leukocyte. (b) Relative KKLF expression. A dot
blot analysis of 0.5 µg of poly(A)+ RNA was performed
using the human RNA Master Blot (Clontech). Hybridization signals were
quantified using an image analyzer (BAS-2500; Fuji Corp.)
|
|
Immunohistochemistry of KKLF.
To better localize the cells
expressing the KKLF gene, especially in the kidney cells already known
to express CLC-K1 and CLC-K2, we generated anti-rat KKLF antiserum
using a carboxyl-terminal peptide. Western blotting of in
vitro-translated KKLF was performed with the antibody to confirm its
specificity. In vitro-translated KKLF with
[35S]methionine (Fig. 5a)
showed an apparent molecular mass of ~50 kDa, and this matched the
calculated molecular mass of 44 kDa. The parallel samples with a cold
complete amino acid mixture but without hot methionine were subjected
to SDS-polyacrylamide gel electrophoresis Western blotted onto a
nitrocellulose membrane, and incubated with anti-KKLF antibody (1:200).
As shown in Fig. 5b, the anti-KKLF antibody recognized a band of ~50
kDa only in one lane where in vitro-translated KKLF was present,
thereby confirming the specificity of the antibody. This antibody also
recognized a single protein of ~65 kDa in the liver, heart, skeletal
muscle, and kidneys but not in the spleen (Fig. 5b), which was
consistent with the result of KKLF mRNA expression. Preimmune serum did
not recognize in vitro-translated KKLF and a 65-kDa protein in rat tissues (Fig. 5c). Posttranslational modifications of KKLF in vivo may
be possible based on the ~15-kDa difference between the native
protein in tissues and the in vitro-translated product. A similar
phenomenon (14-kDa difference) was observed for another Krüppel-like factor, Zf9 (27). Although these
modifications may include both phosphorylation and glycosylation, no
glycosylation site was found in residues conserved in human and rat
KKLF. Potential phophorylation sites for protein kinase C were found at
amino acid residues 14 to 16 and 408 to 410.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
In vitro translation of rat KKLF and Western blot of rat
KKLF protein. (a) In vitro translation of rat KKLF. Rat KKLF protein
was synthesized in vitro using TnT-coupled wheat germ extract in the
presence of [35S]methionine. A 10-µl volume was
analyzed by electrophoresis in an SDS-polyacrylamide gel, dried, and
autoradiographed. IVT(KKLF) and IVT( ) indicate a rat KKLF (~50 kDa)
and negative control, respectively. (b and c) Western blots of in
vitro-translated rat KKLF and various rat tissues. A 10-µl volume of
the in vitro translation reaction mixture of rat KKLF cDNA in pCDNA3
and an empty pCDNA3 vector with cold methionine were electrophoresed
together with 10 µg of tissue extracts from rat heart, liver, kidney,
skeletal muscle, and spleen in an SDS-polyacrylamide gel, transferred
to a nitrocellulose membrane, and reacted with anti-KKLF
affinity-purified antiserum (1:200) (b) or preimmune serum (c). In the
in vitro translation reaction of rat KKLF, the anti-KKLF antibody
recognized a ~50-kDa band which matched the apparent molecular mass
of KKLF shown in panel A. In tissue samples, the antibody recognized a
~65 kDa protein.
|
|
The immunohistochemistry of KKLF in the liver is shown in Fig.
6A and B. The nuclei of
cells in the sinusoid were stained (Fig. 6A panel b),
and double immunostaining of KKLF and desmin (Fig. 6B panel a) showed
that most of the stained cells in the sinusoid were stellate cells.
ED-2-positive Kupffer cells only occasionally colocalized with KKLF
(Fig. 6B panel c). In addition to the stellate cells, KKLF staining was
observed in subcapsular fibroblasts (Fig. 6A panel d), second-layer
cells in the central vein (Fig. 6B panel b), and portal fibroblasts
(Fig. 6A panel c). Most of the stained nuclei in the heart (Fig. 6C
panels b and c) and skeletal muscle (panel d) were observed between the muscle cells and were not colocalized with ED-2 positivity, which suggested that the KKLF-positive interstitial cells in the heart and
skeletal muscle were not resident macrophages but fibroblasts. In the
kidneys, the KKLF staining was observed in the nuclei of cells in the
inner medulla (Fig. 6D panels a through c), and there were also
numerous stained cells in the glomeruli and interstitium in the cortex
(Fig. 6E panel a). To examine whether KKLF and CLC-K1 colocalized in
the inner medulla, double-immunofluorescence staining was performed. As
shown in Fig. 6D panels a through c, colocalization of KKLF with AQP-2
(panel a) and AQP-1 (panel b) confirmed the presence of KKLF in the
inner medullary collecting ducts and the thin descending limb of
Henle's loop, but there was no colocalization with CLC-K1 (panel c).
KKLF-positive cells that were negative for AQP-1, AQP-2, and CLC-K1
were also observed by simultaneous staining of all four proteins (data
not shown), indicating that KKLF was also present in the interstitial
cells in the inner medulla. KKLF staining in the glomeruli was mostly
associated with desmin staining (Fig. 6E panel b, indicated by arrows)
and occasionally associated with Von Willebrand facor staining (panel
c, indicated by arrows), suggesting that KKLF was present predominantly
in the mesangial cells in the glomeruli. In the interstitial cells of
the kidney cortex, KKLF-positive cells were also positive for ecto-5'-nucleotidase (Fig. 6E panel d), a marker for fibroblasts in the
renal cortex (12), but they were not colocalized with MHC-II
antigen (panel e), a marker for dendritic cells, another predominant
cell type in the interstitium of the renal cortex (12).





View larger version (369K):
[in this window]
[in a new window]
|
FIG. 6.
(A) KKLF in the liver. Cryostat sections of rat liver
were incubated with preimmune serum (a) or anti-KKLF antibody (1:100)
(b to d) in the TSA-Indirect system, and KKLF was visualized with
3,3'-diaminobenzidine tetrahydrochloride (DAB) (b and d) or
3-amino-9-ethyl carbazole (c). The sections were counterstained with
hematoxylin. Cells in siunusoids (b), portal fibroblasts (c), and
subcapsular fibroblasts (d) were stained. (B) Double immunostaining of
KKLF with desmin and ED-2 in the liver. (a) KKLF staining in sinusoids
(green) was associated with desmin staining (red) and became yellowish
(arrows). (b) The nuclei of desmin-positive (red) second-layer cells
were also positive for KKLF (arrows). (c) ED-2 stainings identifying
Kupffer cells (red) were only occasionally associated with KKLF
staining (green). (C) KKLF staining in the heart and skeletal muscle.
(a and b) Cryostat sections of rat heart were incubated with preimmune
serum (a) or anti-KKLF antibody (1:100) (b) in the TSA-Indirect system,
and KKLF was visualized with DAB (b). KKLF staining was observed in the
interstitial cells (brown). (c) Double staining of KKLF (green) and
ED-2 (red) in the heart. Most of the KKLF-positive cells were ED-2
negative. (d) KKLF staining in the skeletal muscle. KKLF visualized by
DAB staining (brown) was observed in the interstitial cells between the
muscle fibers and was not associated with the ED-2 staining (pinkish
staining by Fast red). (D) Immunohistochemistry of rat KKLF in the
inner medulla of the rat kidney. Double immunofluorescence of KKLF
(green) and other marker proteins (red) in the inner medulla: AQP-2 (a)
AQP-1 (b), or CLC-K1 (c) KKLF is colocalized with AQP-1 and AQP-2 but
not with CLC-K1. Magnifications, ×400 (a) and ×200 (b and c). (E)
KKLF in the glomeruli and cortex. (a) KKLF visualized with DAB was
observed in the interstitial cells and cells in glomeruli in the cortex
Magnification, ×200. (b) KKLF staining (green [arrows]) in the
nuclei of glomeruli was mostly surrounded by desmin staining (red). (c)
Only a small portion of KKLF staining (arrows) was associated with Von
Willebrand factor staining (red). (d) Most of the KKLF staining in the
interstitium was surrounded by ecto-5'-nucleotidase staining (arrows).
(e) Most of the MHC-II-positive dendritic cells (red) did not have KKLF
staining (green).
|
|
RT-PCR of rat MAZ and KKLF along nephron segments.
Human MAZ
was reported to be expressed ubiquitously (3). RT-PCR
analysis using manually dissected nephron segements was performed to
confirm that MAZ is also expressed in the nephron segments together
with CLC-K1 and CLC-K2. Dissected nephron segments were permeabilized
with Triton X-100 and directly used as the templates of cDNA synthesis.
The resultant cDNAs were divided for PCR of rat MAZ, rat CLC-K1, rat
CLC-K2, rat KKLF, and
-actin. As shown in Fig.
7, CLC-K1 mRNA was detected only in the
thin ascending limb of Henle's loop (35, 36) while CLC-K2
expression was detected in the glomeruli, thick ascending limb of
Henle's loop, and distal tubules. This was consistent with the data
from our in situ hybridization study (39). Just as for
-actin, the expression of rat MAZ was detected in all nephron
segments tested (Fig. 7). This finding confirmed the ubiquitous nature
of MAZ expression and suggested that MAZ could interact with the GA
elements of the CLC-K1 and CLC-K2 gene promoters and activate the
transcription of these genes in the nephron. Detection of the KKLF mRNA
in the glomeruli, thin descending limb of Henle's loop, and inner
medullary collecting ducts supported the results of the
immunohistochemical study. The positive signal in the proximal tubules
in RT-PCR analysis might have been due to contamination of the sample
with the interstitial fibroblasts. KKLF expression along nephron
segments appeared to be inversely correlated with CLC-K1 and CLC-K2
expression.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
RT-PCR of rat MAZ and rat KKLF along nephron segments
The upper panel of rKKLF shows ethidium bromide staining of RT-PCR
products; 402-bp PCR products were detected. The lower panel of rKKLF
shows a Southern blot of the gel in the upper panel probed with a
32P-labeled rKKLF-specific oligonucleotide probe and
visualized by autoradiography. The upper panel of rMAZ shows ethidium
bromide staining of RT-PCR; 330-bp PCR products were detected. The
lower panel of rMAZ shows a Southern blot of the gel in the upper
panel. Lanes: 1, glomeruli; 2, proximal tubules; 3, thin descending
limb of Henle's loop; 4, thin ascending limb of Henle's loop; 5, thick ascending limb of Henle's loop; 6, cortical collecting ducts; 7, inner medullary collecting ducts; 8, glomeruli without RT; 9, cDNA as a
positive control for PCR.
|
|
KKLF expression in the kidney of the UUO model and effect of KKLF
on the promoter activity of human
2(I) collagen gene promoter.
Immunohistochemistry revealed predominant expression of KKLF in the
fibroblasts in several organs. To investigate the role of KKLF in the
fibroblasts, we tested the expression of KKLF in UUO mouse kidneys, a
well-characterized model of progressive interstitial fibrosis in the
kidney (10). KKLF expression began to decrease 1 day after
ureteral obstruction and could not be detected in Northern blots from 3 days after obstruction onward (Fig. 8a). This decrease of KKLF expression preceded the type I collagen expression, suggesting that KKLF expression in normal fibroblasts may
be involved in the regulation of type I collagen expression. To address
this issue, we tested the effect of KKLF expression on the human
2(I) collagen promoter (Fig. 8b). Cotransfection of the KKLF
expression vector with the reporter gene driven by the human
2(I)
collagen promoter inhibited the human
2(I) collagen promoter
activity (Fig. 8b), clearly indicating that KKLF repressed the human
2(I) collagen promoter.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 8.
(a) Northern blot of a UUO mouse kidney probed with
rKKLF (top panel) and human type I collagen (middle panel) probes.
Lanes: cont, total RNA from sham-operated mice kidney; C1, C5, and C10,
RNAs from contralateral kidneys from UUO mice sacrificed 1, 3, and 5 days, respectively, after UUO; U1 to U10, RNAs from obstructed kidneys
1 to 10 days, respectively, after UUO. Each lane contains 10 µg of
total RNA. The bottom panel shows ethidium bromide staining of the
RNAs. (b) Effect of KKLF expression on the human 2(I) collagen gene
promoter. The human 2(I) collagen gene promoter cloned in the pGL-2
basic vector (20 µg) was cotransfected with either pCDNA3.1+ empty
vector or rat KKLF expression vector in pCDNA3.1+ (20 µg) in NIH 3T3
cells. At 48 h after transfection, luciferase activity was
measured and corrected by -galactosidase activity (n = 3, means and standard deviations).
|
|
 |
DISCUSSION |
In previous reports we characterized an essential element of the
rat CLC-K1 and CLC-K2 gene promoters that contributes to the basal and
cell-specific activities of these genes (26, 34). We also
demonstrated in these reports that this GA element is recognized by one
or more distinct proteins (26, 34). To identify possible
transcription factors that bind to the GA element, we have screened a
human kidney cDNA library by using a yeast one-hybrid system and
isolated two cDNAs that encode polypeptides with zinc finger motifs.
The first polypeptide was MAZ, a previously discovered protein
(3) that transactivated the CLC-K1 gene promoter, and the
second polypeptide was KKLF, a novel Krüppel-like factor that
carried a three-zinc-finger (Cys2-His2) motif at its C-terminal domain
and repressed the promoter activity. A human MAZ and its mouse homolog,
mPur-1, were previously shown to bind to the GGGAGGG motif
of the c-myc P2 promoter (3) and the GAGA box of the insulin
promoter (13), respectively. Since the GA element of the
CLC-K1 and CLC-K2 gene promoters is GGGGAGG(G)GGAGGGGAG, it stands to reason that MAZ can bind to the GA element. Cotransfection assay and EMSA clearly demonstrated that MAZ interacted with the GA
element of the CLC-K1 promoter and transactivated the CLC-K1 promoter.
Although Bossone et al. reported that MAZ is expressed at lower levels
in the kidneys than in other tissues, we could confirm MAZ expression
in the kidneys by Northern analysis (data not shown). We also detected
its expression in all nephron segments, including the thin ascending
limb of Henle's loop, where CLC-K1 is expressed, and the thick
ascending limb of Henle's loop and the distal nephron segments, where
CLC-K2 is expressed. Based on these results, we speculated that MAZ
could be one of the transcription factors that activate the expression
of the CLC-K1 and CLC-K2 genes in vivo. On the other hand,
cotransfection of KKLF with MAZ appeared to block the strongly
activating effect of MAZ. The consensus sequence of the KKLF binding
site identified in this study, GGGGNGGNG, overlaps the consensus
sequence of the MAZ binding site, GGGGAGGGG. Accordingly, we
speculated that the MAZ binding competed with the KKLF binding, and we
confirmed this by EMSA (Fig. 2C). This finding suggests that the
interplay at the GA element between zinc finger proteins that repress
or activate transcription may constitute kidney-specific expression of
the CLC-K1 and CLC-K2 genes. Double immunostaining of KKLF and other marker proteins in rat inner medulla revealed that KKLF was present in
the nuclei of inner medullary collecting ducts and the thin descending
limb of Henle's loop, i.e., nephron segments where no expression of
CLC-K1 and CLC-K2 is observed. Given that KKLF is never expressed in
any of the cells or tissues where the expression of CLC-K1 and CLC-K2
is also absent, the combination of KKLF and MAZ alone may not account
for all of the mechanisms of kidney-specific expression of CLC-K1 and
CLC-K2. However, the spatial pattern of KKLF expression along the
nephron overlaps the negative expression of the CLC-K1 and CLC-K2, as
confirmed by RT-PCR analysis. Accordingly, KKLF might suppress CLC-K1
and CLC-K2 expression in inner medullary collecting ducts and the thin
descending limb of Henle's loop in vivo, thereby contributing to the
strict nephron segment-specific expression of CLC-K1 and CLC-K2. A
recent pool of evidence suggets that strict cell- and tissue-specific
gene expression is attained not by a single positive regulatory factor
but by a combination of activators and repressors. For example,
RINZF blocks the activating effect of SpI through the CACC
element of the gastrin promoter (33), and
-enolase
repressor factor 1, a Krüppel-like factor, can compete with other
positively regulating factors on the BEE-1 element of the
-enolase
gene (25). In agreement with these studies, the present
study revealed that the GA element, although originally identified as a
positive cis element, has both positive and negative effects
on the CLC-K1 promoter.
Apart from the Cys2-His2 zinc finger domains, the KKLF coding sequence
bears little resemblance to other reported zinc finger genes. For
example, there were no Krüppel, leucine zipper, Ets, or basic
helix-loop-helix domains. However, KKLF contains serine-rich or
proline-rich sequences, which are involved in the transactivation functions of many transcription factors (23) and are
considered typical features of repression motifs present in suppressor
factors like Krüppel and WT1 (18, 19). Since this
proline-rich sequence is shared by proteins closely related to KKLF,
namely, EKLF (22), LKLF (2), GKLF
(29), and BTEB2 (31), KKLF can be definitively classed a new Krüppel-like factor. In addition to these potential regulatory domains, there is a glutamic acid cluster at amino acid
residues 142 to 150 (EEIEEFLEE) in KKLF. Several reports have indicated
that a high charge is a common feature of repression motifs (4,
28, 38). On this basis, the glutamic acid cluster may be
considered a repressive element of KKLF.
Although we named this new Krüppel-like factor KKLF for
"kidney-enriched Krüppel like factor"), its expression is
actually most abundant in the liver and more prevalent in heart and
skeletal muscle than in the kidneys. Immunohistochemistry revealed that KKLF in the liver is present not in hepatocytes but in cells in the
sinusoid. The various cell types in the sinusoid include Kupffer cells,
stellate cells, and endothelial cells. Given that KKLF is not found in
the lymphoid tissues such as the lymph nodes and spleen, it is less
likely to be present in Kupffer cells. In fact, double staining of KKLF
with ED-2, a marker for Kupffer cells, showed that only a few
ED-2-positive cells were also KKLF positive. Most KKLF staining was
associated with desmin staining, clearly suggesting that the
KKLF-positive sinusoidal cells were stellate cells. KKLF was also
present in the subcapsular and portal fibroblasts, suggesting that KKLF
may be preferentially expressed in fibroblasts rather than in lymphoid
cells. This may be true in the heart and skeletal muscles. In the heart
and skeletal muscles, the stained nuclei appeared to be present between
the muscle fibers rather than in the muscle cells themselves. The
stained nuclei were not ED-2 positive, suggesting that the interstitial
cells in the heart and skeletal muscles were also fibroblasts. Also,
KKLF was apparently present in the interstitial cells in the kidney
cortex. Most of the cells in the interstitium of the kidney cortex were
fibroblasts and dendritic cells, cell types identified by
ecto-5'-nucleotidase and MHC-II markers, respectively (12).
Double immunostaining clearly revealed that KKLF-positive cells were
positive for ecto-5'-nucleotidase, suggesting that KKLF-positive cells
in the kidney cortex were also fibroblasts. The KKLF-positive cells in
the glomeruli were speculated to be mesangial cells, since mesangial
cells have properties similar to the stellate cells in the liver. As
expected, KKLF-positive nuclei were mostly associated with
desmin-positive mesangial matrix. These results suggest that KKLF may
play an important role in fibroblasts and other potentially fibrogenic
cells in the liver, heart, skeletal muscles, and kidneys. Zf9, a
Krüppel-like factor present in stellate cells in the liver,
transactivates a collagen
1(I) promoter (27) and is
speculated to be involved in hepatic fibrosis. c-Krox, a
Krüppel-like protein present in the skin, binds to the
GGGAGGG sequence in type I collagen genes (7). Ihn et al. reported that G-rich elements in the human
2(I) collagen promoter had repressor activity (11). Accordingly, it would be interesting to determine whether KKLF is involved in the regulation of collagen gene promoters. As shown in Fig. 8b, cotransfection of KKLF
significantly repressed the human type I collagen gene promoter. In
addition, KKLF expression was dramatically decreased in the UUO
kidneys, and after this decrease an abundant expression of type I
collagen was noted. This evidence implies that KKLF could function as a
repressor of type I collagen expression and an important regulator of
tissue fibrosis. The regulation of KKLF expression in the other
fibrosis models in other organs will help to confirm whether or not
this is true.
In summary, MAZ and a novel Krüppel-like factor, KKLF, were
cloned as GA element binding proteins. This study suggests that both
positively and negatively regulating zinc finger proteins may interact
at the GA element and may be involved in the strict transcriptional
control of the CLC-K1 and CLC-K2 genes. KKLF may also be involved in
the regulation of type I collagen expression in fibroblasts in vivo.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Second
Department of Internal Medicine, School of Medicine, Tokyo Medical and
Dental University, 1-5-45 Yushima Bunkyo, Tokyo 113-8519, Japan. Phone: 81-3-5803-5216. Fax: 81-3-5803-0172. e-mail:
suchida.med2{at}med.tmd.ac.jp.
 |
REFERENCES |
| 1.
|
Adachi, S.,
S. Uchida,
H. Ito,
M. Hata,
M. Hiroe,
F. Marumo, and S. Sasaki.
1994.
Two isoforms of a chloride channel predominantly expressed in thick ascending limb of Henle's loop and collecting ducts of rat kidney.
J. Biol. Chem.
269:17677-17683[Abstract/Free Full Text].
|
| 2.
|
Anderson, K. P.,
C. B. Kern,
S. C. Crable, and J. B. Lingrel.
1995.
Isolation of a gene encoding a functional zinc finger protein homologous to erythroid Kruppel-like factor: identification of a new multigene family.
Mol. Cell. Biol.
15:5957-5965[Abstract].
|
| 3.
|
Bossone, S. A.,
C. Asselin,
A. J. Patel, and K. B. Marcu.
1992.
MAZ, a zinc finger protein, binds to c-MYC and C2 gene sequences regulating transcriptional initiation and termination.
Proc. Natl. Acad. Sci. USA
89:7452-7456[Abstract/Free Full Text].
|
| 4.
|
Cowell, I. G., and H. C. Hurst.
1994.
Transcriptional repression by the human bZIP factor E4BP4: definition of a minimal repression domain.
Nucleic Acids Res.
22:59-65[Abstract/Free Full Text].
|
| 5.
|
Crossley, M.,
E. Whitelaw,
A. Perkin,
G. Williams,
Y. Fujiwara, and S. H. Orkin.
1996.
Isolation and characterization of the cDNA encoding BKLF/TEF-2, a mojor CACCC-box-binding protein in erythroid cells and selected other cells.
Mol. Cell. Biol.
16:1695-1705[Abstract].
|
| 6.
|
Duncan, D. D.,
A. Stupakoff,
S. M. Hedrick,
K. B. Marcu, and G. Siu.
1995.
A myc-associated zinc finger protein binding site is one of four important functional regions in the CD4 promoter.
Mol. Cell. Biol.
15:3179-3186[Abstract].
|
| 7.
|
Galera, P.,
R.-W. Park,
P. Ducy,
M.-G. Mattei, and G. Karsenty.
1996.
c-Krox binds to several sites in the promoter of both mouse type I collagen genes. Structure/function study and developmental expression analysis.
J. Biol. Chem.
271:21331-21339[Abstract/Free Full Text].
|
| 8.
|
Garrett-Sinha, L. A.,
H. Eberspaecher,
M. F. Seldin, and B. de Crombrugghe.
1996.
A gene for a novel zinc-finger protein expressed in differentiated epithelial cells and transiently in certain mesenchymal cells.
J. Biol. Chem.
271:31384-31390[Abstract/Free Full Text].
|
| 9.
|
Her, S.,
R. Ann Bell,
A. K. Bloom,
B. J. Siddall, and D. L. Wong.
1999.
Phenylethanolamine N-methyltransferase gene expression.
J. Biol. Chem.
274:8698-8707[Abstract/Free Full Text].
|
| 10.
|
Hughes, J., and R. J. Johnson.
1999.
Role of Fas (CD95) in tubulointerstitial disease induced by unilateral ureteric obstruction.
Am. J. Physiol. Ser. F
277:F26-F32[Abstract/Free Full Text].
|
| 11.
|
Ihn, H.,
K. Ohnishi,
T. Tamaki,
E. C. Leroy, and M. Trojanowska.
1996.
Transcriptional regulation of the human a2(I) collagen gene.
J. Biol. Chem.
271:26717-26723[Abstract/Free Full Text].
|
| 12.
|
Kaissling, B., and M. Le Her.
1994.
Characterization and distribution of interstitial cell types in the renal cortex of rats.
Kidney Int.
45:709-720[Medline].
|
| 13.
|
Kennedy, G. C., and W. J. Rutter.
1992.
Pur-1, a zinc-finger protein that binds to purine-rich sequences, transactivates an insulin promoter in heterologous cells.
Proc. Natl. Acad. Sci. USA
89:11498-11502[Abstract/Free Full Text].
|
| 14.
|
Klevit, R. E.
1991.
Recognition of DNA by Cys2,His2 zinc finger.
Science
253:1367[Free Full Text], 1393.
|
| 15.
|
Koritschoner, N. P.,
J. L. Bocco,
G. Panzetta-Dutari,
C. I. Dumur,
A. Flury, and L. C. Patrito.
1997.
A novel human zinc finger protein that interacts with the core promoter element of a TATA-box-less gene.
J. Biol. Chem.
272:9573-9580[Abstract/Free Full Text].
|
| 16.
|
Kozak, M.
1987.
At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells.
J. Mol. Biol.
196:947-950[CrossRef][Medline].
|
| 17.
|
Kozak, M.
1989.
The scanning model for translation: an update.
J. Cell Biol.
108:229-241[Abstract/Free Full Text].
|
| 18.
|
Licht, J. D.,
M. J. Grossel,
J. Figge, and U. M. Hansen.
1990.
Drosophila Kruppel protein is a transcriptional repressor.
Nature
346:76-79[CrossRef][Medline].
|
| 19.
|
Madden, S. L.,
D. M. Cook, and F. J. Rauscher.
1993.
A structure-function analysis of transcriptional repression mediated by the WT1, Wilms' tumor suppressor protein.
Oncogene
8:1713-1720[Medline].
|
| 20.
|
Matsumoto, N.,
L. Friedrich,
R. Aldabe,
W. Zhang,
F. Ramirez,
T. Yoshida, and M. Terada.
1998.
Cloning of the cDNA for a new human zinc finger protein defines a group of closely related Kruppel-like transcription factors.
J. Biol. Chem.
273:28229-28237[Abstract/Free Full Text].
|
| 21.
|
Matsumura, Y.,
S. Uchida,
Y. Kondo,
H. Miyazaki,
S. B. H. Ko,
A. Hayama,
T. Morimoto,
W. Liu,
M. Arisawa,
S. Sasaki, and F. Marumo.
1999.
Overt nephrogenic diabetes insipidus in mice lacking the CLC-K1 chloride channel.
Nat. Genet.
21:95-98[CrossRef][Medline].
|
| 22.
|
Miller, I. J., and J. J. Bieker.
1993.
A novel, erythroid cell-specific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins.
Mol. Cell. Biol.
13:2776-2786[Abstract/Free Full Text].
|
| 23.
|
Nakamura, T.,
H. Alder,
Y. Gu,
R. Prasad,
O. Canaani,
N. Kamada,
R. P. Gale,
B. Lange,
W. M. Crist,
P. C. Nowell,
C. M. Croce, and E. Canaani.
1993.
Genes on chromosomes 4, 9, and 19 involved in 11q23 abnormalities in acute leukemia share sequence homology and/or common motifs.
Proc. Natl. Acad. Sci. USA
90:4631-4635[Abstract/Free Full Text].
|
| 24.
|
Parks, C. L., and T. Shenk.
1996.
The serotonin 1a receptor gene contains a TATA-less promoter that responds to MAZ and SpI.
J. Biol. Chem.
271:4417-4430[Abstract/Free Full Text].
|
| 25.
|
Passantino, R.,
V. Antona,
G. Barbieri,
P. Rubino,
R. Melchionna,
G. Cossu,
S. Feo, and A. Giallongo.
1998.
Negative regulation of b enolase gene transcription in embryonic muscle is dependent upon a zinc finger factor that binds to the G-box within the muscle-specific enhancer.
J. Biol. Chem.
273:484-494[Abstract/Free Full Text].
|
| 26.
|
Rai, T.,
S. Uchida,
S. Sasaki, and F. Marumo.
1999.
Isolation and characterization of kidney-specific CLC-K2 chloride channel gene promoter.
Biochem. Biophys. Res. Commun.
261:432-438[CrossRef][Medline].
|
| 27.
|
Ratziu, V.,
A. Lalazar,
L. Wong,
Q. Dang,
C. Collins,
E. Shaulian,
S. Jensen, and S. L. Friedman.
1998.
Zf9, a Kruppel-like transcription factor up-regulated in vivo during early hepatic fibrosis.
Proc. Natl. Acad. Sci. USA
95:9500-9505[Abstract/Free Full Text].
|
| 28.
|
Saha, S.,
J. M. Brickman,
N. Lehming, and M. Ptashne.
1993.
New eukaryotic transcriptional repressors.
Nature
363:642-652.
|
| 29.
|
Shields, J. M.,
R. J. Christy, and V. W. Yang.
1996.
Identification and characterization of a gene encoding a gut-enriched Kruppel-like factor expressed during growth arrest.
J. Biol. Chem.
271:20009-20017[Abstract/Free Full Text].
|
| 30.
|
Simon, D. B.,
R. S. Bindra,
T. A. Mansfield,
C. Nelson-Williams,
E. Mendonca,
R. Stone,
S. Schurman,
A. Nayir,
H. Alpay,
A. Bakkaloglu,
J. Rodriguez-Soriano,
J. M. Morales,
S. A. Sanjad,
C. M. Taylor,
D. Pilz,
A. Brem,
H. Trachtman,
W. Griswold,
G. A. Richard,
E. John, and R. P. Lifton.
1997.
Mutations in the chloride channel gene, CLCNKB, cause Bartter's syndrome type III.
Nat. Genet.
17:171-178[CrossRef][Medline].
|
| 31.
|
Sogawa, K.,
H. Imataka,
Y. Yamasaki,
H. Kusume, and Y. Fujii-Kuriyama.
1993.
cDNA cloning and transcriptional properties of a novel GC box-binding protein, BTEB2.
Nucleic Acids Res.
21:1527-1532[Abstract/Free Full Text].
|
| 32.
|
Terada, Y.,
K. Tomita,
H. Nonoguchi, and F. Marumo.
1992.
Polymerase chain reaction localization of constitutive nitric oxide synthase and soluble guanylate cyclase messenger RNAs in microdissected rat nephron segments.
J. Clin. Investig.
90:659-665.
|
| 33.
|
Tillotson, L. G.
1999.
RIN ZF, a novel zinc finger gene, encodes proteins that bind to the CACC element of the gastrin promoter.
J. Biol. Chem.
274:8123-8128[Abstract/Free Full Text].
|
| 34.
|
Uchida, S.,
T. Rai,
H. Yatsushige,
Y. Matsumura,
M. Kawasaki,
S. Sasaki, and F. Marumo.
1998.
Isolation and characterization of kidney-specific ClC-K1 chloride channel gene promoter.
Am. J. Physiol.
274:F602-F610.
|
| 35.
|
Uchida, S.,
S. Sasaki,
T. Furukawa,
M. Hiraoka,
T. Imai,
Y. Hirata, and F. Marumo.
1993.
Molecular cloning of a chloride channel that is regulated by dehydration and expressed predominantly in kidney medulla.
J. Biol. Chem.
268:3821-3824[Abstract/Free Full Text].
|
| 36.
|
Uchida, S.,
S. Sasaki,
K. Nitta,
K. Uchida,
S. Horita,
H. Nihei, and F. Marumo.
1995.
Localization and functional characterization of rat kidney-specific chloride channel, CLC-K1.
J. Clin. Investig.
95:104-113.
|
| 37.
|
Vandewalle, A.,
F. Cluzeaud,
M. Bens,
S. Kieferle,
K. Steinmeyer, and T. J. Jentsch.
1997.
Localization and induction by dehydration of ClC-K chloride channels in the rat kidney.
Am. J. Physiol. Ser. F
272:F678-F688[Abstract/Free Full Text].
|
| 38.
|
Witzgall, R.,
E. O'Leary,
A. Leaf,
D. Onaldi, and J. V. Bonventre.
1994.
The Kruppe-associated box-A (KRAB-A) domain of zinc finger proteins mediates transcriptional repression.
Proc. Natl. Acad. Sci. USA
91:4514-4518[Abstract/Free Full Text].
|
| 39.
|
Yoshikawa, M.,
S. Uchida,
A. Yamauchi,
A. Miyai,
Y. Tanaka,
S. Sasaki, and F. Marumo.
1999.
Localization of rat CLC-K2 chloride channel mRNA in the kidney.
Am. J. Physiol.
276:F552-F558[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 2000, p. 7319-7331, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Adler, L., Efrati, E., Zelikovic, I.
(2008). Molecular mechanisms of epithelial cell-specific expression and regulation of the human anion exchanger (pendrin) gene. Am. J. Physiol. Cell Physiol.
294: C1261-C1276
[Abstract]
[Full Text]
-
Natesampillai, S., Kerkvliet, J., Leung, P. C. K., Veldhuis, J. D.
(2008). Regulation of Kruppel-like factor 4, 9, and 13 genes and the steroidogenic genes LDLR, StAR, and CYP11A in ovarian granulosa cells. Am. J. Physiol. Endocrinol. Metab.
294: E385-E391
[Abstract]
[Full Text]
-
Fisch, S., Gray, S., Heymans, S., Haldar, S. M., Wang, B., Pfister, O., Cui, L., Kumar, A., Lin, Z., Sen-Banerjee, S., Das, H., Petersen, C. A., Mende, U., Burleigh, B. A., Zhu, Y., Pinto, Y. M., Liao, R., Jain, M. K.
(2007). Kruppel-like factor 15 is a regulator of cardiomyocyte hypertrophy. Proc. Natl. Acad. Sci. USA
104: 7074-7079
[Abstract]
[Full Text]
-
Malakooti, J., Sandoval, R., Memark, V. C., Dudeja, P. K., Ramaswamy, K.
(2005). Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate. Am. J. Physiol. Gastrointest. Liver Physiol.
289: G653-G663
[Abstract]
[Full Text]
-
Mori, T., Sakaue, H., Iguchi, H., Gomi, H., Okada, Y., Takashima, Y., Nakamura, K., Nakamura, T., Yamauchi, T., Kubota, N., Kadowaki, T., Matsuki, Y., Ogawa, W., Hiramatsu, R., Kasuga, M.
(2005). Role of Kruppel-like Factor 15 (KLF15) in Transcriptional Regulation of Adipogenesis. J. Biol. Chem.
280: 12867-12875
[Abstract]
[Full Text]
-
Efrati, E., Arsentiev-Rozenfeld, J., Zelikovic, I.
(2005). The human paracellin-1 gene (hPCLN-1): renal epithelial cell-specific expression and regulation. Am. J. Physiol. Renal Physiol.
288: F272-F283
[Abstract]
[Full Text]
-
Ray, A., Kumar, D., Ray, P., Ray, B. K.
(2004). Transcriptional Activity of Serum Amyloid A-activating Factor-1 Is Regulated by Distinct Functional Modules. J. Biol. Chem.
279: 54637-54646
[Abstract]
[Full Text]
-
Otteson, D. C., Liu, Y., Lai, H., Wang, C., Gray, S., Jain, M. K., Zack, D. J.
(2004). Kruppel-like Factor 15, a Zinc-Finger Transcriptional Regulator, Represses the Rhodopsin and Interphotoreceptor Retinoid-Binding Protein Promoters. IOVS
45: 2522-2530
[Abstract]
[Full Text]
-
Yamamoto, J., Ikeda, Y., Iguchi, H., Fujino, T., Tanaka, T., Asaba, H., Iwasaki, S., Ioka, R. X., Kaneko, I. W., Magoori, K., Takahashi, S., Mori, T., Sakaue, H., Kodama, T., Yanagisawa, M., Yamamoto, T. T., Ito, S., Sakai, J.
(2004). A Kruppel-like factor KLF15 Contributes Fasting-induced Transcriptional Activation of Mitochondrial Acetyl-CoA Synthetase Gene AceCS2. J. Biol. Chem.
279: 16954-16962
[Abstract]
[Full Text]
-
Ray, A., Ray, P., Guthrie, N., Shakya, A., Kumar, D., Ray, B. K.
(2003). Protein Kinase A Signaling Pathway Regulates Transcriptional Activity of SAF-1 by Unmasking Its DNA-binding Domains. J. Biol. Chem.
278: 22586-22595
[Abstract]
[Full Text]
-
Auzanneau, C., Thoreau, V., Kitzis, A., Becq, F.
(2003). A Novel Voltage-dependent Chloride Current Activated by Extracellular Acidic pH in Cultured Rat Sertoli Cells. J. Biol. Chem.
278: 19230-19236
[Abstract]
[Full Text]
-
Ray, B. K., Murphy, R., Ray, P., Ray, A.
(2002). SAF-2, a Splice Variant of SAF-1, Acts as a Negative Regulator of Transcription. J. Biol. Chem.
277: 46822-46830
[Abstract]
[Full Text]
-
Gray, S., Feinberg, M. W., Hull, S., Kuo, C. T., Watanabe, M., Sen-Banerjee, S., DePina, A., Haspel, R., Jain, M. K.
(2002). The Kruppel-like Factor KLF15 Regulates the Insulin-sensitive Glucose Transporter GLUT4. J. Biol. Chem.
277: 34322-34328
[Abstract]
[Full Text]
-
Higaki, Y., Schullery, D., Kawata, Y., Shnyreva, M., Abrass, C., Bomsztyk, K.
(2002). Synergistic activation of the rat laminin {gamma}1 chain promoter by the gut-enriched Kruppel-like factor (GKLF/KLF4) and Sp1. Nucleic Acids Res
30: 2270-2279
[Abstract]
[Full Text]
-
Yoshida, T., Yoshino, J., Hayashi, M., Saruta, T.
(2002). Identification of a Renal Proximal Tubular Cell-Specific Enhancer in the Mouse 25-Hydroxyvitamin D 1{alpha}-Hydroxylase Gene. J. Am. Soc. Nephrol.
13: 1455-1463
[Abstract]
[Full Text]
-
Jentsch, T. J., Stein, V., Weinreich, F., Zdebik, A. A.
(2002). Molecular Structure and Physiological Function of Chloride Channels. Physiol. Rev.
82: 503-568
[Abstract]
[Full Text]
-
Zhang, F., Nakanishi, G., Kurebayashi, S., Yoshino, K., Perantoni, A., Kim, Y.-S., Jetten, A. M.
(2002). Characterization of Glis2, a Novel Gene Encoding a Gli-related, Kruppel-like Transcription Factor with Transactivation and Repressor Functions. ROLES IN KIDNEY DEVELOPMENT AND NEUROGENESIS. J. Biol. Chem.
277: 10139-10149
[Abstract]
[Full Text]
-
Ray, A., Yu, G.-Y., Ray, B. K.
(2002). Cytokine-Responsive Induction of SAF-1 Activity Is Mediated by a Mitogen-Activated Protein Kinase Signaling Pathway. Mol. Cell. Biol.
22: 1027-1035
[Abstract]
[Full Text]
-
Ray, B. K., Chen, J., Ray, A.
(20