Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7353-7362, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Control of hnRNP A1 Alternative Splicing: an Intron
Element Represses Use of the Common 3' Splice Site
Martin J.
Simard and
Benoit
Chabot*
Département de Microbiologie et
d'Infectiologie, Faculté de Médecine, Université de
Sherbrooke, Sherbrooke, Québec, Canada J1H 5N4
Received 29 November 1999/Returned for modification 14 January
2000/Accepted 10 July 2000
 |
ABSTRACT |
Alternative splicing of exon 7B in the hnRNP A1 pre-mRNA produces
mRNAs encoding two proteins: hnRNP A1 and the less abundant A1B. We
have reported the identification of several intron elements that
contribute to exon 7B skipping. In this study, we report the activity
of a novel element, conserved element 9 (CE9), located in the intron
downstream of exon 7B. We show that multiple copies of CE9 inhibit exon
7B-exon 8 splicing in vitro. When CE9 is inserted between two competing
3' splice sites, a single copy of CE9 decreases splicing to the distal
3' splice site. Our in vivo results also support the conclusion that
CE9 is a splicing modulator. First, inserting multiple copies of CE9
into an A1 minigene compromises the production of fully spliced
products. Second, one copy of CE9 stimulates the inclusion of a short
internal exon in a derivative of the human
-globin gene. In this
case, in vitro splicing assays suggest that CE9 decreases splicing of
intron 1, an event that improves splicing of intron 2 and decreases
skipping of the short internal exon. The ability of CE9 to act on
heterologous substrates, combined with the results of a competition
assay, suggest that the activity of CE9 is mediated by a
trans-acting factor. Our results indicate that CE9
represses the use of the common 3' splice site in the hnRNP A1
alternative splicing unit.
 |
INTRODUCTION |
Alternative RNA splicing is a
crucial event in the expression of many eucaryotic genes transcribed by
RNA polymerase II. Regulation of alternative splicing plays a key role
in the production of distinct protein isoforms during development and
in different cell types. Although the mechanisms that control splice
site selection in mammalian cells remain poorly understood, recent
progress indicates that a variety of sequence elements within precursor
mRNAs can have positive or negative effects on splice site recognition
and pairing (reviewed in references 5, 13, and
43). A class of elements called splicing enhancers
stimulate the use of splice sites. Many of these sequences are bound by
proteins that are part of the SR family of splicing factors
(45). The binding of SR proteins to exonic enhancer elements
can increase U2AF65 or U2 snRNP binding to an upstream 3'
splice site region (38, 42, 57, 60). Because SR proteins can
also improve the binding of U1 snRNP to 5' splice sites (29,
40), it is assumed that enhancer elements located near a 5'
splice site may also facilitate the stable recruitment of U1 snRNP
(9, 20, 28, 36). When located directly in a 3' splice site
region, a binding site for SR protein can impair U2 snRNP binding
(39), indicating that the position of the SR protein binding
site is crucial to determining whether the site will act as an
activator or a repressor.
Elements that repress splice site utilization have also been uncovered
in mammalian pre-mRNAs. Some silencer elements act by forming a duplex
structure that impairs splice site recognition (7, 17, 19, 30,
37). Other negative elements require the contribution of
trans-acting factors. While the binding of the
polypyrimidine tract-binding protein has been linked to enhancer function in one case (44), polypyrimidine tract-binding
protein binding to intronic elements has generally been
associated with splicing inhibition (58, 63).
Recently, the hnRNP A1 protein has been implicated in the activity
of silencer elements located in the alternative exon of fibroblast
growth factor receptor 2 (24) and the human immunodeficiency
virus tat exon 2 (11). While additional silencer
elements have been uncovered in other mammalian pre-mRNAs, the
mechanisms by which they inhibit splicing are not understood (8,
50, 51, 56). Interestingly, the binding of hnRNP A1
proteins to intron elements can modulate 5' splice site utilization
without affecting 5' splice site recognition (8, 15). In
this case, an interaction between bound A1 proteins has been proposed
to bring into close proximity distant splicing partners (8).
While it is clear that several regulatory elements can affect the
recognition of splicing signals, several studies now suggest that
proper control of a single alternative splicing event requires coordination between distinct elements and factors (1, 3, 8, 10,
12, 19, 20, 22, 23, 31, 33, 35, 41, 48, 53, 56, 59). The
convergence of many elements acting on a single splicing event may be
essential to modulate pre-mRNA splicing in response to a large variety
of tissue-specific effectors and developmental cues.
We are using the hnRNP A1 gene as a model system to study the control
of alternative splicing. This gene produces two different mRNAs,
encoding the A1 (34 kDa) and A1B (38 kDa) proteins. These two mRNAs are
produced by the exclusion and inclusion of exon 7B, respectively.
Sequence alignment between the mouse and human hnRNP A1 genes has
revealed several conserved regions in the introns flanking exon 7B.
Previous results have shown that at least four elements influence the
alternative splicing of exon 7B (7, 8, 15). In this study,
we report the activity of an intron sequence called conserved element 9 (CE9). Our results show that CE9 is a silencer element that can repress
the use of a variety of downstream 3' splice sites, including the 3'
splice site of hnRNP A1 exon 8. We discuss the role of this novel
element in the control of hnRNP A1 pre-mRNA splicing.
 |
MATERIALS AND METHODS |
Plasmid constructs.
To insert multiple copies of CE9 we used
an oligonucleotide with a mutated HindIII site, the CE9
sequence, a HindIII site, and an EcoRV site.
A partial duplex form of this oligonucleotide was inserted in between
the HindIII and EcoRV sites of pBluescript II
KS(+). Thereafter, additional CE9 oligonucleotides were inserted to
produce pK9-2x and pK9-3x. pA was constructed by inserting a
HincII-EcoRV fragment of pK9-2x and pK9-3x into
the StuI site of pSPAdStu (42). To generate
pB
, pK78A1 was digested with StuI and HincII
and self-ligated. To construct pB derivatives, the
HincII-EcoRV fragments of pK9 derivatives were
inserted between the StuI and HincII sites of
pK78A1 (14). pC3'
/9 was constructed by reinserting the
reannealed CE9 oligonucleotides (38 bp) into the EcoRV site
of pC3'
/
(6). To produce pmA1
9, the
StuI-BbsI fragment of STE (7) was
inserted into pmA1
STE, which had been previously cut with
StuI and HincII. pmA1-3x and pmA1-3x
were generated by insertion of a HincII and EcoRV
fragment, taken from pK9-3x, into a pmA1 derivative lacking CE9 and
previously digested with MscI. To produce DUP derivatives,
oligonucleotides were inserted into DUP4-1 and DUP5-1 (kindly provided
by E. Modafferi and D. Black [49]), which had been
previously digested with ApaI or BglII and
treated with T4 DNA polymerase or Klenow, respectively. Derivatives
used for in vitro splicing studies were made by inserting the
BamHI-SacI fragment from DUP constructs into
pBluescript II KS(+) previously cut with BamHI and
SacI. To generate pKCE9 and derivatives, pBluescript II
KS(+) was cut with HincII, and reannealed oligonucleotides
were inserted at this site. All constructs were verified by extensive
restriction enzyme digestion analysis and DNA sequencing when appropriate.
Transfection assays.
Transfection of HeLa cells with
different constructs of DUP was accomplished using 20 µg of Dosper
liposomal transfection reagent (Boehringer Mannheim). For pmA1
derivatives, transfection in HeLa cells was performed using the
standard calcium phosphate coprecipitation procedure. At 48 h
posttransfection, total RNA was extracted using the guanidine
hydrochloride procedure (14).
RNA analysis.
Primer extension analysis was performed on
total RNA essentially as described by Modafferi and Black
(49). The reactions were run on a 5% denaturing gel (38:2
acrylamide-bisacrylamide, 8 M urea, 1× Tris-borate-EDTA) in 1×
Tris-borate-EDTA buffer. For pmA1 derivatives, reverse transcription
(RT)-PCR was performed as described previously (61). The
oligonucleotides used in this assay were CMV-1 (15), A1E9
(8), and A1E7 (TGCCAAATCCATTATAGCCA). RT-PCR
assays on the endogenous
-actin mRNA were performed by using
oligonucleotides AC-1 (GGAGCATTTGCGGTGGACGAT) and AC-2 (ACCACCATGTACCCTGGCATT).
In vitro transcription and splicing assays.
All derived DUP
substrates were produced from pBluescript-based plasmids linearized
with BamHI and transcribed with T7 RNA polymerase (Amersham
Pharmacia Biotech) in the presence of cap analog and
[
-32P]UTP (Amersham Pharmacia Biotech). The A RNA and
derivatives were obtained from plasmids linearized with
HincII. C3'
/
and C3'
/9 RNAs were obtained from
plasmids linearized with ScaI. B RNA and derivatives were
obtained from plasmids linearized with BamHI. Transcription
was accomplished with T3 or SP6 RNA polymerase (Amersham Pharmacia
Biotech). CE9 and K(+) RNAs were produced from plasmids linearized with
ClaI and transcribed with T3 RNA polymerase. Cold RNAs were
produced as described above except that the relative amount of
[
-32P]UTP was reduced 2,000-fold. The purification of
all RNA molecules was performed as described by Chabot (14).
HeLa nuclear extracts were prepared (25) and used in
splicing reactions as previously described (15).
Identification of lariat molecules and other splicing products was
confirmed by performing debranching reactions in S100 extracts
(20) followed by gel migration relative to molecular weight
standards. The competition assay was performed by preincubating the
splicing mixture with cold competitor RNAs for 10 min at 30°C prior
to addition of the radiolabeled RNA substrate.
Gel shift assays.
For complex formation, we used the
procedure described by Das and Reed (21). Some of the
extracts used for splicing complex formation were treated with RNase H
and oligonucleotides as described by Black et al. (6). The
oligonucleotides used for these experiments were U2A
(GGCCGAGAAGCGAT) and U4A (CCACTGCGCAAAGCT).
 |
RESULTS |
To address the molecular mechanisms controlling the alternative
splicing of the hnRNP A1 pre-mRNA, we are investigating the contribution of sequence elements located in the introns flanking alternative exon 7B. The rationale for selecting intron elements is
based on their high degree of sequence conservation between the mouse
and human hnRNP A1 genes. Each of the four intron elements that have
been analyzed so far have demonstrated an effect on the alternative
splicing of exon 7B: CE6 base-pairs with the 5' splice site region of
exon 7B to decrease its use (7), CE4m represses the 3'
splice site of exon 7B (8), and hnRNP A1 binding sites
located in each of the introns flanking exon 7B promote exon 7B
skipping (8, 15). Here, we focus on CE9, which is located in
the intron downstream of exon 7B. The 38-nucleotide (nt)-long CE9 is
located 119 nt upstream from the 3' splice site of exon 8 in the hnRNP
A1 pre-mRNA (Fig. 1).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of the downstream portion of
the hnRNP A1 alternative splicing unit, with the length indicated in
nucleotides. An alignment between the mouse and the human sequences
from the middle of the intron to a portion of exon 8 is shown. The
sequence of CE9 is underlined.
|
|
CE9 represses a downstream 3' splice site in vitro.
To
determine whether CE9 can affect splicing, we tested the effect of
deleting CE9 from the intron of a simple exon 7B-exon 8 pre-mRNA.
Compared to the pre-mRNA containing CE9, no significant difference in
splicing efficiency was observed following a time course incubation in
a HeLa nuclear extract (Fig. 2A, lanes 1 through
8). Because the effect of weak elements
can be difficult to detect in vitro, we tested the effect of inserting
several copies of the element in the single intron construct. This
approach often reveals the activity of weak elements in vitro and in
vivo (for examples, see references 4, 34, 46, 48,
and 49). Compared to the insertion of complementary
sequences in the pre-mRNA lacking CE9 (B2x
and B3x
) (Fig. 2A,
lanes 11 and 12), two or three copies of CE9 completely inhibited
splicing (B2x and B3x) (Fig. 2A, lanes 9 and 10). Lack of splicing was
not due to the presence of a nonspecific inhibitor in the B2x and B3x
RNA preparations, since coincubation with B2x
and B3x
RNAs did
not compromise splicing activity (Fig. 2A, lanes 13 and 14). Copies of
CE9 were also inserted in an adenovirus model pre-mRNA (Fig. 2B). The
presence of two or three copies of CE9 inhibited in vitro splicing
(Fig. 2B, lanes 2 and 3), whereas the insertion of two or three copies of complementary sequences was not inhibitory (Fig. 2B, lanes 4 and 5).
Thus, the presence of at least two copies of CE9 can inhibit the in
vitro splicing of the intron normally separating exon 7B from exon 8. Moreover, multiple copies of CE9 can inhibit the splicing of a
heterologous intron.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
CE9 inhibits in vitro splicing. (A) The structures of
pre-mRNA B and B , as well as derivatives containing multiple copies
of CE9 or complementary sequences, are shown at the top. The distance
of the insertion point to the 3' splice site (ss) is indicated in
nucleotides. Note that the CE6 element is absent from all pre-mRNAs.
Labeled pre-mRNAs were incubated in HeLa nuclear extracts for the times
indicated for B and B RNAs or for 2 h for multiple inserts.
Splicing products were run on an 11% acrylamide-8 M urea gel.
Mixtures containing two different RNAs were analyzed to rule out the
presence of a nonspecific inhibitor in the B2x and B3x RNA preparations
(lanes 13 and 14). (B) Copies of CE9 or complementary sequences were
inserted into a pre-mRNA substrate derived from the adenovirus (Ad)
major late transcription unit (A RNA). The labeled splicing products
were resolved on a 7% acrylamide-8 M urea gel. Because mRNA products
were obscured by the degradation of the pre-mRNAs, only the portion of
the gels that indicates the pre-mRNAs and lariat products is shown.
|
|
An approach that is more sensitive to the activity of weak elements
relies on the use of pre-mRNAs containing alternative
splice sites (for
examples, see references
8,
15, and
52).
Moreover, this approach has the advantage of
simultaneously addressing
the ability of the element to modulate splice
site selection.
To analyze this activity for CE9, we used a model
pre-mRNA carrying
the two 3' splice sites competing for a single 5'
splice site
(C3'

/

RNA) (
8). This pre-mRNA is spliced to
each 3' splice
site with approximately equivalent efficiency (Fig.
3B,
lane 2).
Inserting one copy of CE9
between the two 3' splice sites repressed
the use of the distal site
(C3'

/9 RNA [Fig.
3B, lane 1]). Adding
two or three copies of CE9
gave the same effect, with no reduction
in total splicing efficiency
(data not shown). Insertion of unrelated
sequences of the same length
had no effect on 3' splice site selection,
ruling out a distance effect
(data not shown, but see reference
8). CE9 did not
influence 5' splice site selection when positioned
between the 5'
splice sites of exon 7 and exon 7B (data not shown).
Given that
multiple copies of CE9 inhibit the splicing of one-intron
pre-mRNAs
(Fig.
2), these results suggest that CE9 is a silencer
element and that
one copy of CE9 can repress the use of a downstream
3' splice site in a
model pre-mRNA carrying competing 3' splice
sites.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
CE9 represses the utilization of a downstream 3' splice
site (ss). (A) Schematic representation of pre-mRNAs containing
competing 3' splice sites. The position of CE9 is indicated, as is its
distance from the 3' splice site, in nucleotides. Ad, adenovirus. (B)
Labeled pre-mRNAs were incubated in a HeLa nuclear extract for 2 h. Splicing products were fractionated on an 11% acrylamide-8 M urea
gel. The positions of the lariat products generated from the use of the
distal (Ad) or the proximal (7B) 3' splice site are indicated.
|
|
CE9 affects splicing in vivo.
To determine whether CE9 has the
same activity in vivo, we tested the effect of deleting CE9 or
inserting several copies of CE9 into an hnRNP A1 minigene. The
wild-type A1 minigene was spliced to yield predominantly the skipped A1
isoform, as judged by an RT-PCR assay (Fig.
4A, lanes 3 and 8) (7, 8, 15).
The deletion of CE9 did not affect the frequency of exon 7B inclusion (Fig. 4A, lane 4). We then tested the effect of adding several copies
of CE9 into pmA1
9. In comparison to a control construct carrying
three copies of the complementary sequence of CE9 (pmA1-3x
) (Fig.
4A, lane 11), three copies of CE9 (pmA1-3x) promoted a large decrease
in the accumulation of spliced products (Fig. 4A, lane 10). This effect
was seen in three independent transfection assays (data not shown). The
lack of signal was not due to RNA degradation or to a nonspecific
inhibitor of RT-PCR, since the signal corresponding to the actin mRNA
was obtained by coamplification in all samples (Fig. 4A, lanes 8 to
11). Moreover, a separate RT-PCR assay performed with the CMV-1 and
A1E7 oligonucleotides indicated that splicing had occurred normally
between exon 5 and exon 7 (Fig. 4A, lanes 12 to 16), ruling out a
general problem of expression with pmA1-3x. The absence of products
with the CMV-1-A1E9 pair of oligonucleotides may mean that an RNA
missing exon 9 is produced. Alternatively, if the intron separating
exon 7B from exon 8 is retained, the formation of a very stable
secondary structure between the CE6 element and the 5' splice site of
exon 7B (6) may prevent progression by reverse transcriptase
and hence affect the accumulation of amplified products. In any case,
the results indicate that the CE9 elements have locally perturbed
splicing, consistent with the predicted outcome for a splicing
repressor element.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 4.
CE9 affects splicing in vivo. (A) CE9 prevents
the production of fully spliced mRNAs. A genomic portion of the murine
A1 gene was expressed in HeLa cells using the CMV-1 promoter. The
relative position of CE9 is indicated, as well as the position of the
oligonucleotides used for the RT-PCR assays performed on total RNA
isolated 48 h posttransfection. A derivative carrying a deletion
of CE9 was used (pmA1 9 [lane 4]). Three copies of CE9 or three
copies of the complementary sequence of CE9 were inserted into pmA1 9
(pmA1-3x or pmA1-3x , respectively). Reconstructed A1 or A1B cDNAs
were used as controls in PCR assays (lanes 1, 2, 5, 6, and 12). RT-PCR
amplification of the endogenous -actin mRNA was performed
independently on a mock transfection (lane 7) or simultaneously with
the A1 minigene analysis with oligonucleotides CMV-1 and A1E9 (lanes 8 to 11). A separate RT-PCR assay was carried out with the CMV-1 and A1E7
oligonucleotides (lanes 12 to 16). The number of cycles used in the
amplification rounds is indicated above the lanes. (B) Schematic
representation of the DUP constructs and derivatives. The length of the
central exon for DUP 4-1 and DUP 5-1 is indicated. The transcription
start site is indicated by an arrow. The distance between the different
cloning sites and the central exon is indicated. The arrow below exon 3 represents the oligonucleotide used for primer extension analysis. The
RNA versions of the different oligonucleotides cloned into the DUP
plasmids are shown at the bottom. (C) CE9 promotes the inclusion of
artificial globin exon in vivo. DUP expression was analyzed by primer
extension. Plasmid names are indicated above each lane. Each DUP 4-1, DUP 5-1, or derivative was generated by inserting oligonucleotides at
the ApaI site, except for D4-CE9(BglII), for
which BglII in the downstream intron was used (lane 8).
Extension products were loaded onto a 5% acrylamide-8 M urea. The
slightly abnormal migration of the 1-3 product in lane 8 is a gel
artifact.
|
|
The lack of an effect associated with the deletion of CE9 may be due to
the presence of redundant elements in the A1 pre-mRNA.
Redundancy in
sequence elements that affect the alternative splicing
of the
neurospecific c-
src exon has also complicated the analysis
of individual elements in their natural context (
48,
49).
A
strategy to assess the potential effect of individual elements
in vivo
is to insert them into a heterologous alternative splicing
unit. An
artificial human

-globin minigene has been used for
this purpose
(DUP4-1) (Fig.
4B) (
48,
49). This reporter gene
contains an
internal exon of 33 nt which is skipped at a frequency
of >95%
following expression in HeLa cells (
27). Whereas exclusion
of the internal exon is attributed to the proximity of the abutting
3'
and 5' splice sites, it remains unclear whether this proximity
prevents
exon definition or hinders the simultaneous assembly
of spliceosomes on
flanking introns (
26,
27). Exon inclusion
is assessed by
performing a primer extension assay on total RNA
isolated 48 h
posttransfection. As shown in Fig.
4C, insertion
of one copy of CE9 in
the upstream intron promoted inclusion of
the internal exon (20%
inclusion [lane 3]). Insertion of the complementary
sequence of CE9
at the same position had a modest effect (9% inclusion
[lane 6]),
and insertion of CE9 in the downstream intron had no
effect (<5%
inclusion [lane 8]). The insertion of CE9 in a similar
construct
containing an internal exon of 51 nt also stimulated
exon inclusion in
vivo (DUP5-1 [lanes 13 and 14]).
To better characterize the sequences within CE9 that are responsible
for this activity, we tested the activity of the first
23 nt and the
last 13 nt of CE9 (CE9A and CE9B, respectively).
CE9A promoted exon
inclusion of the DUP4-1 exon almost as efficiently
as the complete CE9
element, whereas CE9B was slightly less efficient
at promoting
inclusion of the internal exon (17 and 13% inclusion
[Fig.
4B, lanes
11 and 12, respectively]). A derivative of CE9A,
CE9A

4, which lacks
4 nt near the 3' end of CE9A, was at least
as efficient as CE9 at
promoting inclusion of the internal exon
(30% inclusion [Fig.
4C,
lane 4]). Finally, the first 12 nt of
CE9 retained the ability to
promote inclusion of the globin internal
exon (25% inclusion [lane
5]). An insert carrying a portion of
the complementary sequence of CE9
did not promote exon inclusion
(<5% inclusion [lane 7]). Our in
vivo results indicate that at
least two regions of CE9 can affect the
alternative splicing of
DUP4-1 (CE9A and CE9B). However, the first 12 nt of CE9A possess
the ability to stimulate the inclusion of the
internal globin
exon as efficiently as the complete CE9
element.
CE9 can relieve interference of closely positioned splice
sites.
If exclusion of the internal globin exon is caused by poor
exon definition, improving splice site recognition should reduce exon
skipping, consistent with the observations of Dominski and Kole
(26). On the other hand, if exon skipping is due to steric interference between closely positioned splice sites, reducing the rate
of spliceosome assembly on the first intron may improve spliceosome
assembly on the second intron and should also lead to more efficient
inclusion of the internal exon in vivo. Thus, the more frequent
inclusion of the short globin exon could be due to either an enhancer
or a silencer element. To verify whether more efficient inclusion of
the central globin exon was due to the silencer activity of CE9,
we monitored the in vitro splicing of labeled pre-mRNAs produced
from DUP4-1 and derivatives (D4-CE9 and D4-CE9
). The identity
of each band in Fig. 5B was confirmed by
gel purifying each RNA species, submitting it to a debranching reaction in a HeLa 100 extract, and assessing its size
relative to length markers (data not shown). The splicing
profile of the DUP4-1 pre-mRNA matched the profile observed
previously by Dominski and Kole (26, 27) for a related
pre-mRNA (DUP33) in HeLa extracts. To facilitate the presentation, we
compared products that are unique to each of the three splicing
pathways. As shown in Fig. 5A, A* represents an RNA splicing
intermediate specific for the pathway where intron 1 is removed first
(pathway A), while B* is a splicing intermediate specific for the
pathway where intron 2 is removed first (pathway B). C* is a doublet
band that contains a splicing intermediate and a splicing product
diagnostic of exon skipping (pathway C). Incubation of DUP4-1 pre-mRNA
generated products corresponding to the three splicing pathways (Fig.
5B, lane 1), in agreement with previous results obtained with DUP33 (26, 27). The preference in the order of intron removal can be estimated by measuring the ratio of B* to A* products, which is
approximately 0.7 with DUP4-1 pre-mRNA. In addition, exon 2 skipping
(C* and C
products) is the most efficient pathway by which DUP4-1 is
spliced. The insertion of CE9 strongly decreased the appearance of
skipped products (C* and C
) and increased the ratio of B* to A*
products to 1.8 (Fig. 5B, lane 2). In contrast, a derivative carrying
the complementary sequence of CE9 allowed relatively efficient exon 2 skipping (C* and C
products) and a ratio of B* to A* products that
was similar to that of DUP4-1 (Fig. 5B, lane 3).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of CE9 on DUP 4-1 and DUP 5-1 splicing
in vitro. (A) Representation of different pathways used for the
splicing of DUP pre-mRNAs. Pathway A occurs when intron 1 is the first
intron to be removed, while pathway B takes place when intron 2 is
spliced first. Pathway C corresponds to skipping of the internal exon.
The splicing products, A*, A , B*, B , C*, and C , indicate
molecules that are unique to each pathway and correspond to the bands
shown in the splicing gels (panels B and C). (B) CE9 shifts splicing in
favor of pathway B. Labeled pre-mRNAs were incubated in HeLa extracts
for 1 h. Splicing products were fractionated on an 11%
acrylamide-8 M urea gel. Selected products are indicated. (C) CE9 also
improves pathway B in DUP 5-1. Products specific to pathway A or B are
indicated. Note that the band immediately below product A
corresponds to the intron 2-exon 3 lariat intermediate, a product
common to pathways A and B. Pre-mRNAs were incubated under splicing
conditions for the times indicated. Splicing products were loaded onto
an 8% acrylamide-8 M urea gel. The ratio of product B* to product A*
(or B /A ) is indicated and is based on the 2-h time point. The
structure of DUP pre-mRNA and derivatives is as shown in Fig. 4A,
except that the labeled pre-mRNAs were synthesized in vitro using T7
RNA polymerase.
|
|
The effect of CE9 was confirmed using a DUP pre-mRNA produced from
DUP5-1, which contains a slightly larger internal exon
(51 nt). In our
laboratory, no exon 2 skipping was observed with
the DUP5-1 pre-mRNA in
vitro (data not shown). By monitoring the
appearance of intermediates
and products that are unique to pathways
A and B, we observed that the
ratio of B* to A* products is approximately
1 for the control pre-mRNA
that contains the complementary sequence
of CE9 (Fig.
5C, lane 10).
When CE9 is present in intron 1, this
ratio changes to 4 (Fig.
5C, lane
5). These values are confirmed
by assessing the intensity of another
set of diagnostic products
that are specific for pathways A and B (Fig.
5A). Thus, for both
DUP4-1 and DUP5-1 pre-mRNAs, the presence of CE9
decreased the
splicing efficiency of the first intron, consistent with
the silencer
effect of CE9. This decrease was accompanied by an
improvement
in the splicing efficiency of the second intron. Better
splicing
of intron 2 likely explains why exon 2 skipping is less
efficient
in the D4-CE9 pre-mRNA. Thus, the silencing effect of CE9
would
indirectly promote more efficient splicing of the second intron
possibly because of reduced interference in spliceosome assembly.
This
would reduce the frequency of exon 2 skipping and would lead
to more
frequent inclusion of the internal exon. Although CE9
reduces splicing
of the first intron in vitro, splicing of this
intron may ultimately
take place by default in
vivo.
The effect of CE9 is mediated by a trans-acting
factor.
The ability of CE9 to influence the splicing of
heterologous pre-mRNAs suggests that a trans-acting
factor(s) mediates the activity of CE9. To confirm that a cellular
factor is required for the activity of CE9, we performed splicing
assays in the presence of an excess of cold competitor RNA. When a
short RNA containing the complete CE9 sequence was preincubated in a
HeLa extract, the effect of the cis-acting CE9 element was
abrogated, and splicing to the distal 3' splice site of the C3'
/9
pre-mRNA was improved (Fig. 6, lanes 9 to
11). No effect on 3' splice site selection was seen when the competitor
RNA contained plasmid-derived sequences only (lanes 12 to 14). These
results suggest that titratable factors bind to the CE9 element to
mediate its effect. Notably, an excess of the CE9 competitor RNA also
affected 3' splice site selection on a pre-mRNA lacking CE9 (C3'
/
)
(Fig. 6, lanes 2 to 4). This result suggests that the factor binding to
CE9 may play a general role in 3' splice site selection.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 6.
A trans-acting factor mediates the repression
by CE9 on a downstream 3' splice site. Splicing was performed in a HeLa
nuclear extract preincubated for 10 min with increasing amounts of the
CE9 RNA as a competitor (lanes 2 to 4 and 9 to 11) or with a control
RNA derived from pBluescript K(+) (lanes 5 to 7 and 12 to 14). Each set
of the competition was performed with 0.5 fmol of pre-mRNA and 50, 250, or 500 fmol of unlabeled competitor RNA.
|
|
The CE9 repressor element does not prevent splicing complex
formation.
To address the mechanism by which CE9 inhibits
splicing, we analyzed splicing complex assembly. As shown in Fig.
7, early complex formation was as
efficient with the adenovirus pre-mRNA carrying two copies of CE9 as
with the pre-mRNA carrying two copies of the complementary sequences
(compare lane 2 with lane 5). The major complex likely corresponds to
complex A, since its assembly was strongly reduced in an extract that
had been pretreated with RNase H and an oligonucleotide complementary
to the 5' end of U2 snRNA (lanes 3 and 6). Using longer incubation
periods, we could monitor more advanced stages of spliceosome assembly,
although the resolution was not sufficient to distinguish complex B
from complex C (lanes 7 to 16). When pre-mRNAs were incubated in an extract that had been pretreated with RNase H and an oligonucleotide complementary to U4 snRNA, slower-migrating complexes were converted into a complex probably equivalent to complex A (Fig. 7, lanes 11 and
16). The pre-mRNA containing two copies of CE9 (A2x) underwent complex
formation at least as efficiently as that of the control A2x
version
(compare lanes 8 to 10 with lanes 13 to 15). Thus, although two copies
of CE9 blocked splicing of the A2x pre-mRNA, this substrate was
efficiently assembled into snRNP-containing complexes.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 7.
CE9 does not block the assembly of
snRNP-containing complexes. The time course of splicing complex
assembly was determined by using adenovirus pre-mRNAs
containing two copies of CE9 or two copies of the complementary
sequences (A2x or A2x , respectively) (see Fig. 2B for a schematic
diagram of the pre-mRNAs). Nuclear extracts were
pretreated for 1 h at 30°C in the presence of RNase H alone (NE)
or RNase H and oligonucleotides complementary to U2 snRNA ( U2) or U4
snRNA ( U4). The reaction mixtures were loaded on a 2%
low-melting-point agarose gel. The origins of the gels and the
identities of the complexes are indicated.
|
|
 |
DISCUSSION |
We have shown that the intron element CE9 can modulate in vivo and
in vitro splicing. Several observations are consistent with the
conclusion that CE9 is a silencer element that represses the use of a
downstream 3' splice site. First, the insertion of multiple copies of
CE9 in the intron of simple pre-mRNAs abrogates in vitro splicing. This
effect was seen for an adenovirus model pre-mRNA and, more importantly,
for an A1 pre-mRNA carrying the 5' splice site of exon 7B and the 3'
splice site of exon 8. In vivo, the insertion of several copies of CE9
in an A1 minigene also compromises the accumulation of fully spliced
products. Second, the insertion of a single CE9 element between two
competing 3' splice sites reduces splicing to the downstream 3' splice
site. Third, the presence of CE9 in the first intron of an artificial globin pre-mRNA represses splicing of this intron in vitro. Because this effect is accompanied by an improvement in splicing of the second
intron, the repressing activity of CE9 apparently relieves the
interference created by closely positioned splice sites on this short
exon. Assuming that splicing of the first intron ultimately occurs by
default, this would explain why CE9 improves the inclusion of the short
internal globin exon in vivo. Overall, these results are consistent
with the notion that the normal function of CE9 is to reduce the use of
the 3' splice site of exon 8.
In the hnRNP A1 pre-mRNA, the frequency of inclusion of exon 7B is
determined to a large extent by a competition between the 3' splice
sites of exon 7B and exon 8. This is because a duplex structure impairs
the use of the 5' splice site of exon 7B (7). At least two
types of elements favor selection of the 3' splice site of exon 8 over
that of exon 7B in HeLa cells: the CE4m element represses the 3' splice
site of exon 7B, and A1 binding elements have been proposed to
facilitate pairing between the 5' splice site of exon 7 and the 3'
splice site of exon 8 (8, 15). This combination of elements
may neutralize the activity of a weak element like CE9 and explain why
deleting CE9 from the A1 minigene has little impact in vivo. However,
in certain types of cells or in some situations, repressing the 3'
splice site of exon 8 may be important to favor selection of the 3'
splice site of exon 7B.
The interaction of CE9 with a cellular factor appears to be important
for its modulating activity, since an excess of competitor RNA
containing the CE9 sequences can stimulate splicing to a distal 3'
splice site. The ability of CE9 to function in a variety of pre-mRNA
substrates also supports the notion that a cellular factor is required
for the activity of CE9. Further work will be required to identify the
factor that binds to CE9. It is intriguing that the first half of CE9,
which displays most of the activity of CE9, contains a sequence that
resembles the CE4m repressor element downstream of exon 7B
(8) and the human immunodeficiency virus repressor element
in exon 3 of tat-rev (2, 56) (consensus sequence = CU[A/G]GA[C/U]UA). Despite this similarity between CE4m and CE9, the mechanisms of inhibition appear to be different, since CE4m and CE9 repress the upstream and the downstream 3' splice
sites, respectively, in C3'
/
pre-mRNA. In contrast to silencer
elements that prevent splicing complex formation (16, 38,
54), the inhibition of pre-mRNA splicing by CE9 was not associated with a block in the assembly of snRNP-containing complexes. Some silencer elements do not prevent snRNP binding (51),
and others are bound by snRNPs (18, 32, 38, 47, 55). Thus, CE9 apparently belongs to the latter category of silencer elements and
may block a late step of spliceosome assembly or promote the formation
of aberrant splicing complexes.
The mechanisms that control the alternative splicing of cassette exons
have implicated elements that affect the recognition or use of splice
sites directly flanking the alternative exon. However, modulating the
use of common splice sites in alternative splicing units may be equally
important for producing the proper ratio of mRNA isoforms. Although the
common splice sites of alternative splicing units are often suboptimal,
less is known about elements that affect their use. Enhancers elements
in 3' and 5' common exons have been identified in the fibronectin ED1
and calcitonin/calcitonin gene-related peptide alternative splicing
units, respectively (42, 62). In these cases, it remains
unclear whether these elements affect alternative splicing in their
natural setting. However, in the neural cell adhesion molecule splicing
unit, an exon enhancer in the 5' common exon alters the inclusion rate of a downstream alternative exon (20). To our knowledge, CE9 is the first element documented to repress splicing to a 3' common exon. We expect that the current efforts aimed at identifying elements
that modulate splice site selection will reinforce the notion that
alternative splicing requires controlling the use of common as well as
alternative splice sites.
 |
ACKNOWLEDGMENTS |
We thank D. Black and E. Modaferri for kindly providing DUP4-1
and DUP5-1 plasmids. We thank Johanne Toutant for performing transfections and preparing nuclear extracts, and we thank M. Blanchette and S. Hutchison for comments on the manuscript.
M.J.S. is the recipient of a studentship from the FCAR/FRSQ. This work
was supported by a grant from the Medical Research Council of Canada.
B.C. is a Chercheur-Boursier Senior from the FRSQ and is a member of
the Sherbrooke RNA/RNP group supported by the FCAR.
 |
FOOTNOTES |
*
Corresponding author. Mailing address:
Département de Microbiologie et d'Infectiologie, Faculté
de Médecine, Université de Sherbrooke, 3001 12e Avenue
Nord, Sherbrooke, Québec, Canada J1H 5N4. Phone: (819) 564-5295. Fax: (819) 564-5392. E-mail:
b.chabot{at}courrier.usherb.ca.
 |
REFERENCES |
| 1.
|
Amendt, B. A.,
D. Hesslein,
L.-J. Chang, and C. M. Stoltzfus.
1994.
Presence of negative and positive cis-acting RNA splicing elements within and flanking the first tat coding exon of human immunodeficiency virus type 1.
Mol. Cell. Biol.
14:3960-3970[Abstract/Free Full Text].
|
| 2.
|
Amendt, B. A.,
Z.-H. Si, and C. M. Stoltzfus.
1995.
Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors.
Mol. Cell. Biol.
15:4606-4615[Abstract]. (Erratum, 15:6480.)
|
| 3.
|
Ashiya, M., and P. J. Grabowski.
1997.
A neuron-specific splicing switch mediated by an array of pre-mRNA repressor sites: evidence of a regulatory role for the polypyrimidine tract binding protein and a brain-specific PTB counterpart.
RNA
3:996-1015[Abstract].
|
| 4.
|
Black, D. L.
1992.
Activation of c-src neuron-specific splicing by an unusual RNA element in vivo and in vitro.
Cell
69:795-807[CrossRef][Medline].
|
| 5.
|
Black, D. L.
1995.
Finding splice sites within a wilderness of RNA.
RNA
1:763-771[Medline].
|
| 6.
|
Black, D. L.,
B. Chabot, and J. A. Steitz.
1985.
U2 as well as U1 small nuclear ribonucleoproteins are involved in premessenger RNA splicing.
Cell
42:737-750[CrossRef][Medline].
|
| 7.
|
Blanchette, M., and B. Chabot.
1997.
A highly stable duplex structure sequesters the 5' splice site region of hnRNP A1 alternative exon 7B.
RNA
3:405-419[Abstract].
|
| 8.
|
Blanchette, M., and B. Chabot.
1999.
Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization.
EMBO J.
18:1939-1952[CrossRef][Medline].
|
| 9.
|
Bourgeois, C. F.,
M. Popielarz,
G. Hildwein, and J. Stevenin.
1999.
Identification of a bidirectional splicing enhancer: differential involvement of SR proteins in 5' or 3' splice site activation.
Mol. Cell. Biol.
19:7347-7356[Abstract/Free Full Text].
|
| 10.
|
Caputi, M.,
G. Casari,
S. Guenzi,
R. Tagliabue,
A. Sidoli,
C. A. Melo, and F. E. Baralle.
1994.
A novel bipartite splicing enhancer modulates the differential processing of the human fibronectin EDA exon.
Nucleic Acids Res.
22:1018-1022[Abstract/Free Full Text].
|
| 11.
|
Caputi, M.,
A. Mayeda,
A. R. Krainer, and A. M. Zahler.
1999.
hnRNP A/B proteins are required for inhibition of HIV-1 pre-mRNA splicing.
EMBO J.
18:4060-4067[CrossRef][Medline].
|
| 12.
|
Carstens, R. P.,
W. L. McKeehan, and M. A. Garcia-Blanco.
1998.
An intronic sequence element mediates both activation and repression of rat fibroblast growth factor receptor 2 pre-mRNA splicing.
Mol. Cell. Biol.
18:2205-2217[Abstract/Free Full Text].
|
| 13.
|
Chabot, B.
1996.
Directing alternative splicing: cast and scenarios.
Trends Genet.
12:472-478[CrossRef][Medline].
|
| 14.
|
Chabot, B.
1994.
Synthesis and purification of RNA substrates, p. 1-29.
In
D. Hames, and S. Higgins (ed.), RNA processing, vol. 1. Oxford University Press, Oxford, England.
|
| 15.
|
Chabot, B.,
M. Blanchette,
I. Lapierre, and H. La Branche.
1997.
An intron element modulating 5' splice site selection in the hnRNP A1 pre-mRNA interacts with hnRNP A1.
Mol. Cell. Biol.
17:1776-1786[Abstract].
|
| 16.
|
Chew, S. L.,
L. Baginsky, and I. C. Eperon.
2000.
An exonic splicing silencer in the testes-specific DNA ligase III beta exon.
Nucleic Acids Res.
28:402-410[Abstract/Free Full Text].
|
| 17.
|
Clouet d'Orval, B.,
Y. d'Aubenton Carafa,
P. Sirand-Pugnet,
M. Gallego,
E. Brody, and J. Marie.
1991.
RNA secondary structure repression of a muscle-specific exon in HeLa cell nuclear extracts.
Science
252:1823-1828[Abstract/Free Full Text].
|
| 18.
|
Cook, C. R., and M. T. McNally.
1998.
SR protein and snRNP requirements for assembly of the Rous sarcoma virus negative regulator of splicing complex in vitro.
Virology
242:211-220[CrossRef][Medline].
|
| 19.
|
Côté, J., and B. Chabot.
1997.
Natural base-pairing interactions between 5' splice site and branch site sequences affect mammalian 5' splice site selection.
RNA
3:1248-1261[Abstract].
|
| 20.
|
Côté, J.,
M. J. Simard, and B. Chabot.
1999.
An element in the 5' common exon of the NCAM alternative splicing unit interacts with SR proteins and modulates 5' splice site selection.
Nucleic Acids Res.
27:2529-2537[Abstract/Free Full Text].
|
| 21.
|
Das, R., and R. Reed.
1999.
Resolution of the mammalian E complex and the ATP-dependent spliceosomal complexes on native agarose mini-gels.
RNA
5:1504-1508[Abstract].
|
| 22.
|
Del Gatto, F., and R. Breathnach.
1995.
Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon.
Mol. Cell. Biol.
15:4825-4834[Abstract].
|
| 23.
|
Del Gatto, F.,
A. Plet,
M.-C. Gesnel,
C. Fort, and R. Breathnach.
1997.
Multiple interdependent sequence elements control splicing of a fibroblast growth factor receptor 2 alternative exon.
Mol. Cell. Biol.
17:5106-5116[Abstract].
|
| 24.
|
Del Gatto-Konczak, F.,
M. Olive,
M.-C. Gesnel, and R. Breathnach.
1999.
hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer.
Mol. Cell. Biol.
19:251-260[Abstract/Free Full Text].
|
| 25.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1489[Abstract/Free Full Text].
|
| 26.
|
Dominski, Z., and R. Kole.
1992.
Cooperation of pre-mRNA sequence elements in splice site selection.
Mol. Cell. Biol.
12:2108-2114[Abstract/Free Full Text].
|
| 27.
|
Dominski, Z., and R. Kole.
1991.
Selection of splice sites in pre-mRNAs with short internal exons.
Mol. Cell. Biol.
11:6075-6083[Abstract/Free Full Text].
|
| 28.
|
Elrick, L. L.,
M. B. Humphrey,
T. A. Cooper, and S. M. Berget.
1998.
A short sequence within two purine-rich enhancers determines 5' splice site specificity.
Mol. Cell. Biol.
18:343-352[Abstract/Free Full Text].
|
| 29.
|
Eperon, I. C.,
D. C. Ireland,
R. A. Smith,
A. Mayeda, and A. R. Krainer.
1993.
Pathways for selection of 5' splice sites by U1 snRNPs and SF2/ASF.
EMBO J.
12:3607-3617[Medline].
|
| 30.
|
Estes, P. A.,
N. E. Cooke, and S. A. Liebhaber.
1992.
A native RNA secondary structure controls alternative splice-site selection and generates two human growth hormone isoforms.
J. Biol. Chem.
267:14902-14908[Abstract/Free Full Text].
|
| 31.
|
Gallego, M. E.,
L. Balvay, and E. Brody.
1992.
cis-acting sequences involved in exon selection in the chicken -tropomyosin gene.
Mol. Cell. Biol.
12:5415-5425[Abstract/Free Full Text].
|
| 32.
|
Gontarek, R. R.,
M. T. McNally, and K. Beemon.
1993.
Mutation of an RSV intronic element abolishes both U11/U12 snRNP binding and negative regulation of splicing.
Genes Dev.
7:1926-1936[Abstract/Free Full Text].
|
| 33.
|
Gooding, C.,
G. C. Roberts, and C. W. Smith.
1998.
Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.
RNA
4:85-100[Abstract].
|
| 34.
|
Hertel, K. J., and T. Maniatis.
1998.
The function of multisite splicing enhancers.
Mol. Cell
1:449-455[CrossRef][Medline].
|
| 35.
|
Huh, G. S., and R. O. Hynes.
1993.
Elements regulating an alternatively spliced exon of the rat fibronectin gene.
Mol. Cell. Biol.
13:5301-5314[Abstract/Free Full Text].
|
| 36.
|
Humphrey, M. B.,
J. Bryan,
T. A. Cooper, and S. M. Berget.
1995.
A 32-nucleotide exon-splicing enhancer regulates usage of competing 5' splice sites in a differential internal exon.
Mol. Cell. Biol.
15:3979-3988[Abstract].
|
| 37.
|
Hutton, M.,
C. L. Lendon,
P. Rizzu,
M. Baker,
S. Froelich,
H. Houlden,
S. Pickering-Brown,
S. Chakraverty,
A. Isaacs,
A. Grover,
J. Hackett,
J. Adamson,
S. Lincoln,
D. Dickson,
P. Davies,
R. C. Petersen,
M. Stevens,
E. de Graaff,
E. Wauters,
J. van Baren,
M. Hillebrand,
M. Joosse,
J. M. Kwon,
P. Nowotny,
P. Heutink, et al.
1998.
Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17.
Nature
393:702-705[CrossRef][Medline].
|
| 38.
|
Kan, J. L., and M. R. Green.
1999.
Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor.
Genes Dev.
13:462-471[Abstract/Free Full Text].
|
| 39.
|
Kanopka, A.,
O. Mühlemann, and G. Aküsjarvi.
1996.
Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA.
Nature
381:535-538[CrossRef][Medline].
|
| 40.
|
Kohtz, J. D.,
S. F. Jamison,
C. L. Will,
P. Zuo,
R. Lührmann,
M. A. Garcia-Blanco, and J. L. Manley.
1994.
Protein-protein interactions and 5'-splice-site recognition in mammalian mRNA precursors.
Nature
368:119-124[CrossRef][Medline].
|
| 41.
|
Kuo, B. A., and P. A. Norton.
1999.
Accurate selection of a 5' splice site requires sequences within fibronectin alternative exon B.
Nucleic Acids Res.
27:3945-3952[Abstract/Free Full Text].
|
| 42.
|
Lavigueur, A.,
H. La Branche,
A. R. Kornblihtt, and B. Chabot.
1993.
A splicing enhancer in the human fibronectin alternate ED1 exon interacts with SR proteins and stimulates U2 snRNP binding.
Genes Dev.
7:2405-2417[Abstract/Free Full Text].
|
| 43.
|
Lopez, A. J.
1998.
Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation.
Annu. Rev. Genet.
32:279-305[CrossRef][Medline].
|
| 44.
|
Lou, H.,
D. M. Helfman,
R. F. Gagel, and S. M. Berget.
1999.
Polypyrimidine tract-binding protein positively regulates inclusion of an alternative 3'-terminal exon.
Mol. Cell. Biol.
19:78-85[Abstract/Free Full Text].
|
| 45.
|
Manley, J. L., and R. Tacke.
1996.
SR proteins and splicing control.
Genes Dev.
10:1569-1579[Free Full Text].
|
| 46.
|
McCullough, A. J., and S. M. Berget.
1997.
G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection.
Mol. Cell. Biol.
17:4562-4571[Abstract].
|
| 47.
|
McNally, L. M., and M. T. McNally.
1998.
An RNA splicing enhancer-like sequence is a component of a splicing inhibitor element from Rous sarcoma virus.
Mol. Cell. Biol.
18:3103-3111[Abstract/Free Full Text].
|
| 48.
|
Modafferi, E. F., and D. L. Black.
1999.
Combinatorial control of a neuron-specific exon.
RNA
5:687-706[Abstract].
|
| 49.
|
Modafferi, E. F., and D. L. Black.
1997.
A complex intronic splicing enhancer from the c-src pre-mRNA activates inclusion of a heterologous exon.
Mol. Cell. Biol.
17:6537-6545[Abstract].
|
| 50.
|
Muro, A. F.,
M. Caputi,
R. Pariyarath,
F. Pagani,
E. Buratti, and F. E. Baralle.
1999.
Regulation of fibronectin EDA exon alternative splicing: possible role of RNA secondary structure for enhancer display.
Mol. Cell. Biol.
19:2657-2671[Abstract/Free Full Text].
|
| 51.
|
Nemeroff, M. E.,
U. Utans,
A. Krämer, and R. M. Krug.
1992.
Identification of cis-acting intron and exon regions in influenza virus NS1 mRNA that inhibit splicing and cause the formation of aberrantly sedimenting presplicing complexes.
Mol. Cell. Biol.
12:962-970[Abstract/Free Full Text].
|
| 52.
|
Reed, R., and T. Maniatis.
1985.
Intron sequences involved in lariat formation during pre-mRNA splicing.
Cell
41:95-105[CrossRef][Medline].
|
| 53.
|
Ryan, K. J., and T. A. Cooper.
1996.
Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle.
Mol. Cell. Biol.
16:4014-4023[Abstract].
|
| 54.
|
Si, Z.-H.,
D. Rauch, and C. M. Stoltzfus.
1998.
The exon splicing silencer in human immunodeficiency virus type 1 tat exon 3 is bipartite and acts early in spliceosome assembly.
Mol. Cell. Biol.
18:5404-5413[Abstract/Free Full Text].
|
| 55.
|
Siebel, C. W.,
L. D. Fresco, and D. C. Rio.
1992.
The mechanism of somatic inhibition of Drosophila P-element pre-mRNA splicing: multiprotein complexes at an exon pseudo-5' splice site control U1 snRNP binding.
Genes Dev.
6:1386-1401[Abstract/Free Full Text].
|
| 56.
|
Staffa, A., and A. Cochrane.
1995.
Identification of positive and negative splicing regulatory elements within the terminal tat-rev exon of human immunodeficiency virus type 1.
Mol. Cell. Biol.
15:4597-4605[Abstract].
|
| 57.
|
Staknis, D., and R. Reed.
1994.
SR proteins promote the first specific recognition of pre-mRNA and are present together with the U1 small nuclear ribonucleoprotein particle in a general splicing enhancer complex.
Mol. Cell. Biol.
14:7670-7682[Abstract/Free Full Text].
|
| 58.
|
Valcárcel, J., and F. Gebauer.
1997.
Post-transcriptional regulation: the dawn of PTB.
Curr. Biol.
7:R705-R708[CrossRef][Medline].
|
| 59.
|
van Oers, C. C. M.,
G. J. Adema,
H. Zandberg,
T. C. Moen, and P. D. Bass.
1994.
Two different sequence elements within exon 4 are necessary for calcitonin-specific splicing of the human calcitonin/calcitonin gene-related peptide I pre-mRNA.
Mol. Cell. Biol.
14:951-960[Abstract/Free Full Text].
|
| 60.
|
Wang, Z.,
H. M. Hoffmann, and P. J. Grabowski.
1995.
Intrinsic U2AF binding is modulated by exon enhancer signals in parallel with changes in splicing activity.
RNA
1:21-35[Abstract].
|
| 61.
|
Yang, X.,
M. R. Bani,
S. J. Lu,
S. Rowan,
Y. Ben-David, and B. Chabot.
1994.
The A1 and A1B proteins of heterogeneous nuclear ribonucleoparticles modulate 5' splice site selection in vivo.
Proc. Natl. Acad. Sci. USA
91:6924-6928[Abstract/Free Full Text].
|
| 62.
|
Yeakley, J. M.,
F. Hedjran,
J.-P. Morfin,
N. Merillat,
M. G. Rosenfeld, and R. B. Emeson.
1993.
Control of calcitonin/calcitonin gene-related peptide pre-mRNA processing by constitutive intron and exon elements.
Mol. Cell. Biol.
13:5999-6011[Abstract/Free Full Text].
|
| 63.
|
Zhang, L.,
W. Liu, and P. J. Grabowski.
1999.
Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB.
RNA
5:117-130[Abstract].
|
Molecular and Cellular Biology, October 2000, p. 7353-7362, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Paradis, C., Cloutier, P., Shkreta, L., Toutant, J., Klarskov, K., Chabot, B.
(2007). hnRNP I/PTB can antagonize the splicing repressor activity of SRp30c. RNA
13: 1287-1300
[Abstract]
[Full Text]
-
Buratti, E., Stuani, C., De Prato, G., Baralle, F. E.
(2007). SR protein-mediated inhibition of CFTR exon 9 inclusion: molecular characterization of the intronic splicing silencer. Nucleic Acids Res
35: 4359-4368
[Abstract]
[Full Text]
-
Myers, J. C., Moore, S. A., Shamoo, Y.
(2003). Structure-based Incorporation of 6-Methyl-8-(2-deoxy-{beta}-ribofuranosyl)isoxanthopteridine into the Human Telomeric Repeat DNA as a Probe for UP1 Binding and Destabilization of G-tetrad Structures. J. Biol. Chem.
278: 42300-42306
[Abstract]
[Full Text]
-
Hutchison, S., LeBel, C., Blanchette, M., Chabot, B.
(2002). Distinct Sets of Adjacent Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1/A2 Binding Sites Control 5' Splice Site Selection in the hnRNP A1 mRNA Precursor. J. Biol. Chem.
277: 29745-29752
[Abstract]
[Full Text]
-
Simard, M. J., Chabot, B.
(2002). SRp30c Is a Repressor of 3' Splice Site Utilization. Mol. Cell. Biol.
22: 4001-4010
[Abstract]
[Full Text]