Previous Article
Molecular and Cellular Biology, October 2000, p. 7410-7417, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Mutations in a tRNA Import Signal Define Distinct
Receptors at the Two Membranes of Leishmania
Mitochondria
Subhendra Nath
Bhattacharyya,
Shankar
Mukherjee, and
Samit
Adhya*
Genetic Engineering Laboratory, Indian
Institute of Chemical Biology, Calcutta 700032, India
Received 29 February 2000/Returned for modification 28 March
2000/Accepted 20 June 2000
 |
ABSTRACT |
Nucleus-encoded tRNAs are selectively imported into the
mitochondrion of Leishmania, a kinetoplastid protozoan. An
oligoribonucleotide constituting the D stem-loop import signal of
tRNATyr(GUA) was efficiently transported into the
mitochondrial matrix in organello as well as in vivo. Transfer through
the inner membrane could be uncoupled from that through the outer
membrane and was resistant to antibody against the outer membrane
receptor TAB. A number of mutations in the import signal had
differential effects on outer and inner membrane transfer. Some mutants
which efficiently traversed the outer membrane were unable to enter the
matrix. Conversely, restoration of the loop-closing GC pair in reverse resulted in reversion of transfer through the inner, but not the outer,
membrane, and binding of the RNA to the inner membrane was restored.
These experiments indicate the presence at the two membranes of
receptors with distinct specificities which mediate stepwise transfer
into the mitochondrial matrix. The combination of oligonucleotide
mutagenesis and biochemical fractionation may provide a general tool
for the identification of tRNA transport factors.
 |
INTRODUCTION |
Mitochondria are genetic
parasites presumed to have evolved from endosymbiotic bacteria.
The recent sequencing of a large number of mitochondrial genomes has
revealed an unexpected diversity in size and gene content
(5). The loss of most of the original bacterial
protein-coding genes, or their transfer to the nucleus, has been
explained in terms of a "big bang" radiation of the different eukaryotic lineages from a single (monophyletic) endosymbiont (5). What is not so easily explained is the loss of a
variable number of tRNA genes apparently randomly in different
protists, higher plants, and at least one invertebrate lineage
(6). At least 24 different tRNA species are required to read
the universal genetic code. In kinetoplastid protozoa, including
leishmanias and trypanosomes, a complete set of tRNAs are apparently
imported in order to compensate for the total lack of mitochondrial
tRNA genes (7, 8, 11, 16, 21-23). The mitochondria of
tetrahymena import about two-thirds of their tRNAs (2),
while in budding yeast only a single tRNALys species is
imported (15). In higher plants, different species mitochondrially import different sets of tRNAs; for example,
mitochondria from wheat but not maize import tRNAHis
(9). Thus, there appears to be a species-specific
selectivity, reflecting perhaps the presence of different mitochondrial
receptors recognizing individual or groups of import signals on tRNAs.
To study the basis of the selectivity of tRNA import, we have developed
an in organello system using leishmania mitochondria (1, 12,
14). Similar systems from trypanosomes have been recently
reported (18, 25). Our experiments showed that tRNA import
is selective, e.g., tRNATyr is efficiently imported whereas
tRNAGln(CUG) is not (1), and that a conserved
sequence motif in the D arm of tRNATyr is necessary and
sufficient for import (13). The importance of the D loop of
tRNAIle for import in vivo has also been demonstrated
(10). Importable RNA interacts directly with the outer
mitochondrial membrane (12), and a 15-kDa RNA binding
protein, TAB, associated with the outer membrane (OM) was purified and
shown to function as an import receptor (1). Using specific
antibody, it was further shown that TAB interacts with
tRNATyr but not with tRNAGln (13).
Thus, the TAB-tRNA interaction accounts for the selectivity of import
in this system.
More recent studies have indicated that, in addition to sequence
discrimination at the OM, a second level of selection possibly occurs
at the inner membrane (IM). Analysis of the distribution of imported
tRNATyr and other transcripts in the different
intramitochondrial compartments, i.e., OM, intermembrane space (IMS),
IM, and matrix (MX), showed that import occurs in a stepwise fashion,
with a distinct kinetic separation of the OM and IM transfer steps
(17). While OM transfer requires ATP, IM transfer is driven
by both the electrical and chemical components of the electromotive
force generated at the IM of energized mitochondria (17).
These results lead to the hypothesis that distinct receptors occur at
the OM and IM which concertedly determine sequence selectivity for MX
entry of tRNAs. However, nothing is known about the specificity of the
interaction at the IM or the identity of any of the components of IM
transport machinery.
Here we show that a short oligoribonucleotide containing the D arm of
tRNATyr(GUA) rapidly and efficiently transits to the
mitochondrial MX in vitro. Site-specific mutagenesis of the D arm was
employed to detect similarities and differences in the sequence and/or structural requirements for OM and IM transfer.
 |
MATERIALS AND METHODS |
Cell culture and preparation of mitochondria.
Promastigotes
of Leishmania tropica strain UR6 were cultured at 22°C on
solid blood agar medium (3) supplemented with 150 µg of
biopterin and 50 µg of adenine per ml. Mitochondria were purified
from DNase I-treated lysates by Percoll gradient centrifugation and
stored in a 50% glycerol storage buffer, as described previously (14). Before use, mitochondria were diluted with cold
isotonic sucrose-Tris-EDTA (STE) buffer (14), washed by
centrifugation, and resuspended in STE at a final protein concentration
of 8 to 10 mg/ml.
Submitochondrial fractionation.
Separation of
submitochondrial compartments was performed as previously described
(17). Briefly, mitochondria were treated with 320 µM
digitonin in STE buffer for 15 min on ice to selectively solubilize the
OM (19). Mitoplasts were separated from the soluble fraction
(OM plus IMS) by centrifugation. To further fractionate the mitoplasts,
they were suspended in a solution of 0.6 M sucrose, 10 mM Tris-HCl (pH
7.5), and 1 mM EDTA and subjected to three freeze-thaw cycles. Soluble
MX and particulate IM fractions were subsequently separated by centrifugation.
Preparation of import substrates.
32P-labeled
tRNATyr(GUA) transcripts were synthesized by runoff
transcription of the plasmid pSKB1 (1), which contains a
cloned genomic copy of the corresponding Leishmania gene,
using T7 RNA polymerase and [
-32P]UTP, as described
previously (4). Wild-type and mutant D arm minihelix RNAs
were synthesized by runoff transcription of the corresponding
double-stranded oligonucleotides containing a T7 RNA polymerase
promoter. To prepare the templates, the promoter primer
GGAATTCTAATACGACTCACTATAGGGACTGTAGCTC, containing an
EcoRI linker, a T7 RNA polymerase promoter, and nucleotides
5 to 13 of tRNATyr(GUA) (11) (see Fig. 1),
was annealed to the following oligonucleotides, each containing
sequences complementary to positions 5 to 27 of tRNATyr(GUA): wild type, ATGCTCTACCAATTGAGCTACAGTC;
U17
A, ATGCTCTACCTATTGAGCTACAGTC;
G18
C, ATGCTCTACGAATTGAGCTACAGTC;
A21
C, ATGCTCGACCAATTGAGCTACAGTC;
G22
C, ATGCTGTACCAATTGAGCTACAGTC;
G22
C, C13
G,
ATGCTGTACCAATTCAGCTACAGTC;
A23
U, ATGCACTACCAATTGAGCTACAGTC;
A23
U, U12
A,
ATGCACTACCAATTGTGCTACAGTC; C11
A,
U12
C, ATGCTCTACCAATTGGTCTACAGTC.
The resulting partially double-stranded molecule was end-filled
with Moloney murine leukemia virus reverse transcriptase
(13) and purified by ethanol precipitation. The sequences of
the 27-mer transcripts were verified by two-dimensional oligonucleotide
fingerprinting (24).
In organello import assays.
Unless otherwise stated,
mitochondria or mitoplasts (100 µg of protein) were incubated in
20-µl reaction mixtures containing 10 mM Tris-HCl (pH 8), 10 mM
magnesium acetate, 2 mM dithiothreitol, and 4 mM ATP with 100 fmol of
32P-labeled substrate for 15 min at 37°C (17).
Then RNase A (2.5 µg/ml) and RNase T1 (50 U/ml) were
added, and incubation continued for an additional 15 min at 37°C. The
vesicles were washed in cold STE buffer by centrifugation. To measure
total uptake, RNase-treated mitochondria or mitoplasts were lysed in
guanidium isothiocyanate, and 32P-labeled RNA was recovered
by isopropanol precipitation, as described previously (13).
Alternatively, intramitochondrial RNAs were assayed by subjecting
postimport RNase-treated mitochondria to digitonin treatment, followed
by freeze-thaw lysis to separate the submitochondrial compartments (as
described above) and recovery of 32P-labeled RNA from each
fraction. Antibody inhibition experiments were carried out with
mitochondria or mitoplasts successively incubated with 4 mg of bovine
serum albumin/ml in STE for 1 h at 0°C and then with 100 µg of
normal or anti-TAB immunoglobulin G (IgG) per ml (1) for 30 min at 0°C and finally washed with STE. To study the effect of
uncouplers, mitoplasts were preincubated with 50 µM carbonyl cyanide
m-chlorophenylhydrazone (CCCP) for 10 min on ice before the
import reaction. 32P-labeled RNA obtained in each case was
analyzed by urea-10% polyacrylamide gel electrophoresis (PAGE)
followed by autoradiography. Quantitation was performed by liquid
scintillation counting of the dried gel band and/or scanning in a
Bio-Rad model GS 710 densitometer.
In vivo matrix localization assay.
32P-labeled
minihelix RNA (1 pmol) was added to 5 × 108
promastigotes in 0.4 ml of HEPES-buffered saline (21 mM HEPES, 137 mM NaCl, 5 mM KCl, 0.7 mM NaH2PO4; pH 7.4) and the
cells were electroporated at 450 V and 500 µF in a Bio-Rad gene
pulser. Electroporated cells were incubated on ice for 5 min,
centrifuged, resuspended in 1 ml of medium M199 containing 10% fetal
bovine serum, and incubated at 22°C for 10 min. The cells were
returned to ice and 0.2-ml aliquots were added to 0.8 ml of
phosphate-buffered saline. After pelleting by centrifugation, the cells
were suspended in 1 ml of hypotonic lysis buffer (14), lysed
by two syringe passages, and returned to isotonicity by sucrose
addition, as described previously (14). The particulate
fraction containing mitochondrial vesicles was suspended in 0.1 ml of
STE containing 10 mM MgCl2 and incubated with DNase I (50 U/ml), RNase A (2.5 to 5 µg/ml), and RNase T1 (50 to 100 U/ml) for 15 min at 37°C. The mitochondria were then washed with STE,
lysed in guanidinium isothiocyanate, and processed for RNA isolation
(13). Quantitations were performed by densitometry.
Binding assay.
Mitochondria or mitoplasts (50 µg of
protein) were incubated with 10 fmol of 32P-labeled RNA in
10 µl of binding buffer (10 mM Tris-HCl [pH 8], 10 mM magnesium
acetate, 1 mM dithiothreitol, 0.1 M KCl) for 30 min on ice. The
vesicles were then washed in 1 ml of cold STE, and bound RNA was
recovered and analyzed as above. To obtain the dissociation
constant (Kd) of the wild-type D arm-receptor
complex, mitoplasts were titrated with increasing concentrations
(t) of 32P-labeled RNA, and the bound
(b) and free (f = t
b) RNA
concentrations were determined. Scatchard plots of b/f
versus b yielded Kd =
(1/slope) and
the total receptor concentration, R0, as the
intercept on the x axis. For each mutant,
Kd was then derived from the equation Kd = [(t
b) (R0
b)]/b.
 |
RESULTS |
Stepwise import of the D arm minihelix.
It was shown earlier
(13, 17) that the tRNATyr(GUA) molecule can be
replaced by progressively smaller derivatives containing the D arm
region, with concomitant increases in the efficiencies of transfer
across the outer and inner mitochondrial membranes. Such derivatives
apparently use the same import pathway as the intact molecule, as
demonstrated by competition and antibody inhibition experiments. This
observation raises the attractive possibility of using small synthetic
oligonucleotides to probe the transport systems on mitochondrial
membranes. Accordingly, a 27-nucleotide RNA hairpin (minihelix) (Fig.
1A) containing the wild-type D arm sequence of the tRNATyr(GUA) was synthesized by T7
RNA polymerase-mediated transcription of the appropriate
oligonucleotide template. The energy-minimized secondary structure of
this molecule (Fig. 1A) contains the 4-bp stem and 8-base loop present
in intact tRNA. Neither the 5' terminal extension, containing the GGGA
initiation sequence for T7 RNA polymerase, nor the 3' tail forms any
detectable base pair with the remainder of the molecule, and this is
true for the wild type as well as for all the mutant sequences used in
this study (see below).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Import of D arm minihelix in vitro. (A)
Sequence of the wild-type minihelix. Numbers correspond to positions on
the intact tRNATyr molecule (11). The secondary
structure shown was derived by energy minimization using the FOLDRNA
program (26). Bases in italics are derived from the T7 RNA
polymerase initiation sequence on the template. The boxed region
contains the conserved nonanucleotide motif found in importable RNAs
(13). (B) Total uptake of the wild-type minihelix by intact
mitochondria. Reaction mixtures were incubated without (lane 1) or with
(lanes 2 through 7) 4 mM ATP. In lane 3, Triton X-100 (0.5%) was added
after the import incubation. In lanes 4 through 7, unlabeled yeast tRNA
(lanes 4 and 5) or low-specific-activity tRNATyr transcript
(lanes 6 and 7) was added as the competitor at concentrations of 0.1 (lanes 4 and 6) or 1 (lanes 5 and 7) pmol. After RNase treatment, the
total internalized RNA was analyzed. (C) Intramitochondrial
distribution of D arm minihelix. Intact mitochondria were incubated
with wild-type RNA and ATP at 37°C for the time intervals shown.
After each incubation, the mitochondria were RNase treated and
subfractionated, and the contents of RNA in the IM and MX fractions
were analyzed. (D) Import of D arm minihelix into mitoplasts.
Mitoplasts (100 µg of protein) were incubated with the wild-type
minihelix in the absence (lane 1) or presence (lanes 2 through 6) of 4 mM ATP. In lane 3, Triton X-100 (0.5%) was added after the incubation.
Reactions 4 and 5 contained 1 pmol of yeast tRNA or
tRNATyr, respectively, as the competitor. In reaction 6, mitoplasts were preincubated with 50 µM CCCP before the import
incubation. RNase-resistant RNA was recovered for analysis. The region
of the major minihelix band in each lane was excised and counted; after
background subtraction, femtomole values were computed from the
specific activity.
|
|
Uptake of the minihelix by isolated leishmania mitochondria was
dependent on ATP; entry into the membrane-bound organelle
was evident
from the susceptibility of the internalized RNA to
RNase in the
presence of detergent (Fig.
1B). Moreover, import
of the minihelix was
specifically competed out by the parental
molecule
tRNA
Tyr(GUA), indicating the utilization of a common import
pathway (Fig.
1B).
The distribution of the minihelix in various intramitochondrial
compartments following entry through the OM was then studied
by
biochemical fractionation (
17). Briefly, mitochondria
were
incubated with
32P-labeled RNA, excess RNA was
digested with RNase, and then the
washed vesicles were treated
with digitonin to selectively permeabilize
the OM (
19).
After centrifugal separation of the soluble fraction
(OM plus IMS) from
the insoluble mitoplasts, the latter was subjected
to freeze-thaw
cycles to liberate the soluble MX contents with
the remaining insoluble
fraction representing the IM. At shorter
incubation times (5 min), more
than 50% of the RNA was found to
be associated with the IM, with the
remainder being in the MX
(Fig.
1C). By 10 min, most of the RNA was in
the MX fraction (Fig.
1C). This kinetic pattern indicates that OM
transfer is faster
than IM transfer and is similar to what was
previously observed
with the parental molecule (
17), except
that the rate of IM
transfer of the minihelix is noticeably higher,
probably due to
the absence of extra sequences which hinder
import.
In the above system using intact mitochondria, IM transfer is dependent
on OM transfer, making it difficult to independently
assess the
requirements of the former step. Therefore, mitoplasts
obtained by
digitonin permeabilization of intact mitochondria
were incubated with
the
32P-labeled D arm minihelix, treated with RNase,
and analyzed for
their RNA content. Transfer of the minihelix
into the MX was dependent
on ATP and inhibited by protonophore
uncouplers such as CCCP (Fig.
1D), demonstrating the requirement of a
proton motive force across
the IM (
17). Under otherwise
identical conditions, the amount
of wild-type oligonucleotide entering
the MX was the same (2 to
2.5 fmol/100 µg of mitochondrial protein),
irrespective of whether
intact mitochondria or mitoplasts were used,
indicating that the
essential components of the IM machinery are not
lost during mitoplast
isolation.
To further assess the validity of the oligonucleotide import system,
the transfer of the D arm minihelix across the OM and
IM was directly
compared with that of intact tRNA
Tyr under a variety of
conditions. ATP, temperature, high concentrations
of monovalent
cations, dissipation of IM electromotive force by
protonophores (CCCP
and nigericin), and disruption of membrane
potential by
K
+ in the presence of valinomycin all had similar or
identical quantitative
effects on the transfer of either
substrate (Table
1). Thus,
except for the
kinetics of transfer (see above), there is little
or no biochemical
distinction between full-length tRNA and the
isolated D arm.
Effect of point mutations in the D arm on transfer through OM and
IM in organello.
The D arm of tRNATyr(GUA) contains
the motif UGGUAGAGC (Fig. 1A), which is conserved in the corresponding
region of tRNAs imported in leishmania and trypanosome mitochondria as
well as in a synthetic transcript imported through the same pathway
(13). To determine the role of the primary sequence and
secondary structure in the import signal, point mutations were
introduced within this region. Mutant RNAs synthesized by in vitro
transcription of the corresponding oligonucleotide templates were
assayed for intramitochondrial distribution after uptake in the
presence of ATP. In this assay, total uptake (i.e., the amount of RNA
in the IM-plus-MX fractions, whereas the OM-plus-IMS fractions
contained negligible amounts of RNA [data not shown]), is a measure
of OM transfer, while the fraction of the total internalized RNA
present in the MX represents IM transfer. For those mutants which are
deficient in OM transfer, it is difficult to accurately assess IM
transfer using intact mitochondria, since the amount internalized is
very low. Therefore, these mutants were directly assayed for their
import into mitoplasts.
The observed effects on OM and IM transfer (Fig.
2 and Table
2) may be summarized as follows. (i)
Single mutations in the
loop (G
18
C, U
17
A,
A
21
C) resulted in a decline of OM transfer by four- to
eightfold
compared to the wild-type sequence. The effect of these
mutations
on IM transfer was somewhat less, being reduced to 30 to 40%
of
the wild-type level. (ii) The mutation G
18
C at the
loop-closing pair of the D arm also reduced OM and IM
transfer by about
10-fold. (iii) However, if the loop-closing
pair was restored by a
second mutation, C
13
G, OM transfer remained low (13% of
wild type), but at least
half of the RNA internalized into intact
mitochondria was found
in the MX, indicating efficient IM transfer.
This was confirmed
with mitoplasts; the G
22
C,
C
13
G mutant was transferred across the IM with about
80% of the
efficiency of the wild-type sequence. (iv) The mutation
A
23
U reduced both OM and IM transfer to 20 to 30% of
that of the
wild type. When the AU pair was restored by a second
mutation,
U
12
A, OM transfer increased from 29 to 64%
(compared to wild type),
but IM transfer was not restored. (v) A double
mutation in the
stem, C
11
U, U
12
C, which
destabilizes the stem without altering the primary sequence
of the
conserved motif (Fig.
1), resulted in a significant amount
of OM
transfer (59% of wild type) but had a more severe effect
on IM
transfer (reduced to 30% of wild type). These results indicate
that
certain mutations in the import signal result in different
efficiencies
of transfer across the IM and OM.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of mutations on intramitochondrial
location of D arm minihelix. (A) 32P-labeled wild-type or
mutant minihelix (100 fmol) was incubated with mitochondria (100 µg
of protein). After 15 min at 37°C, RNase was added, and the washed
mitochondria were fractionated into IM and MX compartments. Lanes 1 through 10 and 11 through 20 show the results of two different
experiments. The RNAs used were as follows. Lanes 1 and 2, 19 and 20, wild type; lanes 3 and 4, G18 C; lanes 5 and 6, U17 A; lanes 7 and 8, A21 C; lanes 9 and
10, G22 C; lanes 11 and 12, G22 C,
C13 G; lanes 13 and 14, A23 U; lanes 15 and
16, A23 U, U12 A; and lanes 17 and 18, C11 A, U12 C. (B) 32P-labeled
wild-type (lane 1), G22 C (lane 2), G22 C,
C13 G (lane 3), A23 U (lane 4), and
A23 U, U12 A (lane 5) RNAs (100 fmol of
each) were incubated with mitoplasts (100 µg of protein) in the
presence of ATP for 15 min at 37°C, and the RNase-resistant RNA was
analyzed. Band quantitation was performed as in Fig. 1; the smear at
the bottom of lane 7 was disregarded. (C) Matrix targeting in vivo.
(Upper panel) Promastigotes were transfected with
32P-labeled wild-type minihelix (1 pmol) in the absence
(lanes 1 to 3) or presence of 10 µM CCCP (lane 4) or of 50 µM
oligomycin (lane 5). Aliquots of the transfected cells were lysed, and
mitochondrial fractions were treated with RNase and DNase in the
absence (lanes 1, 4, and 5) or presence of 1% Triton X-100 (lane 2) or
320 µM digitonin (lane 3). (Lower panel) Promastigotes were
transfected with the wild type (lane 1) or the G22 C
(lane 2), G22 C, C13 G (lane 3),
A23 U (lane 4), A23+ U, U12 A
(lane 5), and C11 A, U12 C (lane 6)
mutants, and the RNase-resistant RNA associated with the mitochondrial
fraction was analyzed. Quantitation was performed by densitometry.
|
|
Targeting of the D arm minihelix to the mitochondrial MX in
vivo.
From the preceding in organello analysis, it is evident that
mutations in the conserved D arm motif result in deficiency of transport into the mitochondrial MX, due to a defect in either OM or IM
transfer. To examine whether this is also true in vivo, 32P-labeled minihelices were introduced into leishmania
promastigotes by electroporation. Transfected cells were lysed by
syringe passage in hypotonic medium, the mitochondrial fraction was
recovered and treated with DNase and RNase, and the nuclease-resistant
RNA was analyzed. Hypotonic treatment results in leakage of the
contents of the IMS; this assay therefore scores exclusively for
MX-localized RNA and does not distinguish between OM and IM transfer.
Approximately 20 to 40 molecules of the wild-type minihelix per
transfected cell were recovered from the mitochondrial fraction
under
optimal conditions (Fig.
2C). Entrapment of the RNA within
a membrane
vesicle was evident from an enhanced RNase sensitivity
in the presence
of Triton X-100, but RNase resistance was unaffected
by treatment with
digitonin at a concentration which selectively
permeabilizes the OM
(
17), indicating MX localization. Transfection
in the
presence of the mitochondrial inhibitors CCCP and oligomycin
resulted
in reduction of MX transfer in vivo (Fig.
2C), consistent
with the
sensitivity of in organello IM transfer to these agents
(
17)
(Fig.
1). About 20% of the RNA remained RNase resistant
in the
presence of Triton X-100 or the inhibitors; this could
be due to
sequestration into an unknown subcellular component
present in the
crude mitochondrial
fractions.
The effect of mutations on targeting in vivo was analyzed. All the
mutants examined were deficient in MX localization (Fig.
2C). The
C
11
A, U
12
C mutant was targeted at about
15% of the wild-type level. These
data confirm that the D arm signal
is necessary and sufficient
for transport into the mitochondrial MX in
vivo as well as in
vitro.
Sequence-specific binding of D arm variants to OM and IM.
To
determine whether the above effects on OM and IM transfer reflect
altered binding to membrane-bound receptors, 32P-labeled
minihelices were allowed to interact with intact mitochondria or
mitoplasts under conditions favoring specific binding but discouraging translocation (i.e., in the presence of 0.1 M KCl at 0°C, in the absence of ATP) (12). The vesicles were then washed, and
bound RNA was analyzed by gel electrophoresis. Control experiments
(data not shown) demonstrated that the bound RNA was completely
sensitive to RNase, i.e., it was associated with the membrane surface.
Both the G
22
C and G
22
C,
C
13
G mutants were bound inefficiently to the OM, but the
second mutation restored IM binding to about
60% of that of the wild
type (Fig.
3A). In contrast, restoration
of the second base pair in the stem (i.e., A
23
U,
U
12
A) increased binding to the OM but not to the IM
(Fig.
3A). The
wild-type sequence bound to the OM and IM with apparent
Kd values
of 0.93 and 3.86 nM, respectively
(Table
3). The mutation
G
22
C increased
KdOM
nearly 8-fold, while
KdIM was
increased 12-fold. But whereas
KdOM
remained high for the double mutant G
22
C,
C
13
G,
KdIM was
restored to near-wild-type levels (Table
3). The converse
effect of
base pair restoration at the next position (A
23) was also
evident: reformation of the AU pair reduced
KdOM by a factor of 2 but increased
KdIM by a factor of 3.5 (Table
3).
Finally, the double mutation C
11
A, U
12
C
had a much more severe effect on
KdIM (8-fold) than on
KdOM (2-fold). Thus, the binding
efficiencies parallel the transfer
efficiencies and indicate the
presence of distinct receptors on
the two membranes which recognize
different structural features
of the D arm.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of minihelices to the OM and IM. (A) The
following 32P-labeled RNAs were incubated with mitochondria
(lanes 1 to 5) or mitoplasts (lanes 6 to 10): lanes 1 and 6, wild type;
lanes 2 and 7, G22 C; lanes 3 and 8, G22 C,
C13 G; lanes 4 and 9, A23 U; and lanes 5 and 10, A23 U, U12 A. After washing with
STE, the membrane-bound RNA was recovered and analyzed as in Fig. 1.
The amounts of wild-type RNA (taken as 100%) bound to mitochondria
(lane 1) and mitoplasts (lane 6) were 0.64 and 1.12 fmol, respectively.
(B) Stability of inner membrane complexes of wild-type (lanes 1 to 4)
and G22 C, C13 G mutant (lanes 5 to 8)
minihelices. Binding reactions with mitoplasts were performed with the
incubation intervals shown. Control reactions without incubation (lanes
1 and 5) yielded 1.80 and 1.01 fmol, respectively. Quantitations were
performed by densitometric scanning of the major band in each lane.
|
|
Although the net yields of the complexes formed with the wild-type
sequence and the G
22
C, C
13
G mutant were
comparable, there was a notable difference in their
rates of
dissociation (Fig.
3B). Thus, while the wild-type complex
remained
stable for at least 30 min at 0°C, more than 90% of the
mutant
complex was dissociated within this time
period.
Competition between D arm variants at OM and IM.
From the
above experiments, two mutants were identified which are transferred
through the OM, but not IM, with good efficiency: the
A23
U, U12
A mutant and the
C11
A, U12
C mutant. Conversely, the
G22
C, C13
G mutant is transferred
efficiently through the IM but not the OM. Only the wild-type sequence
is transferred through both the membranes efficiently. To examine
whether the different structures use the same or distinct receptors at
either membrane, competition assays were performed in which one labeled
oligonucleotide was challenged with an excess of another
oligonucleotide (either unlabeled or labeled to low specific activity).
OM transfer of both the A23
U, U12
A and
C11
A, U12
C mutants was efficiently
competed out by the wild-type sequence, although in the latter case
competition was somewhat less effective than in the self-self situation
(Fig. 4A). At the IM, the wild-type structure and the G22
C, C13
G mutant also
competed with each other, and again, cross competition was
quantitatively less than self-competition (Fig. 4B). Competition for
transfer was paralleled by competition for binding at either membrane
(data not shown). These results are consistent with the binding of the
different structures to the same or similar receptors at either
membrane, albeit with different affinities (Table 3).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 4.
Cross competition between wild-type and mutant
minihelices for transfer across OM and IM. Mitochondria (A) or
mitoplasts (B) were incubated with high-specific-activity
32P-labeled RNA (L) in the absence or presence of
low-specific-activity competitor (C; C/L, ratio of competitor to
substrate), and total uptake was assayed with RNase protection. Panel
A, lanes 1 to 2, 3 to 4, and 5 to 6, contained high-specific-activity
wild-type, A23 U, U12 A, and
C11 A, A12 U RNA (100 fmol), respectively.
Wild-type competitor (1 pmol) was included in reactions 2, 4, and 6. In
panel B, high-specific-activity wild-type (lanes 1 to 5) or
G12 C, C13 G (lanes 6 to 10) RNA (100 fmol)
was incubated without competitor (lanes 1 and 6), with 0.5 pmol (lanes
2 and 9) or 5 pmol (lanes 3 and 10) of wild-type competitor, or with
0.5 pmol (lanes 4 and 7) or 5 pmol (lanes 5 and 8) of
G22 C, C13 G competitor. Quantitations were
performed by densitometric scanning of the major band in each lane.
|
|
Dependence of OM and IM transfer on TAB.
TAB is an
OM-associated RNA binding protein required for the uptake of
tRNATyr into leishmania mitochondria (1). To
examine the role of TAB in the uptake and intramitochondrial
distribution of D arm minihelices, antibody inhibition experiments were
performed (Fig. 5A). Anti-TAB antibody,
but not normal IgG (Fig. 5A) or antibody against total leishmania
antigen (data not shown), inhibited OM transfer of the wild-type
sequence as well as that of the A23
U,
U12
A, and C11
A, U12
C
mutants. Thus, the mutants, like the wild type, interact with TAB at
the OM.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of anti-TAB antibody on transfer of RNA
across the OM and IM. (A) Intact mitochondria (100 µg of protein)
preincubated with normal (n) or anti-TAB ( ) IgG were incubated with
100 fmol of wild-type D arm minihelix (left), A23 U,
U12 A mutant (center), or C11 A,
U12 C mutant (right) in the presence of ATP. The amounts
of total internalized RNA (IM + MX) are expressed as percentages
of the control values obtained in the presence of normal IgG. (B)
Mitoplasts were incubated with normal (n) or anti-TAB ( ) IgG and
then with 100 fmol of tRNATyr(GUA) transcript (left),
wild-type D arm minihelix (center), or G22 C,
C13 G mutant (right) for 15 min at 37°C and treated
with RNase, and the internalized RNA was recovered. IM transfer is
expressed as the percentage of the control value obtained with normal
IgG. Quantitations were performed as for Fig. 4. In panel B, middle,
both bands are of nearly equal intensity and yield similar values for
extent of inhibition.
|
|
In marked contrast, transfer of tRNA
Tyr as well as
transfer of the wild-type D arm minihelix and the G
22
C,
C
13
G mutant across the IM of isolated mitoplasts was
resistant to
anti-TAB antibody (Fig.
5B). This observation indicates
that IM
receptors that are distinct from TAB mediate transport
into the
matrix.
 |
DISCUSSION |
In this report, a simple method for probing the structural basis
of the selectivity of mitochondrial tRNA import is described. The use
of synthetic oligonucleotides as import substrates is based on our
observation that the D arm of tRNATyr is necessary and
sufficient for import in organello (13) as well as in vivo
(Fig. 2), and this approach also greatly facilitates the generation of
mutations for the study of structure-function relationships.
Furthermore, fractionation of the submitochondrial compartments allows
an assessment of the effect of an individual mutation on the precise
location of the corresponding structure within the mitochondrion. By
all the criteria examined, i.e., competition by intact tRNA (Fig. 1),
effect of anti-TAB antibody on import into mitochondria or mitoplasts
(Fig. 5), dependence on ATP and temperature (Table 1), and inhibition
of transfer by inhibitors and uncouplers (Fig. 1 and Table 1), the D
arm minihelix appears to be using the same pathway for import as the parental molecule, although the rate and extent of import of the minihelix are noticeably higher (Fig. 1), presumably due to its smaller
size and/or the lack of inhibitory sequences.
Site-specific mutagenesis of the D arm minihelix revealed a number of
distinct phenotypes (Fig. 2 and Table 1). In the first group of mutants
(U17
A, G18
C; A21
C,
G22
C; and A23
U), both OM and IM transfer
were reduced relative to the wild type. In the second group
(A23
U, U12
A and C11
A,
U12
C), OM transfer was reasonably efficient (about 60%
of the wild type), but IM transfer was considerably reduced, with the
RNA accumulating at the IM (Fig. 2). The third type of mutation, i.e., G22
C, C13
G, had the opposite property:
efficient IM but defective OM transfer (Fig. 2). These results imply
that the RNA sequence and/or structural specificities at the two
membranes are nonidentical.
The differences are particularly pronounced when bases in the stem of
the D arm (Fig. 1A) are altered. Each of the single mutations
(G22
C and A23
U), or the double mutation
on the same side of the helix (C11
A,
U12
C), results in a drastic reduction of secondary
structure stability (Table 3); the FOLDRNA program (26)
predicts relatively unstable energy-minimized structures with the
canonical 4-bp stem replaced by loops, bulges, and non-Watson-Crick
pairs (data not shown). Restoration of the loop-closing pair by the
second C13
G mutation, or of the neighboring pair by the
U12
A mutation, results in restoration of the wild-type
conformation. It would seem from this limited structure-function study
that the loop-closing pair (G22:C13) is
critical at both membranes, but for different reasons: while the G base
is specifically recognized at the OM, base pairing is more important at
the IM, since restoration of the pair in reverse results in
reappearance of IM transfer (Fig. 2) and an increase in binding
affinity for the IM receptor (Table 3). Conversely, the A23
residue critically interacts with the IM receptor(s) but may be
replaced by U at the OM. This would explain the lack of reversion for
IM transfer in the A23
U, U12
A mutant
(Fig. 2); in fact, the binding affinity of this mutant for the IM is
further lowered (Table 3). The importance of base pairing for IM
transfer is further illustrated by the effects of the double mutation
of C11 and U12 in the stem, which results in
considerable weakening of the secondary structure (Table 3), while
leaving the critical A23 and other residues in the
conserved region intact. This mutation, however, only marginally
affects OM transfer (Fig. 2) or OM binding (Table 3), suggesting
recognition of primary sequence, rather than secondary structure, by
the OM receptor TAB. In fact, synthetic transcripts containing the
nonanucleotide conserved motif but lacking significant secondary
structure are transferred efficiently through the OM by the
TAB-dependent pathway (13, 14). Regardless of the precise
nature of the interactions, it is evident from these experiments that
distinct receptors exist for OM and IM transfer. This conclusion was
reinforced by the resistance of IM transfer to antibody against TAB
(Fig. 5).
Almost nothing is currently known about the nature of tRNA import
factors. A major problem in systems such as leishmania, ciliates, and
higher plants is the nonavailability of mutants with defective
mitochondrial function. The use of oligonucleotide probes, coupled with
submitochondrial fractionation, constitutes an alternative and general
approach for the identification of the components of the membrane
transport machinery. Previous experiments using intact tRNA molecules
indicated the occurrence of nonproductive binding to mitochondrial
membranes, with only about 10% of RNA bound to the OM being
internalized (12); moreover, tRNAGln binds
efficiently to the OM in a TAB-independent manner but is poorly
imported (13). This occurrence of nonproductive binding makes it difficult to decide whether a particular tRNA binding membrane
protein is an import factor or is unrelated to import. In contrast,
binding of D arm oligonucleotides to the IM shows a strict correlation
with importability. The most striking example of this correlation is
the loss of binding as well as import in the G22
C
mutant, and their simultaneous restoration by the second mutation, C13
G (Fig. 2 and 3 and Table 3). This should allow the
identification of putative IM receptors by photochemical cross-linking
and other methods.
The observed differential effects of the same mutation on OM and IM
transfer support and refine the stepwise transport model (17) of mitochondrial tRNA import (Fig.
6). In this model, a tRNA species
containing the conserved D arm import signal is proposed to bind to TAB
at the OM and to be transferred in an ATP-dependent manner into the
IMS, where it interacts with a different receptor or receptor complex
on the IM. Subsequent translocation into the MX is driven by both the
electrical (
) and chemical (
pH) components of the proton
motive force across the IM. In the in vitro system, the proton motive
force is generated by F1F0 ATPase-catalyzed ATP
hydrolysis, with concomitant translocation of protons across the IM
(Fig. 6).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 6.
Stepwise transfer of tRNA through the two mitochondrial
membranes. For details see the text. TAB, outer membrane receptor;
IMRC, inner membrane receptor complex components (two components are
shown);  , membrane potential; pH, proton gradient;
F1-F0 ATPase, oligomycin-sensitive proton
pump.
|
|
Mitochondrial translation is dependent on the presence of an adequately
balanced pool of different tRNA species in the MX. Independent
evolution of OM and IM receptor specificities may be a means of
ensuring this balance. Since the MX concentration of an individual
species is dependent on the efficiencies of OM and IM transfer, a low
efficiency of OM transfer would be compensated for by a high efficiency
of IM transfer, and vice versa. There is also evidence that other
domains of the tRNA molecule besides the D arm contain import signals.
In tetrahymena, the anticodon of tRNAGln(UUG)
functions as an import signal (20). Moreover, a
tRNAIle derivative containing a nonfunctional D arm
sequence from tRNAGln is nonetheless imported into
leishmania mitochondria in vivo (10), indicating the
presence of a signal elsewhere in the molecule, possibly in the
anticodon arm, in addition to the one in the D arm. The presence of
distinct OM and IM transport machineries would allow the sequential use
of different signals on the same molecule for MX entry.
 |
ACKNOWLEDGMENTS |
We are indebted to Subhagata Ghosh for technical assistance,
Chanchal Dasgupta for nucleotides, and Tapas Ghosh of the
Bioinformatics Centre, Bose Institute, for running the FOLDRNA program.
This work was supported by a grant from the Department of Science and
Technology, Government of India. S.N.B. and S.M. were supported by
fellowships from the Council of Scientific and Industrial Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Genetic
Engineering Laboratory, Indian Institute of Chemical Biology, 4 Raja
S. C. Mullick Rd., Calcutta 700032, India. Phone: 91 33 473 3491, ext. 136. Fax: 91 33 473 5197/0284. E-mail:
IICHBIO{at}GIASCL01.VSNL.NET.IN.
 |
REFERENCES |
| 1.
|
Adhya, S.,
T. Ghosh,
A. Das,
S. K. Bera, and S. Mahapatra.
1997.
Role of an RNA binding protein in import of tRNA into Leishmania mitochondria.
J. Biol. Chem.
272:21396-21402[Abstract/Free Full Text].
|
| 2.
|
Chiu, N.,
A. Chiu, and Y. Suyama.
1975.
Native and imported transfer RNA in mitochondria.
J. Mol. Biol.
94:37-50.
|
| 3.
|
Das, S., and S. Adhya.
1990.
Organization and chromosomal localization of -tubulin genes in Leishmania donovani.
J. Biosci.
15:239-248.
|
| 4.
|
Ghosh, A.,
T. Ghosh,
S. Ghosh,
S. Das, and S. Adhya.
1994.
Interaction of small ribosomal and transfer RNAs with a protein from Leishmania donovani.
Nucleic Acids Res.
22:1663-1669[Abstract/Free Full Text].
|
| 5.
|
Gray, M. W.,
G. Burger, and B. F. Lang.
1999.
Mitochondrial evolution.
Science
283:1476-1481[Abstract/Free Full Text].
|
| 6.
|
Gray, M. W.,
B. F. Lang,
R. Cedergren,
G. B. Golding,
C. Lemieux,
D. Sankoff,
M. Turmel,
N. Brossard,
E. De Lage,
T. G. Littlejohn,
I. Plante,
P. Rioux,
D. Saint-Louis,
Y. Zhu, and G. Burger.
1998.
Genome structure and gene content in protist mitochondrial DNAs.
Nucleic Acids Res.
26:865-878[Abstract/Free Full Text].
|
| 7.
|
Hancock, K., and S. L. Hajduk.
1990.
The mitochondrial tRNAs of Trypanosoma brucei are nuclear encoded.
J. Biol. Chem.
265:19203-19215.
|
| 8.
|
Hauser, R., and A. Schneider.
1995.
tRNAs are imported into the mitochondria of Trypanosoma brucei independent of their genomic context and of their genetic origin.
EMBO J.
14:4212-4220[Medline].
|
| 9.
|
Kumar, R.,
L. Marechal-Drouard,
K. Akama, and I. Small.
1996.
Striking differences in mitochondrial tRNA import between different plant species.
Mol. Gen. Genet.
252:404-411[Medline].
|
| 10.
|
Lima, B. D., and L. Simpson.
1996.
Sequence dependent in vivo importation of tRNAs into the mitochondrion of Leishmania tarentolae.
RNA
2:429-440[Abstract].
|
| 11.
|
Lye, L.-F.,
D.-H. T. Chen, and Y. Suyama.
1993.
Selective import of nuclear-encoded tRNAs into mitochondria of the protozoan Leishmania tarentolae.
Mol. Biochem. Parasitol.
58:233-246[CrossRef][Medline].
|
| 12.
|
Mahapatra, S., and S. Adhya.
1996.
Import of RNA into Leishmania mitochondria occurs through direct interaction with membrane-bound receptors.
J. Biol. Chem.
271:20432-20437[Abstract/Free Full Text].
|
| 13.
|
Mahapatra, S.,
S. Ghosh,
S. K. Bera,
T. Ghosh,
A. Das, and S. Adhya.
1998.
The D arm of tRNATyr is necessary and sufficient for import into Leishmania mitochondria in vitro.
Nucleic Acids Res.
26:2037-2041[Abstract/Free Full Text].
|
| 14.
|
Mahapatra, S.,
T. Ghosh, and S. Adhya.
1994.
Import of small RNAs into Leishmania mitochondria in vitro.
Nucleic Acids Res.
22:3381-3386[Abstract/Free Full Text].
|
| 15.
|
Martin, R. P.,
J.-M. Schneller,
A. J. Stahl, and G. Dirheimer.
1979.
Import of nuclear deoxyribonucleic acid coded lysine-accepting transfer ribonucleic acid (anticodon C-U-U) into yeast mitochondria.
Biochemistry
18:4600-4605[CrossRef][Medline].
|
| 16.
|
Mottram, J. C.,
S. D. Bell, and D. J. Barry.
1991.
tRNAs of Trypanosoma brucei: unusual gene organization and mitochondrial importation.
J. Biol. Chem.
266:18313-18317[Abstract/Free Full Text].
|
| 17.
|
Mukherjee, S.,
S. N. Bhattacharyya, and S. Adhya.
1999.
Stepwise transfer of tRNA through the double membrane of Leishmania mitochondria.
J. Biol. Chem.
274:31249-31255[Abstract/Free Full Text].
|
| 18.
|
Nabholz, C. E.,
E. K. Horn, and A. Schneider.
1999.
tRNAs and proteins are imported into mitochondria of Trypanosoma brucei by two distinct mechanisms.
Mol. Biol. Cell
10:2547-2557[Abstract/Free Full Text].
|
| 19.
|
Ragan, C. I.,
M. T. Wilson,
V. M. Darley-Usmar, and P. N. Lowe.
1987.
Sub-fractionation of mitochondria and isolation of the proteins of oxidative phosphorylation, p. 79-112.
In
V. M. Darley-Usmar, D. Rickwood, and M. T. Wilson (ed.), Mitochondria, a practical approach. IRL Press, Oxford, England.
|
| 20.
|
Rusconi, C. P., and T. R. Cech.
1996.
The anticodon is the signal sequence for mitochondrial import of glutamine tRNA in Tetrahymena.
Genes Dev.
10:2870-2880[Abstract/Free Full Text].
|
| 21.
|
Schneider, A.,
J. Martin, and N. Agabian.
1994.
A nuclear encoded tRNA of Trypanosoma brucei is imported into mitochondria.
Mol. Cell. Biol.
14:2317-2322[Abstract/Free Full Text].
|
| 22.
|
Shi, X.,
D. H.-T. Chen, and Y. Suyama.
1994.
A nuclear tRNA gene cluster in the protozoan Leishmania tarentolae and differential distribution of nuclear-encoded tRNAs between the cytosol and mitochondria.
Mol. Biochem. Parasitol.
65:23-37[CrossRef][Medline].
|
| 23.
|
Simpson, A. M.,
Y. Suyama,
H. Dewes,
D. Campbell, and L. Simpson.
1989.
Kinetoplastid mitochondria contain functional tRNAs which are encoded in nuclear DNA and also contain small minicircle and maxicircle transcripts of unknown function.
Nucleic Acids Res.
17:5427-5445[Abstract/Free Full Text].
|
| 24.
|
Volckaert, G., and W. Fiers.
1977.
Micro thin-layer techniques for rapid sequence analysis of 32P-labeled RNA: double digestion and pancreatic ribonuclease analyses.
Anal. Biochem.
83:228-239[CrossRef][Medline].
|
| 25.
|
Yermovsky-Kammerer, A. E., and S. L. Hajduk.
1999.
In vitro import of a nuclearly encoded tRNA into the mitochondrion of Trypanosoma brucei.
Mol. Cell. Biol.
19:6253-6259[Abstract/Free Full Text].
|
| 26.
|
Zuker, M.
1989.
Computer prediction of RNA structure.
Methods Enzymol.
180:262-268[Medline].
|
Molecular and Cellular Biology, October 2000, p. 7410-7417, Vol. 20, No. 19
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Basu, S., Mukherjee, S., Adhya, S.
(2008). Proton-guided movements of tRNA within the Leishmania mitochondrial RNA import complex. Nucleic Acids Res
36: 1599-1609
[Abstract]
[Full Text]
-
Chatterjee, S., Home, P., Mukherjee, S., Mahata, B., Goswami, S., Dhar, G., Adhya, S.
(2006). An RNA-binding Respiratory Component Mediates Import of Type II tRNAs into Leishmania Mitochondria. J. Biol. Chem.
281: 25270-25277
[Abstract]
[Full Text]
-
Goswami, S., Adhya, S.
(2006). The {alpha}-Subunit of Leishmania F1 ATP Synthase Hydrolyzes ATP in Presence of tRNA. J. Biol. Chem.
281: 18914-18917
[Abstract]
[Full Text]
-
Goswami, S., Dhar, G., Mukherjee, S., Mahata, B., Chatterjee, S., Home, P., Adhya, S.
(2006). A bifunctional tRNA import receptor from Leishmania mitochondria. Proc. Natl. Acad. Sci. USA
103: 8354-8359
[Abstract]
[Full Text]
-
Mahata, B., Bhattacharyya, S. N., Mukherjee, S., Adhya, S.
(2005). Correction of Translational Defects in Patient-derived Mutant Mitochondria by Complex-mediated Import of a Cytoplasmic tRNA. J. Biol. Chem.
280: 5141-5144
[Abstract]
[Full Text]
-
Sherrer, R. L., Yermovsky-Kammerer, A. E., Hajduk, S. L.
(2003). A Sequence Motif within Trypanosome Precursor tRNAs Influences Abundance and Mitochondrial Localization. Mol. Cell. Biol.
23: 9061-9072
[Abstract]
[Full Text]
-
Goswami, S., Chatterjee, S., Bhattacharyya, S. N., Basu, S., Adhya, S.
(2003). Allosteric regulation of tRNA import: interactions between tRNA domains at the inner membrane of Leishmania mitochondria. Nucleic Acids Res
31: 5552-5559
[Abstract]
[Full Text]
-
Bhattacharyya, S. N., Chatterjee, S., Goswami, S., Tripathi, G., Dey, S. N., Adhya, S.
(2003). "Ping-Pong" Interactions between Mitochondrial tRNA Import Receptors within a Multiprotein Complex. Mol. Cell. Biol.
23: 5217-5224
[Abstract]
[Full Text]
-
Bhattacharyya, S. N., Chatterjee, S., Adhya, S.
(2002). Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane. Mol. Cell. Biol.
22: 4372-4382
[Abstract]
[Full Text]