Previous Article | Next Article 
Molecular and Cellular Biology, January 2000, p. 542-555, Vol. 20, No. 2
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Distinct Subcellular Localization Patterns
Contribute to Functional Specificity of the Cln2 and Cln3
Cyclins of Saccharomyces cerevisiae
Mary E.
Miller and
Frederick R.
Cross*
The Rockefeller University, New York, New
York 10021
Received 11 August 1999/Returned for modification 20 September
1999/Accepted 7 October 1999
 |
ABSTRACT |
The G1 cyclins of budding yeast drive cell cycle
initiation by different mechanisms, but the molecular basis of their
specificity is unknown. Here we test the hypothesis that the functional
specificity of G1 cyclins is due to differential
subcellular localization. As shown by indirect immunofluorescence and
biochemical fractionation, Cln3p localization appears to be primarily
nuclear, with the most obvious accumulation of Cln3p to the nuclei of
large budded cells. In contrast, Cln2p localizes to the cytoplasm. We
were able to shift localization patterns of truncated Cln3p by the
addition of nuclear localization and nuclear export signals, and we
found that nuclear localization drives a Cln3p-like functional profile, while cytoplasmic localization leads to a partial shift to a Cln2p-like functional profile. Therefore, forcing Cln3p into a Cln2p-like cytoplasmic localization pattern partially alters the functional specificity of Cln3p toward that of Cln2p. These results suggest that
there are CLN-dependent cytoplasmic and nuclear events
important for cell cycle initiation. This is the first indication of a
cytoplasmic function for a cyclin-dependent kinase. The data presented
here support the idea that cyclin function is regulated at the level of
subcellular localization and that subcellular localization contributes
to the functional specificity of Cln2p and Cln3p.
 |
INTRODUCTION |
Key events in the eukaryotic cell
cycle are regulated by the serine-threonine cyclin-dependent kinase
(cdk). The binding of regulatory cyclin subunits to the cdk enzyme
induces structural changes that are required for kinase activity. In
addition to the activation of the cdk, cyclin molecules are thought to
serve targeting functions, conferring functional specificity to
different cyclin-cdk complexes (37). In Saccharomyces
cerevisiae the cdk encoded by the CDC28 gene, Cdc28p,
regulates the cell division cycle when bound to one of nine different
cyclins: CLN1 to CLN3, and CLB1 to
CLB6.
During the postmitotic growth period prior to DNA replication, haploid
cells are able to respond to mating pheromone or initiate a round of
cell division. Initiation of the cell division cycle follows a critical
cell size threshold and requires the accumulation of Clbp-Cdc28p kinase
activity, which is required for DNA replication and subsequent mitosis.
Each of these events (cell size, mating pathway activation, and Clbp
activation) are regulated by the Cln proteins.
Deletion of all three CLN genes results in a cell cycle
arrest as unbudded cells with 1C DNA content. Genetic characterization of the CLN genes shows that CLN1,
CLN2, and CLN3 are functionally redundant, since
any one CLN gene is able to complement the arrest caused by
the triple cln1 cln2 cln3 deletion. However, there are significant differences in expression, primary sequence, and functional specificity of CLN2 (representative of the highly homologous
CLN1-CLN2 gene pair) and CLN3. CLN2
transcription is cell cycle regulated, peaking at late G1
(59, 64). CLN3 transcription is relatively constitutive, with a two- to threefold peak during the time in the cell
cycle where wild-type cells finish mitosis and begin G1,
prior to CLN2 expression (16, 33, 41, 59, 64).
The sequence similarity between these two classes of CLN
genes is low and confined to the cyclin box, a region of the cyclin
involved in physical interactions with Cdc28p (19).
Functional analysis of CLN2 and CLN3 indicate
that CLN3 is primarily required for the expression of genes
during late G1. The Swi4p-Swi6p complex, called SBF, is
required for the CLN3-dependent expression of
CLN1-CLN2 (26). The BCK2 gene product
also triggers transcription of CLN1-CLN2. The
BCK2-dependent activation of CLN1-CLN2 most
likely occurs through the SBF complex, working in parallel with Cln3p
to activate CLN1-CLN2 (9, 13). CLN3 is
unable to complement the triple cln1 cln2 cln3 deletion in
the absence of SWI4 or SWI6, indicating that this
transcription complex is crucial for Cln3p-dependent viability.
Cln2p-dependent viability in the triple cln1 cln2 cln3
deletion strain does not require Swi4p or Swi6p (27). The
Mbp1p-Swi6p complex, called MBF, may also be responsive to Cln3p.
Transcripts potentially regulated by Cln3p through the MBF include the
CLB5 and CLB6 cyclins (50), as well as
other genes involved in DNA replication. It is important to note that
the Cln2p-Cdc28p complex is able to activate SBF- and MBF-dependent
transcription, although not as efficiently as the Cln3p-Cdc28p complex
(12, 56). For this reason, the Cln3p-Cdc28p complex is
thought to be the physiologically relevant cdk complex regulating
transcription in G1.
Since Cln2p supports viability in the cln
swi4
and cln
swi6
strains, while Cln3p does not, it is possible
that Cln3p induces expression of proteins that carry out one of several
events normally triggered more directly by Cln2p. The gene pairs
CLB5-CLB6 (50) and PCL1-PCL2 (34,
42) are essential for Cln3p-dependent viability in the triple
cln1 cln2 cln3 deletion strain (27). Each of
these genes encodes a cyclin homologue that can bind to and activate the cdk Cdc28p or Pho85p, respectively. PHO85 is also
essential for viability in cln1 cln2 cells (14),
and Pho85p contributes to phosphorylation of the Sic1p inhibitor of
Clbp-Cdc28p complexes (40). The molecular basis for
lethality of cln1 cln2 pcl1 pcl2 or cln1 cln2
pho85 strains is not well established.
The activation of Clb cyclins results from a combination of cellular
events that are regulated by Clnp-Cdc28p protein kinase activity. As
described above, Cln3p may regulate the MBF-dependent transcription of
CLB5-CLB6. In addition to this, Clnp-Cdc28p-dependent phosphorylation leads to the SCF-dependent ubiquitination and degradation of Sic1p (15, 61). Sic1p is a stoichiometric
inhibitor of Clbp-Cdc28p protein kinase activity (35, 49).
Overexpression of Sic1p results in growth arrest, due to inactivation
of Clbp-Cdc28p activity, and Cln2p is able to suppress this growth
arrest (27, 58). Finally, the Clnp-Cdc28p activity may be
involved in regulating the phosphorylation state of Hct1p.
Unphosphorylated Hct1p promotes the activation of the
anaphase-promoting complex toward Clb2p (22, 48, 62, 68).
Anaphase-promoting complex activity leads to ubiquitination and
subsequent degradation of Clb2p by the proteosome (67).
Events required for proper cell cycle progression that may be regulated
by Cln2p, rather than Cln3p, include cell polarization (29)
and bud emergence (3, 8). The ability of CLN3 to complement the triple cln1 cln2 cln3 deletion is strongly
reduced in the absence of the BUD2 gene due to failure of
bud emergence, indicating that this gene product is important for
Cln3p-dependent morphogenesis. Cln2p-dependent viability in the triple
cln1 cln2 cln3 deletion strain is not influenced by deletion
of BUD2 (27). In wild-type cells, Bud2p is not
essential and is involved in bud site selection (5).
Intrinsic qualitative differences between Cln2p and Cln3p (as opposed
to simple quantitative or timing differences in expression or
associated kinase activity) have been demonstrated through a comparison
of CLN3::CLN2 (CLN2 under the control
of the CLN3 promoter), CLN3, and cln2
mutants by using strains that distinguish genetically between Cln2p and
Cln3p activity (27). However, this study did not establish a
molecular basis for the functional specificity. We address here two
possible mechanisms. First, the cyclin molecule might confer structural
differences to the cdk active site, changing the substrate specificity
of the kinase. Second, differences in subcellular localization might
bring Clnp-Cdc28p complexes into contact with different subsets of
Clnp-Cdc28p protein kinase substrates.
Studies of higher eukaryotic cyclin molecules suggest that localization
is important for cyclin function. Cyclins E, A, D1, and B1 have been
implicated in nuclear events and show nuclear localization when the
cyclin-cdk activity is required for function (2, 4, 11, 20, 25,
31, 32, 43, 45). The correlation is extended by the fact that a
cyclin D1 mutant that is unable to enter the nucleus is unable to
activate DNA replication in fibroblasts (11). The ability of
cyclin B1 to promote mitosis in frog eggs is abolished in mutant cyclin
B1 that does not localize to the nucleus (30). Also, cyclin
B1 that is targeted to the nucleus through addition of a nuclear
localization signal (NLS) or through disruption of the cyclin B1
nuclear export signal (NES) shows a defect in DNA damage-induced
G2 arrest (23, 57). Different cyclins may be
localized by distinct mechanisms. The redistribution of cyclin D1 to
the cytoplasm is triggered by a glycogen synthase kinase
3
-dependent phosphorylation event (10). The distinct localization pattern of cyclin B1, which accumulates in the nucleus during mitosis, results from a balance between CRM1-mediated nuclear export and nuclear import most likely mediated by the importin
/
complex (36, 44, 66).
In the study presented here, we analyze differential localization of
Cln2p and Cln3p in Saccharomyces cerevisiae. The
localization patterns are distinct, and our data support the idea that
these distinct patterns contribute to cyclin functional specificity.
 |
MATERIALS AND METHODS |
The relevant genotypes of the yeast strains used are shown in
Table 1. All strains are congenic with
BF264-15D (46). YPDex, YPGal, and synthetic complete (SC)
media for yeast growth were prepared as described earlier
(51). Yeast cells were transformed with plasmid DNA as
described previously (18).
Plasmids.
The 9X myc epitope-tagged
GAL1::CLN2myc (AG4) and
GAL1::CLN3hamyc (AG2) were
derived from the plasmids KH100 and KL002-4 (27) by A. Gartner. The 9X myc tag is engineered at the C terminus of the cyclin
proteins in these constructs. The Cln2myc integration
plasmid (pMM56) was constructed by replacing the NotI
cassette containing the 3× hemagglutinin (HA) epitope tag of MT104
with the NotI cassette containing the 9X myc epitope tag of
AG2. This construct contains a CLN2 promoter driven
CLN2myc and integrates at the endogenous
CLN2 locus. The
GAL1::CLN3hamyc integration
plasmid (pMM64) was constructed by inserting the NotI
cassette containing the 9X myc epitope tag of AG2 into the NotI site of pKL036. pKL036 results from the insertion of
the SalI-SacII fragment of pKL002-4
(27) into the polylinker of pRS404 (52). The
pMM64 construct was used for ectopic integration of the
GAL1::CLN3hamyc cassette at
the URA3 locus.
The
CLN2myc and
CLN3hamyc
plasmids (pMM82 and pMM45, respectively) each contain a 9X myc
epitope-tagged
CLN gene under the control
of the
CLN3 promoter in a low-copy-number
TRP1 vector
and were
constructed as follows. The
SalI-
ClaI
GAL1 promoter cassette of
AG2 and AG4 were replaced with the
SalI-
ClaI
CLN3 promoter cassette
of
pKL001 (
27). Sequencing shows a base change within the
carboxy-terminal
tail of
CLN3 used in these studies. This
base change results in
an amino acid change of proline 462 to glutamic
acid (P462Q).
Cln3 constructs that contain a proline at position 462 were constructed
and tested for function to ensure that this base
change did not
alter Cln3p function. No differences in protein levels,
the presence
of the 35-kDa Cln3p species (see below), localization
patterns,
or
CLN function (as defined by cell volume assay,
cln-complementation
assay, or mutant strain rescue assay as
described here) were observed
between strains containing pMM45
(
CLN3 with P462Q) and pMM99 (
CLN3 with P462)
(data not shown). The pMM99 construct contains a 9X
myc epitope-tagged
CLN3 gene (with no HA epitope tag) under the
control of the
CLN3 promoter in a low-copy-number
TRP1 vector.
The pMM99 was constructed by PCR amplification of the
CLN3
coding
sequence by using the plasmid pBSI6 as a template. The 3' primer
for the
CLN3 amplifications was
5'-CTAGCGGCCGCTGCGAGTTTTCTTGAGGTTGCTACTATC-3'
and the 5'
primer was 5'-CGAATTGCCCGAGTAGTCTCC-3'. PCR products
were subsequently
cloned into TOPOII vector with topoisomerase-based
ligations
(Invitrogen).
EcoRI-
NotI cassettes from the
TOPOII clones
were used to replace the
EcoRI-
NotI
CLN3 sequences of pMM45 to
give rise to pMM97. The 9X myc
epitope tag
NotI cassette from
pAG4 was cloned into the
NotI site following the
CLN3 sequences
in pMM97
to give rise to pMM99. The pMM99 plasmid was sequenced
to confirm that
CLN3 coding sequences were followed in frame by
the 9X myc
epitope tag, and no errors were introduced during the
PCR
amplification.
The 9X myc epitope-tagged
CLN3-1hamyc construct
(pMM55) was made by inserting the 9X myc epitope
NotI
fragment of AG2 at the
NotI
site immediately following the
3X HA tag of pKL037. This results
in
CLN3-1hamyc
driven from the
CLN3 promoter on a low-copy
TRP1
vector. The
pKL037 plasmid was made by replacing the
BamHI-
EcoRI fragment
of pKL001 with the
BamHI-
EcoRI fragment of MT9. Constructs were
sequenced to confirm that the
NotI fragment insertion gave
rise
to the 9X myc tag expressed in frame with the
CLN3-1ha coding
sequence.
NLS-
CLN2myc (pMM60),
mnls-
CLN2myc (pMM61),
NES-
CLN2myc (pMM92), and
mnes-
CLN2myc (pMM93) were constructed by PCR
amplification of AG4 template
sequences with a 5' primer that encodes a
ClaI restriction endonuclease
site followed by the NLS, nls
(
39), NES, or nes (
17,
54,
63) localization
signals in frame with
CLN2. PCR products were
subsequently
cloned into TOPOII vector with topoisomerase-based
ligations
(Invitrogen).
ClaI-
SpeI cassettes from the TOPOII
clones
were used to replace the
ClaI-
SpeI
cassette of pMM82. The 5' primers
for the
CLN2 PCR
amplifications are as follows (with the
ClaI
restriction
site indicated in brackets, the localization signal
underlined, and the
bases changed in mutant nls or nes sequences
in lowercase
letters): NLSCLN2,
5'- GG[ATCGAT]CCGACAGACA
ATGCCCAAGAAGAAGCGGAAGGTCGC
TAGTGCTGAACCAAGACCCCG-3';
nlsCLN2,
5'-GG[ATCGAT]CCGACA GACA
ATGCCCAAGAcGAAGCGGAAGGTCGCTAGTGCTGAACCAAG ACCCCG;
NESCLN2,
5'-CC[ATCGAT]CGACAGACAATGGAATTAGCCT TGAAATTAGCAGGTCTTGATATCAACAAGACAGCTAGTGCTGAACC
AAGACCCCG-3';
and nesCLN2,
5'-CC[ATCGAT]CGACAGACA
ATGGAATTAGCCTTGAAATTAGCAGGTgcTGATATCAACAAGACAGCTAGTGCTGAACCAAGACCCCG-3'.
The 3' primer for the
CLN2 PCR reactions is
5'-CTGAGCAGCGTAATCT-3'.
The
NLS-
CLN3hamyc (pMM74),
nes-
CLN3hamyc (pMM75),
NES-
CLN3hamyc (pMM76), and
nes-
CLN3hamyc (pMM77) plasmids were constructed
by the same method as that
used for the
CLN2 plasmids. In
this case, the template for PCR
reactions was the pKL001 plasmid and
the
ClaI-
EcoRI cassettes
from the TOPOII clones
were used to replace the
ClaI-
EcoRI cassette
of
pMM45. The 5' primers for these PCR amplifications are as follows:
NLSCLN3,
5'-GG[ATCGAT]CCGACAGACA
ATGCCCAAGAAGAAGCGGAAGGTCGCCATATTGAAGGATACCATAATT-3';
nlsCLN3,
5'-GG[ATCG AT]CCGACAGACA
ATGCCCAAGAcGAAGCGGAAGGTCGCCATATTG
AAGGATACCATAATT-3';
NESCLN3,
5'-CC[ATCGAT]TTTCTGTACG
AT GGAATTAGCCTTGAAATTAGCAGGTCTTGATATCAACAAGACAGCC
ATATTGAAGGATACCATAATT-3';
and nesCLN3,
5'-CC[ATCGAT]TTTC TGTACG
ATGGAATTAGCCTTGAAATTAGCAGGTgcTGATATCAACAA GACAGCCATATTGAAGGATACCATAATT-3'.
The 3' primer for the
CLN3 PCR amplifications was
5'-GATGGTTTCCAATGCTTGTGACGCGTAGAATTCTTC-3'.
All constructs
were sequenced to confirm that no errors were introduced
into coding
sequences during the PCR
amplifications.
The NES-
CLN3-1hamyc (pMM83),
nes-
CLN3-1hamyc (pMM84),
NLS-
CLN3- 1hamyc (pMM85), and
nls-
CLN3-1hamyc (pMM86) were constructed by
replacing the
ClaI-
EcoRI fragment
of pMM55
(CLN3-1
hamyc) with the
EcoRI-
NotI
fragment of pMM74 to pMM77 for pMM83 to
pMM86,
respectively.
Indirect immunolocalization.
Exponentially growing cultures
expressing the myc-tagged Cln proteins were fixed in growth medium with
formaldehyde (1:10 dilution) for 90 min at 30°C with rotation. Cells
were washed with phosphate-buffered saline (PBS), briefly sonicated,
washed again in PBS, and then washed in sorbitol citrate buffer (0.1 M
K2HPO4, 33 mM citric acid, 1.2 M sorbitol, 2 mM
dithiothreitol [DTT]). Cells walls were removed by digestion with a
1:10 volume of glusalase, a 1:100 volume of a 20-mg/ml concentration of
zymolyase, and 1 mM DTT for 2 h at 30°C with rotation. Cells
were washed four times with sorbitol citrate buffer. Cells were fixed
to polylysine-coated slides by placing the cell suspension in wells for
3 min and aspirating off the suspension until they were dry. The slides
were placed in 100% Methonal for 5 min, 100% acetone for 5 min,
and then air dried. Fixed cells were then rehydrated and blocked by
incubation with 2% nonfat dry milk in PBS-Tween solution (1× PBS,
0.2% Tween 20) overnight at 4°C. Primary monoclonal antibody 9E10
(Santa Cruz Biotechnology) was diluted 1:200 in blocking solution,
cleared for 2 min by centrifugation in a microfuge, and incubated on
the cells for 2 h. The wells were washed quickly four times,
followed by three 5-min washes. Secondary antibody (Cy3-conjugated
anti-mouse immunoglobulin G; Jackson Immunochemicals) was diluted 1:200
in blocking solution, cleared, and incubated on the wells for 2 h. Cells were again washed, and mounting solution (10% 1× PBS in glycerol with 0.02 µg of DAPI [4',6'-diamidino-2-phenylindole] and
1 mg of phenylenediamine per ml) was added to the wells. The negative
control for integrated myc-tagged Cln proteins was the wild-type strain
1255-5C. The negative control for plasmid-based expression of
myc-tagged Cln proteins was the vector control, pRS414 (52).
Immunofluorescence was done on an Axioplan Universal Microscope (Carl
Zeiss, Inc.) by using a Hamamatsu digital camera. Images
were collected
by using Openlab software version 1.2 (Improvision)
and processed with
Photoshop version 4.0 (Adobe Systems). All
images presented in a single
figure were captured and processed
in parallel by identical
means.
Biochemical fractionation.
Biochemical fractionation was
carried out as described elsewhere (24, 47), with the
following modifications. Culture volumes were scaled down to 1 liter,
and cells were allowed to recover from spheroplasting for 1 h in
YPDex (for CLN2myc) or YPGal (for
GAL1::CLN3hamyc) before the
cells were harvested and lysed by Polytron shearing. Western blots of
different fractions from these preparations were probed with the
anti-myc polyclonal antibody A-14 (Santa Cruz Biotechnologies) and
anti-Pgk1p polyclonal antibody (Molecular Probes) to visualize the
cytoplasmic fractions and with anti-Nop1p antibody (M. Rout) to
visualize the nuclear fractions.
-factor synchronization.
-Factor was added to 500 ml
of exponentially growing cells to a final concentration of 0.6 mM until
they were synchronized, as determined by morphology (2 h for
CLN2myc strain grown in YPDex).
-Factor was
washed out with 500 ml of medium, then briefly sonicated, and finally
washed again. Washing consisted of collecting cells by filtration and
resuspending cells in a 500 ml of medium. After the second wash, cells
were resuspended in 30°C YPDex medium. Samples were collected every
15 min and assayed by indirect immunofluorescence and Western blot
analysis. Synchrony was confirmed by determining the budding index.
Cell volume assay.
Cell volume assays were carried out on a
cln2 cln3 GAL1::CLN3 strain grown on
glucose-containing medium that had been transformed with the
following plasmids: pMM45, pMM55, pMM82, pMM60, pMM61, pMM92,
pMM93, pMM83, pMM84, pMM85, pMM86, and pRS416. Subsequent experiments
were done with this strain transformed with pMM99 and pRS416. All
plasmids are episomal centromeric low-copy plasmids and carry the
TRP1 gene. For each strain, three individual transformants were assayed as described earlier (27), with the following
modifications. Overnight cultures grown in defined (SC) medium
containing 3% galactose and lacking tryptophan (SCGal-trp) were used
to inoculate SC medium containing 2% glucose lacking tryptophan
(SCDex-trp) and grown overnight at 30°C to an optical density at 660 nm (OD660) of approximately 1.0. These cultures were then
diluted to an OD660 of approximately 0.2 in SCDex-trp and
allowed to grow at 30°C to an OD660 of 0.8. Cells were
then fixed in 1% formaldehyde and sonicated to disperse the clumps.
Cell volume analysis was done with a Coulter Channelyzer 256. The data
shown are representative of at least two independent experiments for
each strain.
Cell viability assays.
Mutant strains (see Table 1) were
transformed with the following plasmids: pMM45, pMM55, pMM82,
pMM60, pMM61, pMM92, pMM93, pMM83, pMM84, pMM85, pMM86, pMM99,
and pRS416. For each transformant strain, 10-fold serial dilutions were
prepared for two pools of transformants (5 to 10 colonies), and 5 µl
of each dilution were plated onto a YPDex (dextrose) or YPGal
(galactose) plate and assayed for growth at 30 and 38°C after 2 to 3 days. The maximum decrease in viability that can be determined from
this assay is 1,000-fold. Plates were replica plated to SCGal-trp and
SCDex-trp to confirm that colonies forming on YPDex and YPGal plates
maintained the test plasmids. The data presented are representative of
data from at least two independent experiments.
Protein extraction and immunoblotting.
Total cellular
protein lysates were obtained as follows: 10 ml of exponentially
growing yeast cultures (OD660 between 0.5 and 0.9) were
quick chilled by pouring over ice. The remaining steps were done at
4°C. The cells were spun, and the pellet was resuspended in 1 ml of
1× TE (pH 7.4; 10 mM Tris, 1 mM EDTA) and transferred to a 1.5-ml
microfuge tube. Cells were spun for 5 s in a microcentrifuge, and
the pellets were resuspended in 100 µl of extraction buffer with
inhibitors (0.6% sodium dodecyl sulfate [SDS]; 10 mM Tris, pH 7.4;
10% aprotinin; 1:1,000 [vol/vol] 0.5 M phenylmethylsulfonyl
fluoride; 1:100 [vol/vol] 1 mg of leupeptin-pepstatin per ml; 1:10
[vol/vol] 100 mM NaPPi, pH 7.3). An equivalent of 150 µl of glass beads was added, and the bead slurry was vortexed for 3 min. Then, 100 µl of 2× SDS sample buffer was added, and the lysates
were analyzed by immunoblotting. Cellular lysates containing the 35-kDa
Cln3hamycp were also prepared by lysis in 1.85 N NaOH and
7.4%
-mercaptoethanol, followed by trichloroacetic acid
precipitation. Identical results were obtained by using both lysis
protocols. Lysates were run on SDS-polyacrylamide gels and transferred
to immunoblots as described previously (7). Immunoblotting
was performed as described previously (27). The antibody
used to detect the myc epitope was polyclonal
-myc A-14 (Santa Cruz
Biotechnology), and the antibody used to detect the HA epitope in the
peptide kinase assays was polyclonal antibody 12CA5 (Babco). Detection
was done by enhanced chemiluminescence (ECL) with the super signal ECL
Kit (Pierce).
Immunoprecipitation and peptide kinase assays.
Immunoprecipitations were performed as described earlier
(27), with the following modifications. The HA
epitope-tagged Cln strains (2195-5c for Cln2hap and 1022 for Cln3hap expressed from the GAL1 promoter)
were scaled up to 500 ml and resuspended in a final volume of 300 µl
of kinase buffer. Extraction buffer N (50 mM Tris-HCl, pH 7.5; 100 mM
NaCl; 0.1 mM EDTA, pH 8.0; 10 mM NaF; 60 mM
-glycerophosphate; 0.1%
NP-40) was used instead of TNN buffer. Immunoprecipitates were washed
with extraction buffer five times instead of three times. Then, 15 µl
of the final suspension was used for each peptide kinase assay. The
cell suspension was incubated with various concentrations of peptide
substrate in a volume of 2 µl, with 2 µl of 50 mM ATP and 1 µl of
[
-32P]ATP (NEN). The kinase reaction mixtures were
incubated at 30°C for 5 min. The reactions were stopped by adding 18 µl of the reaction mixture to 2 µl of 0.5 M EDTA, followed by a
10-min incubation at 65°C. The reaction was then spotted onto
phosphocellulose paper disks and processed as described elsewhere
(53). D. Lawrence kindly provided the peptides. Each assay
was performed in duplicate, and assays were done from at least three
separate immunoprecipitations. The apparent Km
(± the standard error of the mean [SEM]) and
Vmax (± SEM) values were determined from
initial rate experiments that included five different peptide
concentrations over a 10-fold range encompassing the
Km. These data were plotted by using the Lineweaver-Burke procedure; the corresponding plots proved to be linear.
 |
RESULTS |
Enzyme kinetics of Cln2p-Cdc28p and Cln3p-Cdc28p kinase
activities.
To investigate the possibility that the functional
specificity observed between Cln2p and Cln3p reflects differences in
substrate specificity, we measured the phosphorylation kinetics of
Cln2p-Cdc28p and Cln3p-Cdc28p with previously characterized
peptide substrates (53). The amino acid sequence of
these peptides is based on the minimal necessary sequence for substrate
recognition by cyclin-dependent kinase, S/T-P-X-Z, where Z is typically
basic (see Table 2 for peptide sequences). To allow analysis of Cln2p-
and Cln3p-associated Cdc28p activity, immunoprecipitated complexes of
HA epitope-tagged cyclin were used as the source of
cyclin-associated kinase activity. The Vmax is
expressed relative to the amount of Cdc28p present in
coimmunoprecipitation, as determined by Western blot analysis (see
Materials and Methods).
To determine if the Cln2p- and Cln3p-associated kinase activity
measured in these assays are due to associated Cdc28p, we
measured the
Cln2p- and Cln3p-dependent phosphorylation of peptide
substrate P from
a strain containing a mutant Cdc28p. This mutant
Cdc28
csr1-1p (
28) is defective for binding
to Cln2p and Cln3p. Cln2p and
Cln3p immunoprecipitates from
cdc28csr1-1 cells show reduction in
peptide phosphorylation that is consistent
with the reduction in
Clnp-Cdc28p complex formation observed by
Western blot analysis (data
not
shown).
Peptide P is an efficient substrate of cyclin B-cdc2 from
Pisaster ochraceus, with a
Km of
1.5 ± 0.04 µM and a
Vmax of 2 ±
0.18 µmol/min/mg (
53). We find that this peptide also
serves
as an efficient substrate for the yeast Cln2p and Cln3p-Cdc28p
(Table
2). We find no significant difference between Cln2p and
Cln3p
complexes in binding affinity (
Km), rate of
catalysis (
Vmax),
or overall efficiency
(
Kcat/
Km) for this
peptide (Table
2). The
presence of an
aspartic acid residue at the

1 position relative
to the
phosphorylated serine (P-1) reduced binding affinity approximately
15-fold, with no changes in the catalysis rate (Table
2, P-1).
These
results are similar to those found by using cyclin B-cdc2,
which showed
an approximate 10-fold reduction in
Km
(
53). When
the P+2 glycine was substituted with arginine, no
significant
differences were observed when compared to peptide P (Table
2).
Although limited, these data did not suggest that the catalytic core of
Cdc28p was folded very differently when in complex
with Cln2p compared
to Cln3p and prompted us to look elsewhere
for the source of functional
specificity. Data on mammalian cyclins
have similarly shown little
specific effect on peptide substrate
specificity due to the cyclin
subunit associated with a given
Cdk (
21).
Cellular localization of Cln2p.
The functional specificity of
Cln2p-Cdc28p and Cln3p-Cdc28p complexes may result from differential
localization of cyclins, making distinct subsets of substrates or
cyclin-cdk regulators accessible to different cyclin-Cdc28p
complexes. Cellular localization of Cln2p and Cln3p were determined by
using indirect immunofluorescence of 9X myc epitope-tagged proteins. We
myc epitope tagged the carboxy terminus of CLN2 at the
endogenous CLN2 locus (see Materials and Methods). The
integration results in the expression of myc epitope-tagged Cln2p under
the control of the endogenous CLN2 promoter
(Cln2mycp). The staining pattern for Cln2mycp
appears to be primarily cytoplasmic and somewhat punctate, with the
nucleus appearing understained relative to the cytoplasm (Fig. 1A). This signal was specific to
Cln2mycp and occurred in unbudded and small
budded cells, a finding consistent with the cell cycle-regulated
expression pattern of CLN2. To confirm that the signal
observed by indirect immunofluorescence of asynchronous cultures was
due to Cln2mycp, we assayed for localization by using a
synchronized culture. In a culture synchronized by
-factor block and
release, cytoplasmic Cln2mycp signal was detected by
indirect immunofluorescence almost uniformly in the population at the
same time (at or just prior to bud emergence) that Cln2myc
protein peaked, as determined by Western blot analysis (data not
shown).


View larger version (7776K):
[in this window]
[in a new window]
|
FIG. 1.
Indirect immunolocalization of Cln2p and Cln3p. (A)
Strains expressing Cln2mycp from the CLN2
promoter (strain MMY1) and Cln3hamycp from the
GAL1 promoter (strain MMY2). (B) Cln3hamycp from
the CLN3 promoter (1255-5C with pMM45). Strains were assayed
by indirect immunofluorescence as described in Materials and Methods.
The first row shows DIC images (cells); the second row shows indirect
immunofluorescence where monoclonal anti-myc 9E10 (Santa Cruz
Biotechnology) was used as the primary antibody ( -myc), and the
third row shows the DAPI staining of DNA. The myc-tagged cyclins
expressed are indicated at the top of each set. The
Cln2mycp signal appeared to be punctate and cytoplasmic. At
a low frequency, spots of Cln2mycp signal are visible but
do not lie within the area of the nucleus as defined by the DAPI stain.
Nuclear Cln3-1hamycp staining was usually throughout the
area of the nucleus, but on rare occasions (<0.5% of the cells with
overexpressed Cln3-1hamycp) the staining appeared along the
edge of the nucleus. Bar, 5 µm.
|
|
Cellular localization of Cln3p.
The localization pattern of
Cln3p was visualized by using the 9X myc epitope placed in frame at the
carboxy terminus of the CLN3hap. Since the
expression level of Cln3p is significantly lower than the peak
expression of cell cycle-regulated Cln2p, we first characterized the
localization of overexpressed myc epitope-tagged Cln3p by using
the galactose-inducible GAL1 promoter
(GAL1::CLN3hamyc). The
GAL1::CLN3hamyc construct
was integrated at the URA3 locus in strain 1255-5c, and
cells grown in the presence of galactose were assayed by indirect immunofluorescence. Overexpressed Cln3hamycp is present
throughout the cell, with a concentration of Cln3hamycp in
the nucleus of some cells (Fig. 1A). The cells that accumulate Cln3hamycp in the nucleus consist primarily of budded cells.
To determine if the galactose-induced overexpression influenced the
localization pattern of Cln3
hamycp, indirect
immunofluorescence was done on a wild-type strain
containing a
low-copy-number plasmid that encodes
CLN3hamyc
under the control of the
CLN3 promoter.
Cln3
hamycp expressed at endogenous levels localizes to the
nuclei of large
budded cells. On occasion (<10%), large unbudded
cells show nuclear
accumulation of Cln3
hamycp, but cells
with small buds or small unbudded cells do not show
Cln3
hamycp signal (Fig.
1B and Fig.
4). It is unclear if
Cln3
hamycp is below the level of detection or absent from
these populations
of cells. It is interesting to note that the time of
nuclear accumulation
of Cln3p may roughly coincide with the early cell
cycle box-,
or ECB-, dependent peak in
CLN3 transcription
(
16,
33,
41,
59,
64), although a similar pattern was
observed with the
cell-cycle-constitutive
GAL1 promoter.
Cellular fractionation of Cln2p and Cln3p.
Western blot
analysis with antibodies against the myc epitope indicate that a
significant amount of the immunoreactive myc in lysates from cells
expressing Cln3hamycp comes from a species of approximately
35 kDa (Fig. 2). An estimated 18 kDa of
this protein is due to the 3X HA and 9X myc epitopes, leaving 17 kDa of
Cln3p. This product is consistent with a cleavage event internal to
Cln3p, one approximately 150 amino acids from the carboxy-terminal end
of the protein. The 35-kDa species is observed in both anti-myc
immunoprecipitations and crude cellular lysates. It is present when
Cln3p is expressed from the GAL1 and CLN3
promoters. A similar species is observed when the protein A epitope is
engineered at the carboxy terminus of CLN3 (data not shown).
We have been unable to detect a faster-migrating species with the 3X HA
epitope-tagged Cln3p, possibly because of the smaller size of this
epitope. Experiments that use anti-Cln3p serum to detect untagged Cln3p
on Western blots show a nonfunctional species shorter than full-length
Cln3p (7), the size of which might result from the loss of
C-terminal sequences. It remains unclear if the cleavage of
Cln3hamycp resulting in the approximately 35-kDa species
occurs in vivo or in vitro.

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblot analysis of Cln3hamycp and
Cln3-1hamycp. A wild-type strain (1255-5c) was transformed
with plasmids pRS414 (vector, lane 1), pAG2 (Cln3hamycp
expressed from the GAL1 promoter, lane 2), and pMM55
(Cln3-1hamycp, lane 3). All plasmids are episomal CEN (low
copy number). Cellular lysates were separated by SDS-12%
polyacrylamide gel electrophoresis (PAGE) and analyzed by Western
blotting as described in Materials and Methods. Proteins were
visualized by using the polyclonal anti-myc A-14 antibody (Santa Cruz
Biotechnology). Molecular size markers are listed to the left of the
blot in kilodaltons.
|
|
The immunofluorescence data described above may reflect the
localization of both full-length and 35-kDa Cln3
hamycp. To
confirm our indirect immunofluorescence results and to determine
where
full-length Cln3
hamycp localizes, we did cellular
fractionation experiments to separate
the cytoplasmic and nuclear
components of the cell. Consistent
with the indirect immunofluorescence
studies, the Cln2
myc protein cofractionates with
cytoplasmic marker Pgk1p (Fig.
3B),
while
full-length Cln3
hamycp cofractionates with the nuclear
marker, Nop1p (Fig.
3A). The
35-kDa Cln3
hamycp does not
cofractionate with nuclear markers. The 35-kDa species
is found
primarily at the interface between the nuclear and cytoplasmic
fractions, with low levels visible in the cytoplasmic fractions
(see
fraction 3, Fig.
3A). The interface between nuclear and cytoplasmic
fractions usually contains the larger organelles of the cell,
including
the endoplasmic reticulum and Golgi (
55). It is clear
from
these results that full-length Cln3
hamycp is localized to
the nucleus, while Cln2
mycp is localized primarily to the
cytoplasm. These results do not
rule out the possibility that a
fraction of Cln3
hamycp is located in the cytoplasm, since
it is possible that full-length
Cln3p is degraded to the 35-kDa form
after cell breakage.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of Cln3p and Cln2p by subcellular
fractionation. Fractions were prepared as described in Materials and
Methods. Duplicate samples of each fraction were separated by SDS-12%
PAGE and analyzed by Western blotting. Fractions are indicated at the
top of each blot. Fraction 1 corresponds to the crude cytoplasmic
fraction, fraction 2 corresponds to the surface of the sucrose
gradient, fraction 3 corresponds to the surface-2.01 M sucrose
interface, fraction 4 corresponds to the 2.01 to 2.1 M sucrose
interface, fraction 5 corresponds to the 2.1 to 2.3 M sucrose
interface, and fraction 6 corresponds to the remaining pellet of the
sucrose gradient. The total protein isolated from cells prior to
polytron shearing is indicated in the lane marked 7. (A) Immunoblot
analysis of fractions from a strain expressing Cln3hamycp
from the GAL1 promoter (MMY2). The position of full-length
Cln3hamycp is indicated by Cln3, and the 35-kDa species is
indicated by Cln3*. Corresponding immunoblot analysis of the Nop1p and
Pgk1p fractionation is shown below the Cln3p blot. The nucleolar
protein Nop1p detected with the monoclonal antibody D77 (1)
indicates which fractions contain nuclear proteins. The cytoplasmic
protein Pgk1p detected with the anti-Pgk1p polyclonal antibody
(Molecular Probes) indicates which fractions contain cytoplasmic
proteins. (B) Immunoblot analysis of fractions from a strain expressing
Cln2mycp from the CLN2 promoter (MMY1). The
Cln2p, Pgk1p, and Nop1p immunoblots are shown. A moderate level of
nuclear breakage apparently occurred in this fractionation, as
indicated by leakage of Nop1p into the intermediate and cytosolic
fractions.
|
|
Cellular localization of Cln3-1p.
If the 35-kDa
Cln3hamycp results from a cleavage within the C-terminal
tail of Cln3p, then a mutant Cln3p lacking the C-terminal tail would be
missing the presumed site of cleavage and would not produce the 35-kDa
Cln3hamycp. To test this idea, we 9X myc epitope tagged the
truncated allele of CLN3ha,
CLN3-1ha. CLN3-1 encodes a stable
Cln3-1p that is more active than full-length Cln3p, as measured by cell
size experiments, presumably because of the increase in steady-state
levels of Cln3-1p (7, 60, 65). Protein lysates from a strain
expressing Cln3-1hamycp do not show faster-migrating
species (Fig. 2, lane 3), a result consistent with the idea that a
cleavage site falls within the C-terminal tail of Cln3. Indirect
immunofluorescence of Cln3-1hamycp shows a staining pattern
similar to that of overexpressed Cln3hamycp, with
localization to the nucleus in budded cells and localization throughout
the cell in unbudded cells (see Fig. 5). Comparison of Cln3-1p
localization and Cln3p localization shows an increase in cytoplasmic
staining with Cln3-1hamycp (see Fig. 1 and 5).
Altering cellular localization of Cln3p.
To determine the
functional relevance of Clnp localization patterns, we attempted to
redirect localization by engineering localization signals on the N
terminus of Cln3p. To facilitate exit from the nucleus, the PKI NES was
used. The NES consists of a leucine-rich sequence that is necessary and
sufficient to mediate nuclear export (63). This export
signal is functional in S. cerevisiae (17, 54).
We also engineered the simian virus 40 large T NLS onto Cln3p. The NLS
consists of a short lysine-rich sequence that is sufficient to mediate
nuclear import of a heterologous protein in yeast cells
(39). Point mutants of the NLS (mnls) and NES (mnes) that
disrupt localization activity of these sequences were used to control
for nonspecific effects of the additional sequences at the N terminus
of the proteins. Indirect immunofluorescence shows no changes in the
cellular localization of the proteins. Indirect immunofluorescence
shows no changes in the cellular localization of the
NLS-Cln3mycp expressed from the CLN3 promoter
compared to the Cln3mycp or mnls-Cln3mycp
patterns. A slight increase in cytoplasmic staining was observed with
the NES-Cln3mycp compared to Cln3mycp or
mnes-Cln3mycp (Fig. 4 and
data not shown).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Indirect immunolocalization of NLS- and
NES-Cln3mycp. Wild-type cells (1255-5c) were transformed
with plasmids pRS414 (vector), pMM99 (Cln3mycp), pMM100
(NLS-Cln3mycp), pMM101 (mnls-Cln3mycp), pMM102
(NES-Cln3mycp), and pMM103 (mnes-Cln3mycp). All
plasmids are episomal CEN (low copy number) and express the myc-tagged
Cln3 protein from the CLN3 promoter. Transformants were
assayed by indirect immunofluorescence as described in Materials and
Methods. The first row shows DIC images (cells), the second row shows
the indirect immunofluorescence with monoclonal anti-myc antibody 9E10
( -myc), and the third row shows DAPI staining of DNA. The myc-tagged
cyclins expressed are indicated at the top of each set. Bar, 5 µm.
|
|
In contrast, when we placed the NLS, mnls, NES, and mnes at the N
terminus of Cln3-1
hamycp, we detected clear NLS- and
NES-dependent changes in the cellular
localization of
Cln3-1
hamycp. NES-Cln3-1
hamycp is localized
primarily to the cytoplasm, with lighter staining
in the region of the
nucleus compared to Cln3-1
hamycp and
mnes-Cln3-1
hamycp. NLS-Cln3-1
hamycp localizes
almost entirely to the nucleus in both budded and
unbudded cells
compared to Cln3-1
hamycp or mnls-Cln3-1
hamycp
(Fig.
5). The mnls- and
mnes-Cln3-1
hamycp localization patterns most resemble those
of wild-type Cln3-1
hamycp, although a slight shift of
signal into the nucleus with mnls
and into the cytoplasm with mnes is
detectable. In all cases,
the immunofluorescence data shown is
representative of the population
of cells and is reproducible in
different experiments. These data
show that addition of the NLS shifts
the Cln3-1p localization
to a pattern that more resembles that of Cln3p
and that addition
of the NES shifts Cln3-1p to a localization pattern
that more
resembles that of Cln2p.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 5.
Indirect immunolocalization of NLS- and
NES-Cln3-1hamycp. Wild-type cells (1255-5c) were
transformed with plasmids pRS414 (vector), pMM55
(Cln3-1hamycp), pMM83 (NLS-Cln3-1hamycp),
pMM84 (nmls-Cln3-1hamycp), pMM85
(NES-Cln3-1hamycp), and pMM86
(mnes-Cln3-1hamycp). All plasmids are episomal CEN (low
copy number) and express the myc-tagged Cln protein from the
CLN3 promoter. Transformants were assayed by indirect
immunofluorescence as described in Materials and Methods. The first row
shows DIC images (cells), the second row shows the indirect
immunofluorescence with monoclonal anti-myc antibody 9E10 ( -myc),
and the third row shows DAPI staining of DNA. The myc-tagged cyclins
expressed are indicated at the top of each set. Bar, 5 µm.
|
|
The increased ability to mislocalize Cln3p when C-terminal sequences
are deleted suggests that the Cln3p C-terminal third
may include
endogenous localization signals, a possibility that
we are exploring.
This idea is consistent with the significant
loss of tight nuclear
localization when Cln3-1p is compared with
Cln3p (Fig.
5).
Alternatively, the differences in the localization
patterns of Cln3p
and Cln3-1p may be due to differences in the
turnover rates of these
two
proteins.
Altering cellular localization of Cln2p.
Attempts to change
the localization pattern of Cln2mycp were carried out as
described for Cln3hamycp. Sequences comprising the NLS,
mnls, NES, and mnes sequences were engineered at the N terminus
of Cln2mycp and assayed for localization by indirect
immunofluorescence. Expression of the NLS-Cln2mycp does not
significantly change the localization pattern compared to
mnls-Cln2mycp or Cln2mycp. Some nuclear
accumulation of NLS-Cln2mycp (but not of
Cln2mycp and mnls-Cln2mycp) is observed when
overexpressed from the GAL1 promoter, but cytoplasmic
staining is still obvious (data not shown). Thus, while the NLS is
functional, it is unable to confer efficient nuclear localization to
Cln2mycp. As for Cln3p, this may be due to efficient
endogenous regulation of Cln2p localization. NES-Cln2mycp
shows no evident difference in localization patterns from wild-type Cln2mycp and mnes-Cln2mycp, although the
cytoplasmic localization of Cln2p already observed would make any
increased cytoplasmic accumulation difficult to detect (data not shown).
Localization-mediated functional specificity of Cln2p, Cln3-1p, and
Cln3p.
Strains containing the NLS- or
NES-CLN2myc and the NLS- or
NES-CLN3-1hamyc constructs were assayed for
CLN function. Both CLN2 and CLN3-1 are
expressed from the constitutive CLN3 promoter to control for differences in the expression of CLN2 and CLN3.
Western blot analysis of the
NES/mnes/NLS/mnls-Cln3-1hamycp and
NES/mnes/NLS/mnls-Cln2mycp show similar steady-state
protein levels (Fig. 6). In all of the
assays described here, we assigned functional defects to changes in
localization exclusively based on differences between Cln proteins that
contain the wild-type (NLS or NES) and mutant (nls or nes) localization
signals. The mnls and mnes control for nonspecific alterations in Clnp
function that may result from the addition of sequences to the N
terminus of the protein. In cases where indirect immunofluorescence
shows little to no detectable alterations in localization patterns, the
mnls and mnes will allow us to attribute any detectable functional
defects to the localization activity of the NLS or NES.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 6.
Comparison of myc-tagged Cln proteins. Wild-type strain
(1255-5c) was transformed with plasmids pRS414 (vector, lane 1), pMM45
(Cln3, lane 2), pMM55 (Cln3-1, lane 3), pMM83 (NLS-Cln3-1, lane 4),
pMM84 (mnls-Cln3-1, lane 5), pMM85 (NES-Cln3-1, lane 6), pMM86
(mnes-Cln3-1, lane 7), pMM82 (Cln2, lane 8), pMM60 (NLS-Cln2, lane 9),
pMM61 (mnls-Cln2, lane 10), pMM92 (NES-Cln2, lane 11), and pMM93
(mnes-Cln2, lane 12). All plasmids are episomal CEN (low copy number)
and express the myc-tagged Cln protein from the CLN3
promoter. Cellular lysates were separated by SDS-12% PAGE and
analyzed by Western blotting as described in Materials and Methods.
|
|
Initially, we assayed for
CLN activity by monitoring cell
volume. Initiation of the cell cycle requires
CLN activity
for bud
emergence and activation of Clbp-Cdc28p complexes, as described
above. Cells with reduced
CLN activity will have a delay in
these
events, resulting in a population of large cells due to a longer
period of cell growth after cell division and before cell cycle
initiation. Conversely, high
CLN activity results in a
population
of small cells (
6,
38). Plasmids encoding the
various mutant
Cln proteins were introduced into a
cln2 cln3
strain, and transformants
were assayed for cell volume as described in
Materials and Methods.
As expected, expression of Cln2
mycp
and Cln3
hamycp confer smaller cell volumes than the vector
control. Cln3-1
hamycp confers a smaller cell volume than do
Cln2p and Cln3p, most
likely because of the increased steady-state
levels of Cln3-1p
(
7,
60,
65) (Fig.
7A). In contrast, we find that the
expression
of NES-Cln3-1
hamycp and NES-Cln2
mycp
(but not the mnes controls) produces populations of cells with
large
cell volumes, as with the vector transformants (Fig.
7B
and C). These
data show a reduction of
CLN activity when Cln3-1p
(and
perhaps Cln2
mycp) is exported out of the nucleus and into
the cytoplasm via the
NES.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Cell size assay for CLN gene function.
CLN1 cln2 cln3 cells (1421-21D) were transformed with
plasmids containing various CLN2 and CLN3
constructs (see Fig. 5 legend). Cell size analysis was carried out as
described in Materials and Methods. The data for three transformants
are shown on each graph. The x and y axis scales
for all of the graphs in this figure are identical.
|
|
Thus, in the cell volume assay for
CLN activity, a
functional NES appears to significantly reduce the biological activity
of both Cln3-1p and Cln2p. Despite the fact that the NES did little
to
the observed distribution of Cln2p, the result appears to be
reliable
since the effect was eliminated by a point mutation of
the NES. This
result suggests that nuclear Cln protein may be
required at least
transiently to efficiently drive cell cycle
initiation. The NLS had no
effect on either Cln2p or Cln3-1p function.
In the case of Cln3-1p,
which was efficiently localized to the
nucleus by this sequence, this
result suggests that sufficient
nuclear localization of Cln3-1p to
drive initiation of the cell
cycle may occur even without the NLS (Fig.
7). NES-Cln3-1-expressing
cells show a wider distribution of slightly
larger cells than
the NES-Cln2p-expressing cells, for unknown
reasons.
The second assay used to address
CLN function is the ability
of the various Clnp mutants to complement a triple
cln
deletion
mutant (
cln
). This experiment was
done by using a
cln1 cln2 cln3 GAL1::CLN3 strain.
The
GAL1 promoter is induced by growth on medium containing
galactose, resulting in the expression of Cln3p. Growth on glucose
shuts off the
GAL1 promoter, resulting in growth arrest due
to
the lack of
CLN function. We are able to test our
CLN constructs
by introducing into this strain plasmids
encoding the various
mutants, all expressed from the
CLN3
promoter, and then comparing
the ability of these plasmid-bearing
strains to form colonies
on galactose- and glucose-containing media.
All
CLN2 and
CLN3 plasmids tested were able to
support viability in the
cln
strain at 30°C.
However, at 38°C the plasmids expressing
NES-Cln3-1
hamycp and NES-Cln2
mycp were unable
to rescue viability as well as the plasmids expressing
mnes-Cln3-1
hamycp and mnes-Cln2
mycp (Fig.
8A). The NLS and mnls had no effect in
this assay. These
data support the results from the cell volume assay.

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 8.
Viability assay for NLS- and NES-CLN2 and
CLN3-1 strains. Mutant strains, each containing a
GAL1::CLN for viability, were transformed with
CLN plasmids. For each transformant strain, 10-fold serial
dilutions were prepared from independent pools of transformants (5 to
10 colonies), and 3 µl of each dilution was plated onto both YPDex
and YPGal plates. Plates were incubated at 30 or 38°C as indicated.
CLN plasmids used are those listed in the legend to Fig. 5.
(A) cln and cln
bck2 strains. (B) cln
swi4 and CLN3 cln1,2
GAL::SIC1 strains. (C) CLN3
cln1,2 clb5,6 strain. (D)
cln pcl1,2 and
cln bud2 strains. (E) CLN3
cln1,2 swi4 strain.
|
|
The third assay used to test for
CLN activity utilizes a
series of mutant strains that allow us to differentiate between
CLN2 and
CLN3 function. In the strains assayed
here, except for the
cln
bck2
strain, wild-type
CLN3 is unable to rescue in the absence of
additional
CLN genes, but wild-type
CLN2 does
rescue (see the
introduction). These assays were performed as described
for the
cln
strain, except in the case of the
GAL1::
SIC1 strain. In this
case, growth
on galactose results in overexpression of Sic1p and
growth arrest, so
this strain is not viable on galactose-containing
medium and viable on
glucose-containing medium. Expression of
CLN2 from the
CLN3 promoter suppresses
GAL1::
SIC1 lethality (
27,
58).
We found that in strains where Cln3
hamycp is unable to
rescue, Cln3-1
hamycp is able to rescue to various degrees,
although not to the level
of Cln2
mycp (Fig.
8). In the case
of the
cln
clb5,6
strain and the
cln
swi4
strain, this may in
part reflect higher steady-state levels of
Cln3-1p versus Cln3p in the
cell (
27). Additionally, it may
be due to the increase in
cytoplasmic localization observed with
CLN3-1
hamycp
compared to Cln3
hamycp (compare Fig.
1 and Fig.
5). The
latter idea is supported by
the observation that Cln3-1p function is
altered by mislocalization
with the NLS or NES but not with the control
mnls or mnes (see
below).
Analysis of rescue by the NLS- and NES-mislocalized cyclins and the
mnls and mnes controls strongly suggested that subcellular
localization
is a major determinant of cyclin specificity. In
the
cln
bck2
strain, the NES
addition (but not the mnes, NLS, or mnls addition)
to Cln2p or Cln3-1p
yielded a partial defect in rescue at 30°C
(Fig.
8A). Since
BCK2 may activate a set of transcripts similar
to those that
are regulated by
CLN3 activity (
9,
13), this
phenotype may reflect a nuclear requirement for Clnp that involves
activation of transcription. These data are consistent with the
findings in the cell volume and
cln
complementation assays, suggesting an important functional role
for
nuclear localization of Cln
proteins.
A different pattern was observed with the
GAL1::
SIC1 and
cln
swi4
strains: rescue by Cln3-1p was hampered by
either the NLS or
the NES (but not by the mnls or the mnes) (Fig.
8B).
These data
suggest that there are
CLN requirements in both
the nucleus and
cytoplasm for rescue in this context. If so, the
NES-Cln3-1p should
rescue in the presence of wild-type Cln3p. The
cytoplasmic Cln3p
activity would be provided by NES-Cln3-1p, and the
nuclear Cln3p
activity would be provided by wild-type Cln3p. To test
this idea,
we introduced the NES-Cln3-1p into a
CLN3
cln1,
2
swi4
strain and
assayed for rescue as described for the
cln
swi4
strain. Consistent with a requirement of Cln3p
activity in both
the nucleus and cytoplasm in this strain background,
NES-Cln3-1p
is able to rescue as well as mnes-Cln3-1p and Cln3-1p in
the presence
of wild-type Cln3p (Fig.
8E). Thus, wild-type (nuclear)
Cln3p
and cytoplasmic NES-Cln3-1p complement each other for the rescue
of the
cln1,2 swi4 mutant strain, a result consistent with
CLN requirements in both compartments for
rescue.
In the
cln
clb5,
6
strain, NES (but not mnes) addition to Cln3-1p or Cln2p strongly
reduced rescue, but NLS (and not mnls)
addition yielded a reproducible
5- to 10-fold increase in viability
(Fig.
8C). These data suggest an
important role for the efficient
nuclear localization of Cln
protein.
In the
cln
bud2
and
cln
pcl1,
2
strains,
the NLS (but not the mnls) strongly reduced rescue by Cln3-1p, while
the NES (but
not the mnes) strongly increased rescue (Fig.
8D). These
data
suggest an important cytoplasmic
CLN function.
Despite the low impact on full-length Cln3p localization with the
addition of NES or NLS sequences, we found that NES addition
(but not
mnes, NLS, or mnls addition) resulted in partial Cln3p
rescue of the
cln
pcl1,2
and
cln
swi4
strains (Fig.
9A and B). These data are consistent with
the interpretation
above that cytoplasmic Cln3p may gain some ability
to function
in assays normally restricted to Cln2p.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 9.
Viability assays and Western blot for NLS- and
NES-CLN3 strains. (A and B) Mutant strains, each containing
a GAL1::CLN for viability, were transformed with
plasmids pRS414 (vector), pMM45 (CLN3), pMM83
(NLS-CLN3), pMM84 (mnls-CLN3), pMM85
(NES-CLN3), and pMM86 (mnes-CLN3). For each
transformant strain, 10-fold serial dilutions were prepared from
independent pools of transformants (5 to 10 colonies), and 3 µl of
each dilution was plated onto both YPDex and YPGal plates. Plates were
incubated at 30 or 38°C as indicated. (A) cln
pcl1,2 strain. (B)
cln swi4 strain. (C) Wild-type
strain 1255-5C was transformed with the plasmids listed above. Cellular
lysates from two independent transformants were prepared in parallel
for each plasmid-bearing strain (except pRS414). All plasmids are
episomal CEN (low copy number) and express the myc-tagged Cln protein
from the CLN3 promoter. Cellular lysates were separated by
SDS-10% PAGE and analyzed by Western blotting as described in
Materials and Methods. Proteins were visualized by using the polyclonal
anti-myc A-14 antibody (Santa Cruz Biotechnology). Lanes: 1, vector; 2, CLN3; 3, NLS-CLN3; 4, mnls-CLN3; 5, NES-CLN3; 6, mnes-CLN3. The position of
full-length Cln3hamycp is indicated by Cln3, and the 35-kDa
species is indicated by *Cln3.
|
|
Previous studies have established that an increase in steady-state
protein levels of Cln3p is sufficient for partial rescue
of the
cln
swi4
strain (
27).
Western blot analysis was done to ensure that
the ability of NES-Cln3p
to rescue the
cln
swi4
strain is
not due to an NES-dependent increase in Cln3p protein
levels. A
comparison of NES-Cln3p and mnes-Cln3p showed no significant
difference
in steady-state protein levels (Fig.
9).
 |
DISCUSSION |
Enzyme kinetics of Cln2p-Cdc28p and Cln3p-Cdc28p.
No
significant differences in the binding affinity, catalysis rate, or
overall efficiency of the Cln2p-Cdc28p and Cln3p-Cdc28p complexes were
observed in our analysis. These data are consistent with an overall
similarity of the active site of Cdc28p when activated by the two
different cyclins. We note that these studies utilize a limited set of
three short peptides. For this reason, these data are not definitive,
and kinetic differences may exist with additional peptide substrates.
However, the fact that the enzyme kinetics in this limited study showed
no differences between Cln2p- and Cln3p-associated Cdc28 kinase
activity prompted us to look for other mechanisms to explain the cyclin
functional specificity.
Subcellular localization of Cln2p and Cln3p.
Cln2p and Cln3p
have distinct localization patterns. Cln2mycp is localized
primarily to the cytoplasm, as demonstrated by indirect immunofluorescence and biochemical fractionation of cells. While the
majority of Cln2mycp is clearly cytoplasmic, it is likely
that some proportion of Cln2p also localizes to the nucleus, since
limiting the ability of Cln2p to reside in the nucleus with an NES
inhibits some Cln2p functions (Fig. 7 and 8). The point mutant mnes has
no effect, indicating that this is probably specific to nuclear export,
not to addition of a nonspecific sequence to Cln2p. In contrast to the
primarily cytoplasmic localization of Cln2mycp,
Cln3mycp accumulates in the nuclei of large budded cells.
Nuclear accumulation of Cln3p appears gradual, in that we cannot
correlate a morphological event (such as bud emergence or nuclear
division) with efficient Cln3p nuclear localization. Constitutively
expressed Cln2p remains cytoplasmic in large budded cells (data not
shown), while Cln3p localizes to the nuclei. These data indicate
distinctly regulated cellular localization of Cln2p and Cln3p,
providing a possible mechanism to confer substrate specificity to
Clnp-Cdc28p complexes.
Cln3p function and cellular localization.
The mechanism by
which Cln3p activity results in the activation of late G1
transcripts, such as those regulated by the SBF or MBF transcription
factors, is not understood. However, one might speculate that Cln3p
acts directly on the components of the transcriptional machinery,
possibly within the nucleus of the cell. We demonstrate that the
efficient nuclear localization of Cln3-1p is required for proper
CLN function in the cln
bck2
strain, which is specifically defective in
SBF-dependent transcription (27). These data suggest the
likelihood that Cln3p acts directly within the nucleus to trigger
transcription of late G1 transcripts. This raises the
speculation that direct interactions occur between Cln3p and the
transcriptional machinery; testing this idea further is beyond the
scope of this study.
The localization of Cln3p in the nuclei of large budded cells
introduces interesting possibilities for the regulation of Cln3p
function. In a wild-type cell, Cln3p-responsive transcription
is
triggered just prior to DNA replication, in late G
1. Cln3p
does not appear to be tightly localized to the nucleus during
this
time. The maximal accumulation of nuclear Cln3p occurs when
Cln3p-dependent transcription is off (large budded cells with
one or
two nuclei). Assuming that Cln3p must localize to the nucleus
to
trigger transcription of late-G
1 transcripts (see paragraph
above), one might expect for the peak nuclear accumulation of
Cln3p to
coincide with the Cln3p activity. In this case, Cln3p
may function
during the preceding cell cycle, during late mitosis
or early
G
1, when Cln3p localizes most clearly to the nucleus,
to
create an environment in the cell which is responsive to SCB-
and
MCB-mediated transcription in late G
1. Alternatively, the
relatively low amount of Cln3p that localizes to the nucleus of
cells
in late G
1 may be sufficient to trigger the transcription
of genes regulated by
Cln3p.
Functional significance of Cln2p and Cln3p localization.
If
the localization patterns of Cln2p and Cln3p reflect significant
regulatory mechanisms, then mislocalization of the cyclins should alter
CLN function. We found NES-dependent decreases in Cln2p and
Cln3-1p activity in both cln complementation and cell size
assays, indicating that the presence of Cln proteins in the nucleus is
critical for some CLN functions (see Fig. 7 and 8). We also
saw consequences of the addition of NES to Cln2p in most of the mutant
strains tested (Fig. 8). These data suggest that the localization of
Cln protein to the nucleus of the cell is important for the efficient
function of both Cln2p and Cln3p. The lack of effect of the NLS on
Cln2p function in most assays is difficult to evaluate given that the
NLS has very little cytologically detectable effect on Cln2p
localization. Additionally, as described below, specific NES- and
NLS-Cln3-1p-dependent changes in Cln protein activity were observed in
the series of mutant strains tested. These results suggest that there
are CLN-dependent cytoplasmic and CLN-dependent
nuclear events that are important for cell cycle initiation.
Cln3-1p shows an intermediate localization pattern between Cln2p and
Cln3p, with an increase in cytoplasmic localization and
accumulation in
the nuclei of large budded cells (Fig.
5), suggesting
that some signals
for correct Cln3p nuclear localization are present
in the C-terminal
third of the protein. Correlating with this
loss of localization
specificity, Cln3-1p shows some loss of biological
specificity: in the
mutant strains where Cln2p is able to rescue
viability and Cln3p is not
able to rescue, Cln3-1p shows intermediate
degrees of rescue (Fig.
8).
Addition of the NLS (but not mnls)
to Cln3-1p moves the Cln3-1p into
the nucleus and results in the
loss of Cln3-1p-dependent rescue in four
of the five mutant strains
tested. The exception to this is the
cln
clb5,
6
strain,
which is rescued by Cln3p when overexpressed (
27),
and it is
known that Cln3-1p accumulates to higher levels than
Cln3p due to the
loss of C-terminal PEST sequences (
60). These
data suggest
that once the partial defect in nuclear localization
is corrected,
Cln3-1p functions similarly to overexpressed
Cln3p.
In contrast, addition of the NES (but not the mnes) to Cln3-1p results
in an increase in rescue in the
cln
pcl1,
2
and
cln
bud2
strains normally rescued by Cln2p but not by
Cln3p. Therefore,
shifting Cln3-1p into a more Cln2p-like localization
pattern allows
a more Cln2p-like activity. This finding may not be
restricted
to the Cln3-1p truncation since, consistent with the Cln3-1p
results,
we found that the NES (but not mnes)-Cln3p provides weak
rescue
of the
cln pcl1,
2
and
cln
swi4
strains. Therefore, the
ectopic presence of Cln3p in the cytoplasm
allows Cln3p or Cln3-1p some
ability to perform functions normally
restricted to Cln2p. Overall, it
appears that Cln2p is required
in both the cytoplasm and the nucleus of
the cell for maximal
function. Cln3p, on the other hand, appears to
function primarily
in the nucleus of the cell, although Cln3p is
capable of Cln2p-like
activity when forced into the cytoplasm (Fig.
8D
and
9). These
data are the first to suggest a cytoplasmic function for
a cyclin-Cdk
complex. Although the putative cytoplasmic function
remains poorly
defined, it is likely to involve some aspect of cell
polarity
determination or bud emergence (
29).
We conclude that
CLN activity is influenced by Clnp
localization and that the functional specificity of Cln proteins is
determined,
at least in part, by subcellular localization. These data
suggest
that investigation of mechanisms that regulate cyclin
localization
will provide information about the regulation of cyclin
specificity.
 |
ACKNOWLEDGMENTS |
We thank Mike Rout and David Lawrence for advice and helpful
discussions in these studies. We thank Ray Deshaies for providing the
anti-Cdc28p antibody, Mike Rout for providing the anti-Nop1p antibody,
David Lawrence for providing peptide substrates, and Tony Gartner and
Mike Tyers for providing plasmids. We also thank Mary Koszelak, Kristi
Levine, Kimberly Huang, Maria Yuste Rojas, and David W. Miller for
helpful discussions.
This work was supported by NIH grant GM47238 to F.R.C. M.E.M. was
supported by an NRSA GM18782.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Rockefeller
University, 1230 York Ave., New York, NY 10021. Phone: (212) 327-7686. Fax: (212) 327-7193. E-mail:
fcross{at}rockvax.rockefeller.edu.
 |
REFERENCES |
| 1.
|
Aris, J. P., and G. Blobel.
1988.
Identification and characterization of a yeast nucleolar protein that is similar to a rat liver nucleolar protein.
J. Cell Biol.
107:17-31[Abstract/Free Full Text].
|
| 2.
|
Baldin, V.,
J. Lukas,
M. J. Marcote,
M. Pagano, and G. Draetta.
1993.
Cyclin D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev.
7:812-821[Abstract/Free Full Text].
|
| 3.
|
Benton, B. K.,
A. Tinkelenberg,
I. Gonzalez, and F. R. Cross.
1997.
Cla4p, a Saccharomyces cerevisiae Cdc42p-activated kinase involved in cytokinesis, is activated at mitosis.
Mol. Cell. Biol.
17:5067-5076[Abstract/Free Full Text].
|
| 4.
|
Cardosa, M. C.,
H. Leonhardt, and B. Nada-Ginard.
1993.
Reversal of terminal differentiation and control of DNA replication cyclin A and Cdk2 specifically localize at subnuclear sites of DNA replication.
Cell
74:979-992[CrossRef][Medline].
|
| 5.
|
Chant, J.,
K. Corrado,
J. R. Pringle, and I. Herskowitz.
1991.
Yeast BUD5, encoding a putative GDP-GTP exchange factor, is necessary for bud site selection and interacts with bud formation gene BEM1.
Cell
65:1213-1224[CrossRef][Medline].
|
| 6.
|
Cross, F. R.
1988.
DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae.
Mol. Cell. Biol.
8:4675-4684[Abstract/Free Full Text].
|
| 7.
|
Cross, F. R., and C. M. Blake.
1993.
The yeast Cln3 protein is an unstable activator of Cdc28.
Mol. Cell. Biol.
13:3266-3271[Abstract/Free Full Text].
|
| 8.
|
Cvrcková, F., and K. Nasmyth.
1993.
Yeast G1 cyclins CLN1 and CLN2 and a GAP-like protein have a role in bud formation.
EMBO J.
12:5277-5286[Medline].
|
| 9.
|
Di Como, C. J.,
H. Chang, and K. T. Arndt.
1995.
Activation of CLN1 and CLN2 G1 cyclin gene expression by BCK2.
Mol. Cell. Biol.
15:1835-1846[Abstract/Free Full Text].
|
| 10.
|
Diehl, J. A.,
M. Cheng,
M. F. Roussel, and C. J. Sherr.
1998.
Glycogen synthase kinase 3beta regulates cyclin D1 proteolysis and subcellular localization.
Genes Dev.
15:3499-3511.
|
| 11.
|
Diehl, J. A., and C. J. Sherr.
1997.
A dominant-negative cyclin D1 mutant prevents nuclear import of cyclin-dependent kinase 4 (CDK4) and its phosphorylation by CDK-activating kinase.
Mol. Cell. Biol.
17:7362-7374[Abstract/Free Full Text].
|
| 12.
|
Dirick, L.,
T. Böhm, and K. Nasmyth.
1995.
Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae.
EMBO J.
14:4803-4813[Medline].
|
| 13.
|
Epstein, C. B., and F. R. Cross.
1994.
Genes that can bypass the CLN requirement for Saccharomyces cerevisiae cell cycle START.
Mol. Cell. Biol.
14:2041-2047[Abstract/Free Full Text].
|
| 14.
|
Espinoza, F. H.,
J. Ogas,
I. Herskowitz, and D. O. Morgan.
1994.
Cell cycle control by a complex of the cyclin HCS26 (PCL1) and the kinase PHO85.
Science
266:1388-1391[Abstract/Free Full Text].
|
| 15.
|
Feldman, R. M. R.,
C. C. Correll,
K. B. Kaplan, and R. J. Deshaies.
1997.
A complex of Cdc4p, Skp1p, and Cdc53p/Cullin catalyzes ubiquitination of the phosphorylated CDK inhibitor Sic1p.
Cell
91:221-230[CrossRef][Medline].
|
| 16.
|
Fernandez-Sarabia, M. J.,
A. Sutton,
T. Zhong, and K. T. Arndt.
1992.
SIT4 protein phosphatase is required for the normal accumulation of SWI4, CLN1, CLN2, and HCS26 RNAs during late G1.
Genes Dev.
6:2417-2428[Abstract/Free Full Text].
|
| 17.
|
Fritz, C. C., and M. R. Green.
1996.
HIV Rev uses a conserved cellular protein export pathway for the nucleocytoplasmic transport of viral RNAs.
Curr. Biol.
6:848-854[CrossRef][Medline].
|
| 18.
|
Gietz, R. D., and R. H. Schiestl.
1991.
Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier.
Yeast
7:253-263[CrossRef][Medline].
|
| 19.
|
Hadwiger, J. A.,
C. Wittenberg,
M. D. Mendenhall, and S. I. Reed.
1989.
The Saccharomyces cerevisiae CKS1 gene, a homolog of the Schizosaccharomyces pombe suc1+ gene, encodes a subunit of the Cdc28 protein kinase complex.
Mol. Cell. Biol.
9:2034-2041[Abstract/Free Full Text].
|
| 20.
|
Hagting, A.,
C. Karlsson,
P. Clute,
M. Jackman, and J. Pines.
1998.
MPF localization is controlled by nuclear export.
EMBO J.
17:4127-4138[CrossRef][Medline].
|
| 21.
|
Holmes, J. K., and M. J. Solomon.
1996.
A predictive scale for evaluating cyclin-dependent kinase substrates. A comparison of p34cdc2 and p33cdk2.
J. Biol. Chem.
11:25240-25246.
|
| 22.
|
Jaspersen, S. L.,
J. F. Charles, and D. O. Morgan.
1999.
Inhibitory phosphorylation of the APC regulatory hct1 is controlled by the kinase cdc28 and the phosphatase cdc14.
Curr. Biol.
9:227-236[CrossRef][Medline].
|
| 23.
|
Jin, P.,
S. Hardy, and D. O. Morgan.
1998.
Nuclear localization of cyclin B1 controls mitotic entry after DNA damage.
J. Cell Biol.
18:875-885.
|
| 24.
|
Kilmartin, J. V., and J. Fogg.
1982.
Partial purification of yeast spindle pole bodies, p. 157-170.
In
P. Cappucinelli, and N. R. Morris (ed.), Microtubules and microorganisms. Marcel Dekker, Inc., New York, N.Y.
|
| 25.
|
Knoblich, J. A.,
K. Sauer,
L. Jones,
H. Richardson,
R. Saint, and C. F. Lehner.
1994.
Cyclin E controls S phase progression and its down regulation during Drosophila embryogenesis is required for the arrest of cell proliferation.
Cell
77:107-120[CrossRef][Medline].
|
| 26.
|
Koch, C., and K. Nasmyth.
1994.
Cell cycle regulated transcription in yeast.
Curr. Opin. Cell Biol.
6:451-459[CrossRef][Medline].
|
| 27.
|
Levine, K.,
K. Huang, and F. R. Cross.
1996.
Saccharomyces cerevisiae G1 cyclins differ in their intrinsic functional specificities.
Mol. Cell. Biol.
16:6794-6803[Abstract/Free Full Text].
|
| 28.
|
Levine, K.,
L. J. W. M. Oehlen, and F. R. Cross.
1998.
Isolation and characterization of new alleles of the cyclin-dependent kinase gene CDC28 with cyclin-specific functional and biochemical defects.
Mol. Cell. Biol.
18:290-302[Abstract/Free Full Text].
|
| 29.
|
Lew, D. J., and S. I. Reed.
1993.
Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins.
J. Cell Biol.
120:1305-1320[Abstract/Free Full Text].
|
| 30.
|
Li, J.,
A. N. Meyer, and D. Donoghue.
1997.
Nuclear localization of cyclin B1 mediates ints biological activity and is regulated by phosphorylation.
Proc. Natl. Acad. Sci. USA
94:502-507[Abstract/Free Full Text].
|
| 31.
|
Lukas, J.,
M. Pagano,
Z. Staskova,
G. Draetta, and J. Bartek.
1994.
Cyclin D1 protein oscillates and is essential for cell cycle progression in human tumour cell lines.
Oncogene
9:707-718[Medline].
|
| 32.
|
Maridor, G.,
P. Gallant,
R. Golsteyn, and E. A. Nigg.
1993.
Nuclear localization of vertebrate cyclin A correlates with its ability to form complexes with cdk catalytic subunits.
J. Cell Sci.
106:535-544[Abstract].
|
| 33.
|
McInerny, C. J.,
J. F. Partridge,
G. E. Mikesell,
D. P. Creemer, and L. L. Breeden.
1997.
A novel Mcm1-dependent element in the SWI4, CLN3, CDC6, and CDC47 promoters activates M/G1-specific transcription.
Genes Dev.
11:1277-1288[Abstract/Free Full Text].
|
| 34.
|
Measday, V.,
L. Moore,
J. Ogas,
M. Tyers, and B. Andrews.
1994.
The PCL2 (ORFD)-PHO85 cyclin-dependent kinase complex: a cell cycle regulator in yeast.
Science
266:1391-1395[Abstract/Free Full Text].
|
| 35.
|
Mendenhall, M. D.
1993.
An inhibitor of p34CDC28 protein kinase activity from Saccharomyces cerevisiae.
Science
259:216-219[Abstract/Free Full Text].
|
| 36.
|
Moore, J. D.,
J. Yang,
R. Truant, and S. Kornbluth.
1999.
Nuclear import of Cdk/cyclin complexes: identification of distinct mechanisms for import of Cdk2/cyclin E and Cdc2/cyclin B1.
J. Cell Biol.
144:213-224[Abstract/Free Full Text].
|
| 37.
|
Morgan, D. O.
1995.
Principles of CDK regulation.
Nature
374:131-134[CrossRef][Medline].
|
| 38.
|
Nash, R.,
G. Tokiwa,
S. Anand,
K. Erickson, and A. B. Futcher.
1988.
The WHI1+ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog.
EMBO J.
7:4335-4346[Medline].
|
| 39.
|
Nelson, M., and P. Silver.
1989.
Context affects nuclear protein localization in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:384-389[Abstract/Free Full Text].
|
| 40.
|
Nishizawa, M.,
M. Kawasumi,
M. Fujino, and A. Toh-e.
1998.
Phosphorylation of sic1, a cyclin-dependent kinase (Cdk) inhibitor, by Cdk including Pho85 kinase is required for its promp degradation.
Mol. Biol. Cell
9:2395-2405.
|
| 41.
|
Oehlen, L. J. W. M., and F. R. Cross.
1994.
G1 cyclins CLN1 and CLN2 repress the mating factor response pathway at Start in the yeast cell cycle.
Genes Dev.
8:1058-1070[Abstract/Free Full Text].
|
| 42.
|
Ogas, J.,
B. J. Andrews, and I. Herskowitz.
1991.
Transcriptional activation of CLN1, CLN2, and a putative new G1 cyclin (HCS26) by SWI4, a positive regulator of G1-specific transcription.
Cell
66:1015-1026[CrossRef][Medline].
|
| 43.
|
Ohtsubo, M.,
A. M. Theodoras,
J. Schumacher,
J. M. Roberts, and M. Pagano.
1995.
Human cyclin E, a nuclear protein essential for the G1-to-S phase transition.
Mol. Cell. Biol.
15:2612-2524[Abstract/Free Full Text].
|
| 44.
|
Pines, J., and T. Hunter.
1994.
The differential localization of human cyclins A and B is due to a cytoplasmic retention signal in cyclin B.
EMBO J.
13:3772-3781[Medline].
|
| 45.
|
Pines, J., and T. Hunter.
1991.
Human cyclins A and B1 are differentially located in the cell and undergo cell cycle-dependent nuclear transport.
J. Cell Biol.
115:1-17[Abstract/Free Full Text].
|
| 46.
|
Richardson, H. E.,
C. Wittenberg,
F. Cross, and S. I. Reed.
1989.
An essential G1 function for cyclin-like proteins in yeast.
Cell
59:1127-1133[CrossRef][Medline].
|
| 47.
|
Rout, M. P., and J. V. Kilmartin.
1990.
Components of the yeast spindle and spindle pole body.
J. Cell Biol.
111:1913-1927[Abstract/Free Full Text].
|
| 48.
|
Schwab, M.,
A. S. Lutum, and W. Seufert.
1997.
Yeast Hct1 is a regulator of Clb2 cyclin proteolysis.
Cell
90:683-693[CrossRef][Medline].
|
| 49.
|
Schwob, E.,
T. Böhm,
M. D. Mendenhall, and K. Nasmyth.
1994.
The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae.
Cell
79:233-244[CrossRef][Medline].
|
| 50.
|
Schwob, E., and K. Nasmyth.
1993.
CLB5 and CLB6, a new pair of B cyclins involved in DNA replication in Saccharomyces cerevisiae.
Genes Dev.
7:1160-1175[Abstract/Free Full Text].
|
| 51.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1989.
Laboratory course manual for methods in yeast genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 52.
|
Sikorski, R. S., and P. Hieter.
1989.
A system for shuttle vectors and yeast strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 53.
|
Srinivasan, J.,
M. Koszelak,
M. Mendelow,
Y. G. Kwon, and D. S. Lawrence.
1995.
The design of peptide based substrates for the cdc2 protein kinase.
Biochem. J.
309:927-931.
|
| 54.
|
Stade, K.,
C. S. Ford,
C. Guthrie, and K. Weis.
1997.
Exportin 1 (Crm1p) is an essential nuclear export factor.
Cell
90:1041-1050[CrossRef][Medline].
|
| 55.
|
Strambio-de-Castillia, C.,
G. Blobel, and M. P. Rout.
1995.
Isolation and characterization of nuclear envelopes from the yeast Saccharomyces.
J. Cell Biol.
131:19-31[Abstract/Free Full Text].
|
| 56.
|
Stuart, D., and C. Wittenberg.
1995.
CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells.
Genes Dev.
9:2780-2794[Abstract/Free Full Text].
|
| 57.
|
Toyoshima, F.,
T. Moriguchi,
A. Wada,
M. Fukuda, and E. Nishida.
1998.
Nuclear export of cyclin B1 and its possible role in the DNA damage-induced G2 checkpoint.
EMBO J.
17:2728-2735[CrossRef][Medline].
|
| 58.
|
Tyers, M.
1996.
The cyclin-dependent kinase inhibitor p40SIC1 imposes the requirement for CLN G1 cyclin function at Start.
Proc. Natl. Acad. Sci. USA
93:7772-7776[Abstract/Free Full Text].
|
| 59.
|
Tyers, M.,
G. Tokiwa, and B. Futcher.
1993.
Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins.
EMBO J.
12:1955-1968[Medline].
|
| 60.
|
Tyers, M.,
G. Tokiwa,
R. Nash, and B. Futcher.
1992.
The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation.
EMBO J.
11:1773-1784[Medline].
|
| 61.
|
Verma, R.,
R. S. Annan,
M. J. Huddleston,
S. A. Carr,
G. Reynard, and R. J. Deshaies.
1997.
Phosphorylation of Sic1p by G1 Cdk required for its degradation and entry into S phase.
Science
278:455-460[Abstract/Free Full Text].
|
| 62.
|
Visintin, R.,
S. Prinz, and A. Amon.
1998.
CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis.
Science
278:460-463[Abstract/Free Full Text].
|
| 63.
|
Wen, W.,
J. L. Meinkoth,
R. Y. Tsein, and S. S. Taylor.
1995.
Identification of a signal for rapid export of proteins from the nucleus.
Cell
82:463-473[CrossRef][Medline].
|
| 64.
|
Wittenberg, C.,
K. Sugimoto, and S. I. Reed.
1990.
G1-specific cyclins of S. cerevisiae: cell cycle periodicity, regulation by mating pheromone, and association with the p34CDC28 protein kinase.
Cell
62:225-237[CrossRef][Medline].
|
| 65.
|
Yaglom, J.,
M. H. K. Linskens,
S. Sadis,
D. M. Rubin,
B. Futcher, and D. Finley.
1995.
p34Cdc28-mediated control of Cln3 cyclin degradation.
Mol. Cell. Biol.
15:731-740[Abstract/Free Full Text].
|
| 66.
|
Yang, J.,
E. S. Bardes,
J. D. Moore,
J. Brennan,
M. A. Powers, and S. Kornbluth.
1998.
Control of cyclin B1 localization through regulated binding of the nuclear export factor CRM1.
Genes Dev.
12:2131-2143[Abstract/Free Full Text].
|
| 67.
|
Zachariae, W., and K. Nasmyth.
1996.
TPR proteins required for anaphase progression mediate ubiquitination of mitotic B-type cyclins in yeast.
Mol. Biol. Cell
7:791-801[Abstract].
|
| 68.
|
Zachariae, W.,
A. Shevchenko,
P. D. Andrews,
R. Ciosk,
M. Galova,
M. J. R. Stark,
M. Mann, and K. Nasmyth.
1998.
Mass spectrometric analysis of the anaphase-promoting complex of yeast: identification of a subunit related to cullins.
Science
279:1216-1219[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 2000, p. 542-555, Vol. 20, No. 2
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Streckfuss-Bomeke, K., Schulze, F., Herzog, B., Scholz, E., Braus, G. H.
(2009). Degradation of Saccharomyces cerevisiae Transcription Factor Gcn4 Requires a C-Terminal Nuclear Localization Signal in the Cyclin Pcl5. Eukaryot Cell
8: 496-510
[Abstract]
[Full Text]
-
Jorgensen, P., Edgington, N. P., Schneider, B. L., Rupes, I., Tyers, M., Futcher, B.
(2007). The Size of the Nucleus Increases as Yeast Cells Grow. Mol. Biol. Cell
18: 3523-3532
[Abstract]
[Full Text]
-
Rubenstein, E. M., Schmidt, M. C.
(2007). Mechanisms Regulating the Protein Kinases of Saccharomyces cerevisiae. Eukaryot Cell
6: 571-583
[Full Text]
-
Hungerbuehler, A. K., Philippsen, P., Gladfelter, A. S.
(2007). Limited Functional Redundancy and Oscillation of Cyclins in Multinucleated Ashbya gossypii Fungal Cells. Eukaryot Cell
6: 473-486
[Abstract]
[Full Text]
-
Eluere, R., Offner, N., Varlet, I., Motteux, O., Signon, L., Picard, A., Bailly, E., Simon, M.-N.
(2007). Compartmentalization of the functions and regulation of the mitotic cyclin Clb2 in S. cerevisiae. J. Cell Sci.
120: 702-711
[Abstract]
[Full Text]
-
Flick, K., Wittenberg, C.
(2005). Multiple Pathways for Suppression of Mutants Affecting G1-Specific Transcription in Saccharomyces cerevisiae. Genetics
169: 37-49
[Abstract]
[Full Text]
-
Queralt, E., Igual, J. C.
(2004). Functional Distinction Between Cln1p and Cln2p Cyclins in the Control of the Saccharomyces cerevisiae Mitotic Cycle. Genetics
168: 129-140
[Abstract]
[Full Text]
-
Chen, K. C., Calzone, L., Csikasz-Nagy, A., Cross, F. R., Novak, B., Tyson, J. J.
(2004). Integrative Analysis of Cell Cycle Control in Budding Yeast. Mol. Biol. Cell
15: 3841-3862
[Abstract]
[Full Text]
-
Han, B.-K., Aramayo, R., Polymenis, M.
(2003). The G1 Cyclin Cln3p Controls Vacuolar Biogenesis in Saccharomyces cerevisiae. Genetics
165: 467-476
[Abstract]
[Full Text]
-
Moore, J. D., Kirk, J. A., Hunt, T.
(2003). Unmasking the S-Phase-Promoting Potential of Cyclin B1. Science
300: 987-990
[Abstract]
[Full Text]
-
Queralt, E., Igual, J. C.
(2003). Cell Cycle Activation of the Swi6p Transcription Factor Is Linked to Nucleocytoplasmic Shuttling. Mol. Cell. Biol.
23: 3126-3140
[Abstract]
[Full Text]
-
Nguyen, T. B., Manova, K., Capodieci, P., Lindon, C., Bottega, S., Wang, X.-Y., Refik-Rogers, J., Pines, J., Wolgemuth, D. J., Koff, A.
(2002). Characterization and Expression of Mammalian Cyclin B3, a Prepachytene Meiotic Cyclin. J. Biol. Chem.
277: 41960-41969
[Abstract]
[Full Text]
-
Shemer, R., Meimoun, A., Holtzman, T., Kornitzer, D.
(2002). Regulation of the Transcription Factor Gcn4 by Pho85 Cyclin Pcl5. Mol. Cell. Biol.
22: 5395-5404
[Abstract]
[Full Text]
-
Wijnen, H., Landman, A., Futcher, B.
(2002). The G1 Cyclin Cln3 Promotes Cell Cycle Entry via the Transcription Factor Swi6. Mol. Cell. Biol.
22: 4402-4418
[Abstract]
[Full Text]
-
Edgington, N. P., Futcher, B.
(2002). Relationship between the function and the location of G1 cyclins in S. cerevisiae. J. Cell Sci.
114: 4599-4611
[Abstract]
[Full Text]
-
Cross, F. R., Archambault, V., Miller, M., Klovstad, M.
(2002). Testing a Mathematical Model of the Yeast Cell Cycle. Mol. Biol. Cell
13: 52-70
[Abstract]
[Full Text]
-
Gari, E., Volpe, T., Wang, H., Gallego, C., Futcher, B., Aldea, M.
(2001). Whi3 binds the mRNA of the G1 cyclin CLN3 to modulate cell fate in budding yeast. Genes Dev.
15: 2803-2808
[Abstract]
[Full Text]
-
Miller, M. E., Cross, F. R.
(2001). Mechanisms Controlling Subcellular Localization of the G1 Cyclins Cln2p and Cln3p in Budding Yeast. Mol. Cell. Biol.
21: 6292-6311
[Abstract]
[Full Text]
-
Draviam, V. M., Orrechia, S., Lowe, M., Pardi, R., Pines, J.
(2001). The Localization of Human Cyclins B1 and B2 Determines Cdk1 Substrate Specificity and Neither Enzyme Requires Mek to Disassemble the Golgi Apparatus. JCB
152: 945-958
[Abstract]
[Full Text]
-
Miller, M., Cross, F.
(2001). Cyclin specificity: how many wheels do you need on a unicycle?. J. Cell Sci.
114: 1811-1820
[Abstract]