Previous Article | Next Article 
Molecular and Cellular Biology, January 2000, p. 594-603, Vol. 20, No. 2
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
An Antitumor Drug-Induced Topoisomerase Cleavage
Complex Blocks a Bacteriophage T4 Replication Fork In Vivo
George
Hong and
Kenneth N.
Kreuzer*
Department of Microbiology, Duke University
Medical Center, Durham, North Carolina 27710
Received 23 August 1999/Returned for modification 21 September
1999/Accepted 20 October 1999
 |
ABSTRACT |
Many antitumor and antibacterial drugs inhibit DNA topoisomerases
by trapping covalent enzyme-DNA cleavage complexes. Formation of
cleavage complexes is important for cytotoxicity, but evidence suggests
that cleavage complexes themselves are not sufficient to cause cell
death. Rather, active cellular processes such as transcription and/or
replication are probably necessary to transform cleavage complexes into
cytotoxic lesions. Using defined plasmid substrates and two-dimensional
agarose gel analysis, we examined the collision of an active
replication fork with an antitumor drug-trapped cleavage complex.
Discrete DNA molecules accumulated on the simple Y arc, with branch
points very close to the topoisomerase cleavage site. Accumulation of
the Y-form DNA required the presence of a topoisomerase cleavage site,
the antitumor drug, the type II topoisomerase, and a T4 replication
origin on the plasmid. Furthermore, all three arms of the Y-form DNA
were replicated, arguing strongly that these are trapped replication
intermediates. The Y-form DNA appeared even in the absence of two
important phage recombination proteins, implying that Y-form DNA is the
result of replication rather than recombination. This is the first
direct evidence that a drug-induced topoisomerase cleavage complex
blocks the replication fork in vivo. Surprisingly, these blocked
replication forks do not contain DNA breaks at the topoisomerase
cleavage site, implying that the replication complex was inactivated
(at least temporarily) and that topoisomerase resealed the drug-induced DNA breaks. The replication fork may behave similarly at other types of
DNA lesions, and thus cleavage complexes could represent a useful
(site-specific) model for chemical- and radiation-induced DNA damage.
| |
INTRODUCTION |
Type II DNA topoisomerases are
involved in diverse cellular processes such as replication,
transcription, recombination, chromosome condensation, and the
maintenance of genome stability. These enzymes transform the
topological state of DNA by a strand passage reaction (for reviews, see
references 6, 65, and 66). After
binding to one segment of duplex DNA, a type II topoisomerase cleaves the duplex with a four-base stagger while covalently attaching to both
5' ends via phosphotyrosine linkages. This reaction intermediate, with
the enzyme covalently linked to broken DNA, is referred to as the
cleavage complex. After passage of a second duplex segment through the
break, the topoisomerase reverses the phosphotyrosine linkages and
rejoins the cleaved DNA ends.
Mammalian type II topoisomerases are targets of many important
antitumor drug classes, including aminoacridines, anthracenediones, anthracyclines, ellipticines, and epipodophyllotoxins (for reviews, see
references 10, 13, and 55). In
addition, bacterial type II topoisomerases are targets of clinically
important antibacterial agents (quinolones and flouroquinolones)
(17, 28). Remarkably, all these antitumor and antibacterial
agents inhibit the enzyme by trapping the cleavage complex. The
simplest model is that the drug, localized precisely at the site of DNA
cleavage, prevents topoisomerase from rejoining DNA breaks.
Results from different systems suggest that the cytotoxicity of
topoisomerase inhibitors depends on trapping of the cleavage complex
rather than loss of enzyme activity (for reviews, see references
13, 17, and 44). First,
Escherichia coli cells that contain both nalidixic
acid-sensitive and -resistant DNA gyrase are sensitive to nalidixic
acid (24, 33). This result implies that in the presence of
drug, the drug-sensitive gyrase causes cytotoxicity even though the
resistant gyrase is enzymatically active. Second, bacteriophage T7
growth is inhibited by nalidixic acid even though T7 does not require
DNA gyrase for growth, and this inhibition is alleviated by heat
inactivation of a thermosensitive gyrase subunit A (36).
Third, mutational inactivation of bacteriophage T4 topoisomerase, which
is not totally essential for growth, causes drug resistance
(50). Fourth, overproduction of type II topoisomerase in
Saccharomyces cerevisiae causes hypersensitivity to
antitumor drugs (52). Fifth, in various systems,
recombinational repair reduces sensitivity to topoisomerase inhibitors,
consistent with the cleavage complex (or some derivative) causing DNA
damage (18, 32, 33, 50, 52).
The drug-induced cleavage complex itself is apparently not a cytotoxic
lesion; cellular processes are probably required to cause cytotoxicity
(15). For example, inhibition of protein synthesis protects
cells from cytotoxicity but does not prevent the formation of cleavage
complexes (59). In addition, mammalian cells treated with a
topoisomerase poison survive much better when they are simultaneously
treated with dinitrophenol, an uncoupler of oxidative phosphorylation
that reduces the intracellular ATP pool (39). Since
dinitrophenol has little effect on cleavage complex formation, an
ATP-requiring process (e.g., transcription or DNA replication)
subsequent to cleavage complex formation is apparently involved in the
cytotoxicity of topoisomerase poisons.
Transcription appears to play a role in the killing of certain
mammalian cells by
4'-(9-acridinylamino)methanesulfon-m-anisidide (m-AMSA) because the transcription inhibitor
cordycepin protects G1-phase cells (15). The
involvement of transcription, however, may not be universal. Yeast
cells arrested by 
factor are transcription competent and yet
resistant to m-AMSA and the epipodophyllotoxin etoposide
(53). This result suggests that DNA replication might be
important for cytotoxicity. Indeed, S-phase yeast cells are more
readily killed by m-AMSA than are G1-phase yeast
cells (53). Furthermore, the cytotoxicity of
m-AMSA can be reduced or abolished if mammalian S-phase
cells are cotreated with the DNA polymerase inhibitor aphidicolin
(15, 27, 67). These results argue that some interaction
between the drug-induced cleavage complex and the replication apparatus
can be very important in cell death mediated by topoisomerase inhibitors.
We analyzed the collision of a replication fork with a drug-stabilized
cleavage complex in vivo by using the bacteriophage T4 model system.
Phage T4 encodes a type II DNA topoisomerase that is inhibited by many
of the same antitumor drugs that block the mammalian enzyme. The T4
topoisomerase was demonstrated to be the physiological target for
m-AMSA (31), and inhibition of phage growth is
probably dependent on cleavage complex formation (see above)
(50). Recombinational repair of damage derived from the
drug-induced cleavage complex is important in both the bacteriophage T4
and mammalian systems, which also argues that T4 is a useful model
system for these studies. Bacteriophage T4 is obviously not a suitable
model system for all aspects of topoisomerase inhibitor action, since
it lacks the cell cycle checkpoints and programmed cell death responses
seen in the more complex mammalian systems. Nevertheless, T4 provides
many experimental advantages for this study, including the availability
of mutants in all important replication and recombination genes,
well-defined replication origins, a unique cytosine modification that
marks DNA at the time of replication, and a type II topoisomerase that
has been carefully analyzed for DNA sequence recognition (19,
38). Here, we use a strong topoisomerase cleavage site and a
cloned T4 replication origin to examine the in vivo consequence of a collision between a replication fork and an m-AMSA-induced
type II topoisomerase cleavage complex.
| |
MATERIALS AND METHODS |
Materials.
m-AMSA was provided by the Drug Synthesis
and Chemistry Branch, National Cancer Institute. Oligonucleotides were
purchased from National Biosciences. Nylon blotting membrane was
obtained from Schleicher & Schuell, the random-primed labeling kit was obtained from Boehringer Mannheim, and Sequenase version 2.0 was obtained from United States Biochemicals. Restriction enzymes and T4
ligase were purchased from New England Biolabs.
Bacterial and phage strains.
The host for all infections was
an acrA::Tn10-kan derivative of
E. coli NapIV (hsdMK+
hsdRK
hsdSK+ rglB1
nonsuppressing) (51). The acrA mutation
eliminates a multidrug efflux pump so that the infected cells are more
sensitive to m-AMSA (J. George and K. Kreuzer, unpublished
data). Phage strains used in this study were T4 K10 (amB262
[gene 38] amS29 [gene 51]
nd28 [denA] rIIPT8
[denB-rII deletion]) (61),
K10-46/uvsX (as K10, with amB14 [gene
46] and am11 [gene uvsX])
(37), K10-39 (as K10, with amN116
[gene 39]) (49) and T4 dC (amC87
[gene 42], amE51 [gene 56], NB5060
[denB-rII deletion], W7 [gene
alc], and probably an uncharacterized denA
mutation) (62).
Plasmid construction.
For these studies, we used a strong
m-AMSA-inducible topoisomerase cleavage site (topo site)
that had been designed based on an analysis of T4 topoisomerase
sequence recognition (19, 20). Plasmid pGH2, containing this
strong site, was constructed by ligating the following duplex
oligonucleotide to the large BamHI-SalI fragment
of pBR322:
5'GATCCAAGCTAAAGTTATATAACTTTATTCAAGG3' 3'GTTCGATTTCAATATATTGAAATAAGTTCCAGCT5'
Plasmid pGH2-01 was constructed by ligating a purified
PstI-ClaI fragment [containing the T4 origin,
ori(34) (ori)] from plasmid pKK061-6 (46) to the
large purified PstI-ClaI fragment of pGH2 (which
contains the topo site). A control plasmid, pGH4, lacking both the topo
site and the T4 origin, was constructed by cleaving pGH2 with
BamHI and SalI, filling in the ends with Klenow
polymerase, purifying the large fragment from low-melting-temperature
agarose, and then ligating the fragment into a circle. Another control plasmid, pGH4-01, which has the ori but not the topo site, was constructed as follows. Plasmid pGH2-01 was cleaved with
PstI and ClaI, and the small fragment containing
the T4 origin was purified. Similarly, plasmid pGH4 was cleaved with
the same two enzymes and the large fragment containing the
BamHI-SalI deletion was purified. The two
fragments were ligated and transformed.
T4 infections and DNA preparations.
NapIV acrA
cells containing the indicated plasmid were grown with vigorous shaking
at 37°C to a cell density of 4 × 108 per ml and
then infected with the indicated bacteriophage T4 strain at a
multiplicity of 3 PFU per cell. After 4 min at 37°C, without shaking,
for adsorption, the cells were incubated for 2 min with shaking and
then m-AMSA was added at 10 µg/ml (unless otherwise
indicated). The infected cells were then incubated with vigorous
shaking at 37°C for 18 min. Infected cells from 1 ml of the culture
were collected by centrifugation, and the pellet was frozen in a dry
ice-ethanol bath. The frozen pellet was thawed in 300 µl of cleavage
lysis buffer (50 mM Tris-HCl [pH 7.8], 10 mM disodium EDTA, 100 mM
NaCl, 0.2% sodium dodecyl sulfate [SDS]). Proteinase K was added to
0.5 mg/ml, and the suspension was incubated at 65°C for 2 h. The
total nucleic acid was extracted sequentially with phenol and
chloroform-isoamyl alcohol (24:1) and then dialyzed overnight at 4°C
against TE buffer (10 mM Tris-HCl [pH 7.8], 1 mM disodium EDTA).
The experiment in Fig.
8 compared two different extraction conditions.
One aliquot (1 ml) of infected cells was added to 1
ml of 2× reversal
lysis buffer (final concentrations: 50 mM Tris-HCl
[pH 7.8], 10 mM
disodium EDTA, 100 mM NaCl, 1% Triton X-100, 1.8
mg of lysozyme per
ml) and placed at 65°C for 20 min. After this
incubation for reversal
of cleavage complexes, SDS (0.2%) and
proteinase K (0.5 mg/ml) were
added and the sample was incubated
at 65°C for an additional 100 min.
A second aliquot (1 ml) of
infected cells was added to 200 µl of 6×
cleavage lysis buffer
(final concentrations: 50 mM Tris-HCl [pH 7.8],
10 mM disodium
EDTA, 100 mM NaCl, 0.2% SDS) and incubated at 37°C
for 20 min.
The sample was then incubated at 65°C for an additional
100 min.
Nucleic acids from both samples were purified as described
above.
Agarose gel electrophoresis and Southern hybridization.
Nucleic acid samples were treated with the indicated restriction
enzymes before being subjected to gel electrophoresis. The one-dimension gels contained 1% agarose and were run in 0.5× TBE buffer (1× TBE contains 89 mM Tris-HCl, 89 mM borate, and 2.0 mM
disodium EDTA) at 2.8 V/cm for 15 h. The two-dimension gel protocol was from Friedman and Brewer (21). Briefly, the
first-dimension gel was a 0.4% agarose gel run in 1× TBE buffer for
30 h at 1 V/cm at room temperature (21°C). The desired gel lane
was sliced from the first-dimension gel and cast across the top of a
second-dimension 1% agarose gel, which was run in 1× TBE containing
ethidium bromide (0.3 µg/ml) for 15 h at 6 V/cm in the cold
(4°C). For Southern hybridization, agarose gels were transferred to a
nylon blotting membrane by the downward sponge method (adapted from
reference 48). The probe for the Southern blots
consisted of pBR322 DNA labeled with [-32P]dATP by
using the random-primed DNA-labeling kit.
| |
RESULTS |
Inhibition of DNA replication by m-AMSA.
The
antitumor drug m-AMSA blocks T4 growth by targeting the
phage-encoded type II topoisomerase (31). Nevertheless, this enzyme is not essential for T4 DNA replication, presumably because the
host DNA gyrase can substitute for it (45). We therefore began by testing whether m-AMSA inhibits T4 DNA replication
and, if so, whether the inhibition is caused by reduction of the
topoisomerase catalytic activity or stabilization of the cleavage
complex. Bacterial cells were infected with either
topoisomerase-proficient bacteriophage T4 (strain K10) or an isogenic
topoisomerase-deficient mutant (K10-39am) and
treated with various levels of m-AMSA. DNA was collected after 24 min of infection and analyzed by restriction enzyme digestion followed by gel electrophoresis. A large majority of the ethidium bromide-stained DNA in this gel consists of phage DNA that has been
replicated during this infection, since T4 replication predominates during the infection and E. coli DNA replication is shut
off. Even at the lowest level of m-AMSA, T4 DNA replication
was greatly inhibited in the K10 infection (Fig.
1A). However, m-AMSA had much
less effect on DNA replication in the K10-39am
infection (compare Fig. 1A and B). These results argue that
m-AMSA does not inhibit T4 DNA replication by reducing the
topoisomerase catalytic activity. If this had been true, the extent of
T4 DNA replication should have been equal in the
K10-39am infection with or without drug and in
the K10 infection with m-AMSA. Instead, the absence of
topoisomerase actually protected phage DNA replication from
m-AMSA. These results argue strongly that formation of the
cleavage complex inhibits T4 DNA replication.
View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
Inhibition of T4 replication by m-AMSA.
Nonsuppressing E. coli cells were infected with either
bacteriophage K10 (encoding wild-type topoisomerase) (A) or
K10-39am (topoisomerase-deficient mutant) (B). Phage
attachment was allowed for 4 min, and m-AMSA was added 2 min
later (at 0, 5, 15, and 50 µg/ml in lanes 1 to 4, respectively).
After an additional 18 min of infection, DNA was harvested. The DNA was
purified, digested with AseI and HaeIII, and
subjected to electrophoresis through a 1% agarose gel, and the
resulting fragments were visualized by ethidium bromide staining. These
bacterial cells also harbored a plasmid containing a T4 origin; plasmid
replication is analyzed in detail below (Fig. 2).
|
|
Plasmid replication and m-AMSA-induced cleavage during
T4 infection.
To examine the encounter of replication forks and
m-AMSA-induced cleavage complexes, a plasmid model system
was used because proper controls can easily be constructed and because
larger amounts of DNA can be visualized. We constructed a series of
closely related plasmids that differ only in whether they contain a
cloned strong m-AMSA-inducibe topoisomerase cleavage site
(topo site) and/or the T4 replication origin ori(34) (ori)
(20, 46). Drug-induced cleavage of the plasmids was analyzed
after plasmid-bearing cells were infected with T4 strain K10, which
produces modified DNA during replication (see below). Although these
plasmids contain the ColE1 origin, they do not replicate during a T4
infection unless a T4 origin is present on the plasmid (5)
(see below).
DNA from the drug-free control infections produced the expected linear
AseI fragments from all four plasmids (Fig.
2A, lanes
1 to 4). For the two
ori-containing plasmids, this band consists
of both T4-replicated
plasmid and residual plasmid that was not
replicated during the
infection. To visualize only the plasmid
DNA that had been replicated
by T4, we took advantage of the cytosine
modifications that are
introduced during T4-directed DNA replication
(by direct incorporation
of 5-hydroxymethyl dCMP [Hm-dCMP]).
AseI,
which was used
to linearize the plasmid DNA, cleaves DNA regardless
of whether the
cytosine residues are modified. However,
HaeIII
cannot
cleave Hm-dCMP-containing DNA, and the plasmids contain
numerous
HaeIII recognition sites. Therefore, by including
HaeIII
in the digest, all unreplicated plasmid DNA is
cleaved into small
fragments that run off the gel but all T4-replicated
plasmid DNA
is unaffected. In this case, Southern hybridization with
the plasmid
probe revealed only T4-replicated DNA. As expected,
T4-replicated
plasmid DNA was generated only with the ori-containing
plasmids
(Fig.
2A, lanes 5 to 8).
View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Replication and topoisomerase cleavage of plasmid
substrates. DNA was purified after T4 infection either in the presence
(B and D) or absence (A and C) of m-AMSA (10 µg/ml for K10
and 2.5 µg/ml for T4 dC infections [same conditions as described in
Fig. 1 and Materials and Methods]). The infecting phage was T4 K10,
which produces modified DNA (A and B), or T4 dC, which produces
unmodified DNA (C and D). The presence or absence of the topo site and
the ori on each plasmid is indicated. Each sample was digested with the
indicated restriction enzymes and subjected to agarose gel
electrophoresis and Southern hybridization with pBR322 as the probe.
The cleavage products from the cloned m-AMSA-induced
cleavage site are indicated by asterisks. One relatively strong
m-AMSA-induced cleavage site in the vector generates two
partner fragments, indicated by daggers, whereas another generates two
comigrating partner fragments, indicated by a double dagger. In
comparing the cleavage products generated from the cloned topo site in
the ori versus non-ori plasmids (highlighted with asterisks in lanes 1 and 3 of panels B and D), the smaller cleavage products differed in
size due to the presence or absence of the cloned ori. In the K10
infections (panel B), the larger cleavage product from the
ori-containing plasmid migrated more slowly than that from the non-ori
plasmid because the former DNA is modified.
|
|
When
m-AMSA was added to the infections, topoisomerase
cleavage products smaller than the linear plasmid DNA were evident
(Fig.
2B). Consider first the non-ori plasmids. When the non-ori
plasmid contained the cloned topo site, most of the
m-AMSA-induced
cleavage was at this site, generating the two
expected partner
fragments after
AseI digestion; these two
fragments disappeared
when the topo site was absent (Fig.
2B, lanes 1 and 2). The patterns
with the ori-containing plasmids are more complex.
In the
AseI
digest of the ori- and topo site-containing
plasmid, the same
two partner fragments were detected, along with
several additional
sublinear fragments (Fig.
2B, lane 3). These include
fragments
generated by at least two other relatively strong topo sites
in
the vector (Fig.
2B, lanes 3 and 4). The additional cleavage
products
must have been generated from the replicated plasmid DNA,
because
they were resistant to
HaeIII (lanes 7 and 8).
Furthermore, these
additional cleavage fragments were not detected when
the DNA was
treated with only
PstI, which linearizes
unreplicated DNA but
cannot cleave T4-modified DNA (data not
shown).
One model to explain the additional sites of
m-AMSA-induced
cleavage in the replicated (modified) DNA is that the T4 topoisomerase
recognizes additional sites when DNA contains modified cytosine
residues (
35,
56). If this is true, these additional sites
should not be recognized when the replicated DNA is generated
during
infections by T4 dC, a multiple-mutant phage strain which
replicates
with unmodified cytosine residues (
40). The ori-containing
plasmids replicated extensively in T4 dC infections, as judged
by the
ori-dependent increase in the amount of linearized plasmid
DNA in the
AseI digests (Fig.
2C, lanes 1 to 4). Also as expected,
the
replicated plasmid DNA was sensitive to
HaeIII (data not
shown).
The
m-AMSA-induced cleavage patterns from the T4 dC
infections
were very simple, with only the cloned topo site generating
the
two expected partner fragments regardless of the presence of the
ori (Fig.
2D, lanes 1 and 3). Therefore, the T4 cytosine modifications
led to recognition of the additional cleavage sites by T4 topoisomerase
in the K10 infections above. This conclusion was confirmed by
in vitro
cleavage assays with purified T4 topoisomerase (data
not shown). For
the experiments described below, the most important
conclusion is that
the cloned topo site is the only strong site
in the plasmid during T4
dC infections and is one of about three
strong sites during infections
by phages that make modified DNA
(e.g., strain
K10).
Unique Y-form DNAs generated at the topo site in the presence of
m-AMSA.
Since the m-AMSA-induced cleavage
complexes formed at the cloned topo site can be visualized easily, we
next analyzed the collision between a replication fork and the
topoisomerase cleavage complex by two-dimensional (neutral-neutral) gel
electrophoresis (8, 21). In this method, DNA fragments are
separated by mass in the first dimension (left to right) and by both
mass and shape in the second dimension (top to bottom). Because of
their branched structures, a series of replicative intermediates
generates unique arc shapes with reduced migration in the second dimension.
The branched DNA structures generated from T4 ori-containing plasmids
during T4 infection are primarily intermediates of rolling-circle
replication. Indirect evidence suggests that such plasmids begin
replication in the theta forms, which are then converted into
rolling
circles that replicate in either direction (
2-4) (Fig.
3A). The two different directions of
rolling-circle replication
generate two families of Y-form
intermediates after the plasmid
is linearized by restriction digests in
vitro (Fig.
3E), but both
families fall on the simple Y arc in the
two-dimensional gel.
This arc emanates from the linear monomer spot,
reaches a peak
that contains intermediates with branches near the
middle of the
restriction fragment, and then returns to the diagonal of
linear
DNA at twice the size of the plasmid (almost fully replicated
intermediates).
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
Model for generation of Y-form DNAs. The possible steps
involved in generating Y-form DNA from an ori-containing plasmid are
diagrammed. (A) The plasmid initiates replication in a presumed theta
form. (B) The theta form then converts into a rolling circle, possibly
by means of a DNA break generated within the bubble region of the
theta. (C) Rolling-circle replication proceeds until it is blocked by
an m-AMSA-induced topoisomerase cleavage complex (depicted
as two circles at the topo site). (D) The m-AMSA-induced
topoisomerase cleavage complex reverses in vivo, but the replication
fork does not immediately restart. (E) After a restriction digest to
linearize the DNA, two unique Y-form DNAs are generated from the two
directions of rolling-circle replication.
|
|
When DNA was prepared from K10-infected cells harboring plasmids that
contained both the ori and the topo site, the simple
Y arc was greatly
enhanced by the presence of
m-AMSA (compare
Fig.
4A and
B). Furthermore, a series of unique
Y-form DNAs appeared
as discrete spots along the simple Y arc in the
infections with
m-AMSA. Importantly, two of these spots
depended on the presence
of the cloned topo site (compare Fig.
4B and
C). The migration
of these two Y-form DNAs in the first-dimension gel
(relative
to size markers) indicated that each contains a branch close
to
the cloned topo site. The two spots represent the two different
orientations of the branch, presumably resulting from rolling
circles
that replicate in each of two directions. The additional
spots most
probably reflect Y-form DNA with the branches at the
additional strong
topoisomerase cleavage sites in the plasmid
vector (see the cleavage
site analysis [above]). Since the unique
Y-form DNAs depend on the
presence of
m-AMSA and accumulate at
the topo site, we
propose that they consist of blocked replication
forks. The proposed
pathway for the formation of blocked replication
forks is diagrammed in
Fig.
3, and various aspects of this pathway
are discussed and defended
throughout this paper. Ignoring the
strong spots, the entire length of
the Y arc is much stronger
in the presence of
m-AMSA than in
its absence (compare Fig.
4A
and B). We believe that this increased
Y-form DNA is also caused
by blocked replication forks. The plasmid
vector contains numerous
weak topoisomerase cleavage sites, and
cleavage complexes located
at these sites could produce a relatively
smooth Y arc by blocking
replication forks. (In addition, the analysis
of a topoisomerase-deficient
mutant [below] argues that the increase
in the Y arc is not caused
by a loss of topoisomerase activity [see
Fig.
6].) Overexposure
of a blot from a K10 infection without
m-AMSA showed a simple
Y arc without spots, presumably
representing the normal intermediates
of rolling circle replication
(Fig.
4D) (
4).
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
Two-dimensional agarose gel electrophoresis of plasmid
DNA from a bacteriophage K10 infection. E. coli cells
harboring plasmids with or without the cloned topo site were infected
with bacteriophage K10. For this and all subsequent experiments,
attachment was for 4 min and m-AMSA (10 µg/ml) was added 2 min later where indicated. After an additional 18 min of infection, the
DNA was harvested, purified, digested with AseI (which
linearizes the plasmid), and subjected to two-dimensional gel
electrophoresis. The first-dimension gel was run from left to right,
and the second-dimension gel was run from top to bottom. Plasmid DNA
forms were visualized by Southern hybridization with a plasmid probe.
The arrows depict the two unique Y-form DNAs that result from the
cloned topo site. Panel D shows an overexposure of a blot with DNA from
a K10 infection of E. coli harboring the topo
site-containing plasmid in the absence of m-AMSA.
|
|
As demonstrated above, only a single strong topoisomerase cleavage site
is recognized on the plasmid during infections by
T4 dC. When T4 dC
infections were analyzed by two-dimensional
gel electrophoresis, the
unique Y-form DNAs again depended on
the presence of
m-AMSA,
and, as predicted, the only strong spots
occurred at the two positions
corresponding to the cloned topo
site (Fig.
5).
View larger version (81K):
[in this window]
[in a new window]
|
FIG. 5.
Two-dimensional agarose gel analysis of plasmid DNA from
bacteriophage T4 dC infection. E. coli cells harboring
plasmids with or without the cloned topo site were infected with
bacteriophage T4 dC as described in the legend to Fig. 4, except that
the concentration of m-AMSA was 2.5 µg/ml. The arrows
depict the two unique Y-form DNAs that result from the cloned topo
site. We do not understand the large amount of branched DNA in the T4
dC infection without m-AMSA; note that the unique spots are
only present with m-AMSA.
|
|
If these unique Y-form DNAs are generated from topoisomerase cleavage
complexes, they should depend on the presence of the
T4 topoisomerase.
We therefore compared DNA from infections by
wild-type and
topoisomerase-deficient (gene
39am) phages in
the presence and absence of
m-AMSA. As above, an intense
Y
arc with unique spots was detected from the wild-type infection
in the
presence of
m-AMSA (Fig.
6A and
B; panel A is underexposed
compared to
the other panels) but not from the topoisomerase-deficient
infection
(Fig.
6C). The faint arc without spots in Fig.
6C through
E presumably
represents simple replication intermediates (
4).
We conclude
that the unique Y-form DNAs depend on
m-AMSA, the
topo site,
and the presence of a functional topoisomerase.
View larger version (52K):
[in this window]
[in a new window]
|
FIG. 6.
Requirement for T4 topoisomerase. E. coli
cells harboring the plasmid with both the ori and the topo site were
infected with either K10 (wild type) or K10-39am
(topoisomerase-deficient mutant) in the presence or absence of
m-AMSA. DNA was purified, digested with AseI, and
subjected to two-dimensional gel analysis. Panel A is a lighter
exposure of panel B, while panels B to E are matched exposures.
|
|
Replication is needed for generation of Y-form DNAs.
We next
asked whether the cloned ori is also important in the generation of the
unique Y-form DNAs during infection by either T4 K10 or T4 dC. In both
infections, only the ori-containing plasmids produced the intense Y-arc
with strong spots (Fig. 7A, C, and E),
consistent with the model that these represent blocked replication forks.
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Requirement for T4 origin and DNA replication. E. coli cells harboring plasmids with the topo site, either with or
without the ori, were infected with either K10 (A through D) or T4 dC
(E and F). DNA samples were digested with AseI, in either
the presence or absence of HaeIII, and subjected to
two-dimensional gel electrophoresis.
|
|
We also asked whether the DNA within the spots on the Y arc had been
replicated by treating DNA from the K10 infections with
HaeIII, which cleaves unreplicated DNA into small pieces
(see
above). The pattern was unchanged (compare Fig.
7A and C), and
therefore the branched Y-form molecules must have been replicated
throughout the length of all three arms. The origin dependence
and the
replicated status of the Y-form DNA strongly support the
conclusion
that the Y-form DNAs arise from blocked replication
forks.
Why are Y-form DNAs not cleaved at the topo site?
If the
unique Y-form DNAs arise from replication forks that were blocked at a
cleavage complex, why is the Y form intact? The infected cells were
lysed in the presence of SDS, which should disrupt any topoisomerase
cleavage complex and reveal the staggered double-stranded break. One
explanation is that the topoisomerase resealed the cleaved DNA within
the cleavage complex before cell lysis and yet the replication fork did
not restart (Fig. 3D) (see Discussion). A different explanation is that
the topoisomerase resealed the cleaved DNA during cell lysis in some
fraction of the Y molecules, in spite of the presence of SDS. In this
case, perhaps a large proportion of Y molecules are lost during
extraction due to SDS-induced DNA cleavage, and a large increase in the
amount of Y-form DNA would be obtained if we could prevent this
SDS-induced cleavage. To explore these two possibilities, we set up
cell lysis conditions which would disfavor SDS-induced cleavage but
favor resealing of the DNA within the cleavage complex.
Purified topoisomerase can reseal broken DNA within the cleavage
complex in vitro upon dilution of drug, brief heating to
65°C, or
treatment with EDTA and/or high salt (a phenomenon known
as reversal)
(
29,
54,
57,
63). In addition, at least upon
brief heat
treatment at 65°C, cleavage complexes can reverse on
chromosomal DNA
within mammalian cells (
30).
We tested reversal conditions with purified T4 topoisomerase in vitro
and found that a large fraction of cleavage complexes
could be reversed
to intact plasmid DNA by treatment with Triton
X-100 detergent (1%) at
65°C (data not shown). We next compared
both DNA cleavage and
production of Y-form DNA when
m-AMSA-treated,
infected cells
were lysed either under these reversal conditions
or under the standard
conditions that should not favor resealing.
About 80% of the total
cleavage complexes underwent reversal,
demonstrating that the reversal
conditions worked well for in
vivo samples (Fig.
8A). However, the unique Y-form DNAs
appeared
in similar amounts in the two samples (compare Fig.
8B and C).
These results argue that intact Y-form DNA is not created by resealing
during the cell lysis procedure. Rather, we believe that topoisomerase
resealing happens in vivo prior to cell lysis (see Discussion).
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 8.
Reversal of topoisomerase cleavage does not affect the
production of branched DNA. E. coli cells harboring plasmids
containing both the ori and the topo site were infected with K10,
treated with m-AMSA, and then lysed with either reversal
lysis buffer (Rev.) or cleavage lysis buffer (Cl.) as described in
Materials and Methods. The AseI-digested samples were
analyzed on a one-dimensional gel (A) and on a two-dimensional gel (B
and C). Note that most of the topoisomerase-mediated cleavage was
reversed by the reversal conditions (A), yet the amount of unique
branched DNA did not increase (B and C).
|
|
Y-form DNAs are not dependent on recombinational repair.
One
concern about our interpretation of these results is that, in theory,
Y-form DNAs could also arise from recombination. The
m-AMSA-induced topoisomerase cleavage complex or some
derivative thereof is repaired by a recombinational mechanism (see the
introduction), which could perhaps lead to Y-form intermediates with
the branches near topoisomerase cleavage sites.
To ask whether the Y-form DNAs are recombination intermediates, we
analyzed a T4 K10-
46/uvsX double mutant, which is strongly
deficient in recombination and recombinational repair. Since the
majority of T4 DNA replication occurs through a recombination-dependent
mode and therefore relies on recombination proteins gp46 and UvsX,
we
began by comparing the extent of plasmid replication as a function
of
the
m-AMSA dose in the wild type (K10) and the recombination
mutant (K10-
46/uvsX). Particularly at the higher levels of
drug,
the recombination mutant produced much less replicated plasmid
DNA (Fig.
9) (see Discussion). The ratio
of intact linear DNA
to topoisomerase-cleaved DNA was also lower for
the recombination
mutant than for the wild-type as the
m-AMSA dose increased.
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 9.
Titration of m-AMSA in wild-type and
recombination-deficient mutant infection. E. coli cells
harboring the plasmid with both the ori and topo site were infected
with either K10 or K10-46/uvsX in the presence of increasing
concentrations of m-AMSA (0, 1, 2, 3, 5, and 10 µg/ml in
lanes 1 through 6, respectively). DNA was purified from the infected
cells, digested with AseI and HaeIII, and
subjected to agarose gel electrophoresis. The resulting fragments were
visualized by Southern hybridization with pBR322 as the probe.
|
|
For the analysis of Y-form DNA above, our standard level of
m-AMSA was 10 µg/ml (equivalent to lane 6 in Fig.
9).
However,
for comparisons of K10 and K10-
46/uvsX infections,
this level
is problematic for the following reasons. First, there was
very
little replicated plasmid DNA at the higher drug level in the
recombination mutant infection. Second, the mutant infection was
probably more aberrant than the wild-type infection at high levels
of
drug, because phage DNA replication was more strongly inhibited
(data
not shown) (the stronger inhibition of phage DNA replication
would
presumably lead to lower levels of replication and recombination
proteins). Third, a higher fraction of the replicated DNA was
cleaved
by topoisomerase at the high concentration of
m-AMSA in
the
mutant infection, and thus a larger proportion of the Y-form
DNA would
presumably be destroyed due to topoisomerase cleavage
complexes in one
of the three arms (unrelated to the cleavage
complex that led to branch
formation). For these reasons, we analyzed
Y-form DNA by
two-dimensional gel electrophoresis of DNA from
infections with a
relatively low drug level, 2 µg/ml (equivalent
to lane 3 in Fig.
9).
When equal volumes of DNA were compared,
the recombination mutant
infections were found to produce somewhat
less Y-form DNA than the
wild-type infections did (Fig.
10A and
B). However, Y-form DNA cannot exist
without unit-length plasmid
DNA, and the recombination mutant infection
has less replicated
unit-length plasmid DNA even at this low drug level
(see Fig.
9). It seems more fair to compare the ratios between the
amount
of Y-form DNA and replicated unit-length linear DNA. We
therefore
quantitated the replicated unit-length plasmid DNA and
equalized
this amount between the pair of infections by loading
decreased
amounts of the wild-type DNA sample. When this equalization
was
applied, the amount of Y-form DNA was unaffected by the
recombination
mutations (Fig.
10B and C). These results argue that the
unique
Y-form DNAs seen on the simple Y arc are not recombination
intermediates.
View larger version (57K):
[in this window]
[in a new window]
|
FIG. 10.
Branched DNA in the recombination-deficient mutant
infection. E. coli cells harboring the plasmid with both the
ori and the topo site were infected with either K10 or
K10-46/uvsX in the presence of m-AMSA at 2 µg/ml. Equal volumes of DNA (50 µl) were compared in panels A and
B. To allow a comparison of wild-type and mutant infections at similar
levels of intact replicated monomer plasmid, samples from each
infection were equalized by changing the volume of the K10 infection
DNA that was digested with AseI. Equalization was calculated
after quantitating the unit-length linear fragments in Fig. 9 (lane 3)
by using an Ambis direct radioisotope imaging system. Note that the
unit-length linear spots are approximately the same intensity in panels
B and C.
|
|
| |
DISCUSSION |
Type II topoisomerases such as bacterial DNA gyrase act in front
of DNA replication forks to relieve the overwinding produced from
unwinding of the parental helix (42). Here we showed that m-AMSA-induced cleavage complexes can arrest the progression
of T4 replication forks in vivo, consistent with the placement of the
type II topoisomerase in front of the replication fork. Since DNA
molecules containing the arrested replication forks were found to be
intact, we infer that the replication apparatus must have been
inactivated upon encountering the cleavage complex and that the
topoisomerase subsequently resealed the DNA breaks prior to cell lysis
(Fig. 3). Since the cytotoxicity of topoisomerase inhibitors is known
to involve DNA replication, these arrested replication forks may become
cytotoxic lesions if they are not restarted or repaired.
Previous reports have shown that replication forks can be blocked by
bound proteins, such as terminator protein binding at ter
sites or centromere protein-DNA complexes (1, 23, 26). The
replication fork barrier in yeast or human rDNA is also probably a
protein-mediated blockage (9, 34, 43). In addition, two previous reports suggest that a drug-induced type II topoisomerase cleavage complex can block a replication fork. Using mammalian cells,
Catapano et al. (11) measured a reduction in the extent of
replication downstream from a cleavage site but did not directly analyze the state of DNA at the cleavage site. Using an in vitro E. coli replication system, Hiasa et al. (25)
presented evidence that replication forks are blocked by
quinolone-induced topoisomerase IV cleavage complexes; they did not
attempt to map the position of the blocked fork with respect to
particular topoisomerase IV cleavage sites.
In this study, we detected an accumulation of unique Y-form DNA,
appearing as spots along the simple Y arc, when m-AMSA,
topoisomerase, and a topoisomerase cleavage site were all present.
Several results argue strongly that the unique Y-form DNA originates
from replication forks blocked at topoisomerase cleavage complexes.
First, a T4 origin was required on the plasmid to generate the unique
Y-form DNA molecules. Second, the unique Y-form DNA spots persisted
after HaeIII digestion, demonstrating that all three arms of
the branched DNA were replicated during the T4 infection. Third,
deletion of the strong topo site led to the disappearance of two spots
(one for each direction of replication). Fourth, the spots were present in the analysis of DNA from a recombination-deficient infection, arguing against the possibility that recombination generates the unique
Y-form DNA.
A somewhat surprising aspect of our results is that the Y-form DNA
molecules are not actually cleaved at the topo site. Instead, the
results indicate that the topoisomerase-mediated DNA cleavages are
resealed after fork blockage but before cell lysis. There was no
noticeable increase in the amounts of unique Y-form DNAs when the cells
were lysed under conditions that favored resealing of the
enzyme-mediated breaks. In vivo resealing is a reasonable possibility
because drug-induced cleavage complex formation is an equilibrium
process rather than an absolute trapping of the cleaved intermediate.
If the resealing event happens in vivo, why do the Y-form DNAs not
disappear due to the restart of the replication fork? Perhaps the
collision between the replication fork and the topoisomerase cleavage
complex leads to disassembly of one or more components of the
replication complex such that restart is delayed or prevented.
The above model assumes that the fork-blocking lesion at the topo site
is a cleavage complex complete with topoisomerase-bound DNA breaks. A
different interpretation is that m-AMSA stabilizes another
type of topoisomerase-DNA complex that does not contain any DNA breaks.
To our knowledge, no one has detected the induction of stable complexes
without DNA breaks by this general class of topoisomerase inhibitors.
Furthermore, in their in vitro study, Hiasa et al. (25)
found that a mutant topoisomerase IV, which binds DNA but cannot
cleave, does not block replication in the presence of inhibitor.
The topoisomerase cleavage complex, or some derivative thereof, can be
repaired by a recombinational mechanism (see the introduction). During
phage T4 infection, this repair depends on the products of the
46 and uvsX genes (50). Since
recombination could, in principle, produce Y-form DNA intermediates, we
tested the involvement of gp46 and UvsX in the production of the Y-form
DNA. When we equalized the replicated monomer fragments between the
wild-type and 46/uvsX infections, we found a comparable
intensity of the Y-form DNAs. This result argues strongly that the
Y-form DNAs do not arise from recombination and is consistent with the
stalled-fork model presented above. Nevertheless, there was a fairly
dramatic difference in the level of plasmid replication between the
recombination mutant and wild-type infections, particularly as the
concentration of m-AMSA increased (Fig. 9). This result
suggests that the continued replication of the ori-containing plasmid
in the presence of m-AMSA depends on the recombinational
repair system that is blocked in the 46/uvsX infection. In
other words, we propose that these recombination proteins assist the
restart of replication after the blockage event. One plausible scenario
is that the Y-form DNA is converted into an overt DNA break and that
the DNA break (after a strand invasion reaction) serves to initiate a
new round of recombination-dependent plasmid replication. Previous
studies demonstrated that recombinational repair of
endonuclease-generated breaks involves extensive DNA replication
triggered from the break (22, 49).
Several alternatives for processing topoisomerase cleavage complexes
have been suggested from in vitro experiments, although none have yet
been shown to be important in vivo. Howard et al. (29)
showed that a helicase can disrupt a drug-induced cleavage complex,
generating overt DNA breaks, and it is conceivable that a complete
replication complex can do the same. Yang et al. (68) purified a yeast enzyme that is able to cleave the phosphotyrosine bond
between a type I topoisomerase and DNA, generating a DNA nick. If such
an enzyme is involved in processing cleavage complexes in vivo, the
resulting nicks could be resealed by DNA ligase. If a similar enzyme
acts on type II topoisomerase cleavage complexes, a double-strand break
would probably result. Sastry and Ross (58) detected an
apparently similar phosphodiesterase from human cells and also
presented some evidence for a nuclease that creates double-strand breaks flanking topoisomerase cleavage complexes. Any of these processes could play important roles in the cytotoxicity and/or repair
of topoisomerase-mediated DNA damage.
Based on the results presented here and prior work of other groups
described above, we suggest that blocked replication forks might be the
most important lesion in cytotoxicity and DNA repair of
topoisomerase-mediated damage. Understanding the repair pathway could
improve chemotherapy, perhaps leading to compounds that inhibit repair
and thereby potentiate the topoisomerase inhibitors.
In a broader sense, the process that we are analyzing at the
topoisomerase cleavage sites may occur with other forms of DNA damage.
Our use of topoisomerase cleavage complexes provided a unique
opportunity to analyze DNA damage in a site-specific manner in vivo.
Various studies argue that replication forks are blocked by other forms
of DNA damage, for example pyrimidine dimers from UV treatment (5,
64). In addition, E. coli chromosomal forks can be
artificially stalled by a replicative helicase defect, perhaps
mimicking DNA (or replication protein) damage (7, 41, 47,
60). Blocked forks, or some derivative thereof, may be generally
cytotoxic unless repaired. Our results may also be relevant in
considering the process of replication fork blockage in normal cells
without overt DNA damage, which has recently become a topic of great
interest. A variety of indirect results argue that many, perhaps most,
E. coli replication forks initiated at oriC under normal growth conditions become blocked and need to be restarted by a
recombinational process to complete replication (14).
Furthermore, replication fork blockage has recently been implicated in
aging: elimination of the Fob1p replication block protein prolongs the life span of yeast mother cells by preventing fork blockage (and subsequent events) in the rDNA (16). Finally, the helicases defective in the premature-aging disease Werner's syndrome and the
cancer predisposition disease Bloom's syndrome have been proposed to
play a role in recognizing or correcting aberrant replication structures such as blocked forks (12).
| |
ACKNOWLEDGMENTS |
We thank Michael Been, Jeffrey Dawson, Mariano Garcia-Blanco,
Tao-shih Hsieh, and David Pickup for insightful discussions.
This work was supported by research grant CA60836 from National
Institutes of Health/National Cancer Institute, and George Hong was
supported in part by National Research Science Award 5 T32 CA09111.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Box 3020, Duke University Medical Center, Durham, NC
27710. Phone: (919) 684-6466. Fax: (919) 681-8911. E-mail:
kenneth.kreuzer{at}duke.edu.
| |
REFERENCES |
| 1.
|
Bastia, D., and B. Mohanty.
1996.
Mechanisms for completing replication, p. 177-215.
In
M. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 2.
|
Belanger, K. G.
1997.
Origin-dependent DNA replication in bacteriophage T4. Ph.D. thesis.
Duke University, Durham, N.C.
|
| 3.
|
Belanger, K. G., and K. N. Kreuzer.
1998.
Bacteriophage T4 initiates bidirectional DNA replication through a two-step process.
Mol. Cell
2:693-701[CrossRef][Medline].
|
| 4.
|
Belanger, K. G.,
C. Mirzayan,
H. E. Kreuzer,
B. M. Alberts, and K. N. Kreuzer.
1996.
Two-dimensional gel analysis of rolling circle replication in the presence and absence of bacteriophage T4 primase.
Nucleic Acids Res.
24:2166-2175[Abstract/Free Full Text].
|
| 5.
|
Berger, C. A., and H. J. Edenberg.
1996.
Pyrimidine dimers block simian virus 40 replication forks.
Mol. Cell. Biol.
6:3443-3450.
|
| 6.
|
Berger, J. M.
1998.
Type II DNA topoisomerases.
Curr. Opin. Struct. Biol.
8:26-32[CrossRef][Medline].
|
| 7.
|
Bierne, H., and B. Michel.
1994.
When replication forks stop.
Mol. Microbiol.
13:17-23[CrossRef][Medline].
|
| 8.
|
Brewer, B. J., and W. L. Fangman.
1987.
The localization of replication origins on ARS plasmids in S. cerevisiae.
Cell
51:463-471[CrossRef][Medline].
|
| 9.
|
Brewer, B. J.,
D. Lockshon, and W. L. Fangman.
1992.
The arrest of replication forks in the rDNA of yeast occurs independently of transcription.
Cell
71:267-276[CrossRef][Medline].
|
| 10.
|
Burden, D. A., and N. Osheroff.
1998.
Mechanism of action of eukaryotic topoisomerase II and drugs targeted to the enzyme.
Biochim. Biophys. Acta
1400:139-154[Medline].
|
| 11.
|
Catapano, C. V.,
G. M. R. Carbone,
F. Pisani,
J. Qiu, and D. J. Fernandes.
1997.
Arrest of replication fork progression at sites of topoisomerase II-mediated DNA cleavage in human leukemia CEM cells incubated with VM-26.
Biochemistry
36:5739-5748[CrossRef][Medline].
|
| 12.
|
Chakraverty, R. K., and I. D. Hickson.
1999.
Defending genome integrity during DNA replication: a proposed role for RecQ family helicases.
Bioessays
21:286-294[CrossRef][Medline].
|
| 13.
|
Chen, A. Y., and L. F. Liu.
1994.
DNA topoisomerases: essential enzymes and lethal targets.
Annu. Rev. Pharmacol. Toxicol.
34:191-218[CrossRef][Medline].
|
| 14.
|
Cox, M. M.
1999.
Recombinational DNA repair in bacteria and the RecA protein.
Nucleic Acids Res. Mol. Biol.
63:310-366.
|
| 15.
|
D'Arpa, P.,
C. Beardmore, and L. F. Liu.
1990.
Involvement of nucleic acid synthesis in cell killing mechanisms of topoisomerase poisons.
Cancer Res.
50:6919-6924[Abstract/Free Full Text].
|
| 16.
|
Defossez, P. A.,
R. Prusty,
M. Kaeberlein,
S. J. Lin,
P. Ferrigno,
P. A. Silver,
R. L. Keil, and L. Guarente.
1999.
Elimination of replication block protein Fob1 extends the life span of yeast mother cells.
Mol. Cell
3:447-455[CrossRef][Medline].
|
| 17.
|
Drlica, K., and X. L. Zhao.
1997.
DNA gyrase, topoisomerase IV, and the 4-quinolones.
Microbiol. Rev.
61:377-392[Abstract].
|
| 18.
|
Eng, W.-K.,
L. Faucette,
R. K. Johnson, and R. Sternglanz.
1989.
Evidence that DNA topoisomerase I is necessary for the cytotoxic effects of camptothecin.
Mol. Pharmacol.
34:755-760[Abstract].
|
| 19.
|
Freudenreich, C. H., and K. N. Kreuzer.
1993.
Mutational analysis of a type II topoisomerase cleavage site: Distinct requirements for enzyme and inhibitors.
EMBO J.
12:2085-2097[Medline].
|
| 20.
|
Freudenreich, C. H., and K. N. Kreuzer.
1994.
Localization of an aminoacridine antitumor agent in a type II topoisomerase-DNA complex.
Proc. Natl. Acad. Sci. USA
91:11007-11011[Abstract/Free Full Text].
|
| 21.
|
Friedman, K. L., and B. J. Brewer.
1995.
Analysis of replication intermediates by two-dimensional agarose gel electrophoresis.
Methods Enzymol.
262:613-627[Medline].
|
| 22.
|
George, J. W., and K. N. Kreuzer.
1996.
Repair of double-strand breaks in bacteriophage T4 by a mechanism that involves extensive DNA replication.
Genetics
143:1507-1520[Abstract].
|
| 23.
|
Greenfeder, S. A., and C. S. Newlon.
1992.
Replication forks pause at yeast centromeres.
Mol. Cell. Biol.
12:4056-4066[Abstract/Free Full Text].
|
| 24.
|
Hane, M. W., and T. H. Wood.
1969.
Escherichia coli K-12 mutants resistant to nalidixic acid: genetic mapping and dominance studies.
J. Bacteriol.
99:238-241[Abstract/Free Full Text].
|
| 25.
|
Hiasa, H.,
D. O. Yousef, and K. J. Marians.
1996.
DNA strand cleavage is required for replication fork arrest by a frozen topoisomerase-quinolone-DNA ternary complex.
J. Biol. Chem.
271:26424-26429[Abstract/Free Full Text].
|
| 26.
|
Hill, T. M.
1992.
Arrest of bacterial DNA replication.
Annu. Rev. Microbiol.
46:603-633[CrossRef][Medline].
|
| 27.
|
Holm, C.,
J. M. Covey,
D. Kerrigan, and Y. Pommier.
1989.
Differential requirement of DNA replication for the cytotoxicity of DNA topoisomerase I and II inhibitors in Chinese hamster DC3F cells.
Cancer Res.
49:6365-6368[Abstract/Free Full Text].
|
| 28.
|
Hooper, D. C.
1998.
Clinical applications of quinolones.
Biochim. Biophys. Acta
1400:45-61[Medline].
|
| 29.
|
Howard, M. T.,
S. H. Neece,
S. W. Matson, and K. N. Kreuzer.
1994.
Disruption of a topoisomerase-DNA cleavage complex by a DNA helicase.
Proc. Natl. Acad. Sci. USA
91:12031-12035[Abstract/Free Full Text].
|
| 30.
|
Hsiang, Y.-H., and L. F. Liu.
1989.
Evidence for the reversibility of cellular DNA lesion induced by mammalian topoisomerase II poisons.
J. Biol. Chem.
264:9713-9715[Abstract/Free Full Text].
|
| 31.
|
Huff, A. C.,
J. K. Leatherwood, and K. N. Kreuzer.
1989.
Bacteriophage T4 DNA topoisomerase is the target of antitumor agent 4'-(9-acridinylamino) methanesulfon-m-anisidide (m-AMSA) in T4-infected Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:1307-1311[Abstract/Free Full Text].
|
| 32.
|
Jeggo, P. A.,
K. Caldecott,
S. Pidsley, and G. R. Banks.
1989.
Sensitivity of Chinese hamster ovary mutants defective in DNA double strand break repair to topoisomerase II inhibitors.
Cancer Res.
49:7057-7063[Abstract/Free Full Text].
|
| 33.
|
Khodursky, A. B., and N. R. Cozzarelli.
1998.
The mechanism of inhibition of topoisomerase IV by quinolone antibacterials.
J. Biol. Chem.
273:27668-27677[Abstract/Free Full Text].
|
| 34.
|
Kobayashi, T., and T. Horiuchi.
1996.
A yeast gene product, Fob1 protein, required for both replication fork blocking and recombinational hotspot activities.
Genes Cells
1:465-474[Abstract].
|
| 35.
|
Kreuzer, K. N., and B. M. Alberts.
1984.
Site-specific recognition of bacteriophage T4 DNA by T4 type II DNA topoisomerase and Escherichia coli DNA gyrase.
J. Biol. Chem.
259:5339-5346[Abstract/Free Full Text].
|
| 36.
|
Kreuzer, K. N., and N. R. Cozzarelli.
1979.
Escherichia coli mutants thermosensitive for deoxyribonucleic acid gyrase subunit A: effects on deoxyribonucleic acid replication, transcription, and bacteriophage growth.
J. Bacteriol.
140:424-435[Abstract/Free Full Text].
|
| 37.
|
Kreuzer, K. N.,
H. W. Engman, and W. Y. Yap.
1988.
Tertiary initiation of replication in bacteriophage T4. Deletion of the overlapping uvsY promoter/replication origin from the phage genome.
J. Biol. Chem.
263:11348-11357[Abstract/Free Full Text].
|
| 38.
|
Kreuzer, K. N., and S. W. Morrical.
1994.
Initiation of DNA replication, p. 28-42.
In
J. D. Karam (ed.), Molecular biology of bacteriophage T4. ASM Press, Washington, D.C.
|
| 39.
|
Kupfer, G.,
A. L. Bodley, and L. F. Liu.
1987.
Involvement of intracellular ATP in cytotoxicity of topoisomerase II-targeting antitumor drugs.
NCI Monogr.
4:37-40.
|
| 40.
|
Kutter, E., and L. Snyder.
1983.
Preparation of cytosine-containing T4 phage, p. 56-57.
In
C. K. Mathews, E. M. Kutter, G. Mosig, and P. B. Berget (ed.), Bacteriophage T4. ASM Press, Washington, D.C.
|
| 41.
|
Kuzminov, A.
1995.
Collapse and repair of replication forks in Escherichia coli.
Mol. Microbiol.
16:373-384[CrossRef][Medline].
|
| 42.
|
Levine, C.,
H. Hiasa, and K. J. Marians.
1998.
DNA gyrase and topoisomerase IV: Biochemical activities, physiological roles during chromosome replication, and drug sensitivities.
Biochim. Biophys. Acta
1400:29-43[Medline].
|
| 43.
|
Little, R. D.,
T. H. Platt, and C. L. Schildkraut.
1993.
Initiation and termination of DNA replication in human rRNA genes.
Mol. Cell. Biol.
13:6600-6613[Abstract/Free Full Text].
|
| 44.
|
Liu, L. F.
1989.
DNA topoisomerase poisons as antitumor drugs.
Annu. Rev. Biochem.
58:351-375[CrossRef][Medline].
|
| 45.
|
McCarthy, D.
1979.
Gyrase-dependent initiation of bacteriophage T4 DNA replication: interactions of Escherichia coli gyrase with novobiocin, coumermycin and phage DNA-delay gene products.
J. Mol. Biol.
127:265-283[CrossRef][Medline].
|
| 46.
|
Menkens, A. E., and K. N. Kreuzer.
1988.
Deletion analysis of bacteriophage T4 tertiary origins.
J. Biol. Chem.
263:11358-11365[Abstract/Free Full Text].
|
| 47.
|
Michel, B.,
S. D. Ehrlich, and M. Uzest.
1997.
DNA double-strand breaks caused by replication arrest.
EMBO J.
16:430-438[CrossRef][Medline].
|
| 48.
|
Ming, Y. Z.,
X. Di,
E. P. Gomez-Sanchez, and C. E. Gomez-Sanchez.
1994.
Improved downward capillary transfer for blotting of DNA and RNA.
BioTechniques
16:58-60[Medline].
|
| 49.
|
Mueller, J. E.,
J. Clyman,
Y. J. Huang,
M. M. Parker, and M. Belfort.
1996.
Intron mobility in phage T4 occurs in the context of recombination-dependent DNA replication by way of multiple pathways.
Genes Dev.
10:351-364[Abstract/Free Full Text].
|
| 50.
|
Neece, S. H.,
K. Carles-Kinch,
D. J. Tomso, and K. N. Kreuzer.
1996.
Role of recombinational repair in sensitivity to an antitumor agent that inhibits bacteriophage T4 type II DNA topoisomerase.
Mol. Microbiol.
20:1145-1154[CrossRef][Medline].
|
| 51.
|
Nelson, M. A.,
M. Ericson,
L. Gold, and J. F. Pulitzer.
1982.
The isolation and characterization of TabR bacteria: hosts that restrict bacteriophage T4 rII mutants.
Mol. Gen. Genet.
188:60-68[CrossRef].
|
| 52.
|
Nitiss, J., and J. C. Wang.
1988.
DNA topoisomerase-targeting antitumor drugs can be studied in yeast.
Proc. Natl. Acad. Sci. USA
85:7501-7505[Abstract/Free Full Text].
|
| 53.
|
Nitiss, J. L., and J. C. Wang.
1996.
Mechanisms of cell killing by drugs that trap covalent complexes between DNA topoisomerases and DNA.
Mol. Pharmacol.
50:1095-1102[Abstract].
|
| 54.
|
Osheroff, N., and E. L. Zechiedrich.
1987.
Calcium-promoted DNA cleavage by eukaryotic topoisomerase II: Trapping the covalent enzyme-DNA complex in an active form.
Biochemistry
26:4303-4309[CrossRef][Medline].
|
| 55.
|
Pommier, Y.
1993.
DNA topoisomerase I and II in cancer chemotherapy: update and perspectives.
Cancer Chemother. Pharmacol.
32:103-108[CrossRef][Medline].
|
| 56.
|
Ripley, L. S.,
J. S. Dubins,
J. G. deBoer,
D. M. DeMarini,
A. M. Bogerd, and K. N. Kreuzer.
1988.
Hotspot sites for acridine-induced frameshift mutations in bacteriophage T4 correspond to sites of action of the T4 type II topoisomerase.
J. Mol. Biol.
200:665-680[CrossRef][Medline].
|
| 57.
|
Sander, M., and T.-S. Hsieh.
1983.
Double strand DNA cleavage by type II DNA topoisomerase from Drosophila melanogaster.
J. Biol. Chem.
258:8421-8428[Abstract/Free Full Text].
|
| 58.
|
Sastry, S., and B. M. Ross.
1998.
Mechanisms for the processing of a frozen topoisomerase-DNA conjugate by human cell-free extracts.
J. Biol. Chem.
273:9942-9950[Abstract/Free Full Text].
|
| 59.
|
Schneider, E.,
P. A. Lawson, and R. K. Ralph.
1989.
Inhibition of protein synthesis reduces the cytotoxicity of 4'-(9-acridinylamino)methanesulfon-m-anisidide without affecting DNA breakage and DNA topoisomerase II in a murine mastocytoma cell line.
Biochem. Pharmacol.
38:263-269[CrossRef][Medline].
|
| 60.
|
Seigneur, M.,
V. Bidnenko,
S. D. Ehrlich, and B. Michel.
1998.
RuvAB acts at arrested replication forks.
Cell
95:419-430[CrossRef][Medline].
|
| 61.
|
Selick, H. E.,
K. N. Kreuzer, and B. M. Alberts.
1988.
The bacteriophage T4 insertion/substitution vector system. A method for introducing site-specific mutations into the virus chromosome.
J. Biol. Chem.
263:11336-11347[Abstract/Free Full Text].
|
| 62.
|
Snustad, D. P.,
L. Snyder, and E. M. Kutter.
1983.
Effects on host genome structure and expression, p. 40-57.
In
C. K. Mathews, E. M. Kutter, G. Mosig, and P. B. Berget (ed.), Bacteriophage T4. ASM Press, Washington, D.C.
|
| 63.
|
Tewey, K. M.,
G. L. Chen,
E. M. Nelson, and L. F. Liu.
1984.
Intercalative antitumor drugs interfere with the breakage-reunion reaction of mammalian DNA topoisomerase II.
J. Biol. Chem.
259:9182-9187[Abstract/Free Full Text].
|
| 64.
|
Villani, G.,
S. Boiteux, and M. Radman.
1978.
Mechanism of ultraviolet-induced mutagenesis: Extent and fidelity of in vitro DNA synthesis on irradiated templates.
Proc. Natl. Acad. Sci. USA
75:3037-3041[Abstract/Free Full Text].
|
| 65.
|
Wang, J. C.
1996.
DNA topoisomerases.
Annu. Rev. Biochem.
65:635-692[CrossRef][Medline].
|
| 66.
|
Wigley, D. B.
1995.
Structure and mechanism of DNA topoisomerases.
Annu. Rev. Biophys. Biomol. Struct.
24:185-208[CrossRef][Medline].
|
| 67.
|
Wilson, W. R., and G. F. Whitmore.
1981.
Cell-cycle-stage specificity of 4'-(9-acridinylamino)methanesulfon-m-anisidide (m-AMSA) and interaction with ionizing radiation in mammalian cell cultures.
Radiat. Res.
87:121-136[Medline].
|
| 68.
|
Yang, S. W.,
A. B. Burgin, Jr.,
B. N. Huizenga,
C. A. Robertson,
K. C. Yao, and H. A. Nash.
1996.
A eukaryotic enzyme that can disjoin dead-end covalent complexes between DNA and type I topoisomerases.
Proc. Natl. Acad. Sci. USA
93:11534-11539[Abstract/Free Full Text].
|
Molecular and Cellular Biology, January 2000, p. 594-603, Vol. 20, No. 2
0270-7306/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Long, D. T., Kreuzer, K. N.
(2008). Regression supports two mechanisms of fork processing in phage T4. Proc. Natl. Acad. Sci. USA
105: 6852-6857
[Abstract]
[Full Text]
-
Kuo, H. K., Griffith, J. D., Kreuzer, K. N.
(2007). 5-Azacytidine Induced Methyltransferase-DNA Adducts Block DNA Replication In vivo. Cancer Res.
67: 8248-8254
[Abstract]
[Full Text]
-
Shea, M. E., Hiasa, H.
(2003). The RuvAB Branch Migration Complex Can Displace Topoisomerase IV{middle dot}Quinolone{middle dot}DNA Ternary Complexes. J. Biol. Chem.
278: 48485-48490
[Abstract]
[Full Text]
-
Hong, G., Kreuzer, K. N.
(2003). Endonuclease cleavage of blocked replication forks: An indirect pathway of DNA damage from antitumor drug-topoisomerase complexes. Proc. Natl. Acad. Sci. USA
100: 5046-5051
[Abstract]
[Full Text]
-
Miller, E. S., Kutter, E., Mosig, G., Arisaka, F., Kunisawa, T., Ruger, W.
(2003). Bacteriophage T4 Genome. Microbiol. Mol. Biol. Rev.
67: 86-156
[Abstract]
[Full Text]
-
Michel, B., Flores, M.-J., Viguera, E., Grompone, G., Seigneur, M., Bidnenko, V.
(2001). Rescue of arrested replication forks by homologous recombination. Proc. Natl. Acad. Sci. USA
98: 8181-8188
[Abstract]
[Full Text]
-
George, J. W., Stohr, B. A., Tomso, D. J., Kreuzer, K. N.
(2001). The tight linkage between DNA replication and double-strand break repair in bacteriophage T4. Proc. Natl. Acad. Sci. USA
98: 8290-8297
[Abstract]
[Full Text]
-
Stohr, B. A., Kreuzer, K. N.
(2001). Repair of Topoisomerase-Mediated DNA Damage in Bacteriophage T4. Genetics
158: 19-28
[Abstract]
[Full Text]
-
Doan, P. L., Belanger, K. G., Kreuzer, K. N.
(2001). Two Types of Recombination Hotspots in Bacteriophage T4: One Requires DNA Damage and a Replication Origin and the Other Does Not. Genetics
157: 1077-1087
[Abstract]
[Full Text]
Top
Abstract
Introduction
