INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Alternative splicing is a common mechanism for regulating gene expression in eukaryotes, allowing the generation of diverse proteins from the same primary RNA transcript (46, 77, 78). The alteration of splice site choice is thought to be determined by regulatory proteins that bind to the pre-mRNA transcript and affect spliceosome assembly on particular exons or splice sites. The best characterized of these splicing-regulatory proteins are a set of polypeptides called SR proteins that, among many other properties, bind to exonic splicing enhancer sequences (7, 10, 35, 47, 75). The SR proteins bound to an exonic enhancer are thought to stimulate spliceosome assembly at the adjacent splice sites. Another group of pre-mRNA binding proteins are the heterogeneous nuclear ribonucleoproteins (hnRNPs) (19, 66). These are a diverse group of molecules that coat nascent pre-mRNAs, forming complex but little understood hnRNP structures (42, 52). The assembly of the spliceosome occurs after formation of these hnRNP complexes, and some hnRNPs have been implicated in splicing regulation. For example, hnRNP A1 is able to counteract the effect of SR proteins in some assays and can also apparently repress splicing through splicing silencer sequences (3, 7, 8, 11, 31). However, the assembly of a pre-mRNP complex is poorly understood. It is apparently highly cooperative, but the interactions between the different hnRNPs in these complexes are mostly unknown.

Although widely expressed, the SR proteins and hnRNPs do vary in concentration between different tissues (31, 39). Changes in splicing patterns are thought to be determined, in part, by subtle changes in the combinations of these proteins present in different cell types. Indeed, the ratio of hnRNP A1 to particular SR proteins can strongly affect the splicing pattern of some transcripts (50, 51). However, it is likely that more tissue-specific proteins also direct changes in splicing; how a cell achieves the precise tissue-specific control of a splicing pattern is still a mystery.

Polypyrimidine tract binding protein (PTB or hnRNP I) is a member of the hnRNP group of proteins (24, 26, 61, 74). PTB is implicated as a negative regulator of splicing for several alternative exons. In the -tropomyosin (TM) pre-mRNA, the skeletal muscle-specific exon 7 is apparently repressed by PTB in nonmuscle tissues (29, 57). This protein also represses the splicing of -tropomyosin (TM) exon 3 in smooth muscle (27, 62). Neuron-specific exons in the c-src, -aminobutyric acid A (GABA_A) 2 receptor, clathrin light chain B, and N-methyl-D-aspartate (NMDA) pre-mRNAs are also thought to be repressed by PTB (2, 13, 81). With the exception of TM, these systems are similar in that PTB seems to repress a highly tissue-specific exon outside of that particular tissue. Although PTB is an apparent inhibitor of splicing, its mechanism of action is not clear. PTB often binds to pyrimidine-rich elements within or near the 3' splice site of the repressed exon (74). In some cases, this PTB can block binding of the required splicing factor, U2AF, to the 3' splice site (45, 65). However, sequence elements apart from the 3' splice site are often required for splicing repression, indicating the need for more than the simple binding of PTB to the 3' splice site (13, 27). It is also not clear how PTB-mediated splicing repression is relieved in particular cell types. Interestingly, an altered form of PTB has been found in extracts of neuronal cell lines and rat brain (2, 13). The electrophoretic mobility of this neural protein differs from that of the three known isoforms of HeLa cell PTB, indicating the existence of a tissue-specific form of the polypeptide. It has been speculated that this neural protein may prevent PTB-mediated repression of particular neuron-specific exons (28).

We are characterizing the N1 exon of the mouse c-src pre-mRNA as a model for understanding the neuron-specific regulation of splicing. The small (18-nucleotide [nt]) exon N1 is inserted into the src mRNA in neurons but skipped in other cells (71). This regulation can be observed in vitro using extracts of nonneural HeLa cells that skip the N1 exon and extracts of WERI-1 retinoblastoma cells where the N1 exon is spliced. The regulation of N1 splicing requires two regulatory regions in the src pre-mRNA (5, 12, 55, 56). The 3' splice site upstream of the N1 exon is needed for the repression of N1 splicing in nonneural cells. We have shown that PTB binds to CUCUCU elements within this 3' splice site and is required for splicing repression (13, 17). The second N1 regulatory region, encompassing nt 17 to 142 downstream of the N1 5' splice site, is an intronic splicing enhancer and is also required for splicing repression by the upstream elements. Within this enhancer, nt 37 to 70 are highly conserved between mouse and human. This core sequence, called the downstream control sequence (DCS), contains the elements GGGGGCUG and UGCAUG that are needed for the proper function of the N1 enhancer in vivo and have been found in other intronic splicing enhancers. When present in more than one copy, the DCS alone can induce high levels of N1 exon splicing in vivo (56). However, the DCS normally requires adjacent elements to function properly (55). The DCS binds specific RNA binding proteins that can be detected in WERI-1 nuclear extract and are thought to be important for splicing regulation. Three of these proteins have been identified as hnRNP F, hnRNP H, and the KH-type splicing-regulatory protein (KSRP) (16, 53, 54). There are additional unidentified components of the DCS complexes. Moreover, none of the identified DCS binding proteins is specific to the WERI extract even though the larger of the observed DCS-RNP complexes is enriched in this extract over the HeLa extract.

The roles of the individual sequence elements within the DCS and the proteins that bind to them have been difficult to resolve. In vivo, the DCS sequence acts as a general splicing enhancer activating splicing to some extent in either cell type (56). Competition with a DCS RNA in an in vitro splicing reaction inhibits splicing, implying a positive role for some DCS RNA binding proteins (5, 53). Immunodepletion experiments and the direct addition of antibodies to splicing extract also support this role (16, 53, 54). However, CUCUCU elements within and around the DCS are also required for the repression of splicing in nonneural extract (13, 17). The DCS CUCUCU element binds to PTB in HeLa extract. Therefore, some DCS binding proteins are apparently also effectors of splicing repression or derepression.

The structure and assembly of the DCS-RNP complex is poorly understood. Here we characterize where on the DCS sequence the various DCS binding proteins contact the RNA and identify some of their protein-protein interactions. We also report the cloning and characterization of nPTB, a new protein binding to the CUCUCU element of the DCS RNA in WERI-1 nuclear extract. nPTB is very similar in sequence to PTB but is expressed primarily in the brain. The binding properties of nPTB and its reduced inhibitory activity on splicing imply roles in controlling the assembly of other splicing-regulatory proteins.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

DNA constructs and in vitro transcription. The N70W, BS7, BS27, H6, and adenovirus pSPAd constructs are described elsewhere (13, 41, 53, 68). BS7 and BS27 templates were linearized with NotI, pSPAd was linearized with SmaI, and H6 was linearized with BamHI. The N70A1 template was obtained by placing DCS DNA under control of the T7A1 Escherichia coli RNA polymerase (RNAP) promoter using two-step PCR.

Synthesis of 4-thiouridine-substituted RNA. Site-specific introduction of 4-S-UTP (a gift of A. Mustaev, Public Health Research Institute, New York, N.Y.) into the DCS RNA was achieved through the "walking" transcription method using a His₆-tagged E. coli RNAP bound to Ni-nitrilotriacetic acid agarose (Qiagen) (48, 58). The RNAP used in these experiments was purified, as described elsewhere, from the E. coli strain bearing the His-tagged ' subunit of polymerase incorporated into the chromosome (a kind gift from R. Landick, University of Wisconsin, Madison, Wis.) RNAP (2 µg) and N70A1 template (2 µg) were preincubated for 5 min at 37°C in 20 µl of the transcription buffer TB (50 mM HEPES-HCl [pH 7.9], 100 mM KCl, 10 mM MgCl₂), mixed with 10 µl of Ni-nitrilotriacetic acid beads preequilibrated with TB, and incubated for another 5 min. To this resin-bound complex, 2 µl of transcription starting mix (200 µM CpUpApC primer and 250 µM each ATP and GTP) was added. After a 5-min incubation, the beads were washed three times with 1.5 ml of TB. The elongation complex containing an RNA 11-mer was then walked to a desired position along the template by repeated alterations of washing and RNA chain extension with a subset of 10 µM deoxynucleoside triphosphates (NTPs) for 3 min at room temperature. The radiolabeled NTP and 4-S-UTP were then introduced into the system, and the reaction mix was incubated for 10 min at room temperature. After three washes with TB, all four NTPs at final concentrations of 200 µM each were added to generate a runoff RNA product. The modified RNA thus synthesized was purified on a 12% denaturing polyacrylamide gel.

Gel mobility shift and UV cross-linking. UV cross-linking and gel shift experiments were carried out under the same conditions reported previously (53). A 4-µl volume (60 µg) of the WERI-1 or HeLa nuclear extract or the equivalent amount of 40% ammonium sulfate precipitate fraction (ASP40) was used in the site-specific cross-linking experiments. After incubation under splicing conditions in the presence of 13 µg of heparin per ml, the samples were irradiated with 360-nm UV light on ice for 15 min using a handheld UV lamp (UVP) and then treated with 1 µg of RNase A each for 15 min at 37°C. The cross-linked proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and visualized on a PhosphorImager (Molecular Dynamics).

Immunoprecipitation and Western blot analysis. Immunoprecipitation experiments used rabbit polyclonal antibodies raised against the PTB C-terminal peptide (CGAHHLRVSFSKSTI), the C2742 antiserum against residues 172 to 711 of KSRP, the 4606 antiserum against FUSE binding protein (FBP) (a gift of D. Levens), and the anti-Sm monoclonal antibody Y12 (a gift of J. Steitz). In a typical experiment, 10 µl of protein A or GammaBind Plus Sepharose (Pharmacia), preequilibrated with TETN150 buffer (25 mM Tris [pH 7.5], 5 mM EDTA 150 mM NaCl, 0.1% Triton X-100) and blocked with 2.5 mg of bovine serum albumin per ml in TETN150, was preincubated with 1 to 15 µl of antibody for 1 h at 4°C, washed with TETN150, and then incubated with the cross-linked sample for 1 h at 4°C. Western blot analysis also used the following: rabbit antibodies raised against the C-terminal peptides of KSRP (DB-KS) and U1-70k; full-length U2AF⁶⁵ and hnRNP H proteins; mouse monoclonal antibodies 9H10 against hnRNP A1 (G. Dreyfuss), AK-96 against ASF/SF2 (A. Krainer), BB7 against PTB, and MAb104 recognizing phosphorylated SR proteins (M. Roth and K. Neugebauer); and human sera Hu134 against nucleolin (P. Bouvet) and LE against LA antigen (J. Steitz).

In vitro splicing. Each splicing reaction, conducted as described previously (13), was performed in a mixture containing 8 µl of WERI-1 extract (approximately 100 µg of protein). This was supplemented with 40 to 400 ng of nPTB or PTB or with 0.3 to 3 µl of WERI- or HeLa-derived 0.3M KCl fractions from the DCS RNA affinity column, providing an equivalent amount of either protein. These reactions were terminated after a 4-h incubation for the BS7 and BS27 templates, a 90-min incubation for the adenovirus major late transcript (SPAd), and a 2-h incubation for the -globin transcript (H · 6).

nPTB purification. nPTB was purified from 10 ml (150 mg of protein) of WERI-1 nuclear extract by using a method modified from that described previously (61). Chromatography over 20-ml DEAE-Sepharose Fast Flow, 10-ml heparin-Sepharose CL-6B, and 2-ml poly(U)-Sepharose 4B columns (Pharmacia) resulted in a fraction containing a mixture of PTB and nPTB proteins. A 1-ml HiTrap Blue Sepharose column (Pharmacia) was used next to purify nPTB from PTB. The poly(U) fraction containing these proteins was loaded on the column in buffer A (20 mM Tris [pH 8.0], 3 mM MgCl₂, 0.1 mM EDTA, 10% glycerol, 1 mM mercaptoethanol, 0.5 mM phenylmethylsulfonyl fluoride [PMSF]) containing 150 mM KCl. A 30-ml KCl gradient (150 to 500 mM) was then applied to the column, resulting in the elution of homogeneous nPTB at approximately 250 mM KCl. The bulk of the PTB eluted at 500 mM KCl. The fractions containing each protein were combined, dialyzed against buffer DG (20 mM HEPES [pH 7.9], 80 mM potassium glutamate, 1 mM dithiothreitol, 20% glycerol, 0.2 mM EDTA, 0.2 mM PMSF) overnight, and concentrated using Centricon-30 (Amicon) concentrators. HeLa PTB was purified in a similar fashion.

RNA affinity column purification. RNA coupling to adipic acid hydrazide agarose (Pharmacia) was performed as specified by the manufacturer. A 40-nmol (470 µg) portion of a chemically synthesized 37-mer DCS RNA oligonucleotide (CUGAGGCUGGGGGCUGCUCUCUGCAUGUGCUUCCUGG) or the same amount of a 37-mer UR (unrelated) RNA oligonucleotide (CGAAUUGGGUACCGGGCCCAGCGCCGCCGUCGUGCCG) was dissolved in 980 µl of 20 mM Tris-HCl (pH 7.5). A 20-µl volume of freshly made 1 M sodium periodate solution was added, and the mixture was incubated on ice in the dark for 1 h. Oxidized RNA was ethanol precipitated and resuspended in 1 ml of 0.1 M sodium acetate (pH 5). This RNA was then incubated for 3 h at 4°C with 0.5 ml of adipic acid hydrazide agarose beads preequilibrated with the same buffer. The beads were then washed with 2 M NaCl and equilibrated with buffer DG. An 8-ml volume of either HeLa or WERI-1 nuclear extract supplemented with 0.1 mg of heparin per ml was added to the beads, which were then incubated for 4 h at 4°C with gentle mixing. The slurry was packed into disposable 2-ml columns and extensively washed either with buffer DG plus 20 mM KCl or with buffer D (20 mM HEPES [pH 7.9], 100 mM KCl, 1 mM dithiothreitol, 20% glycerol, 0.2 mM EDTA, 0.2 mM PMSF). The bound proteins were eluted with 4 to 6 ml of buffer A containing 0.3, 0.5, 1, or 2 M KCl or 6 M urea. The fractions were dialyzed against buffer DG and concentrated to approximately 200 µl using Centricon-10 (Amicon) concentrators.

Northern blot analysis. nPTB cDNA tissue distribution was assessed using a commercial multiple-human-tissue Northern blot as specified by the manufacturer (Clontech). The membrane was probed with a 56-nt nPTB oligonucleotide or nPTB cDNA, a 1-kb PCR-generated fragment of PTB cDNA (nt 550 to 1448 of the PTB open reading frame), or a 2.0-kb human -actin cDNA probe provided with the blot.

nPTB cDNA cloning. Purified nPTB was subjected to SDS-PAGE (10% polyacrylamide), and the nPTB band was excised and subjected to in-gel tryptic digestion. The eluted peptides were fractionated by high-pressure liquid chromatography on a Vydac C₁₈ column and sequenced on an automated protein sequencer (Perkin-Elmer model 492). A search of the GenBank database with the peptides that differed from PTB identified no expressed sequence tag (EST) matches but resulted in the retrieval of two short bacterial artificial chromosome tags of human genomic clone CIT-HSP 2282L8 (DDBJ/EMBL/GenBank accession no. AQ000290 and AQ006967). The short identifier sequence from the end of this clone is in the nPTB exon encoding most of the NNQFQALLQYGDPVNAQQAK peptide. The 56-nt NNQ oligonucleotide (ATACTCAAGCTCTGCTCCAGTATGGTGATCCAGTAAATGCTCAACAAGCAAAACTA) encoding most of this peptide was used to probe a WERI-1 cDNA Lambda Zap library. Six positive clones were obtained. Random hexamer cDNA synthesis of WERI-1 total RNA followed by PCR using the NNQ oligonucleotide and a degenerate oligonucleotide corresponding to the FFQDHK peptide of nPTB resulted in an 821-bp PCR fragment containing approximately half of the nPTB open reading frame. This PCR product was then used to probe the same WERI-1 cDNA library. One positive clone identified by both probes was plaque purified and sequenced.

Nucleotide sequence accession number. The human nPTB cDNA sequence has been submitted to GenBank and has been given accession no. AF176085.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Proteins that bind to individual sequence elements within the DCS RNA. The DCS acts in vivo as part of an intronic splicing enhancer needed for inclusion of the N1 exon (56). The DCS also contains a CUCUCU element that mediates repression of N1 splicing in nonneural cells and that cross-links to PTB in a full-length spliceable src RNA (12, 13, 17). A short DCS RNA probe was previously shown to assemble into two RNA-protein complexes, "nonspecific" and "specific" (53). The nonspecific complex can be competed away by any RNA and is hence non-sequence specific. It is also present in both HeLa and WERI extracts. This complex contains a prominent 50- to 55-kDa protein observable by shortwave UV cross-linking. The specific complex is enriched by removing the 55-kDa protein by ammonium sulfate fractionation of the extract. This specific complex contains hnRNP H, hnRNP F, and KSRP as well as other factors. Although present in HeLa extract, the specific complex is more prominent in WERI extract (16, 53, 54). This complex is also sequence specific, since it is competed efficiently only with a DCS RNA. Although PTB binds to the CUCUCU element of the DCS in a full length pre-mRNA, we had not previously seen PTB binding to this element in the complexes formed on a short DCS RNA probe. To characterize proteins interacting specifically with the CUCUCU element of the DCS, we generated DCS RNAs where the U's in this element were replaced with the photoaffinity label 4-thiouridine (4-thioU). The 5' phosphate of each cytosine in the CUCUCU element was further replaced with ³²P. This modified DCS RNA was incubated with HeLa or WERI nuclear extract and irradiated with 366-nm UV light. The extract was treated with RNase A, and the cross-linked proteins were resolved by SDS-PAGE.

View larger version (66K): [in this window] [in a new window]   FIG. 1.   Structure and composition of the DCS complex. (A) nPTB cross-links to the CUCUCU element of the DCS RNA. The DCS RNA sequence is shown at the top. Modified bases are shown as hollow letters. Site-specific labeling of proteins binding to the DCS RNA is shown below the sequence. Cross-linking in the ASP40 fraction of WERI-1 (lane 1) or HeLa (lane 2) extract and in total HeLa (lane 3) or WERI-1 (lane 4) nuclear extracts is shown. Positions and sizes of the molecular weight standards (in thousands) are indicated on the right. (B) Immunoprecipitation of the proteins binding to the DCS RNA in the WERI ASP40 fraction. Antibodies used were anti-SM Y12 (lane 2), anti-KSRP (lane 3), anti-FBP (lane 4), and anti-PTB (lane 5). (C) Probing hnRNP H, hnRNP F, KSRP, FBP, and nPTB binding sites on the DCS RNA by site-specific labeling. Modified (hollow) and radiolabeled nucleotides are shown below the DCS RNA sequence. Cross-linking was done in the ASP40 fraction of WERI-1 (lanes W) or HeLa (lanes H) nuclear extract. (D) DCS RNA mutants used in the cross-linking experiments. Positions of 4-thioU modifications are indicated as U8 and U18 above the wild-type (WT) sequence, and the mutations are indicated below. (E) Effect of mutations in DCS RNA on the cross-linking of proteins to positions U18 (top) and U8 (bottom) of the DCS in the ASP40 fraction of WERI-1 extract (lanes W) or HeLa extract (lanes H).

Characterization of DCS RNA binding proteins by RNA affinity chromatography. To further examine the proteins binding to the DCS RNA in the absence of cross-linking, we performed RNA affinity chromatography. After periodate treatment, the DCS RNA was chemically attached through its 3' end to adipoyl hydrazido-Sepharose. We find that this resin shows lower nonspecific protein binding than do RNA affinity resins based on the avidin-biotin interaction. To further minimize nonspecific protein binding, nuclear extract was supplemented with 0.1 mg of heparin per ml before being loaded on the column. Based on gel shift data, this amount of heparin disrupts nonspecific RNA-protein complexes while leaving the specific DCS complex intact.

View larger version (65K): [in this window] [in a new window]   FIG. 2.   Purification of proteins bound to the DCS RNA or an unrelated RNA in the WERI-1 or HeLa extracts using RNA affinity chromatography. (A) Coomassie blue-stained gels displaying fractions from the DCS RNA affinity column (lanes 1 to 6 and lanes 8 to 13) or an unrelated RNA affinity column (lanes 15 to 20). Proteins identified by MS are indicated by arrows. Lanes 7, 14, and 21 contain protein markers. (B) Western blot analysis of the same fractions. MAb104 monoclonal antibody was used for identification of the SR proteins. The positions of the SC35 and ASF/SF2 (SRP 35), SRp55, and SRp75 proteins are indicated by arrows.

Purification and cloning of nPTB. The different cross-linking patterns of PTB in the two extracts indicated a difference in the protein from these two sources. To allow a detailed comparison of the PTBs in the two extracts, we purified the two proteins using a modification of the published PTB purification protocol (61). The HeLa and WERI PTBs copurified over the first three columns: DEAE, heparin, and poly(U)-Sepharose. When the WERI extract fractions from the poly(U) column were loaded onto a HiTrap Cibacron Blue Sepharose column and eluted with a shallow gradient of KCl, the two forms of PTB were resolved. Under these conditions, nPTB came off the column earlier than the PTB isoforms seen in HeLa extract (Fig. 3A). As a result, a nearly homogeneous sample of the nPTB protein, free of PTB, was obtained (Fig. 3B).

View larger version (36K): [in this window] [in a new window]   FIG. 3.   Purification of human nPTB. (A) Purification scheme. Coomassie blue-stained gels of PTB- and nPTB-containing fractions from the HiTrap Blue column are shown below the scheme. (B) Coomassie blue staining of an SDS-10% polyacrylamide gel containing purified WERI-1 nPTB and HeLa PTB. (C) nPTB peptide sequences identified by Edman degradation (left) and corresponding human PTB-1 peptides (right). Differences between two proteins are shown by hollow letters.

View larger version (56K): [in this window] [in a new window]   FIG. 4.   Human nPTB cDNA sequence. The NLS sequences are shaded. The four RRM domains are boxed. Sequenced peptides are in bold. The asterisk indicates the stop codon.

View larger version (89K): [in this window] [in a new window]   FIG. 5.   Comparative analysis of the nPTB amino acid sequence. (A) Structural organization of the nPTB RRMs. RNP1 and RNP2 consensus sequences for the typical RRM and for the nPTB RRMs are shown at the top. The domain secondary structure is schematically shown below the RRM sequences. Residues identical in at least two RRMs are shaded. (B) Comparison of human nPTB with related PTB sequences. The human nPTB sequence is aligned with PTB sequences from human (accession no. X62006), mouse (accession no. X52101), Xenopus laevis (accession no. AAF00041), D. melanogaster (accession no. AAF22979), C. elegans (accession no. CAA85411), and Arabidopsis thaliana (accession no. AF076924), with a partial sequence of nPTB from Danio rerio (accession no. AA566427) and with the sequence of human ROD1 (accession no. NM005156) using the MegAlign program (DNAStar). Residues identical to those of nPTB are shown as dots. Brackets indicate the borders of RRM domains. (C) A phylogenetic tree of human nPTB and mammalian, plant, and C. elegans PTBs generated by MegAlign based on the protein alignment. The length of the branch on the x axis indicates the percent sequence divergence.

Tissue distribution of nPTB. The biochemical assays for nPTB indicated its presence in WERI but not HeLa extract. We next examined the expression of nPTB and PTB on a multiple-tissue Northern blot (Fig. 6A). The full-length nPTB cDNA and a 1-kb fragment of the PTB coding region were used as probes. A human -actin cDNA was used as a control. nPTB mRNA appeared as a single band approximately 3.4 kb in length, while PTB gave rise to a doublet of 3.6- and 4.7-kb bands. The upper band may be a cross-hybridizing mRNA or possibly an immature form of PTB mRNA. PTB mRNA was present in a wide range of tissues, with the lowest levels observed in the brain. In contrast, nPTB mRNA was most abundantly expressed in the brain, although there was detectable expression in other tissues, notably the heart and skeletal muscle.

View larger version (44K): [in this window] [in a new window]   FIG. 6.   Tissue and cell line distribution of nPTB. (A) Northern blot analysis of poly(A)+ RNA from the indicated human tissues using an nPTB oligonucleotide probe (top) or the PTB cDNA probe (middle) probe. Loading was verified by hybridization to a -actin control cDNA probe (bottom). (B) Northern blot analysis of total RNA from the indicated neural (lanes 1 and 2) and nonneural (lanes 3 and 4) cell lines. Probes included the full-length nPTB cDNA (top), a 1-kb fragment of PTB (middle), and the -actin control cDNA probe (bottom). (C) Western blot analysis of proteins from neural (lanes 1 to 3) and nonneural (lanes 4 to 6) cell lines using rabbit polyclonal anti-PTB antibodies recognizing both the PTB and nPTB proteins (top). The positions of the PTB isoforms and of nPTB are indicated by arrows. The same blot was probed with anti-U170K antibody as a protein-loading control (bottom).

nPTB is a weaker repressor of N1 splicing than is PTB. To assess the functional differences between nPTB and PTB, we analyzed the behavior of each protein in the in vitro splicing assay by using two src minigene transcripts. BS7 contains both the upstream and downstream regulatory sequences, each containing a pair of CUCUCU elements (Fig. 7A). BS27, obtained by precise deletion of the intron upstream of the N1 exon, contains only the two downstream CUCUCU elements. We previously showed that BS27 is spliced in the HeLa nuclear extract, where BS7 is repressed. Both transcripts splice equally well in WERI extract (12).

View larger version (148K): [in this window] [in a new window]   FIG. 7.   Effect of PTB and nPTB on N1 exon splicing in vitro. (A) Maps of the src splicing substrates. Black boxes indicate splicing-regulatory elements. (B) Splicing of adenovirus major late (lanes 1 to 8) and -globin (lanes 9 to 16) transcripts in WERI-1 nuclear extract in the absence (lanes 2 and 10) or presence of 0.3, 1, or 3 µl of HeLa (lanes 3 to 5 and 14 to 16) or WERI-1 (lanes 6 to 8 and 11 to 13) 0.3 M KCl RNA affinity fractions. (C) The left panel shows splicing of the BS27 (lanes 1 to 8) or BS7 (lanes 9 to 22) transcripts in the WERI-1 nuclear extract. Lanes 1 and 9 contain no extract. Lanes 2 and 10 contain WERI extract without any additional factors. Lanes 3 to 5 and 14 to 16 contain WERI extract plus 0.3, 1, or 3 µl of HeLa 0.3 M KCl RNA affinity fraction. Lanes 6 to 8 and 11 to 13 contain WERI extract plus 0.3, 1, or 3 µl of WERI 0.3 M KCl RNA affinity fraction. Lanes 17 to 19 contain 40, 120, or 400 ng of nPTB. Lanes 20 to 22 contain 40, 120, or 400 ng of PTB. The right panel shows splicing of BS7 transcript in the WERI-1 nuclear extract using different preparations of nPTB, PTB, and nuclear extract from the left panel. Lane 1 contains WERI extract without any additional factors. Lanes 2 to 5 contain 50, 100, 200, or 400 ng of nPTB. Lanes 6 to 9 contain 50, 100, 200, or 400 ng of PTB.

Assembly of the DCS complex from purified components. Three sequence elements were defined previously in functional assays and are defined here as binding sites for particular proteins: the G tract, the CU tract, and the UGCAUG element. These three elements all reside within a 20-nt portion of the DCS sequence. The RNA contacts of an RRM or a KH domain can be between 4 and 7 nt, making these elements reasonable binding sites for individual RNA binding proteins (43, 76). However, one imagines that there must be extensive protein-protein contacts between the DCS complex proteins if they are simultaneously bound to this short sequence. To examine how the binding of each DCS protein affected the binding of the others, we performed gel shift experiments using recombinant or purified fractions of the individual proteins.

View larger version (75K): [in this window] [in a new window]   FIG. 8.   Binding of purified nPTB and PTB to the src N1 exon splicing-regulatory elements in the presence and absence of other protein components of the DCS complex. (A) The left panel shows a gel mobility shift analysis of nPTB (lanes 2 to 6) or PTB (lanes 7 to 11) complexed with an N1 3' splice site polypyrimidine tract RNA. Lane 1 contains free RNA probe (20 fmol, 105 cpm). Lanes 2 to 6 contain 50, 100, 200, 400, and 800 ng of purified nPTB. Lanes 7 to 11 contain equivalent amounts of PTB. The right panel shows a gel mobility shift analysis of nPTB (lanes 2 to 6) or PTB (lanes 7 to 11) complexed with an src DCS RNA. The amount of protein in each lane is equivalent to that in the left panel. (B) The left panel shows that hnRNP H enhances PTB and nPTB binding to the DCS RNA. Binding-reaction mixtures contained 100 ng of either nPTB (lanes 1 to 5) or PTB (lanes 6 to 10). This was supplemented with 25 ng (lanes 1 and 6), 50 ng (lanes 2 and 7), 100 ng (lanes 3 and 8), 200 ng (lanes 4 and 9), or 400 ng (lanes 5 and 10) of hnRNP H. The right panel shows assembly of the DCS-like complex from purified and recombinant factors. A total of 800 ng of purified nPTB, 300 ng of recombinant hnRNP H, and/or 400 ng of a KSRP-FBP fraction were used where indicated by +. (C) DCS RNA mutants used in the gel shift experiments. The sequence of the original DCS probe is shown at the top. The WTs probe sequence is truncated as indicated. The GTrs, CUTrs, and GCA mutations are indicated. Gel mobility shift analysis of nPTB complexed with src DCS RNA mutants in the presence of hnRNP H, KSRP, and FBP is shown below the sequences. A total of 200 ng of purified nPTB, 300 ng of recombinant hnRNP H, and/or 400 ng of a KSRP-FBP fraction were used where indicated by +. The WTs and mutant probes are indicated above. The position of each complex is shown by an arrow.

View larger version (27K): [in this window] [in a new window]   FIG. 9.   Diagram of the DCS RNP complex. The position of each protein along the DCS RNA is indicated. These contacts are supported by cross-linking, affinity chromatography, and gel shift assays using wild-type and mutant DCS RNA sequences. Homologous pairs of proteins are indicated (hnRNPs H and F, PTB and nPTB, and KSRP and FBP). The stoichiometry of hnRNP F and FBP binding relative to their homologs is not yet known.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Cooperative assembly of an hnRNP complex. The regulation of spliceosome assembly is generally thought to occur within the hnRNP complexes that assemble onto nascent pre-mRNAs as they are synthesized by RNAP II. The structures of these pre-mRNPs are extremely complex, with dozens of different hnRNPs binding to each RNA transcript (4, 42, 52). However, the interactions of these proteins with the RNA and each other are generally unknown. In this study, we have characterized the assembly of a small subset of these RNPs that bind to an important splicing regulatory region in the src pre-mRNA, the DCS. The DCS is interesting because it can have both enhancing and repressing activity on the splicing of an upstream exon, depending on the cellular environment and its adjacent sequences (55, 56).

A new tissue-specific RNA binding protein. We identified and cloned nPTB as a component of the DCS complex. nPTB is highly related to PTB/hnRNP I, but where PTB is broadly expressed, nPTB is enriched in the brain. In WERI-1 cell extracts, both nPTB and PTB are present.

Models for splicing derepression. Because of its extract specificity and binding properties, nPTB is a prime candidate for mediating the loss of splicing repression in WERI-1 cells. However, significant further work is required to prove this. Since nPTB is only weakly expressed in at least one cell line (LA-N-5) where the N1 exon is efficiently spliced, nPTB cannot be the sole determinant of N1 splicing. This is not entirely surprising, since previous work has shown that N1 splicing is controlled by a complex mixture of positive and negative elements across the region of the exon (55, 56). The inclusion of the exon can be increased by removing one of its repression mechanisms or by increasing its activation, and different cells seem to make different use of these mechanisms (55). The LA-N-5 cells may overcome the repression by PTB through increased enhancer activity. Indeed, the downstream enhancer is particularly strong and the repressor is relatively weak in LA-N-5 cells (55).