Department of Pharmacology and Cancer
Biology, Duke University Medical Center, Durham, North Carolina
27710,1 and Department of Molecular
Genetics and Microbiology, University of Massachusetts Medical
School, Worcester, Massachusetts 016052
Received 13 March 2000/Returned for modification 24 April
2000/Accepted 21 July 2000
 |
INTRODUCTION |
In the budding yeast
Saccharomyces cerevisiae, cells of the a and
mating types secrete pheromones that bind to G-protein-coupled receptors on the surfaces of cells of the opposite mating type, initiating a signaling cascade in which the 
subunits of the G
protein promote the activation of a mitogen-activated protein kinase
(MAPK) cascade (4). This process appears to involve the
binding of at least two proteins, the upstream kinase Ste20p and the
scaffold protein Ste5p, to the liberated G
subunits (11, 25,
40, 51). MAPK activation then promotes cell cycle arrest in
G1 and stimulates the expression of several genes,
including FUS1, leading ultimately to fusion of the mating
partners (22).
The small GTPase Cdc42p and its guanine nucleotide exchange factor
Cdc24p are essential for polarity establishment and subsequent bud
formation (1, 38). In addition to their roles in cell polarity, these proteins have been proposed to play roles in signal transduction in response to mating pheromones (46, 47, 53). Temperature-sensitive cdc42 and cdc24 mutants
have defects in
-factor-stimulated transcription of FUS1
and in maintaining G1 arrest at the restrictive temperature
(46, 53). In addition, an interaction was detected by
two-hybrid analysis between G
and Cdc24p (53), and
Cdc42p-GTP was shown to bind to and activate Ste20p (46).
These findings led to the hypothesis that G
activated Cdc24p,
causing GTP loading of Cdc42p and consequent activation of Ste20p, as
an important part of the pheromone signaling pathway.
More recent experiments have cast doubt upon the existence of a
G
-Cdc24p-Cdc42p-Ste20p pathway. Mutations in CDC24
that abolished detectable interaction with G
did not cause any
defects in
-factor-stimulated FUS1 transcription or
G1 arrest but rather were specifically defective in
orientation of the mating projection towards the mating partner
(33). Furthermore, mutations in STE20 that
abolished detectable interaction with Cdc42p were also reported to be
wild type with regard to
-factor-stimulated FUS1
transcription, G1 arrest, and mating (23, 37).
Together, these studies indicated that neither the G
-Cdc24p
interaction nor the Cdc42p-Ste20p interaction was important for
-factor signaling. Furthermore, the polarity defect exhibited by
temperature-sensitive cdc24 and cdc42 mutants
triggers the morphogenesis checkpoint to delay the cells in
G2 with abundant G1 cyclins (26), a
state known to render cells unresponsive to
-factor (34).
This raised the possibility that the signaling defect of these mutants
might be an indirect consequence of their accumulation at a
nonresponding stage of the cell cycle. Indeed, the transcriptional
induction of FUS1 was found to be quite normal in
cdc24 and cdc42 mutants that were first arrested
in G1 by deprivation of G1 cyclins
(35), raising the question of whether Cdc24p and Cdc42p play
any role at all in
-factor signaling.
As illustrated by these studies, the interpretation of cdc42
and cdc24 phenotypes is complicated by the possibility of
indirect effects stemming from the well-characterized polarity defects caused by these mutants at the restrictive temperature. To circumvent these problems, we performed a screen to identify
-factor-resistant alleles of CDC42 that could still perform polarization
functions. In this paper we report the isolation and characterization
of such mutants, supporting the notion that Cdc42p has some direct role
in pheromone signaling. Our results further suggest that this signaling
function operates through Cdc42p-dependent activation and localization
of Ste20p.
 |
MATERIALS AND METHODS |
Yeast media and cell synchrony.
Yeast media (YEPD rich
medium, synthetic complete medium lacking specific nutrients, and
sporulation medium) have been described previously (13).
YEPG and YEPS are the same as YEPD but with 2% galactose or sucrose
instead of dextrose. Centrifugal elutriation to isolate
early-G1-phase cells was performed as described previously (27).
Strains, plasmids, and PCR manipulations.
Standard media and
methods were used for plasmid manipulations (2) and yeast
genetic manipulations (13). The S. cerevisiae strains used in this study are listed in Table
1, and the plasmids used are listed in
Table 2.
To generate the GAL1p-CDC42 allele, the oligonucleotides
DJL42-1
(5'-GC CGGAACTCAAAAGGGTAATTTCGTGAAAAACAATCATCGACTACGT CGTAAGGCCG-3' and DJL42-2 (5'-TCAGTAGAAGGATATGACAAGG G-3') were used
to amplify a DNA fragment containing the LEU2 gene, the
GAL1 promoter, and flanking CDC42 sequences using
PCR with the plasmid pGAL-CDC42Sc (55) as a template (the
underlined sequence in DJL42-1 is the genomic sequence 733 to 693 bp
upstream of the CDC42 start codon, whereas in DJL42-2 it is
the reverse complement of nucleotides 204 to 226 in the
CDC42 open reading frame). The PCR fragment was transformed
into DLY1, replacing the endogenous CDC42 promoter (1 to 693 bp upstream of the start codon) with LEU2 and the
GAL1 promoter, creating DLY3067. Leu+
transformants were selected on galactose-containing plates, and promoter replacement was confirmed by the inability to grow on dextrose-containing plates (GAL1 promoter off) and by PCR.
To generate the cdc42::URA3 null
allele, the oligonucleotides CDC42-5'
(5'-CTATTTTCCTGAGGAGATAGGTTAACAAACGAATTAGAGAAGGCGCGTTTCGGTGATGAC-3') and CDC42-3'
(5'-GAGGCTCCAAGGCGGCCACGATAGCTTCATCGAATACATTCTTTCCTGATGCGGTATTTTC-3') were used to amplify the URA3 gene using PCR
with the plasmid pRS306 (45) as a template. The PCR product
was transformed directly into a yeast strain containing an additional
copy of CDC42 under the control of the GAL1
promoter (in this case, integrated at LEU2 using pDLB377, a
YIp derivative of pGAL-CDC42Sc [55]
generated by replacing the ClaI fragment containing pRS315
vector sequences with the corresponding fragment from pRS305
[45]). Ura+ transformants were selected on
galactose-containing plates to replace the endogenous copy of
CDC42 (from 45 bp upstream to 494 bp downstream of the start
codon, removing all but the last 26 codons) with URA3,
generating strain MOSY0090. Transformants were tested for the inability
to grow on dextrose-containing plates (GAL1 promoter off),
and gene replacement was confirmed by PCR.
cdc42-md1 was integrated into the endogenous
CDC42 locus by one-step replacement of the
cdc42::URA3 allele. A 1.2-kb EcoRI fragment containing cdc42-md1 was excised from pMOSB36 and
transformed into MOSY0090 together with the TRP1-marked
plasmid, pRS314 (45). Trp+ transformants were
selected on galactose-containing plates and then selected for the
ability to grow on dextrose-containing plates (GAL1 promoter
off) containing 5-fluoroorotic acid (to kill URA3 cells
[7]), and gene replacement was confirmed by PCR.
cdc42-md1 was then back-crossed to separate it from the
leu2::GAL1p-CDC42::LEU2 present in MOSY0090, generating MOSY0178.
To create pDLB643, the template for PCR mutagenesis of
CDC42, the CDC42 promoter and coding sequences
were fused to the transcription terminator sequences from
TDH3. The oligonucleotides DJL42-3
(5'-CCACCGTCGATTCAAGGGTC-3') and DJL42-4
(5'-AGATCTCTGAGCAAAGCG-3') were first used to amplify CDC42 (from 366 bp upstream of the start codon to 30 bp
downstream of the stop codon) using the plasmid YEp351-CDC42
(55) as a template, and this fragment was cloned into pCR2.1
(Invitrogen, Carlsbad, Calif.) to make pCR42-3/4. The TDH3
transcription terminator sequences (a 900-bp
BamHI/BglII fragment from pAB23BX
[43]) were then cloned into the BamHI site
of pCR42-3/4 to make pDLB643. A 2-kb XhoI/BamHI
fragment from pDLB643 was also cloned into the corresponding sites of
pRS316 (45) to make pMOSB55.
To create pDLB644, the recipient plasmid for expressing the mutant
alleles of CDC42, CDC42 promoter sequences were
fused (via a unique BglII site) to the transcription
terminator sequences from TDH3 and cloned into the vector
pRS316 (45). The oligonucleotides DJL42-3 (see above) and
DJL42-5 (5'-AGATCTGGAAGACCTAATACG-3'; the
BglII site is underlined) were used to amplify a DNA
fragment containing the CDC42 promoter (1 to 366 bp upstream
of the start codon) using the plasmid YEp351-CDC42 (55) as a
template, and this fragment was cloned into pCR2.1 (Invitrogen) to make
pCR42-3/5. The TDH3 transcription terminator sequences were
then cloned into the BamHI site of pCR42-3/5 to create
pDLB642. The 1.2-kb XhoI/BamHI fragment from
pDLB642 was then cloned into the corresponding sites of pRS316
(45) to make pDLB644. pDLB644 was linearized by digestion with BglII and transformed into yeast cells together with
the mutagenized CDC42 PCR products which underwent gap
repair to yield Ura+ colonies.
The cdc42-V36A, cdc42-Y40C, and
cdc42-D57Y alleles were constructed using the ExSite
PCR-based site-directed mutagenesis kit (Stratagene, La Jolla, Calif.).
To generate pMOSB16 (cdc42-V36A), PCR was performed using
the oligonucleotides cdc-4 (5'-ACAGCGTTCGATAACTATGCGG-3') and cdc-11 (5'-TGGAACATAGTCAGCTGGAAATTGATTCG-3')
with pDLB643 as a template. cdc-11 has a silent mutation which
introduces a PvuII site (underlined). To generate pMOSB53
(cdc42-Y40C), PCR was performed using the oligonucleotides
cdc-22 (5'-ACAGTGTTCGATAACTGTGCGGTGACTGTGATG-3') and cdc-11
with pDLB643 as a template. To generate pMOSB29
(cdc42-D57Y), PCR was performed using the oligonucleotides
cdc-18 (5'-TATACGGCCGGTCAAGAAG-3') and cdc-19
(5'-AAACAAACCTAACGTATATGG-3') with pDLB377 as a template. The mutants were sequenced to confirm the presence of the desired mutation and the absence of any other mutations.
To generate pMOSB176 and pMOSB177, PCR was performed using the
oligonucleotides DJL42-3 (see above) and DJL42-6
(5'-CTACTACAGATATTACATGTGGCG-3') to amplify
cdc42-Y40C (pMOSB53 template) or cdc42-V36A
(pMOSB16 template), respectively, and introduced into pDLB644 by gap
repair. To generate pMOSB175 and pMOSB47, 2.1-kb
BamHI/XhoI fragments containing cdc42
alleles were excised from pMOSB176 and pMOSB177, respectively, and
cloned into the corresponding sites of pRS314 (45).
The cdc42-V36A,Q61L and
cdc42-Y40C,Q61L alleles were generated by a
two-step strategy in which we first removed residues 32 to 40 in
CDC42-Q61L and then employed homologous recombination to
repair that "gap" with sequences from cdc42-V36A or
cdc42-Y40C. We first replaced amino acids 32 to 40 in
CDC42-Q61L,C188S with a NotI site,
using the ExSite PCR-based site-directed mutagenesis kit. PCR was
performed with the oligonucleotides JMCDC42-1
(5'-CCGCGTCGGCTGGAAATTGATTCG-3') and JMCDC42-2
(5'-CCGCGGTGACTGTGATGATTGG-3') with pEG202-cdc42-Q61L,C188S (46) as a template. The resulting allele was then
transferred to pOBD.CYH using a PCR and gap repair strategy involving
sequential amplification of the allele with the oligonucleotides
LC20-CDC42 (5'-AATTCCAGCTGACCACCATGCAAACGCTAAAGTGTG-3') and
RC20-CDC42 (5'-GATCCCCGGGAATTGCCATGCTACAAAATTGTAGATTTT-3') followed by a second PCR using the oligonucleotides
BD70F and BD70R (15) containing homology to the first
primers and 70-nucleotide extensions with homology to pOBD.CYH. The
resulting PCR product was transformed together with
PvuII/NcoI-linearized pOBD.CYH into DLY1 to
generate pOBD.CYH-cdc42-Q61L/C188S(
32-40) by gap repair. cdc42-V36A and cdc42-Y40C were then amplified by
PCR using the oligonucleotides DJL42-3 and cdc-19 (see above) with
pMOSB16 or pMOSB53 as a template and transformed into DLY1 together
with NotI-cut pOBD.CYH-cdc42-Q61L/C188S(
32-40) to
generate the gap repair products pOBD.CYH-cdc42-V36A/Q61L/C188S and
pOBD.CYH-cdc42-Y40C/Q61L/C188S.
Plasmids for the expression of myc-tagged alleles of CDC42
in bacteria were made using the Univector system (28).
CDC42 alleles were amplified by PCR using the
oligonucleotides CDC42-UNI1 (5'-GGAATTCCATATGCAAACGCTAAAGTGTGTTGTTGTC-3';
the NdeI site is underlined, and the start codon is in
boldface) and CDC42-UNI2 (5'-CCGAGCTCCTACAAAATTGTACATTTTTTACTTTTC-3'; the
SacI site is underlined) with pGAL-CDC42(Q61L)
(55), pMOSB29, pOBD.CYH-cdc42-V36A/Q61L/C188S, or
pOBD.CYH-cdc42-Y40C/Q61L/C188S as a template.
NdeI/SacI-digested PCR fragments were cloned into
the respective sites of pUNI-10 (28), generating pDLB1034,
-1035, -1160, and -1277. The pUNI-10-CDC42 plasmids were then
recombined with pHB1-MYC3 using the Cre/lox system (28) to
produce the bacterial expression plasmids pDLB1234, -1235, -1240, and
-1242. All constructs were sequenced to confirm that no changes
occurred as a result of PCR manipulations.
To construct pG11-4, STE11-4 was amplified by PCR and
inserted downstream of the GAL1 promoter in pRD53* as a
BamHI/XhoI fragment; pRD53* is a derivative of
pRD53 (40) in which URA3 lacks a PstI site.
Plasmid pGS11
N-T was constructed by transferring the 3.5-kb
SacI/XhoI fragment encoding
GAL1p-GST-STE11
N from pRD-STE11-H3 (32) into
the corresponding sites in pRS314 (45).
Plasmid pPP828 is a LEU2-marked derivative of pRL116
(23) created by homologous recombination in yeast using
pUC4-ura3::LEU2 (31).
To express the Ste20p Cdc42p-Rac interactive binding (CRIB) domain as a
recombinant glutathione S-transferase (GST) fusion protein,
the oligonucleotides ste20-1 (5'-ATGTCATCTTCTATAACCACCGC-3') and ste20-2 (5'-TGTTTGCAGGCGGTGTTG-3') were used to
amplify a DNA fragment encoding the Ste20p residues 328 to 428 by PCR
using yeast genomic DNA as a template. The PCR fragment was cloned into pCR2.1 using the TA cloning kit (Invitrogen) and then excised using the
flanking EcoRI sites and cloned into the EcoRI
site of pGEX-KG, generating pGEX-Ste20CRIB. The construct was sequenced to confirm its orientation and that no PCR-induced mutations had occurred.
To generate the ste20
CRIB allele (23), the
3-kb SphI/KpnI fragment from
pRS316-ste20(
334-369) (23) was cloned into the corresponding sites of YIplac211 (12), generating pMOSB134. pMOSB134 was digested at the unique XbaI site within
STE20 (upstream of the deleted CRIB region) and transformed
into DLY3067. Ura+ transformants containing tandem
STE20-URA3-ste20
CRIB sequences were selected, and
then "pop-out" events in which URA3-containing sequences
between the STE20 and ste20
CRIB genes were
excised by homologous recombination were selected by plating them on
5-fluoroorotic acid. The colonies were screened by PCR using the
oligonucleotide ste20-2 (5'-GAGTTTGCAGGCGGTGTTG-3') and
ste20-9 (5'-AACCGTCCAAGCCTGAAG-3') to determine whether the
excision event left STE20 (558-bp PCR product) or
ste20
CRIB (446-bp PCR product) as the sole remaining allele.
Strains MOSY0023 and MOSY0106 were generated from a cross between
MOSY0095 and BOY774 (cla4::TRP1) or BOY489
(ste20::TRP1), respectively. BOY489 and BOY774
were obtained from F. Cross (6).
The bem1::URA3 allele was generated by one-step
gene replacement using an EcoRI-BamHI fragment
from the plasmid pKO1 (9).
Strain PPY911 (40) contains a HIS2-marked
FUS1-lacZ reporter integrated at the FUS1 locus
that was introduced by transformation of the cdc42-1 strain
DLY3032 with SphI-digested pFL-HIS2. pFL-HIS2 contains a
2-kb HIS2 HindIII fragment in place of the
HinddIII/HindIII TRP1 fragment in
pFL-TRPb, which itself contains a 0.9-kb TRP1 EcoRI/StuI fragment (along with pBluescript polylinker
sequences from EcoRI-HincII) in place of the
HindIII/StuI URA3 fragment of
pSB286 (39).
Screen to identify
-factor-resistant cdc24
mutants.
The oligonucleotides DJL42-3 and DJL42-6 (see above) were
used to amplify CDC42 (and TDH3 terminator
sequences) by mutagenic PCR using pDLB643 as a template. Mutagenic PCRs
were similar to standard PCR except for the addition of 0.2 mM
MnCl2 and the use of an unbalanced deoxynucleoside
triphosphate mix (0.5 mM dTTP, 0.5 mM dGTP, 0.1 mM dATP, and 0.1 mM
dCTP [final concentrations]). The PCR products were transformed into
DLY3067 together with BglII-digested ("gapped" plasmid)
pDLB644, and Ura+ transformants were selected on
dextrose-containing plates (to repress transcription of the genomic
GAL1p-CDC42 allele) coated with 10 µg of
-factor (to
select for
-factor-resistant cdc42 mutants). This amount
of
-factor (custom synthesized by Research Genetics, Huntsville,
Ala.) was more than 10 times the amount needed to completely inhibit
growth of the bar1 parent strain.
-Factor-resistant
colonies could in theory arise due to genomic mutations in other genes.
To distinguish cdc42 mutants, colonies were tested for
-factor-resistant growth on galactose-containing plates, where the
genomic (wild-type) CDC42 is expressed. Plasmids were
isolated from colonies that were
-factor resistant when grown in
dextrose-containing medium but not when grown in galactose-containing medium and were then retransformed into fresh DLY3067 to confirm that
the plasmids were responsible for the
-factor-resistant growth
phenotype. To generate the TRP1-containing plasmids pMOSB42 to -45, CDC42 alleles were transferred from URA3
plasmids (pMOSB36 to -38 and pMOSB55) as 2.1-kb
BamHI/XhoI fragments to the corresponding sites
of pRS314 (45).
Spot assays for growth arrest.
Cells harboring plasmid-borne
CDC42 alleles were grown to stationary phase in
dextrose-containing medium (to repress genomic GAL1p-CDC42)
lacking nutrients appropriate to select for plasmid maintenance. The
number of cells was determined using a hemocytometer, and diluted
stocks were generated to spot 2 µl containing ~1,250, ~250,
~50, and ~10 cells onto plates containing the same selective dextrose medium either with or without 10 µg of
-factor per plate. Assuming a plate "volume" of 20 ml, this would translate to ~0.3 µM
-factor.
Northern blot analysis.
RNA extraction, formaldehyde-agarose
gel electrophoresis, capillary transfer, probe hybridization, and wash
procedures were performed as described previously (10, 41,
42). The FUS1 probe was made from a 880-bp internal
EcoRI/NheI fragment from the FUS1
gene, and the ACT1 probe was made from the entire
ACT1 open reading frame, using [
-32P]dCTP
(ICN Pharmaceuticals, Costa Mesa, Calif.) and the Prime-it II kit
(Stratagene) according to the manufacturer's recommendations.
Flow cytometry.
Cells were processed for
fluorescence-activated cell sorter (FACS) analysis as described
(14), except that the DNA was stained with 1 µM Sytox
(Molecular Probes, Eugene, Oreg.) in 50 mM Tris-HCl (pH 8.0) (instead
of propidium iodide).
DIC microscopy.
Cells were viewed on an Axioskop apparatus
(Zeiss, Thornwood, N.Y.) equipped with epifluorescence and differential
interference contrast (DIC) optics. Images were captured by using a
cooled-model charge-coupled device camera (Princeton Instruments,
Princeton, N.J.).
Analysis of FUS1-lacZ expression.
-Galactosidase assays were performed as described previously
(40). Transformants in cdc42-1 strains were grown
overnight at 28°C in selective synthetic medium containing 2%
raffinose and 0.1% dextrose to an optical density at 660 nm of 0.3 to
0.6, preincubated for 2 h at 38.5°C, and then induced for 4 h with 2% galactose with or without 0.01 µM
-factor. Assays in
CDC42 strains were performed at 30°C.
Production of recombinant proteins and binding assays.
Wild-type and mutant myc-tagged CDC42 alleles were expressed
in Escherichia coli BL21(DE3) (Stratagene). Extracts were
prepared in bacterial lysis buffer (750 mM sucrose, 100 mM NaCl,
100 mM Tris-HCl [pH 8.0], 5 mM EDTA) containing the protease
inhibitors aprotinin (7.5 µg/ml; Sigma, St. Louis, Mo.),
pepstatin (5 µg/ml; Sigma), leupeptin (10 µg/ml; Boehringer
Mannheim, Indianapolis, Ind.), and phenylmethylsulfonyl fluoride (0.5 mM; Sigma). The cells were treated with 2 mg of lysozyme/ml for 20 min
on ice. To remove genomic DNA, MgCl2 was added to 15 mM and
DNase I was added to 50 µg/ml. The cells were lysed by 20 min of
incubation at 4°C with 2 mg of deoxycholic acid/ml. Insoluble
material was removed by centrifugation at 4°C for 10 min.
GST-Ste20-CRIB was expressed in the protease-deficient E. coli BL21, extracts were prepared as described above, and the
protein was purified using glutathione Sepharose 4B (Amersham Pharmacia
Biotech, Piscataway, N.J.) as specified by the manufacturer.
Binding assays were performed by incubating the bacterial extracts
containing Cdc42p-myc with either GST or GST-Ste20-CRIB immobilized on
glutathione beads in 200 µl of binding buffer (10 mM Tris-HCl [pH
7.5], 85 mM NaCl, 6 mM MgCl2, 10% glycerol) at 4°C for
3 h. Binding reaction mixtures were washed three times at room
temperature with wash buffer (10 mM Tris-HCl [pH 7.5], 10 mM
MgCl2, 1 mM dithiothreitol, 0.1% Triton X-100). Bead-bound proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis, blotted to Immobilon-P nylon membranes (Millipore, Bedford, Mass.), and immunoblotted with monoclonal anti-myc antibodies (9E10; Santa Cruz Biotechnology, Santa Cruz, Calif.) using standard procedures (2). To confirm equal loading, the amount of
GST-Ste20-CRIB in each lane was visualized by staining the membrane
with India ink (42).
Localization of GFP-Ste20p.
Cells containing pRL116 or
pPP828 were propagated for at least 24 h in selective liquid
medium containing 2% dextrose and 0.008% adenine (to inhibit
accumulation of red pigment in ade1 cells) at 30°C
(GAL1p-CDC42 strains) or at 36°C (cdc42-1
strains). The cells were examined without fixation using a Nikon E600
epifluorescence microscope with 100× Plan Fluor and 50× Plan
oil-immersion objectives. Images were collected using a cooled black
and white charge-coupled device camera (DAGE-MTI).
 |
RESULTS |
Identification of recessive
-factor-resistant alleles of
CDC42.
A hypothetical cdc42 mutant specifically
defective in pheromone signal transduction should retain all functions
necessary for cell polarity and proliferation but would fail to arrest
in G1 upon exposure to
-factor. Thus, cells expressing
such an allele as the sole source of Cdc42p should proliferate and form
colonies on plates containing a growth-inhibitory dose of
-factor.
We employed an error-prone PCR mutagenesis strategy to generate random mutations in CDC42 and recombined the resulting alleles into
a low-copy-number plasmid in cells whose endogenous CDC42
was transcriptionally repressed (using the regulatable GAL1
promoter; see Materials and Methods for details). Transformants that
promoted proliferation on
-factor-containing plates were selected.
Plasmids containing putative CDC42 mutants were isolated
from the rare
-factor-resistant colonies and retransformed into the
starting strain to confirm that the
-factor resistance was due to
the plasmid and not to a fortuitous genomic mutation. Three
independently derived mutants (cdc42-md1,
cdc42-md2, and cdc42-md12 [md for
mating pathway defective]) were selected for further characterization
(Fig. 1).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Isolation of -factor-resistant cdc42
alleles. The results of growth arrest assays of strain DLY3067
(GAL1p-CDC42) containing plasmid pMOSB55 (CDC42),
pMOSB36 (cdc42-md1), pMOSB37 (cdc42-md2), or
pMOSB38 (cdc42-md12) are shown. The photographs show growth
after 3 days at 30°C with (+) or without ( ) -factor.
|
|
In addition to promoting growth on
-factor-containing plates (Fig.
1), strains bearing the cdc42-md alleles were significantly, though not completely, defective in
-factor-induced FUS1
transcription (see below) and in mating to a wild-type partner (data
not shown). A possible explanation for the defect in FUS1
induction observed previously in temperature-sensitive cdc42
mutants is that the mutants accumulate at a nonresponding stage
(post-G1) of the cell cycle (35). To address
whether a similar situation might apply with cdc42-md
mutants, we isolated early-G1-phase cells from
cdc42-md1 and isogenic wild-type strains using centrifugal
elutriation and monitored cell cycle progression and FUS1
mRNA accumulation upon treatment with different doses of
-factor. As
shown in Fig. 2A, cdc42-md1
cells synchronized in early G1 phase displayed a defect in
FUS1 induction compared to similarly treated wild-type
cells, suggesting that these mutants are defective in responding to
-factor even when the cells are in a responsive stage of the cell
cycle. Flow cytometric analysis confirmed that both mutant and
wild-type cells remained in G1 for the duration of the
30-min
-factor treatment (Fig. 2B). In addition,
cdc42-md1 mutants progressed into S phase (data not shown)
and formed buds (Fig. 2C) with unaltered kinetics in the continuous
presence of 0.015 µM
-factor, a concentration sufficient to
completely arrest wild-type cells. However, 0.06 µM
-factor did
cause cdc42-md1 cells to delay briefly in G1
(Fig. 2C), indicating that the signaling defect is not complete
(consistent with the FUS1 induction data). In other
experiments, we have found that cdc42-md mutants also show a
FUS1 induction defect in cells arrested in G1 by
depletion of the G1 cyclins Cln1p-Cln3p (data not shown).
Together, these data strongly suggest that the signaling defect of
cdc42-md mutants is not due to arrest at a nonresponding stage of the cell cycle.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
FUS1 induction and cell cycle arrest in
early-G1-phase cells. Cells containing two copies of
wild-type CDC42 (DLY1 plus pMOSB55) or cdc42-md1
(MOSY0178 plus pMOSB36) were grown to exponential phase in
sucrose-containing medium lacking uracil at 30°C (using two gene
copies improved the morphology of cdc42-md1 cells, making
the elutriation more effective). Small G1-phase cells were
isolated by centrifugal elutriation and resuspended in YEPD medium at
30°C. Following a 10-min recovery period, -factor was added to the
indicated final concentrations and the incubation was continued with
vigorous shaking. (A) Northern blot of FUS1 mRNA
accumulation following 30 min of -factor treatment.
cdc42-md1 cells display severely reduced induction compared
to wild-type cells. ACT1 mRNA on the same blots provides an
internal control for loading and transfer. (B) FACS analysis
demonstrating that both wild-type and cdc42-md1 cells were
still in G1 phase after 40 min in YEPD medium without
-factor (the same time point used for the FUS1 mRNA
analysis: a 10-min recovery period plus a 30-min -factor treatment).
The FACS profile of asynchronous wild-type cells (top) was used to
determine the fluorescence signal equivalent to G1 (1 N)
and G2 (2 N) DNA content. FACS profiles are shown for the
indicated strains immediately following elutriation (t = 0') or 40 min later in the absence of -factor (t = 40'). (C)
cdc42-md1 cells were not arrested in G1 phase in
response to -factor. Aliquots of cells were withdrawn at the
indicated times, fixed, and examined by phase-contrast microscopy to
determine the percentage of budded cells (n = 200).
, no -factor; , 0.015 µM -factor; , 0.059 µM
-factor.
|
|
In principle, the cdc42-md mutants could be defective
for a normal function of Cdc42p in
-factor signaling or they could encode forms of Cdc42p that can interfere with
-factor signaling even though wild-type Cdc42p might not play a role in signaling. To
distinguish between these options, we performed a dominance test to
determine whether cells containing both wild-type and mutant forms of
CDC42 were
-factor resistant. As shown in Fig. 3A, the mutants were all recessive, in
that cells containing plasmids expressing both wild-type and mutant
Cdc42p were
-factor sensitive. Intriguingly, very tiny colonies were
reproducibly observed in strains containing both cdc42-md1-
and CDC42-expressing plasmids. This appears to be a
dose-dependent effect such that cells with a high
cdc42-md1/CDC42 plasmid ratio are selected for on
-factor plates: when this experiment was repeated in cells with an integrated copy of cdc42-md1 and a plasmid-borne copy of
CDC42, no pheromone-resistant growth was observed (data not
shown). The recessive behavior of these alleles suggests that Cdc42p
wild-type function is required for an efficient pheromone response.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 3.
Intragenic-complementation analysis of the
cdc42-md mutants. Plasmids containing the indicated pairs of
CDC42 alleles were transformed into strain DLY3067. (A)
Pheromone resistance of cdc42-md mutants is recessive. The
photographs show growth after 3 days at 30°C with (+) and without
( ) -factor. The plasmid pairs were (in order) pMOSB55 plus
pMOSB45, pMOSB36 plus pMOSB42, pMOSB55 plus pMOSB42, pMOSB37 plus
pMOSB43, pMOSB55 plus pMOSB43, pMOSB38 plus pMOSB44, and pMOSB55
plus pMOSB44. wt, wild type. (B) cdc42-md mutants form a
single complementation group with regard to -factor resistance. Spot
assays were performed as for panel A (except that fewer cells were
spotted in this experiment). The plasmid pairs were (in order)
pMOSB55 plus pMOSB45, pMOSB36 plus pMOSB42, pMOSB37 plus pMOSB43,
pMOSB36 plus pMOSB43, pMOSB38 plus pMOSB44, pMOSB36 plus pMOSB44,
and pMOSB37 plus pMOSB44. (C) cdc42-md mutants form two
complementation groups with regard to cell morphology. Cells were grown
to exponential phase and photographed using DIC optics.
cdc42-md1 mutants exhibit broad necks and elongated buds
(48% of cells), while cdc42-md2 mutants exhibit large round
cells (>70% of cells); although some abnormal cells are present in
the cdc42-md1 plus cdc42-md2 population (with
generally less severe defects, perhaps due to plasmid loss), the
majority (73%) exhibit normal morphology. The morphologies were
similar in the presence and absence of -factor. The plasmid pairs
were pMOSB55 plus pMOSB45 (wt + wt), pMOSB36 plus pMOSB42
(md1 + md1), pMOSB37 plus pMOSB43
(md2 + md2), and pMOSB36 plus pMOSB43
(md1 + md2).
|
|
Intragenic complementation analysis of the cdc42-md
mutants.
We took advantage of the recessive nature of these
alleles to determine whether they had defects in the same or different functions required for the
-factor response. Cells containing all
pairwise combinations of plasmids bearing different cdc42-md alleles were uniformly resistant to
-factor (Fig. 3B), indicating that no mutant could provide the signaling function(s) defective in
another and suggesting that all three alleles were defective for the
same function.
In addition to the
-factor-resistant phenotype, two of the mutants
(cdc42-md2 and cdc42-md12) displayed a
slow-growth phenotype (Fig. 1A and 3A) (interestingly, growth of these
mutants was actually stimulated by
-factor), and all three mutants
displayed aberrant cell morphologies when grown in the absence of
-factor (Fig. 3C) (a detailed analysis of the morphological
phenotypes will be presented elsewhere). Like
-factor resistance,
the slow growth and morphological phenotypes were recessive (Fig. 3A
and data not shown). However, cells containing two plasmids expressing cdc42-md1 and cdc42-md2 or cdc42-md1
and cdc42-md12 but not cdc42-md2 and
cdc42-md12 grew at wild-type rates and did not display
morphological abnormalities (Fig. 3B and C and data not shown). This
suggests that cdc42-md2 and cdc42-md12 share
similar defects in vegetative growth while cdc42-md1 has a
distinct defect: in cells containing both cdc42-md1 and
cdc42-md2, or cdc42-md1 and
cdc42-md12, all vegetative functions are provided by one of
the alleles and cells grow normally. This finding of intragenic
complementation for the vegetative-growth defects is in contrast to the
lack of such complementation for the pheromone signaling defect (Fig.
3B), suggesting that the pheromone signaling defect is distinct from the vegetative-growth defects and cannot be explained as an indirect result of such defects.
Epistasis analysis of the cdc42-md mutants.
To
determine where in the pheromone response pathway Cdc42p plays a role,
we examined whether the cdc42-md mutants could block signaling that was initiated at various steps in the pathway. Induction
of a FUS1-LacZ reporter construct was used as a readout of
pathway activation. Like signaling induced by
-factor, the signals
initiated by overexpression of the G
subunit Ste4p, or by a
membrane-targeted Ste5p scaffold protein, were substantially blocked by
cdc42-md mutants (Fig. 4). In
contrast, signals initiated by the activated MEKK gene allele
STE11-4 or by overexpression of the transcription factor
Ste12p were unaffected by cdc42-md mutants (Fig. 4). This
suggests that Cdc42p is required after Ste5p membrane recruitment for
the activation of Ste11p. Previous studies have shown that this is
precisely the step at which Ste20p is required (40).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Epistatis analysis of cdc42-md mutants.
Strain PPY911 (cdc42-1) was transformed with pRS314
(vector), pMOSB45 (wild type [WT]), pMOSB42 (md1), pMOSB43
(md2), pMOSB44 (md12), or pMOSB47
(V36A), as indicated. Each of these strains was then
transformed with the mating-pathway-activating plasmids pL19
(GAL1p-STE4 [GAL::STE4]),
pL-GS5 N-CTM (GAL1p-STE5 N-CTM
[GAL::STE5 N-CTM]), pG11-4
(GAL1p-STE11-4 [GAL1::STE11-4]), or
pNC252 (2µm GAL1p-STE12 [2µm
GAL1::STE12]) as indicated on the right.
Transformants grown at restrictive temperature to inactivate
cdc42-1 were induced with 2% galactose (or 2% galactose
plus 0.01 µM -factor; top). The bars indicate the means ± standard deviation for four to six independent transformants. Results
similar to those shown with STE5 N-CTM were also seen with
STE5-CTM, and results similar to those shown with
GAL1p-STE11-4 were also seen with GAL1p-STE11 N
(data not shown).
|
|
Sequence analysis of cdc42 mutants.
To determine
the natures of the mutations that rendered CDC42 signaling
defective, we recovered the mutant plasmids from yeast and sequenced
the open reading frame of each mutant. As shown in Fig.
5A, all three mutants contained
single-amino-acid changes in the "effector" domain of Cdc24p: a
valine-to-alanine substitution at residue 36 in cdc42-md1
and a tyrosine-to-cysteine substitution at position 40 in both
cdc42-md2 and cdc42-md12. In addition, cdc42-md1 contained substitutions at residues 149 and 177, and cdc42-md12 contained a valine-to-alanine substitution at
residue 77 (Fig. 5A). Because the Y40C substitution was the only change in cdc42-md2, we assume that the
-factor resistance of
cdc42-md12 also derives from this same change. Presumably
the V77A mutation confers the somewhat-improved growth properties
observed in cdc42-md12 compared to those of
cdc42-md2. In a recent study,
cdc42Y40C was reported to be nonviable
(18). The discrepancy appears to be due to the fact that in
our case the mutant is expressed from a low-copy-number (CEN ARS)
plasmid while in that study it was integrated into the genome. To
determine which changes were responsible for the
-factor resistance
of the cdc42-md1 mutant, we constructed a mutant that
contained only the V36A substitution. This mutant also conferred an
-factor-resistant phenotype (although not as strong as that
conferred by cdc42-md1 [Fig. 4 and 5B]). We conclude that
a mutation at either V36 (to A) or Y40 (to C) in the effector domain of
Cdc42p renders the protein signaling defective.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 5.
Defective interaction of cdc42-md mutants
with Ste20p. (A) Altered residues in cdc42-md mutants. (B)
The V36A substitution confers -factor resistance. Growth arrest
assays of strain DLY3067 (GAL1p-CDC42) containing plasmid
pMOSB55 (CDC42), pMOSB36 (cdc42-md1), or pMOSB177
(cdc42-V36A) were performed. The photographs show growth
after 3 days at 30°C with (+) or without ( ) -factor. (C) Binding
of cdc42 mutants to the Ste20p CRIB domain. The binding
conditions were as described in Materials and Methods. The top row
shows the amount of the indicated myc-tagged Cdc42p mutant that bound
to immobilized GST-CRIB, the second row shows the amount of each Cdc42p
mutant that bound to immobilized GST (to control for nonspecific
adsorption), and the third row shows the amount of each Cdc42p mutant
added to the binding reaction. India ink staining of the blots
confirmed that equal amounts of GST or GST-CRIB were present in each
lane. Similar results were obtained in four independent experiments.
Recombinant Cdc42p was generated from pDLB1234 (D57Y, mimicking
GDP-bound Cdc42p), pDLB1235 (Q61L, mimicking GTP-bound Cdc42p),
pDLB1240 (V36A and Q61L), or pDLB1242 (Y40C and Q61L).
|
|
Defective interaction of Ste20p with cdc42-md
mutants.
The Y40C mutation has been described in human
CDC42 (which is 80% identical to yeast CDC42 and
complements a cdc42 null mutation in yeast
[44]), where it was found to render Cdc42p defective in binding to and activating p21-activated kinase (PAK), a mammalian Ste20p homologue (19). Combined with epistasis analysis
(Fig. 4), this suggested that the cdc42-md mutants might be
defective in binding to Ste20p. Binding of PAK family kinases to Cdc42p is mediated by the CRIB domain in these proteins (8). We
produced the Ste20p CRIB domain as a GST fusion protein in E. coli and purified it using glutathione Sepharose beads. The wild
type or V36A or Y40C mutants of Cdc42p were produced as myc-tagged
proteins in E. coli and tested for binding to the
GST-Ste20p-CRIB beads or to GST beads as a negative control. A Q61L
substitution, which inhibits Cdc42p GTPase activity, was also
engineered into the constructs to ensure that the proteins were GTP
bound (a prerequisite for CRIB domain binding). As shown in Fig. 5C,
the V36A substitution conferred a mild defect in Ste20p binding while
the Y40C substitution conferred a severe defect.
Ste20p shares a redundant essential function with the related
PAK-family kinase Cla4p. The Cdc42p-Ste20p interaction has been reported to be critical for this function (23, 37). We found that cells containing cdc42-md mutants as the only source of
Cdc42p were synthetically lethal with cla4
mutants (but
not with ste20
mutants [Fig.
6]), suggesting that these mutants fail
to interact with Ste20p in vivo as well as in vitro.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Synthetic lethality of cdc42-md mutants with
cla4 but not ste20 mutants. Strains DLY3067
(GAL1p-CDC42; left), MOSY0106 (GAL1p-CDC42
ste20 ; middle), and MOSY0023 (GAL1p-CDC42 cla4 ;
right) were transformed with pMOSB55 (CDC42), pMOSB36
(cdc42-md1), pMOSB37 (cdc42-md2), or pMOSB38
(cdc42-md12), as indicated. Cells were streaked out on
dextrose-containing plates (to repress the genomic
GAL1p-CDC42) lacking uracil (to select for plasmid
maintenance) and incubated at 30°C for 3 days. WT, wild type.
|
|
Defective localization of Ste20p in cdc42-md
mutants.
Ste20p is concentrated at the bud tips of many cells
during vegetative growth, and at the shmoo tips of cells responding to
-factor, in a manner that depends to a large extent on the CRIB domain (23, 37). GFP-Ste20p localization to bud tips was
greatly reduced in all of the cdc42-md mutants (Fig.
7). Even cells containing both
cdc42-md1 and cdc42-md2, which exhibited a
wild-type growth rate and cell morphology, failed to localize
GFP-Ste20p to the bud tip in most cells (see Fig. 11 below). We were
unable to address the question of whether shmoo tip localization was
affected because these cells were resistant to
-factor and did not
make shmoos.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 7.
Ste20p localization in cdc42-md mutants.
Strain PPY911 (cdc42-1) was transformed with pRL116
(GFP-STE20 [GFP-Ste20p]) and then with pMOSB45
(CDC45), pMOSB42 (cdc42-md1), pMOSB43
(cdc42-md2), pMOSB44 (cdc42-md12), or pMOSB47
(cdc42-V36A) as indicated. The cells were grown at 36°C to
inactivate cdc42-1, and the localization of GFP-Ste20p was
examined by fluorescence microscopy of living cells. Representative
fields are shown (top), and the percentage of budded cells displaying
GFP-Ste20p concentrated at the bud tips is quantitated (bottom left).
The same set of plasmids was transformed into DLY3067
(GAL1p-CDC42), and the cells were grown on dextrose (to
repress GAL1p-CDC42) and analyzed as above (bottom right).
Several images were captured for each transformant, and all cells
within those images were scored for whether GFP-Ste20 was detectably
concentrated at the bud tip. n = 80 to 138 (PPY911
transformants) or n = 55 to 91 (DLY3067
transformants).
|
|
Suppression of the cdc42-md signaling defect by
overexpression of Ste20p.
If the
-factor resistance phenotype
of the cdc42-md mutants is due to defective interaction with
Ste20p, then overexpression of Ste20p might suppress that phenotype.
Indeed, overexpression of STE20 substantially suppressed the
-factor-resistant growth of cdc42-md mutants (Fig.
8). In contrast, overexpression of the related CLA4 did not suppress the cdc42-md
signaling defect, although it did suppress the growth defect of
cdc42-md2 mutants in the absence of
-factor (Fig. 8).
These findings could be accommodated by at least two models: the
observed suppression may be due to a bypass of the cdc42-md
defects by the overexpressed kinases or to a restoration of a
sufficiently effective interaction between the mutant Cdc42p and the
kinases. In the latter model, the CRIB-binding defect of
cdc42-md2 causes a vegetative growth defect due to impaired interaction with Cla4p and a signaling defect due to impaired interactions with Ste20p.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 8.
Overexpression of STE20 suppresses the
cdc42-md signaling defect. Strain DLY3067
(GAL1p-CDC42) was transformed with pMOSB45 (wild type
[WT]), pMOSB42 (md1), pMOSB43 (md2), or pMOSB44
(md12), and each strain was then transformed with pRS426
(vector), pVTU-Ste20 (STE20), or pDLB722 (CLA4).
The photographs show growth after 3 days at 23°C with (+) or without
( ) -factor.
|
|
Restoration of pheromone signaling in cdc42-md mutants
by the ste20
CRIB allele.
The findings presented
above are consistent with the simple hypothesis that the Cdc42p-Ste20p
interaction is a critical step in the
-factor signaling pathway: the
cdc42-md mutants are defective for this interaction in vitro
and in vivo, epistasis analysis suggests that Cdc42p acts at the same
level of the pathway as Ste20p, and overexpression of Ste20p suppresses
that the cdc42-md signaling defect. Nevertheless, the
hypothesis that the Cdc42p-Ste20p interaction is important for
signaling is contradicted by previous studies showing that a
ste20 mutant lacking the CRIB domain (and therefore
defective in Cdc42p interaction) did not affect signaling (23,
37). A possible resolution of this apparent paradox is suggested
by recent evidence that the CRIB domain in PAK family kinases is part
of an autoinhibitory domain, leading to a model in which Cdc42p (or
Rac) proteins activate PAK family kinases by "relief of
autoinhibition" (3, 49, 52, 54). For example, in the Pak1
kinase of Schizosaccharomyces pombe, a region overlapping the CRIB domain of Pak1 binds intramolecularly to the catalytic domain,
yielding a "closed" conformation that can be "opened" either by
binding to Cdc42p or by mutations in the CRIB domain (49).
By analogy, the ste20
CRIB mutant may be competent for signal transduction because it no longer requires a normally critical interaction with Cdc42p for its activation. This hypothesis predicts that the ste20
CRIB mutant should bypass the requirement
for Cdc42p in signaling, rendering cdc42-md strains
sensitive to pheromone. Indeed, we found that ste20
CRIB
restored significant
-factor signaling to the cdc42-md
mutants, as assayed by growth inhibition (Fig.
9A) or FUS1 induction (Fig.
9B). This suggests that the ste20
CRIB allele
encodes an activated form of Ste20p and supports the hypothesis that
the Cdc42p-Ste20p interaction is normally important for pheromone
signaling. We noticed, however, that ste20
CRIB did not
completely restore
-factor sensitivity to cdc42-md
mutants. This suggests that cdc42-md mutants have some
defect in addition to the Ste20p activation defect.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 9.
ste20 CRIB largely restores -factor
sensitivity to cdc42-md strains. (A) Growth arrest. Strains
DLY3067 (GAL1p-CDC42 STE20) and MOSY0268 (GAL1p-CDC42
ste20 CRIB) were transformed with pMOSB55 (wild type [WT]),
pMOSB36 (md1), pMOSB37 (md2), or pMOSB38
(md12), as indicated. The photographs show growth after 3 days at 23°C with (+) or without ( ) -factor. (B)
FUS1-lacZ induction. The same strains as in panel A harbored
the FUS1-lacZ plasmid pSB231 plus either pMOSB45 (WT) or
pMOSB42 (md1) and were assayed in glucose medium after 90 min with (+) or without ( ) 0.01 µM -factor. The bars indicate
the means ± standard deviations of four transformants.
|
|
Contribution of Bem1p to Cdc42p- and Ste20-dependent
signaling.
The BEM1 gene was discovered through its key
role in polarity establishment (5, 9, 38). Subsequent
studies showed that Bem1p can also modulate the pheromone response
pathway, as Bem1p overexpression increases signaling while Bem1p
removal decreases signaling (17, 29). Because the role of
Bem1p in polarity establishment involves Cdc42p and Cdc24p (5,
38), we speculated that its role in pheromone-responsive
signaling may also involve Cdc42p and therefore that the residual
signaling defect observed in cdc42-md ste20
CRIB mutants
might reflect reduced Bem1p function resulting from the
cdc42-md mutations. Consistent with this hypothesis, we
found that like cdc42-md ste20
CRIB mutants, bem1
ste20
CRIB mutants also displayed partial
-factor resistance
(Fig. 10A) and reduced
FUS1 induction (Fig. 10B) compared to
ste20
CRIB single mutants. The signaling defect in
bem1
ste20
CRIB mutants was also evident when
the pathway was activated by membrane-targeted Ste5p but not when it
was activated by the activated Ste11p derivative Ste11
N (Fig. 10C).
This indicates that like Cdc42p, Bem1p acts downstream of Ste5p
membrane recruitment to promote activation of Ste11p by Ste20p.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 10.
BEM1 is important for signaling in
ste20 CRIB mutant strains. (A) Growth arrest. The
photographs show growth after 2 days at 30°C with (+) and without
( ) -factor. (B) FUS1p-lacZ induction by -factor.
Strains harboring a FUS1p-lacZ reporter plasmid (p3058) were
treated with and without 0.1 µM -factor in duplicate for 1 and
2 h with similar results; the data were expressed as percent mean
induced -galactosidase activity in the wild-type (WT) strain (427 U
at 1 h; 835 U at 2 h) and combined, with each bar
representing the mean ± standard deviation (SD) of four
measurements. (C) FUS1p-lacZ induction by Ste5 N-CTM or
Ste11 N was assayed in strains harboring p3058 and either
pGFP-GS5 N-CTM or pGS11 N-T after 4 h of induction with
galactose; the bars indicate the means ± SD of four to six
transformants, expressed as percent mean induced -galactosidase
activity in the WT strain (1,024 U for Ste5 N-CTM; 644 U for
Ste11 N). (D) FUS1p-lacZ induction in strains harboring
p3058 and either pGFP-GS5 N-CTM (Ste5 N-CTM) or pGFP-GS5 N-Sec22
(Ste5 N-Sec22) was assayed after 4 h of induction with
galactose; the bars indicate the means ± SD of eight
transformants. The strains in all panels were DLY1 (WT), MOSY0252
(ste20 CRIB), JMY1128 (bem1 ), and MOSY0270
(bem1 ste20 CRIB).
|
|
We also compared the effects of bem1
and
ste20
CRIB mutations on signaling by Ste5p that was
targeted to different subcellular locations (Fig. 10D). Remarkably,
while Ste20p
CRIB was mildly defective at activating Ste5p that
was targeted to the plasma membrane (Ste5
N-CTM), it showed increased
ability to activate Ste5p that was targeted primarily to internal
membranes (Ste5
N-Sec22 [40]). Consequently, in
ste20
CRIB cells, the four- to fivefold signaling
advantage of plasma membrane-targeted Ste5p over
internal-membrane-targeted Ste5p was eliminated. These results support
the notion that Ste20p
CRIB is an active but delocalized kinase. Loss
of Bem1p did not mimic the effect of ste20
CRIB; instead,
bem1
reduced the ability of Ste20p
CRIB to support
signaling by Ste5
N-Sec22 and Ste5
N-CTM to similar extents,
indicating that Bem1p can affect Ste20p- and Ste5p-dependent signaling
even when both components are mislocalized.
If a part of the signaling defect of cdc42-md mutants is due
to defective Bem1p function, as argued above, then Bem1p overexpression might be expected to improve signaling in cdc42-md cells.
Indeed, we found that a high-copy-number BEM1 plasmid
substantially improved signaling in response to membrane-targeted Ste5p
in cdc42-md1 and cdc42-md2 mutant strains (Fig.
11). Bem1p overexpression also suppressed the growth and morphology defects of cdc42-md
mutants (data not shown). However, this cannot account for the improved signaling because a high-copy-number CLA4 plasmid (which
also suppressed the growth and morphology defects) or introduction of
both cdc42-md1 and cdc42-md2 (leading to
complementation of the growth and morphology defects) failed to
suppress the signaling defect (Fig. 11). Strikingly, Bem1p
overexpression (but not Cla4p overexpression or cdc42-md
combinations) also suppressed the Ste20p localization defect in
cdc42-md mutants (Fig. 11). This result is consistent with
previous studies indicating that Bem1p interacts with Ste20p
(24) and strongly suggests that Bem1p is acting to promote
signaling at the level of Ste20p, consistent with our epistasis results
above. When combined, the introduction of Ste20p
CRIB (to bypass the
Ste20p activation defect) and excess Bem1p (to bypass a possible Bem1p
defect) into the cdc42-md1 mutant completely suppressed its
-factor resistance phenotype (Fig.
12). Together, these data suggest that
the signaling defect of cdc42-md mutants can be accounted
for by their simultaneous failures to activate Ste20p and to promote
Bem1p function.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 11.
Overproduction of BEM1 restores Ste20p
localization and signaling competence to cdc42-md strains.
Strain PPY911 (cdc42-1) containing pL-GS5 N-CTM (for
FUS1 induction) or pPP828 (for Ste20p localization) was
transformed with the CDC42 plasmids pMOSB45 (wild type
[WT]), pMOSB42 (md1), or pMOSB43 (md2) and then
with YEp24 (vector), pMOSB36 (md1), pMOSB37
(md2), pPB321 (2µm BEM1), or pDLB722 (2µm
CLA4) as indicated. FUS1-lacZ induction was
measured as for Fig. 4; the bars indicate means ± SD of six
independent transformants. GFP-Ste20p localization was quantitated as
for Fig. 7 (200 cells counted), and representative cells are shown
below.
|
|

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 12.
Bem1p and Ste20p CRIB cooperate to restore -factor
sensitivity to a cdc42-md1 strain. Strains DLY3067
(GAL1p-CDC42 STE20) and MOSY0268 (GAL1p-CDC42
ste20 CRIB) were transformed with pMOSB42 (cdc42-md1)
and either pRS426 (vector) or pPB321 (2µm BEM1), as
indicated. The photographs show growth after 3 days at 30°C with (+)
and without ( ) -factor.
|
|
 |
DISCUSSION |
A role for Cdc42p in signal transduction in response to
-factor.
We have isolated cdc42 mutants that display
recessive defects in
-factor signaling while retaining the ability
to proliferate. All of these cdc42-md mutants had
morphogenesis defects in addition to their signaling defect. However,
the signaling defect is unlikely to be an indirect result of the
morphogenesis defects for the following reasons. First, overexpression
of CLA4 suppressed the morphogenesis defects of
cdc42-md mutants but not the signaling defect. Second, two
pairwise combinations of cdc42-md alleles displayed
intragenic complementation for their morphogenesis defects but not for
their signaling defects. Third, a synchronous
early-G1-phase population of cdc42-md1 mutant
cells isolated by centrifugal elutriation displayed a signaling defect
even during G1 phase, a time when cells are uniformly
sensitive to
-factor and Cdc42p-dependent polarity has yet to be
established. It is difficult to see how a signaling defect in this
synchronous culture could arise due to any indirect cell cycle or
morphogenesis problems. In summary, these results strongly suggest that
Cdc42p plays a role in
-factor-induced signaling that is separate
from its roles in morphogenesis, confirming the suggestions from
earlier studies with temperature-sensitive cdc42 mutants
(46, 47, 53).
The conclusion that Cdc42p is important for
-factor signaling is at
odds with a study that found no signaling defect in
G1-arrested temperature-sensitive cdc42 or
cdc24 mutants (35). In that study, cells arrested
in G1 by deprivation of G1 cyclins were
subsequently shifted to the restrictive temperature for the
cdc42 or cdc24 mutants and then exposed to
relatively high doses of
-factor. Under these conditions, induction
of FUS1 transcription was unaffected by the cdc42
or cdc24 mutations, suggesting that Cdc42p is not required
for
-factor signaling and affects signaling indirectly as a result
of cell cycle perturbation (35). However, an earlier study
found Cdc24p and Cdc42p to be required for the maintenance of
G1 arrest in cells that had been prearrested by
-factor
(46), which is not explainable by a model in which the
signaling defects of cdc24 and cdc42 mutants are
due simply to accumulation of cells at a nonresponsible stage of the
cell cycle.
While our observations support a role for Cdc42p in
pheromone-responsive signal transduction, they do not suggest that
Cdc42p is a pathway intermediate that gets activated in response to
pheromone. Instead, our work is consistent with the view
(40) that Cdc42p plays a permissive role in maintaining
cellular competence for signaling. For instance, Cdc42p may be
constitutively required for the establishment of relatively long-lived
pre-signaling complexes containing active Ste20p (see below).
Transmission of the pheromone signal could then utilize this
preactivated pool of Ste20p without any further immediate involvement
of Cdc42p. In this hypothesis, the cdc42-md mutants have a
signaling defect because they fail to establish this competent pool of
Ste20p, while the temperature-sensitive cdc42-1 inactivation
regimen used by Oehlen and Cross (35) did not result in a
signaling defect because sufficient Ste20p activation was established
prior to the temperature shift to allow subsequent signaling. Notable
in this regard is evidence from human PAK family members that
GTPase-dependent establishment of the open conformation allows for PAK
autophosphorylation, which subsequently interferes with regeneration of
the closed conformation and thus makes the kinase temporarily GTPase
independent (30, 52).
Ste20p is a key Cdc42p target involved in pheromone signaling.
By several criteria, the cdc42-md mutants are defective in
interacting with Ste20p: they are defective (to varying extents) in
binding to the Ste20p CRIB domain in vitro, they fail to localize Ste20p to bud tips in vivo, and they display synthetic lethality with
cla4 mutants. Furthermore, epistasis analysis suggests that cdc42-md mutants are defective in signal transduction at the
same step in the pathway as ste20 mutants (i.e, the
activation of Ste11p following membrane targeting of Ste5p). Finally,
the signaling defect of cdc42-md mutants is largely
suppressed by overproduction of Ste20p. These data strongly support the
hypothesis that the Cdc42p-Ste20p interaction is important for
efficient signaling in the pheromone response pathway, as originally
proposed (46, 53). However, more recent studies have argued
that the Cdc42p-Ste20p interaction is dispensable for pheromone
response, based on the signaling competence of a version of Ste20p
(Ste20p
CRIB) that cannot bind to Cdc42p. We found that Ste20p
CRIB
largely restored signaling competence to strains containing the
cdc42-md mutants. This observation suggests that
Ste20p
CRIB is an activated version of Ste20p that no longer requires
interaction with Cdc42p for its activation, consistent with current
models for PAK activation which involve a relief of autoinhibition
mechanism (3, 49, 54). We therefore conclude that
interaction of Cdc42p with Ste20p is normally required for Ste20p to
participate in the pheromone response pathway. Importantly, however, we
do not find it necessary to propose that pheromone regulates either GTP
loading of Cdc42p, the Cdc42p-Ste20p interaction, or Ste20p kinase
activity. Instead, the simplest model consistent with available data is
that access of Ste20p to its substrates is the pheromone-regulated
step, with the effect of Cdc42p on Ste20p kinase activity being a
preexisting condition that is independent of pheromone exposure (see
reference 40 for further discussion).
Cdc42p may play a second role together with Bem1p in pheromone
signaling.
Although Ste20p appears to be the major Cdc42p target
for signal transduction, our results suggest the existence of a second role for Cdc42p in this process, because cdc42-md mutants
displayed a residual signaling defect even in the presence of the
activated ste20
CRIB allele. Given the strong links
between Cdc42p and the SH3-domain-containing scaffold protein Bem1p
that have been established through studies of cell polarity in yeast
(5, 9, 38), we suspected that this second role might involve
Bem1p (which has also been shown to modulate the strength of
-factor
signaling [17, 29]). Consistent with this hypothesis,
Bem1p overexpression partially suppressed the signaling defect of
cdc42-md mutants and Bem1p overexpression together with
ste20
CRIB could fully suppress the
-factor-resistant
growth of cdc42-md mutants.
Our observations suggest that the cdc42-md mutants are
defective in activation of the Ste11p-Ste7p-Fus3p MAPK cascade. This step involves the interaction of G
with the Ste5p scaffold
protein (associated with Ste11p, Ste7p, and Fus3p), resulting in
recruitment of Ste5p to the plasma membrane (40) and also
the interaction of G
with Ste20p (25). These
interactions likely serve to raise the local concentrations of Ste20p
and its substrate Ste11p (bound to Ste5p), thereby initiating MAPK
cascade activity. The previously described effects of Bem1p on
pheromone signaling (20, 29) are compatible with its acting
anywhere in the pathway from receptor to the MAPK Fus3p. Our
experiments indicate that Bem1p affects steps following Ste5p membrane
recruitment, since both loss and overproduction of Bem1p affects
signaling by membrane-targeted Ste5p, even in cells with the activated
ste20
CRIB allele. In contrast, signaling by the activated
Ste11p derivative Ste11
N was comparatively insensitive to the loss
of Bem1p. We also observed that Bem1p can affect the localization of
Ste20p, and previous studies showed that Bem1p could form complexes
with both Ste20p and Ste5p (24, 29). Together, these results
suggest that Bem1p influences activation of the Ste5p-associated kinase
cascade by Ste20p, perhaps by helping to bring these proteins together.
It should be noted that earlier work observed effects of Bem1p
overproduction on the residual pheromone response of
ste20
cells (20, 29); the mechanism for this
residual response has not been determined, but it may rely on
inefficient substitution for Ste20p by another PAK family kinase (e.g.,
Cla4p), which would be compatible with our suggestion that Bem1p
affects the step in which Ste11p is activated by the Ste20p (or
substitute) kinase.
The