Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7559-7571, Vol. 20, No. 20
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Role of Cdc42p in Pheromone-Stimulated Signal
Transduction in Saccharomyces cerevisiae
John J.
Moskow,1
Amy S.
Gladfelter,1
Rachel E.
Lamson,2
Peter M.
Pryciak,2 and
Daniel
J.
Lew1,*
Department of Pharmacology and Cancer
Biology, Duke University Medical Center, Durham, North Carolina
27710,1 and Department of Molecular
Genetics and Microbiology, University of Massachusetts Medical
School, Worcester, Massachusetts 016052
Received 13 March 2000/Returned for modification 24 April
2000/Accepted 21 July 2000
 |
ABSTRACT |
CDC42 encodes a highly conserved GTPase of the Rho
family that is best known for its role in regulating cell polarity and actin organization. In addition, various studies of both yeast and
mammalian cells have suggested that Cdc42p, through its interaction with p21-activated kinases (PAKs), plays a role in signaling pathways that regulate target gene transcription. However, recent studies of the
yeast pheromone response pathway suggested that prior results with
temperature-sensitive cdc42 mutants were misleading and
that Cdc42p and the Cdc42p-PAK interaction are not involved in
signaling. To clarify this issue, we have identified and characterized
novel viable pheromone-resistant cdc42 alleles that retain
the ability to perform polarity-related functions. Mutation of the
Cdc42p residue Val36 or Tyr40 caused defects in pheromone signaling and in the localization of the Ste20p PAK in vivo and affected binding to
the Ste20p Cdc42p-Rac interactive binding (CRIB) domain in vitro.
Epistasis analysis suggested that they affect the signaling step at
which Ste20p acts, and overproduction of Ste20p rescued the defect.
These results suggest that Cdc42p is in fact required for pheromone
response and that interaction with the PAK Ste20p is critical for that
role. Furthermore, the ste20
CRIB allele, previously used to disrupt the Cdc42p-Ste20p interaction, behaved as an
activated allele, largely bypassing the signaling defect of the
cdc42 mutants. Additional observations lead us to suggest that Cdc42p collaborates with the SH3-domain protein Bem1p to facilitate signal transduction, possibly by providing a cell surface scaffold that aids in the local concentration of signaling kinases, thus promoting activation of a mitogen-activated protein kinase cascade
by Ste20p.
 |
INTRODUCTION |
In the budding yeast
Saccharomyces cerevisiae, cells of the a and
mating types secrete pheromones that bind to G-protein-coupled receptors on the surfaces of cells of the opposite mating type, initiating a signaling cascade in which the 
subunits of the G
protein promote the activation of a mitogen-activated protein kinase
(MAPK) cascade (4). This process appears to involve the
binding of at least two proteins, the upstream kinase Ste20p and the
scaffold protein Ste5p, to the liberated G
subunits (11, 25,
40, 51). MAPK activation then promotes cell cycle arrest in
G1 and stimulates the expression of several genes,
including FUS1, leading ultimately to fusion of the mating
partners (22).
The small GTPase Cdc42p and its guanine nucleotide exchange factor
Cdc24p are essential for polarity establishment and subsequent bud
formation (1, 38). In addition to their roles in cell polarity, these proteins have been proposed to play roles in signal transduction in response to mating pheromones (46, 47, 53). Temperature-sensitive cdc42 and cdc24 mutants
have defects in
-factor-stimulated transcription of FUS1
and in maintaining G1 arrest at the restrictive temperature
(46, 53). In addition, an interaction was detected by
two-hybrid analysis between G
and Cdc24p (53), and
Cdc42p-GTP was shown to bind to and activate Ste20p (46).
These findings led to the hypothesis that G
activated Cdc24p,
causing GTP loading of Cdc42p and consequent activation of Ste20p, as
an important part of the pheromone signaling pathway.
More recent experiments have cast doubt upon the existence of a
G
-Cdc24p-Cdc42p-Ste20p pathway. Mutations in CDC24
that abolished detectable interaction with G
did not cause any
defects in
-factor-stimulated FUS1 transcription or
G1 arrest but rather were specifically defective in
orientation of the mating projection towards the mating partner
(33). Furthermore, mutations in STE20 that
abolished detectable interaction with Cdc42p were also reported to be
wild type with regard to
-factor-stimulated FUS1
transcription, G1 arrest, and mating (23, 37).
Together, these studies indicated that neither the G
-Cdc24p
interaction nor the Cdc42p-Ste20p interaction was important for
-factor signaling. Furthermore, the polarity defect exhibited by
temperature-sensitive cdc24 and cdc42 mutants
triggers the morphogenesis checkpoint to delay the cells in
G2 with abundant G1 cyclins (26), a
state known to render cells unresponsive to
-factor (34).
This raised the possibility that the signaling defect of these mutants
might be an indirect consequence of their accumulation at a
nonresponding stage of the cell cycle. Indeed, the transcriptional
induction of FUS1 was found to be quite normal in
cdc24 and cdc42 mutants that were first arrested
in G1 by deprivation of G1 cyclins
(35), raising the question of whether Cdc24p and Cdc42p play
any role at all in
-factor signaling.
As illustrated by these studies, the interpretation of cdc42
and cdc24 phenotypes is complicated by the possibility of
indirect effects stemming from the well-characterized polarity defects caused by these mutants at the restrictive temperature. To circumvent these problems, we performed a screen to identify
-factor-resistant alleles of CDC42 that could still perform polarization
functions. In this paper we report the isolation and characterization
of such mutants, supporting the notion that Cdc42p has some direct role
in pheromone signaling. Our results further suggest that this signaling
function operates through Cdc42p-dependent activation and localization
of Ste20p.
 |
MATERIALS AND METHODS |
Yeast media and cell synchrony.
Yeast media (YEPD rich
medium, synthetic complete medium lacking specific nutrients, and
sporulation medium) have been described previously (13).
YEPG and YEPS are the same as YEPD but with 2% galactose or sucrose
instead of dextrose. Centrifugal elutriation to isolate
early-G1-phase cells was performed as described previously (27).
Strains, plasmids, and PCR manipulations.
Standard media and
methods were used for plasmid manipulations (2) and yeast
genetic manipulations (13). The S. cerevisiae strains used in this study are listed in Table
1, and the plasmids used are listed in
Table 2.
To generate the
GAL1p-CDC42 allele, the oligonucleotides
DJL42-1
(5'-
GC CGGAACTCAAAAGGGTAATTTCGTGAAAAACAATCATCGACTACGT CGTAAGGCCG-3'
and DJL42-2 (5'-TCAGTAGAAGGATATGACAAGG G-3') were used
to amplify
a DNA fragment containing the
LEU2 gene, the
GAL1 promoter, and
flanking
CDC42 sequences using
PCR with the plasmid pGAL-CDC42Sc
(
55) as a template (the
underlined sequence in DJL42-1 is the
genomic sequence 733 to 693 bp
upstream of the
CDC42 start codon,
whereas in DJL42-2 it is
the reverse complement of nucleotides
204 to 226 in the
CDC42 open reading frame). The PCR fragment
was transformed
into DLY1, replacing the endogenous
CDC42 promoter
(1 to 693 bp upstream of the start codon) with
LEU2 and the
GAL1 promoter, creating DLY3067. Leu
+
transformants were selected on galactose-containing plates, and
promoter replacement was confirmed by the inability to grow on
dextrose-containing plates (
GAL1 promoter off) and by
PCR.
To generate the
cdc42::
URA3 null
allele, the oligonucleotides CDC42-5'
(5'-CTATTTTCCTGAGGAGATAGGTTAACAAACGAATTAGAGAAGGCGCGTTTCGGTGATGAC-3')
and CDC42-3'
(5'-GAGGCTCCAAGGCGGCCACGATAGCTTCATCGAATACATTCTTTCCTGATGCGGTATTTTC-3')
were used to amplify the
URA3 gene using PCR
with the plasmid
pRS306 (
45) as a template. The PCR product
was transformed directly
into a yeast strain containing an additional
copy of
CDC42 under
the control of the
GAL1
promoter (in this case, integrated at
LEU2 using pDLB377, a
YIp derivative of pGAL-
CDC42Sc [
55]
generated
by replacing the
ClaI fragment containing pRS315
vector sequences
with the corresponding fragment from pRS305
[
45]). Ura
+ transformants were selected on
galactose-containing plates to
replace the endogenous copy of
CDC42 (from 45 bp upstream to 494
bp downstream of the start
codon, removing all but the last 26
codons) with
URA3,
generating strain MOSY0090. Transformants were
tested for the inability
to grow on dextrose-containing plates
(
GAL1 promoter off),
and gene replacement was confirmed by
PCR.
cdc42-md1 was integrated into the endogenous
CDC42 locus by one-step replacement of the
cdc42::URA3 allele. A 1.2-kb
EcoRI
fragment containing
cdc42-md1 was excised from pMOSB36 and
transformed
into MOSY0090 together with the
TRP1-marked
plasmid, pRS314 (
45).
Trp
+ transformants were
selected on galactose-containing plates and
then selected for the
ability to grow on dextrose-containing plates
(
GAL1 promoter
off) containing 5-fluoroorotic acid (to kill
URA3 cells
[
7]), and gene replacement was confirmed by PCR.
cdc42-md1 was then back-crossed to separate it from the
leu2::GAL1p-CDC42::LEU2 present in MOSY0090, generating
MOSY0178.
To create pDLB643, the template for PCR mutagenesis of
CDC42, the
CDC42 promoter and coding sequences
were fused to the transcription
terminator sequences from
TDH3. The oligonucleotides DJL42-3
(5'-CCACCGTCGATTCAAGGGTC-3')
and DJL42-4
(5'-AGATCTCTGAGCAAAGCG-3') were first used to amplify
CDC42 (from 366 bp upstream of the start codon to 30 bp
downstream
of the stop codon) using the plasmid YEp351-CDC42
(
55) as a
template, and this fragment was cloned into pCR2.1
(Invitrogen,
Carlsbad, Calif.) to make pCR42-3/4. The
TDH3
transcription terminator
sequences (a 900-bp
BamHI/
BglII fragment from pAB23BX
[
43])
were then cloned into the
BamHI site
of pCR42-3/4 to make pDLB643.
A 2-kb
XhoI/
BamHI
fragment from pDLB643 was also cloned into the
corresponding sites of
pRS316 (
45) to make
pMOSB55.
To create pDLB644, the recipient plasmid for expressing the mutant
alleles of
CDC42,
CDC42 promoter sequences were
fused (via
a unique
BglII site) to the transcription
terminator sequences
from
TDH3 and cloned into the vector
pRS316 (
45). The oligonucleotides
DJL42-3 (see above) and
DJL42-5 (5'-
AGATCTGGAAGACCTAATACG-3';
the
BglII site is underlined) were used to amplify a DNA
fragment
containing the
CDC42 promoter (1 to 366 bp upstream
of the start
codon) using the plasmid YEp351-CDC42 (
55) as a
template, and
this fragment was cloned into pCR2.1 (Invitrogen) to make
pCR42-3/5.
The
TDH3 transcription terminator sequences were
then cloned into
the
BamHI site of pCR42-3/5 to create
pDLB642. The 1.2-kb
XhoI/
BamHI
fragment from
pDLB642 was then cloned into the corresponding sites
of pRS316
(
45) to make pDLB644. pDLB644 was linearized by digestion
with
BglII and transformed into yeast cells together with
the
mutagenized
CDC42 PCR products which underwent gap
repair to yield
Ura
+ colonies.
The
cdc42-V36A,
cdc42-Y40C, and
cdc42-D57Y alleles were constructed using the ExSite
PCR-based site-directed mutagenesis kit
(Stratagene, La Jolla, Calif.).
To generate pMOSB16 (
cdc42-V36A),
PCR was performed using
the oligonucleotides cdc-4 (5'-ACAGCGTTCGATAACTATGCGG-3')
and cdc-11 (5'-TGGAACATAGT
CAGCTGGAAATTGATTCG-3')
with pDLB643
as a template. cdc-11 has a silent mutation which
introduces a
PvuII site (underlined). To generate pMOSB53
(
cdc42-Y40C), PCR
was performed using the oligonucleotides
cdc-22 (5'-ACAGTGTTCGATAACTGTGCGGTGACTGTGATG-3')
and cdc-11
with pDLB643 as a template. To generate pMOSB29
(
cdc42-D57Y),
PCR was performed using the oligonucleotides
cdc-18 (5'-TATACGGCCGGTCAAGAAG-3')
and cdc-19
(5'-AAACAAACCTAACGTATATGG-3') with pDLB377 as a template.
The mutants were sequenced to confirm the presence of the desired
mutation and the absence of any other
mutations.
To generate pMOSB176 and pMOSB177, PCR was performed using the
oligonucleotides DJL42-3 (see above) and DJL42-6
(5'-CTACTACAGATATTACATGTGGCG-3')
to amplify
cdc42-Y40C (pMOSB53 template) or
cdc42-V36A
(pMOSB16
template), respectively, and introduced into pDLB644 by gap
repair.
To generate pMOSB175 and pMOSB47, 2.1-kb
BamHI/
XhoI fragments
containing
cdc42
alleles were excised from pMOSB176 and pMOSB177,
respectively, and
cloned into the corresponding sites of pRS314
(
45).
The
cdc42-V36A,
Q61L and
cdc42-Y40C,
Q61L alleles were generated by a
two-step strategy in which we first removed residues 32
to 40 in
CDC42-Q61L and then employed homologous recombination
to
repair that "gap" with sequences from
cdc42-V36A or
cdc42-Y40C.
We first replaced amino acids 32 to 40 in
CDC42-Q61L,
C188S with
a
NotI site,
using the ExSite PCR-based site-directed mutagenesis
kit. PCR was
performed with the oligonucleotides JMCDC42-1
(5'-CCGCGTCGGCTGGAAATTGATTCG-3')
and JMCDC42-2
(5'-CCGCGGTGACTGTGATGATTGG-3') with pEG202-cdc42-Q61L,C188S
(
46) as a template. The resulting allele was then
transferred
to pOBD.CYH using a PCR and gap repair strategy involving
sequential
amplification of the allele with the oligonucleotides
LC20-CDC42
(5'-AATTCCAGCTGACCACCATGCAAACGCTAAAGTGTG-3') and
RC20-CDC42 (5'-GATCCCCGGGAATTGCCATGCTACAAAATTGTAGATTTT-3')
followed by a second PCR using the oligonucleotides
BD70F and
BD70R (
15) containing homology to the first
primers and 70-nucleotide
extensions with homology to pOBD.CYH. The
resulting PCR product
was transformed together with
PvuII/
NcoI-linearized pOBD.CYH into
DLY1 to
generate pOBD.CYH-cdc42-Q61L/C188S(

32-40) by gap repair.
cdc42-V36A and
cdc42-Y40C were then amplified by
PCR using the
oligonucleotides DJL42-3 and cdc-19 (see above) with
pMOSB16 or
pMOSB53 as a template and transformed into DLY1 together
with
NotI-cut pOBD.CYH-cdc42-Q61L/C188S(

32-40) to
generate the gap
repair products pOBD.CYH-cdc42-V36A/Q61L/C188S and
pOBD.CYH-cdc42-Y40C/Q61L/C188S.
Plasmids for the expression of myc-tagged alleles of
CDC42
in bacteria were made using the Univector system (
28).
CDC42 alleles were amplified by PCR using the
oligonucleotides CDC42-UNI1
(5'-GGAATTC
CATATGCAAACGCTAAAGTGTGTTGTTGTC-3';
the
NdeI
site is underlined, and the start codon is in
boldface) and CDC42-UNI2
(5'-CC
GAGCTCCTACAAAATTGTACATTTTTTACTTTTC-3'; the
SacI site is
underlined) with pGAL-CDC42(Q61L)
(
55), pMOSB29, pOBD.CYH-cdc42-V36A/Q61L/C188S,
or
pOBD.CYH-cdc42-Y40C/Q61L/C188S as a template.
NdeI/
SacI-digested
PCR fragments were cloned into
the respective sites of pUNI-10
(
28), generating pDLB1034,
-1035, -1160, and -1277. The pUNI-10-CDC42
plasmids were then
recombined with pHB1-MYC3 using the Cre/lox
system (
28) to
produce the bacterial expression plasmids pDLB1234,
-1235, -1240, and
-1242. All constructs were sequenced to confirm
that no changes
occurred as a result of PCR
manipulations.
To construct pG11-4,
STE11-4 was amplified by PCR and
inserted downstream of the
GAL1 promoter in pRD53* as a
BamHI/
XhoI fragment;
pRD53* is a derivative of
pRD53 (
40) in which
URA3 lacks a
PstI
site.
Plasmid pGS11

N-T was constructed by transferring the 3.5-kb
SacI/
XhoI fragment encoding
GAL1p-GST-STE11
N from pRD-STE11-H3
(
32) into
the corresponding sites in pRS314 (
45).
Plasmid pPP828 is a
LEU2-marked derivative of pRL116
(
23) created by homologous recombination in yeast using
pUC4-ura3::LEU2
(
31).
To express the Ste20p Cdc42p-Rac interactive binding (CRIB) domain as a
recombinant glutathione
S-transferase (GST) fusion
protein,
the oligonucleotides ste20-1 (5'-ATGTCATCTTCTATAACCACCGC-3')
and ste20-2 (5'-TGTTTGCAGGCGGTGTTG-3') were used to
amplify a
DNA fragment encoding the Ste20p residues 328 to 428 by PCR
using
yeast genomic DNA as a template. The PCR fragment was cloned into
pCR2.1 using the TA cloning kit (Invitrogen) and then excised
using the
flanking
EcoRI sites and cloned into the
EcoRI
site
of pGEX-KG, generating pGEX-Ste20CRIB. The construct was sequenced
to confirm its orientation and that no PCR-induced mutations had
occurred.
To generate the
ste20
CRIB allele (
23), the
3-kb
SphI/
KpnI fragment from
pRS316-ste20(

334-369) (
23) was cloned into the
corresponding sites of YIplac211 (
12), generating pMOSB134.
pMOSB134 was digested at the unique
XbaI site within
STE20 (upstream
of the deleted CRIB region) and transformed
into DLY3067. Ura
+ transformants containing tandem
STE20-URA3-ste20
CRIB sequences
were selected, and
then "pop-out" events in which
URA3-containing
sequences
between the
STE20 and
ste20
CRIB genes were
excised
by homologous recombination were selected by plating them on
5-fluoroorotic
acid. The colonies were screened by PCR using the
oligonucleotide
ste20-2 (5'-GAGTTTGCAGGCGGTGTTG-3') and
ste20-9 (5'-AACCGTCCAAGCCTGAAG-3')
to determine whether the
excision event left
STE20 (558-bp PCR
product) or
ste20
CRIB (446-bp PCR product) as the sole remaining
allele.
Strains MOSY0023 and MOSY0106 were generated from a cross between
MOSY0095 and BOY774 (
cla4::TRP1) or BOY489
(
ste20::TRP1),
respectively. BOY489 and BOY774
were obtained from F. Cross (
6).
The
bem1::URA3 allele was generated by one-step
gene replacement using an
EcoRI-
BamHI fragment
from the plasmid pKO1 (
9).
Strain PPY911 (
40) contains a
HIS2-marked
FUS1-lacZ reporter integrated at the
FUS1 locus
that was introduced by transformation
of the
cdc42-1 strain
DLY3032 with
SphI-digested pFL-HIS2. pFL-HIS2
contains a
2-kb
HIS2 HindIII fragment in place of the
HinddIII/
HindIII
TRP1 fragment in
pFL-TRPb, which itself contains a 0.9-kb
TRP1 EcoRI/
StuI fragment (along with pBluescript polylinker
sequences
from
EcoRI-
HincII) in place of the
HindIII/
StuI
URA3 fragment
of
pSB286 (
39).
Screen to identify
-factor-resistant cdc24
mutants.
The oligonucleotides DJL42-3 and DJL42-6 (see above) were
used to amplify CDC42 (and TDH3 terminator
sequences) by mutagenic PCR using pDLB643 as a template. Mutagenic PCRs
were similar to standard PCR except for the addition of 0.2 mM
MnCl2 and the use of an unbalanced deoxynucleoside
triphosphate mix (0.5 mM dTTP, 0.5 mM dGTP, 0.1 mM dATP, and 0.1 mM
dCTP [final concentrations]). The PCR products were transformed into
DLY3067 together with BglII-digested ("gapped" plasmid)
pDLB644, and Ura+ transformants were selected on
dextrose-containing plates (to repress transcription of the genomic
GAL1p-CDC42 allele) coated with 10 µg of
-factor (to
select for
-factor-resistant cdc42 mutants). This amount
of
-factor (custom synthesized by Research Genetics, Huntsville,
Ala.) was more than 10 times the amount needed to completely inhibit
growth of the bar1 parent strain.
-Factor-resistant
colonies could in theory arise due to genomic mutations in other genes.
To distinguish cdc42 mutants, colonies were tested for
-factor-resistant growth on galactose-containing plates, where the
genomic (wild-type) CDC42 is expressed. Plasmids were
isolated from colonies that were
-factor resistant when grown in
dextrose-containing medium but not when grown in galactose-containing medium and were then retransformed into fresh DLY3067 to confirm that
the plasmids were responsible for the
-factor-resistant growth
phenotype. To generate the TRP1-containing plasmids pMOSB42 to -45, CDC42 alleles were transferred from URA3
plasmids (pMOSB36 to -38 and pMOSB55) as 2.1-kb
BamHI/XhoI fragments to the corresponding sites
of pRS314 (45).
Spot assays for growth arrest.
Cells harboring plasmid-borne
CDC42 alleles were grown to stationary phase in
dextrose-containing medium (to repress genomic GAL1p-CDC42)
lacking nutrients appropriate to select for plasmid maintenance. The
number of cells was determined using a hemocytometer, and diluted
stocks were generated to spot 2 µl containing ~1,250, ~250,
~50, and ~10 cells onto plates containing the same selective dextrose medium either with or without 10 µg of
-factor per plate. Assuming a plate "volume" of 20 ml, this would translate to ~0.3 µM
-factor.
Northern blot analysis.
RNA extraction, formaldehyde-agarose
gel electrophoresis, capillary transfer, probe hybridization, and wash
procedures were performed as described previously (10, 41,
42). The FUS1 probe was made from a 880-bp internal
EcoRI/NheI fragment from the FUS1
gene, and the ACT1 probe was made from the entire
ACT1 open reading frame, using [
-32P]dCTP
(ICN Pharmaceuticals, Costa Mesa, Calif.) and the Prime-it II kit
(Stratagene) according to the manufacturer's recommendations.
Flow cytometry.
Cells were processed for
fluorescence-activated cell sorter (FACS) analysis as described
(14), except that the DNA was stained with 1 µM Sytox
(Molecular Probes, Eugene, Oreg.) in 50 mM Tris-HCl (pH 8.0) (instead
of propidium iodide).
DIC microscopy.
Cells were viewed on an Axioskop apparatus
(Zeiss, Thornwood, N.Y.) equipped with epifluorescence and differential
interference contrast (DIC) optics. Images were captured by using a
cooled-model charge-coupled device camera (Princeton Instruments,
Princeton, N.J.).
Analysis of FUS1-lacZ expression.
-Galactosidase assays were performed as described previously
(40). Transformants in cdc42-1 strains were grown
overnight at 28°C in selective synthetic medium containing 2%
raffinose and 0.1% dextrose to an optical density at 660 nm of 0.3 to
0.6, preincubated for 2 h at 38.5°C, and then induced for 4 h with 2% galactose with or without 0.01 µM
-factor. Assays in
CDC42 strains were performed at 30°C.
Production of recombinant proteins and binding assays.
Wild-type and mutant myc-tagged CDC42 alleles were expressed
in Escherichia coli BL21(DE3) (Stratagene). Extracts were
prepared in bacterial lysis buffer (750 mM sucrose, 100 mM NaCl,
100 mM Tris-HCl [pH 8.0], 5 mM EDTA) containing the protease
inhibitors aprotinin (7.5 µg/ml; Sigma, St. Louis, Mo.),
pepstatin (5 µg/ml; Sigma), leupeptin (10 µg/ml; Boehringer
Mannheim, Indianapolis, Ind.), and phenylmethylsulfonyl fluoride (0.5 mM; Sigma). The cells were treated with 2 mg of lysozyme/ml for 20 min
on ice. To remove genomic DNA, MgCl2 was added to 15 mM and
DNase I was added to 50 µg/ml. The cells were lysed by 20 min of
incubation at 4°C with 2 mg of deoxycholic acid/ml. Insoluble
material was removed by centrifugation at 4°C for 10 min.
GST-Ste20-CRIB was expressed in the protease-deficient E. coli BL21, extracts were prepared as described above, and the
protein was purified using glutathione Sepharose 4B (Amersham Pharmacia
Biotech, Piscataway, N.J.) as specified by the manufacturer.
Binding assays were performed by incubating the bacterial extracts
containing Cdc42p-myc with either GST or GST-Ste20-CRIB
immobilized on
glutathione beads in 200 µl of binding buffer (10
mM Tris-HCl [pH
7.5], 85 mM NaCl, 6 mM MgCl
2, 10% glycerol) at
4°C for
3 h. Binding reaction mixtures were washed three times
at room
temperature with wash buffer (10 mM Tris-HCl [pH 7.5],
10 mM
MgCl
2, 1 mM dithiothreitol, 0.1% Triton X-100). Bead-bound
proteins were resolved by sodium dodecyl sulfate-polyacrylamide
gel
electrophoresis, blotted to Immobilon-P nylon membranes (Millipore,
Bedford, Mass.), and immunoblotted with monoclonal anti-myc antibodies
(9E10; Santa Cruz Biotechnology, Santa Cruz, Calif.) using standard
procedures (
2). To confirm equal loading, the amount of
GST-Ste20-CRIB
in each lane was visualized by staining the membrane
with India
ink (
42).
Localization of GFP-Ste20p.
Cells containing pRL116 or
pPP828 were propagated for at least 24 h in selective liquid
medium containing 2% dextrose and 0.008% adenine (to inhibit
accumulation of red pigment in ade1 cells) at 30°C
(GAL1p-CDC42 strains) or at 36°C (cdc42-1
strains). The cells were examined without fixation using a Nikon E600
epifluorescence microscope with 100× Plan Fluor and 50× Plan
oil-immersion objectives. Images were collected using a cooled black
and white charge-coupled device camera (DAGE-MTI).
 |
RESULTS |
Identification of recessive
-factor-resistant alleles of
CDC42.
A hypothetical cdc42 mutant specifically
defective in pheromone signal transduction should retain all functions
necessary for cell polarity and proliferation but would fail to arrest
in G1 upon exposure to
-factor. Thus, cells expressing
such an allele as the sole source of Cdc42p should proliferate and form
colonies on plates containing a growth-inhibitory dose of
-factor.
We employed an error-prone PCR mutagenesis strategy to generate random mutations in CDC42 and recombined the resulting alleles into
a low-copy-number plasmid in cells whose endogenous CDC42
was transcriptionally repressed (using the regulatable GAL1
promoter; see Materials and Methods for details). Transformants that
promoted proliferation on
-factor-containing plates were selected.
Plasmids containing putative CDC42 mutants were isolated
from the rare
-factor-resistant colonies and retransformed into the
starting strain to confirm that the
-factor resistance was due to
the plasmid and not to a fortuitous genomic mutation. Three
independently derived mutants (cdc42-md1,
cdc42-md2, and cdc42-md12 [md for
mating pathway defective]) were selected for further characterization
(Fig. 1).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
Isolation of -factor-resistant cdc42
alleles. The results of growth arrest assays of strain DLY3067
(GAL1p-CDC42) containing plasmid pMOSB55 (CDC42),
pMOSB36 (cdc42-md1), pMOSB37 (cdc42-md2), or
pMOSB38 (cdc42-md12) are shown. The photographs show growth
after 3 days at 30°C with (+) or without ( ) -factor.
|
|
In addition to promoting growth on

-factor-containing plates (Fig.
1), strains bearing the
cdc42-md alleles were significantly,
though not completely, defective in

-factor-induced
FUS1
transcription
(see below) and in mating to a wild-type partner (data
not shown).
A possible explanation for the defect in
FUS1
induction observed
previously in temperature-sensitive
cdc42
mutants is that the
mutants accumulate at a nonresponding stage
(post-G
1) of the cell
cycle (
35). To address
whether a similar situation might apply
with
cdc42-md
mutants, we isolated early-G
1-phase cells from
cdc42-md1 and isogenic wild-type strains using centrifugal
elutriation and
monitored cell cycle progression and
FUS1
mRNA accumulation upon
treatment with different doses of

-factor. As
shown in Fig.
2A,
cdc42-md1
cells synchronized in early G
1 phase displayed a defect
in
FUS1 induction compared to similarly treated wild-type
cells,
suggesting that these mutants are defective in responding to

-factor
even when the cells are in a responsive stage of the cell
cycle.
Flow cytometric analysis confirmed that both mutant and
wild-type
cells remained in G
1 for the duration of the
30-min

-factor treatment
(Fig.
2B). In addition,
cdc42-md1 mutants progressed into S phase
(data not shown)
and formed buds (Fig.
2C) with unaltered kinetics
in the continuous
presence of 0.015 µM

-factor, a concentration
sufficient to
completely arrest wild-type cells. However, 0.06
µM

-factor did
cause
cdc42-md1 cells to delay briefly in G
1
(Fig.
2C), indicating that the signaling defect is not complete
(consistent
with the
FUS1 induction data). In other
experiments, we have found
that
cdc42-md mutants also show a
FUS1 induction defect in cells
arrested in G
1 by
depletion of the G
1 cyclins Cln1p-Cln3p (data
not shown).
Together, these data strongly suggest that the signaling
defect of
cdc42-md mutants is not due to arrest at a nonresponding
stage of the cell cycle.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
FUS1 induction and cell cycle arrest in
early-G1-phase cells. Cells containing two copies of
wild-type CDC42 (DLY1 plus pMOSB55) or cdc42-md1
(MOSY0178 plus pMOSB36) were grown to exponential phase in
sucrose-containing medium lacking uracil at 30°C (using two gene
copies improved the morphology of cdc42-md1 cells, making
the elutriation more effective). Small G1-phase cells were
isolated by centrifugal elutriation and resuspended in YEPD medium at
30°C. Following a 10-min recovery period, -factor was added to the
indicated final concentrations and the incubation was continued with
vigorous shaking. (A) Northern blot of FUS1 mRNA
accumulation following 30 min of -factor treatment.
cdc42-md1 cells display severely reduced induction compared
to wild-type cells. ACT1 mRNA on the same blots provides an
internal control for loading and transfer. (B) FACS analysis
demonstrating that both wild-type and cdc42-md1 cells were
still in G1 phase after 40 min in YEPD medium without
-factor (the same time point used for the FUS1 mRNA
analysis: a 10-min recovery period plus a 30-min -factor treatment).
The FACS profile of asynchronous wild-type cells (top) was used to
determine the fluorescence signal equivalent to G1 (1 N)
and G2 (2 N) DNA content. FACS profiles are shown for the
indicated strains immediately following elutriation (t = 0') or 40 min later in the absence of -factor (t = 40'). (C)
cdc42-md1 cells were not arrested in G1 phase in
response to -factor. Aliquots of cells were withdrawn at the
indicated times, fixed, and examined by phase-contrast microscopy to
determine the percentage of budded cells (n = 200).
, no -factor; , 0.015 µM -factor; , 0.059 µM
-factor.
|
|
In principle, the
cdc42-md mutants could be defective
for a normal function of Cdc42p in

-factor signaling or they could
encode forms of Cdc42p that can interfere with

-factor signaling
even though wild-type Cdc42p might not play a role in signaling.
To
distinguish between these options, we performed a dominance
test to
determine whether cells containing both wild-type and
mutant forms of
CDC42 were

-factor resistant. As shown in Fig.
3A, the mutants were all recessive, in
that cells containing plasmids
expressing both wild-type and mutant
Cdc42p were

-factor sensitive.
Intriguingly, very tiny colonies were
reproducibly observed in
strains containing both
cdc42-md1-
and
CDC42-expressing plasmids.
This appears to be a
dose-dependent effect such that cells with
a high
cdc42-md1/CDC42 plasmid ratio are selected for on

-factor
plates: when this experiment was repeated in cells with an integrated
copy of
cdc42-md1 and a plasmid-borne copy of
CDC42, no pheromone-resistant
growth was observed (data not
shown). The recessive behavior of
these alleles suggests that Cdc42p
wild-type function is required
for an efficient pheromone response.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 3.
Intragenic-complementation analysis of the
cdc42-md mutants. Plasmids containing the indicated pairs of
CDC42 alleles were transformed into strain DLY3067. (A)
Pheromone resistance of cdc42-md mutants is recessive. The
photographs show growth after 3 days at 30°C with (+) and without
( ) -factor. The plasmid pairs were (in order) pMOSB55 plus
pMOSB45, pMOSB36 plus pMOSB42, pMOSB55 plus pMOSB42, pMOSB37 plus
pMOSB43, pMOSB55 plus pMOSB43, pMOSB38 plus pMOSB44, and pMOSB55
plus pMOSB44. wt, wild type. (B) cdc42-md mutants form a
single complementation group with regard to -factor resistance. Spot
assays were performed as for panel A (except that fewer cells were
spotted in this experiment). The plasmid pairs were (in order)
pMOSB55 plus pMOSB45, pMOSB36 plus pMOSB42, pMOSB37 plus pMOSB43,
pMOSB36 plus pMOSB43, pMOSB38 plus pMOSB44, pMOSB36 plus pMOSB44,
and pMOSB37 plus pMOSB44. (C) cdc42-md mutants form two
complementation groups with regard to cell morphology. Cells were grown
to exponential phase and photographed using DIC optics.
cdc42-md1 mutants exhibit broad necks and elongated buds
(48% of cells), while cdc42-md2 mutants exhibit large round
cells (>70% of cells); although some abnormal cells are present in
the cdc42-md1 plus cdc42-md2 population (with
generally less severe defects, perhaps due to plasmid loss), the
majority (73%) exhibit normal morphology. The morphologies were
similar in the presence and absence of -factor. The plasmid pairs
were pMOSB55 plus pMOSB45 (wt + wt), pMOSB36 plus pMOSB42
(md1 + md1), pMOSB37 plus pMOSB43
(md2 + md2), and pMOSB36 plus pMOSB43
(md1 + md2).
|
|
Intragenic complementation analysis of the cdc42-md
mutants.
We took advantage of the recessive nature of these
alleles to determine whether they had defects in the same or different functions required for the
-factor response. Cells containing all
pairwise combinations of plasmids bearing different cdc42-md alleles were uniformly resistant to
-factor (Fig. 3B), indicating that no mutant could provide the signaling function(s) defective in
another and suggesting that all three alleles were defective for the
same function.
In addition to the

-factor-resistant phenotype, two of the mutants
(
cdc42-md2 and
cdc42-md12) displayed a
slow-growth phenotype
(Fig.
1A and
3A) (interestingly, growth of these
mutants was actually
stimulated by

-factor), and all three mutants
displayed aberrant
cell morphologies when grown in the absence of

-factor (Fig.
3C) (a detailed analysis of the morphological
phenotypes will
be presented elsewhere). Like

-factor resistance,
the slow growth
and morphological phenotypes were recessive (Fig.
3A
and data
not shown). However, cells containing two plasmids expressing
cdc42-md1 and
cdc42-md2 or
cdc42-md1
and
cdc42-md12 but not
cdc42-md2 and
cdc42-md12 grew at wild-type rates and did not display
morphological
abnormalities (Fig.
3B and C and data not shown). This
suggests
that
cdc42-md2 and
cdc42-md12 share
similar defects in vegetative
growth while
cdc42-md1 has a
distinct defect: in cells containing
both
cdc42-md1 and
cdc42-md2, or
cdc42-md1 and
cdc42-md12, all
vegetative functions are provided by one of
the alleles and cells
grow normally. This finding of intragenic
complementation for
the vegetative-growth defects is in contrast to the
lack of such
complementation for the pheromone signaling defect (Fig.
3B),
suggesting that the pheromone signaling defect is distinct from
the vegetative-growth defects and cannot be explained as an indirect
result of such
defects.
Epistasis analysis of the cdc42-md mutants.
To
determine where in the pheromone response pathway Cdc42p plays a role,
we examined whether the cdc42-md mutants could block signaling that was initiated at various steps in the pathway. Induction
of a FUS1-LacZ reporter construct was used as a readout of
pathway activation. Like signaling induced by
-factor, the signals
initiated by overexpression of the G
subunit Ste4p, or by a
membrane-targeted Ste5p scaffold protein, were substantially blocked by
cdc42-md mutants (Fig. 4). In
contrast, signals initiated by the activated MEKK gene allele
STE11-4 or by overexpression of the transcription factor
Ste12p were unaffected by cdc42-md mutants (Fig. 4). This
suggests that Cdc42p is required after Ste5p membrane recruitment for
the activation of Ste11p. Previous studies have shown that this is
precisely the step at which Ste20p is required (40).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Epistatis analysis of cdc42-md mutants.
Strain PPY911 (cdc42-1) was transformed with pRS314
(vector), pMOSB45 (wild type [WT]), pMOSB42 (md1), pMOSB43
(md2), pMOSB44 (md12), or pMOSB47
(V36A), as indicated. Each of these strains was then
transformed with the mating-pathway-activating plasmids pL19
(GAL1p-STE4 [GAL::STE4]),
pL-GS5 N-CTM (GAL1p-STE5 N-CTM
[GAL::STE5 N-CTM]), pG11-4
(GAL1p-STE11-4 [GAL1::STE11-4]), or
pNC252 (2µm GAL1p-STE12 [2µm
GAL1::STE12]) as indicated on the right.
Transformants grown at restrictive temperature to inactivate
cdc42-1 were induced with 2% galactose (or 2% galactose
plus 0.01 µM -factor; top). The bars indicate the means ± standard deviation for four to six independent transformants. Results
similar to those shown with STE5 N-CTM were also seen with
STE5-CTM, and results similar to those shown with
GAL1p-STE11-4 were also seen with GAL1p-STE11 N
(data not shown).
|
|
Sequence analysis of cdc42 mutants.
To determine
the natures of the mutations that rendered CDC42 signaling
defective, we recovered the mutant plasmids from yeast and sequenced
the open reading frame of each mutant. As shown in Fig.
5A, all three mutants contained
single-amino-acid changes in the "effector" domain of Cdc24p: a
valine-to-alanine substitution at residue 36 in cdc42-md1
and a tyrosine-to-cysteine substitution at position 40 in both
cdc42-md2 and cdc42-md12. In addition, cdc42-md1 contained substitutions at residues 149 and 177, and cdc42-md12 contained a valine-to-alanine substitution at
residue 77 (Fig. 5A). Because the Y40C substitution was the only change in cdc42-md2, we assume that the
-factor resistance of
cdc42-md12 also derives from this same change. Presumably
the V77A mutation confers the somewhat-improved growth properties
observed in cdc42-md12 compared to those of
cdc42-md2. In a recent study,
cdc42Y40C was reported to be nonviable
(18). The discrepancy appears to be due to the fact that in
our case the mutant is expressed from a low-copy-number (CEN ARS)
plasmid while in that study it was integrated into the genome. To
determine which changes were responsible for the
-factor resistance
of the cdc42-md1 mutant, we constructed a mutant that
contained only the V36A substitution. This mutant also conferred an
-factor-resistant phenotype (although not as strong as that
conferred by cdc42-md1 [Fig. 4 and 5B]). We conclude that
a mutation at either V36 (to A) or Y40 (to C) in the effector domain of
Cdc42p renders the protein signaling defective.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 5.
Defective interaction of cdc42-md mutants
with Ste20p. (A) Altered residues in cdc42-md mutants. (B)
The V36A substitution confers -factor resistance. Growth arrest
assays of strain DLY3067 (GAL1p-CDC42) containing plasmid
pMOSB55 (CDC42), pMOSB36 (cdc42-md1), or pMOSB177
(cdc42-V36A) were performed. The photographs show growth
after 3 days at 30°C with (+) or without ( ) -factor. (C) Binding
of cdc42 mutants to the Ste20p CRIB domain. The binding
conditions were as described in Materials and Methods. The top row
shows the amount of the indicated myc-tagged Cdc42p mutant that bound
to immobilized GST-CRIB, the second row shows the amount of each Cdc42p
mutant that bound to immobilized GST (to control for nonspecific
adsorption), and the third row shows the amount of each Cdc42p mutant
added to the binding reaction. India ink staining of the blots
confirmed that equal amounts of GST or GST-CRIB were present in each
lane. Similar results were obtained in four independent experiments.
Recombinant Cdc42p was generated from pDLB1234 (D57Y, mimicking
GDP-bound Cdc42p), pDLB1235 (Q61L, mimicking GTP-bound Cdc42p),
pDLB1240 (V36A and Q61L), or pDLB1242 (Y40C and Q61L).
|
|
Defective interaction of Ste20p with cdc42-md
mutants.
The Y40C mutation has been described in human
CDC42 (which is 80% identical to yeast CDC42 and
complements a cdc42 null mutation in yeast
[44]), where it was found to render Cdc42p defective in binding to and activating p21-activated kinase (PAK), a mammalian Ste20p homologue (19). Combined with epistasis analysis
(Fig. 4), this suggested that the cdc42-md mutants might be
defective in binding to Ste20p. Binding of PAK family kinases to Cdc42p is mediated by the CRIB domain in these proteins (8). We
produced the Ste20p CRIB domain as a GST fusion protein in E. coli and purified it using glutathione Sepharose beads. The wild
type or V36A or Y40C mutants of Cdc42p were produced as myc-tagged
proteins in E. coli and tested for binding to the
GST-Ste20p-CRIB beads or to GST beads as a negative control. A Q61L
substitution, which inhibits Cdc42p GTPase activity, was also
engineered into the constructs to ensure that the proteins were GTP
bound (a prerequisite for CRIB domain binding). As shown in Fig. 5C,
the V36A substitution conferred a mild defect in Ste20p binding while
the Y40C substitution conferred a severe defect.
Ste20p shares a redundant essential function with the related
PAK-family kinase Cla4p. The Cdc42p-Ste20p interaction has been
reported to be critical for this function (
23,
37). We found
that cells containing
cdc42-md mutants as the only source of
Cdc42p
were synthetically lethal with
cla4
mutants (but
not with
ste20
mutants [Fig.
6]), suggesting that these mutants fail
to interact
with Ste20p in vivo as well as in vitro.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Synthetic lethality of cdc42-md mutants with
cla4 but not ste20 mutants. Strains DLY3067
(GAL1p-CDC42; left), MOSY0106 (GAL1p-CDC42
ste20 ; middle), and MOSY0023 (GAL1p-CDC42 cla4 ;
right) were transformed with pMOSB55 (CDC42), pMOSB36
(cdc42-md1), pMOSB37 (cdc42-md2), or pMOSB38
(cdc42-md12), as indicated. Cells were streaked out on
dextrose-containing plates (to repress the genomic
GAL1p-CDC42) lacking uracil (to select for plasmid
maintenance) and incubated at 30°C for 3 days. WT, wild type.
|
|
Defective localization of Ste20p in cdc42-md
mutants.
Ste20p is concentrated at the bud tips of many cells
during vegetative growth, and at the shmoo tips of cells responding to
-factor, in a manner that depends to a large extent on the CRIB domain (23, 37). GFP-Ste20p localization to bud tips was
greatly reduced in all of the cdc42-md mutants (Fig.
7). Even cells containing both
cdc42-md1 and cdc42-md2, which exhibited a
wild-type growth rate and cell morphology, failed to localize
GFP-Ste20p to the bud tip in most cells (see Fig. 11 below). We were
unable to address the question of whether shmoo tip localization was
affected because these cells were resistant to
-factor and did not
make shmoos.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 7.
Ste20p localization in cdc42-md mutants.
Strain PPY911 (cdc42-1) was transformed with pRL116
(GFP-STE20 [GFP-Ste20p]) and then with pMOSB45
(CDC45), pMOSB42 (cdc42-md1), pMOSB43
(cdc42-md2), pMOSB44 (cdc42-md12), or pMOSB47
(cdc42-V36A) as indicated. The cells were grown at 36°C to
inactivate cdc42-1, and the localization of GFP-Ste20p was
examined by fluorescence microscopy of living cells. Representative
fields are shown (top), and the percentage of budded cells displaying
GFP-Ste20p concentrated at the bud tips is quantitated (bottom left).
The same set of plasmids was transformed into DLY3067
(GAL1p-CDC42), and the cells were grown on dextrose (to
repress GAL1p-CDC42) and analyzed as above (bottom right).
Several images were captured for each transformant, and all cells
within those images were scored for whether GFP-Ste20 was detectably
concentrated at the bud tip. n = 80 to 138 (PPY911
transformants) or n = 55 to 91 (DLY3067
transformants).
|
|
Suppression of the cdc42-md signaling defect by
overexpression of Ste20p.
If the
-factor resistance phenotype
of the cdc42-md mutants is due to defective interaction with
Ste20p, then overexpression of Ste20p might suppress that phenotype.
Indeed, overexpression of STE20 substantially suppressed the
-factor-resistant growth of cdc42-md mutants (Fig.
8). In contrast, overexpression of the related CLA4 did not suppress the cdc42-md
signaling defect, although it did suppress the growth defect of
cdc42-md2 mutants in the absence of
-factor (Fig. 8).
These findings could be accommodated by at least two models: the
observed suppression may be due to a bypass of the cdc42-md
defects by the overexpressed kinases or to a restoration of a
sufficiently effective interaction between the mutant Cdc42p and the
kinases. In the latter model, the CRIB-binding defect of
cdc42-md2 causes a vegetative growth defect due to impaired interaction with Cla4p and a signaling defect due to impaired interactions with Ste20p.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 8.
Overexpression of STE20 suppresses the
cdc42-md signaling defect. Strain DLY3067
(GAL1p-CDC42) was transformed with pMOSB45 (wild type
[WT]), pMOSB42 (md1), pMOSB43 (md2), or pMOSB44
(md12), and each strain was then transformed with pRS426
(vector), pVTU-Ste20 (STE20), or pDLB722 (CLA4).
The photographs show growth after 3 days at 23°C with (+) or without
( ) -factor.
|
|
Restoration of pheromone signaling in cdc42-md mutants
by the ste20
CRIB allele.
The findings presented
above are consistent with the simple hypothesis that the Cdc42p-Ste20p
interaction is a critical step in the
-factor signaling pathway: the
cdc42-md mutants are defective for this interaction in vitro
and in vivo, epistasis analysis suggests that Cdc42p acts at the same
level of the pathway as Ste20p, and overexpression of Ste20p suppresses
that the cdc42-md signaling defect. Nevertheless, the
hypothesis that the Cdc42p-Ste20p interaction is important for
signaling is contradicted by previous studies showing that a
ste20 mutant lacking the CRIB domain (and therefore
defective in Cdc42p interaction) did not affect signaling (23,
37). A possible resolution of this apparent paradox is suggested
by recent evidence that the CRIB domain in PAK family kinases is part
of an autoinhibitory domain, leading to a model in which Cdc42p (or
Rac) proteins activate PAK family kinases by "relief of
autoinhibition" (3, 49, 52, 54). For example, in the Pak1
kinase of Schizosaccharomyces pombe, a region overlapping the CRIB domain of Pak1 binds intramolecularly to the catalytic domain,
yielding a "closed" conformation that can be "opened" either by
binding to Cdc42p or by mutations in the CRIB domain (49).
By analogy, the ste20
CRIB mutant may be competent for signal transduction because it no longer requires a normally critical interaction with Cdc42p for its activation. This hypothesis predicts that the ste20
CRIB mutant should bypass the requirement
for Cdc42p in signaling, rendering cdc42-md strains
sensitive to pheromone. Indeed, we found that ste20
CRIB
restored significant
-factor signaling to the cdc42-md
mutants, as assayed by growth inhibition (Fig.
9A) or FUS1 induction (Fig.
9B). This suggests that the ste20
CRIB allele
encodes an activated form of Ste20p and supports the hypothesis that
the Cdc42p-Ste20p interaction is normally important for pheromone
signaling. We noticed, however, that ste20
CRIB did not
completely restore
-factor sensitivity to cdc42-md
mutants. This suggests that cdc42-md mutants have some
defect in addition to the Ste20p activation defect.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 9.
ste20 CRIB largely restores -factor
sensitivity to cdc42-md strains. (A) Growth arrest. Strains
DLY3067 (GAL1p-CDC42 STE20) and MOSY0268 (GAL1p-CDC42
ste20 CRIB) were transformed with pMOSB55 (wild type [WT]),
pMOSB36 (md1), pMOSB37 (md2), or pMOSB38
(md12), as indicated. The photographs show growth after 3 days at 23°C with (+) or without ( ) -factor. (B)
FUS1-lacZ induction. The same strains as in panel A harbored
the FUS1-lacZ plasmid pSB231 plus either pMOSB45 (WT) or
pMOSB42 (md1) and were assayed in glucose medium after 90 min with (+) or without ( ) 0.01 µM -factor. The bars indicate
the means ± standard deviations of four transformants.
|
|
Contribution of Bem1p to Cdc42p- and Ste20-dependent
signaling.
The BEM1 gene was discovered through its key
role in polarity establishment (5, 9, 38). Subsequent
studies showed that Bem1p can also modulate the pheromone response
pathway, as Bem1p overexpression increases signaling while Bem1p
removal decreases signaling (17, 29). Because the role of
Bem1p in polarity establishment involves Cdc42p and Cdc24p (5,
38), we speculated that its role in pheromone-responsive
signaling may also involve Cdc42p and therefore that the residual
signaling defect observed in cdc42-md ste20
CRIB mutants
might reflect reduced Bem1p function resulting from the
cdc42-md mutations. Consistent with this hypothesis, we
found that like cdc42-md ste20
CRIB mutants, bem1
ste20
CRIB mutants also displayed partial
-factor resistance
(Fig. 10A) and reduced
FUS1 induction (Fig. 10B) compared to
ste20
CRIB single mutants. The signaling defect in
bem1
ste20
CRIB mutants was also evident when
the pathway was activated by membrane-targeted Ste5p but not when it
was activated by the activated Ste11p derivative Ste11
N (Fig. 10C).
This indicates that like Cdc42p, Bem1p acts downstream of Ste5p
membrane recruitment to promote activation of Ste11p by Ste20p.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 10.
BEM1 is important for signaling in
ste20 CRIB mutant strains. (A) Growth arrest. The
photographs show growth after 2 days at 30°C with (+) and without
( ) -factor. (B) FUS1p-lacZ induction by -factor.
Strains harboring a FUS1p-lacZ reporter plasmid (p3058) were
treated with and without 0.1 µM -factor in duplicate for 1 and
2 h with similar results; the data were expressed as percent mean
induced -galactosidase activity in the wild-type (WT) strain (427 U
at 1 h; 835 U at 2 h) and combined, with each bar
representing the mean ± standard deviation (SD) of four
measurements. (C) FUS1p-lacZ induction by Ste5 N-CTM or
Ste11 N was assayed in strains harboring p3058 and either
pGFP-GS5 N-CTM or pGS11 N-T after 4 h of induction with
galactose; the bars indicate the means ± SD of four to six
transformants, expressed as percent mean induced -galactosidase
activity in the WT strain (1,024 U for Ste5 N-CTM; 644 U for
Ste11 N). (D) FUS1p-lacZ induction in strains harboring
p3058 and either pGFP-GS5 N-CTM (Ste5 N-CTM) or pGFP-GS5 N-Sec22
(Ste5 N-Sec22) was assayed after 4 h of induction with
galactose; the bars indicate the means ± SD of eight
transformants. The strains in all panels were DLY1 (WT), MOSY0252
(ste20 CRIB), JMY1128 (bem1 ), and MOSY0270
(bem1 ste20 CRIB).
|
|
We also compared the effects of
bem1
and
ste20
CRIB mutations on signaling by Ste5p that was
targeted to different subcellular
locations (Fig.
10D). Remarkably,
while Ste20p

CRIB was mildly
defective at activating Ste5p that
was targeted to the plasma
membrane (Ste5

N-CTM), it showed increased
ability to activate
Ste5p that was targeted primarily to internal
membranes (Ste5

N-Sec22
[
40]). Consequently, in
ste20
CRIB cells, the four- to fivefold
signaling
advantage of plasma membrane-targeted Ste5p over
internal-membrane-targeted
Ste5p was eliminated. These results support
the notion that Ste20p

CRIB
is an active but delocalized kinase. Loss
of Bem1p did not mimic
the effect of
ste20
CRIB; instead,
bem1
reduced the ability of
Ste20p

CRIB to support
signaling by Ste5

N-Sec22 and Ste5

N-CTM
to similar extents,
indicating that Bem1p can affect Ste20p- and
Ste5p-dependent signaling
even when both components are
mislocalized.
If a part of the signaling defect of
cdc42-md mutants is due
to defective Bem1p function, as argued above, then Bem1p overexpression
might be expected to improve signaling in
cdc42-md cells.
Indeed,
we found that a high-copy-number
BEM1 plasmid
substantially improved
signaling in response to membrane-targeted Ste5p
in
cdc42-md1 and
cdc42-md2 mutant strains (Fig.
11). Bem1p overexpression also
suppressed the growth and morphology defects of
cdc42-md
mutants
(data not shown). However, this cannot account for the improved
signaling because a high-copy-number
CLA4 plasmid (which
also
suppressed the growth and morphology defects) or introduction
of
both
cdc42-md1 and
cdc42-md2 (leading to
complementation of
the growth and morphology defects) failed to
suppress the signaling
defect (Fig.
11). Strikingly, Bem1p
overexpression (but not Cla4p
overexpression or
cdc42-md
combinations) also suppressed the Ste20p
localization defect in
cdc42-md mutants (Fig.
11). This result
is consistent with
previous studies indicating that Bem1p interacts
with Ste20p
(
24) and strongly suggests that Bem1p is acting
to promote
signaling at the level of Ste20p, consistent with our
epistasis results
above. When combined, the introduction of Ste20p

CRIB
(to bypass the
Ste20p activation defect) and excess Bem1p (to
bypass a possible Bem1p
defect) into the
cdc42-md1 mutant completely
suppressed its

-factor resistance phenotype (Fig.
12). Together,
these data suggest that
the signaling defect of
cdc42-md mutants
can be accounted
for by their simultaneous failures to activate
Ste20p and to promote
Bem1p function.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 11.
Overproduction of BEM1 restores Ste20p
localization and signaling competence to cdc42-md strains.
Strain PPY911 (cdc42-1) containing pL-GS5 N-CTM (for
FUS1 induction) or pPP828 (for Ste20p localization) was
transformed with the CDC42 plasmids pMOSB45 (wild type
[WT]), pMOSB42 (md1), or pMOSB43 (md2) and then
with YEp24 (vector), pMOSB36 (md1), pMOSB37
(md2), pPB321 (2µm BEM1), or pDLB722 (2µm
CLA4) as indicated. FUS1-lacZ induction was
measured as for Fig. 4; the bars indicate means ± SD of six
independent transformants. GFP-Ste20p localization was quantitated as
for Fig. 7 (200 cells counted), and representative cells are shown
below.
|
|

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 12.
Bem1p and Ste20p CRIB cooperate to restore -factor
sensitivity to a cdc42-md1 strain. Strains DLY3067
(GAL1p-CDC42 STE20) and MOSY0268 (GAL1p-CDC42
ste20 CRIB) were transformed with pMOSB42 (cdc42-md1)
and either pRS426 (vector) or pPB321 (2µm BEM1), as
indicated. The photographs show growth after 3 days at 30°C with (+)
and without ( ) -factor.
|
|
 |
DISCUSSION |
A role for Cdc42p in signal transduction in response to
-factor.
We have isolated cdc42 mutants that display
recessive defects in
-factor signaling while retaining the ability
to proliferate. All of these cdc42-md mutants had
morphogenesis defects in addition to their signaling defect. However,
the signaling defect is unlikely to be an indirect result of the
morphogenesis defects for the following reasons. First, overexpression
of CLA4 suppressed the morphogenesis defects of
cdc42-md mutants but not the signaling defect. Second, two
pairwise combinations of cdc42-md alleles displayed
intragenic complementation for their morphogenesis defects but not for
their signaling defects. Third, a synchronous
early-G1-phase population of cdc42-md1 mutant
cells isolated by centrifugal elutriation displayed a signaling defect
even during G1 phase, a time when cells are uniformly
sensitive to
-factor and Cdc42p-dependent polarity has yet to be
established. It is difficult to see how a signaling defect in this
synchronous culture could arise due to any indirect cell cycle or
morphogenesis problems. In summary, these results strongly suggest that
Cdc42p plays a role in
-factor-induced signaling that is separate
from its roles in morphogenesis, confirming the suggestions from
earlier studies with temperature-sensitive cdc42 mutants
(46, 47, 53).
The conclusion that Cdc42p is important for

-factor signaling is at
odds with a study that found no signaling defect in
G
1-arrested
temperature-sensitive
cdc42 or
cdc24 mutants (
35). In that study,
cells arrested
in G
1 by deprivation of G
1 cyclins were
subsequently
shifted to the restrictive temperature for the
cdc42 or
cdc24 mutants and then exposed to
relatively high doses of

-factor.
Under these conditions, induction
of
FUS1 transcription was unaffected
by the
cdc42
or
cdc24 mutations, suggesting that Cdc42p is not
required
for

-factor signaling and affects signaling indirectly
as a result
of cell cycle perturbation (
35). However, an earlier
study
found Cdc24p and Cdc42p to be required for the maintenance
of
G
1 arrest in cells that had been prearrested by

-factor
(
46),
which is not explainable by a model in which the
signaling defects
of
cdc24 and
cdc42 mutants are
due simply to accumulation of cells
at a nonresponsible stage of the
cell
cycle.
While our observations support a role for Cdc42p in
pheromone-responsive signal transduction, they do not suggest that
Cdc42p
is a pathway intermediate that gets activated in response to
pheromone.
Instead, our work is consistent with the view
(
40) that Cdc42p
plays a permissive role in maintaining
cellular competence for
signaling. For instance, Cdc42p may be
constitutively required
for the establishment of relatively long-lived
pre-signaling complexes
containing active Ste20p (see below).
Transmission of the pheromone
signal could then utilize this
preactivated pool of Ste20p without
any further immediate involvement
of Cdc42p. In this hypothesis,
the
cdc42-md mutants have a
signaling defect because they fail
to establish this competent pool of
Ste20p, while the temperature-sensitive
cdc42-1 inactivation
regimen used by Oehlen and Cross (
35) did
not result in a
signaling defect because sufficient Ste20p activation
was established
prior to the temperature shift to allow subsequent
signaling. Notable
in this regard is evidence from human PAK family
members that
GTPase-dependent establishment of the open conformation
allows for PAK
autophosphorylation, which subsequently interferes
with regeneration of
the closed conformation and thus makes the
kinase temporarily GTPase
independent (
30,
52).
Ste20p is a key Cdc42p target involved in pheromone signaling.
By several criteria, the cdc42-md mutants are defective in
interacting with Ste20p: they are defective (to varying extents) in
binding to the Ste20p CRIB domain in vitro, they fail to localize Ste20p to bud tips in vivo, and they display synthetic lethality with
cla4 mutants. Furthermore, epistasis analysis suggests that cdc42-md mutants are defective in signal transduction at the
same step in the pathway as ste20 mutants (i.e, the
activation of Ste11p following membrane targeting of Ste5p). Finally,
the signaling defect of cdc42-md mutants is largely
suppressed by overproduction of Ste20p. These data strongly support the
hypothesis that the Cdc42p-Ste20p interaction is important for
efficient signaling in the pheromone response pathway, as originally
proposed (46, 53). However, more recent studies have argued
that the Cdc42p-Ste20p interaction is dispensable for pheromone
response, based on the signaling competence of a version of Ste20p
(Ste20p
CRIB) that cannot bind to Cdc42p. We found that Ste20p
CRIB
largely restored signaling competence to strains containing the
cdc42-md mutants. This observation suggests that
Ste20p
CRIB is an activated version of Ste20p that no longer requires
interaction with Cdc42p for its activation, consistent with current
models for PAK activation which involve a relief of autoinhibition
mechanism (3, 49, 54). We therefore conclude that
interaction of Cdc42p with Ste20p is normally required for Ste20p to
participate in the pheromone response pathway. Importantly, however, we
do not find it necessary to propose that pheromone regulates either GTP
loading of Cdc42p, the Cdc42p-Ste20p interaction, or Ste20p kinase
activity. Instead, the simplest model consistent with available data is
that access of Ste20p to its substrates is the pheromone-regulated
step, with the effect of Cdc42p on Ste20p kinase activity being a
preexisting condition that is independent of pheromone exposure (see
reference 40 for further discussion).
Cdc42p may play a second role together with Bem1p in pheromone
signaling.
Although Ste20p appears to be the major Cdc42p target
for signal transduction, our results suggest the existence of a second role for Cdc42p in this process, because cdc42-md mutants
displayed a residual signaling defect even in the presence of the
activated ste20
CRIB allele. Given the strong links
between Cdc42p and the SH3-domain-containing scaffold protein Bem1p
that have been established through studies of cell polarity in yeast
(5, 9, 38), we suspected that this second role might involve
Bem1p (which has also been shown to modulate the strength of
-factor
signaling [17, 29]). Consistent with this hypothesis,
Bem1p overexpression partially suppressed the signaling defect of
cdc42-md mutants and Bem1p overexpression together with
ste20
CRIB could fully suppress the
-factor-resistant
growth of cdc42-md mutants.
Our observations suggest that the
cdc42-md mutants are
defective in activation of the Ste11p-Ste7p-Fus3p MAPK cascade. This
step involves the interaction of G


with the Ste5p scaffold
protein
(associated with Ste11p, Ste7p, and Fus3p), resulting in
recruitment
of Ste5p to the plasma membrane (
40) and also
the interaction
of G


with Ste20p (
25). These
interactions likely serve to
raise the local concentrations of Ste20p
and its substrate Ste11p
(bound to Ste5p), thereby initiating MAPK
cascade activity. The
previously described effects of Bem1p on
pheromone signaling (
20,
29) are compatible with its acting
anywhere in the pathway from
receptor to the MAPK Fus3p. Our
experiments indicate that Bem1p
affects steps following Ste5p membrane
recruitment, since both
loss and overproduction of Bem1p affects
signaling by membrane-targeted
Ste5p, even in cells with the activated
ste20
CRIB allele. In
contrast, signaling by the activated
Ste11p derivative Ste11

N
was comparatively insensitive to the loss
of Bem1p. We also observed
that Bem1p can affect the localization of
Ste20p, and previous
studies showed that Bem1p could form complexes
with both Ste20p
and Ste5p (
24,
29). Together, these results
suggest that Bem1p
influences activation of the Ste5p-associated kinase
cascade by
Ste20p, perhaps by helping to bring these proteins together.
It
should be noted that earlier work observed effects of Bem1p
overproduction
on the residual pheromone response of
ste20
cells (
20,
29);
the mechanism for this
residual response has not been determined,
but it may rely on
inefficient substitution for Ste20p by another
PAK family kinase (e.g.,
Cla4p), which would be compatible with
our suggestion that Bem1p
affects the step in which Ste11p is
activated by the Ste20p (or
substitute)
kinase.
The dramatic effect of Bem1p overexpression on Ste20p localization in
cdc42-md mutants provides a suggestion as to how Bem1p
may
function. During vegetative growth, recruitment of Ste20p
to the bud
tip by Cdc42p may be assisted by Bem1p-mediated local
retention of
Ste20p. Similarly, during pheromone response, recruitment
of Ste5p and
Ste20p to a region of the plasma membrane by G

may be assisted by
local retention of these proteins promoted
by Bem1p. Our results
suggest some collaboration between Cdc42p
and Bem1p in pheromone
response. Thus, Cdc42p and Bem1p may each
help to provide a cell
surface scaffold that facilitates the association
and/or local
retention of Ste5p (with its associated kinases)
and Ste20p, allowing
the local concentrations of these signaling
components to be raised
above the threshold required for efficient
signal
transduction.
Conclusions.
In aggregate, the analysis of the
pheromone-resistant cdc42 alleles presented here combined
with previous studies suggest a novel paradigm for the "signaling"
role of Cdc42p that is quite distinct from the paradigm established for
the ras GTPase. Cdc42p is required for Ste20p activation, but there is
little evidence to suggest that pheromone signals stimulate this
activation; instead, pheromone signaling may make use of a preexisting
constitutive Ste20p activity. In addition, Cdc42p (acting with Bem1p)
helps increase the local concentration of Ste20p together with other signaling components, promoting signal transduction by a proximity effect (36). Providing a surface conducive to the local
concentration of signaling reactants could be a common contributor to
eukaryotic signaling pathways, especially those that rely on
regulatable protein-protein interactions rather than diffusible second
messengers (16). It remains to be seen to what extent these
types of signaling roles will be generally applicable for other Rho
family GTPases and other cells.
 |
ACKNOWLEDGMENTS |
We thank members of the Pringle and Lew laboratories for many
valuable discussions. We also thank E. Bi, C. Boone, F. Cross, E. Leberer, and M. Peter for providing plasmids or strains. Thanks to Lynn
Martinek and Mike Cook from the Duke Cancer Center Flow Cytometry
Shared Resource for help with the flow cytometry.
J.J.M. was supported by American Cancer Society postdoctoral fellowship
PF-98-008. This work was supported by grants from the Worcester
Foundation and the Millipore Foundation, by NIH grant GM57769 to
P.M.P., and by NIH grant GM53050 and American Cancer Society grant
RPG-98-046-CCG to D.J.L.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pharmacology and Cancer Biology, Box 3686, Duke University Medical
Center, Durham, NC 27710. Phone: (919) 613-8627. Fax: (919) 681-1005. E-mail: daniel.lew{at}duke.edu.
 |
REFERENCES |
| 1.
|
Adams, A. E. M.,
D. I. Johnson,
R. M. Longnecker,
B. F. Sloat, and J. R. Pringle.
1990.
CDC42 and CDC43, two additional genes involved in budding and the establishment of cell polarity in the yeast Saccharomyces cerevisiae.
J. Cell Biol.
111:131-142[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1995.
Current protocols in molecular biology.
John Wiley and Sons, New York, N.Y.
|
| 3.
|
Bagrodia, S., and R. A. Cerione.
1999.
Pak to the future.
Trends Cell Biol.
9:350-355[CrossRef][Medline].
|
| 4.
|
Bardwell, L.,
J. G. Cook,
C. J. Inouye, and J. Thorner.
1994.
Signal propagation and regulation in the mating pheromone response pathway of the yeast Saccharomyces cerevisiae.
Dev. Biol.
166:363-379[CrossRef][Medline].
|
| 5.
|
Bender, A., and J. R. Pringle.
1991.
Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
11:1295-1305[Abstract/Free Full Text].
|
| 6.
|
Benton, B. K.,
A. Tinkelenberg,
I. Gonzalez, and F. R. Cross.
1997.
Cla4p, a Saccharomyces cerevisiae Cdc42p-activated kinase involved in cytokinesis, is activated at mitosis.
Mol. Cell. Biol.
17:5067-5076[Abstract].
|
| 7.
|
Boeke, J. D.,
J. Trueheart,
G. Natsoulis, and G. R. Fink.
1987.
5-Fluoroorotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol.
154:164-173[Medline].
|
| 8.
|
Burbelo, P. D.,
D. Drechsel, and A. Hall.
1995.
A conserved binding motif defines numerous candidate target proteins for both Cdc42 and Rac GTPases.
J. Biol. Chem.
270:29071-29074[Abstract/Free Full Text].
|
| 9.
|
Chenevert, J.,
K. Corrado,
A. Bender,
J. Pringle, and I. Herskowitz.
1992.
A yeast gene (BEM1) necessary for cell polarization whose product contains two SH3 domains.
Nature
356:77-79[CrossRef][Medline].
|
| 10.
|
Elder, R. T.,
E. Y. Loh, and R. W. Davis.
1983.
RNA from the yeast transposable element Ty1 has both ends in the direct repeats, a structure similar to retrovirus RNA.
Proc. Natl. Acad. Sci. USA
80:2432-2436[Abstract/Free Full Text].
|
| 11.
|
Feng, Y.,
L. Y. Song,
E. Kincaid,
S. K. Mahanty, and E. A. Elion.
1998.
Functional binding between G and the LIM domain of Ste5 is required to activate the MEKK Ste11.
Curr. Biol.
8:267-278[CrossRef][Medline].
|
| 12.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six base pair restriction sites.
Gene
74:527-534[CrossRef][Medline].
|
| 13.
|
Guthrie, C., and G. R. Fink (ed.).
1991.
Methods in enzymology, vol. 194. Guide to yeast genetics and molecular biology.
Academic Press, Inc., San Diego, Calif.
|
| 14.
|
Haase, S. B., and D. J. Lew.
1997.
Flow cytometric analysis of DNA content in budding yeast.
Methods Enzymol.
283:322-332[Medline].
|
| 15.
|
Hudson, J. R., Jr.,
E. P. Dawson,
K. L. Rushing,
C. H. Jackson,
D. Lockshon,
D. Conover,
C. Lanciault,
J. R. Harris,
S. J. Simmons,
R. Rothstein, and S. Fields.
1997.
The complete set of predicted genes from Saccharomyces cerevisiae in a readily usable form.
Genome Res.
7:1169-1173[Abstract/Free Full Text].
|
| 16.
|
Hunter, T.
2000.
Signaling 2000 and beyond.
Cell.
100:113-127[CrossRef][Medline].
|
| 17.
|
Kao, L. R.,
J. Peterson,
R. Ji,
L. Bender, and A. Bender.
1996.
Interactions between the ankyrin repeat-containing protein Akr1p and the pheromone response pathway in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:168-178[Abstract].
|
| 18.
|
Kozminski, K. G.,
A. J. Chen,
A. A. Rodal, and D. G. Drubin.
2000.
Functions and functional domains of the GTPase Cdc42p.
Mol. Biol. Cell.
11:339-354[Abstract/Free Full Text].
|
| 19.
|
Lamarche, N.,
N. Tapon,
L. Stowers,
P. D. Burbelo,
P. Aspenstrom,
T. Bridges,
J. Chant, and A. Hall.
1996.
Rac and Cdc42 induce actin polymerization and G1 cell cycle progression independently of p65PAK and the JNK/SAPK MAP kinase cascade.
Cell
87:519-529[CrossRef][Medline].
|
| 20.
|
Leberer, E.,
J. Chenevert,
T. Leeuw,
D. Harcus,
I. Herskowitz, and D. Y. Thomas.
1996.
Genetic interactions indicate a role for Mdg1p and the SH3 domain protein Bem1p in linking the G-protein mediated yeast pheromone signalling pathway to regulators of cell polarity.
Mol. Gen. Genet.
252:608-621[Medline].
|
| 21.
|
Leberer, E.,
D. Dignard,
D. Harcus,
D. Y. Thomas, and M. Whiteway.
1992.
The protein kinase homologue Ste20p is required to link the yeast pheromone response G-protein  subunits to downstream signaling components.
EMBO J.
11:4815-4824[Medline].
|
| 22.
|
Leberer, E.,
D. Y. Thomas, and M. Whiteway.
1997.
Pheromone signalling and polarized morphogenesis in yeast.
Curr. Opin. Genet. Dev.
7:59-66[CrossRef][Medline].
|
| 23.
|
Leberer, E.,
C. Wu,
T. Leeuw,
A. Fourest-Lieuvin,
J. E. Segall, and D. Y. Thomas.
1997.
Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase.
EMBO J.
16:83-97[CrossRef][Medline].
|
| 24.
|
Leeuw, T.,
A. Fourest-Lieuvin,
C. Wu,
J. Chenevert,
K. Clark,
M. Whiteway,
D. Y. Thomas, and E. Leberer.
1995.
Pheromone response in yeast: association of Bem1p with proteins of the MAP kinase cascade and actin.
Science
270:1210-1213[Abstract/Free Full Text].
|
| 25.
|
Leeuw, T.,
C. Wu,
J. D. Schrag,
M. Whiteway,
D. Y. Thomas, and E. Leberer.
1998.
Interaction of a G-protein -subunit with a conserved sequence in Ste20/PAK family protein kinases.
Nature
391:191-195[CrossRef][Medline].
|
| 26.
|
Lew, D. J., and S. I. Reed.
1995.
A cell cycle checkpoint monitors cell morphogenesis in budding yeast.
J. Cell Biol.
129:739-749[Abstract/Free Full Text].
|
| 27.
|
Lew, D. J., and S. I. Reed.
1993.
Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins.
J. Cell Biol.
120:1305-1320[Abstract/Free Full Text].
|
| 28.
|
Liu, Q.,
M. Z. Li,
D. Leibham,
D. Cortez, and S. J. Elledge.
1998.
The univector plasmid-fusion system, a method for rapid construction of recombinant DNA without restriction enzymes.
Curr. Biol.
8:1300-1309[CrossRef][Medline].
|
| 29.
|
Lyons, D. M.,
S. K. Mahanty,
K. Y. Choi,
M. Manandhar, and E. A. Elion.
1996.
The SH3-domain protein Bem1 coordinates mitogen-activated protein kinase cascade activation with cell cycle control in Saccharomyces cerevisiae.
Mol. Cell. Biol.
16:4095-4106[Abstract].
|
| 30.
|
Martin, G. A.,
G. Bollag,
F. McCormick, and A. Abo.
1995.
A novel serine kinase activated by rac1/CDC42Hs-dependent autophosphorylation is related to PAK65 and STE20.
EMBO J.
14:1970-1978[Medline]. (Erratum, 14:4385.)
|
| 31.
|
Mosch, H. U.,
R. L. Roberts, and G. R. Fink.
1996.
Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
93:5352-5356[Abstract/Free Full Text].
|
| 32.
|
Neiman, A. M., and I. Herskowitz.
1994.
Reconstitution of a yeast protein kinase cascade in vitro: activation of the yeast MEK homologue STE7 by STE11.
Proc. Natl. Acad. Sci. USA
91:3398-3402[Abstract/Free Full Text].
|
| 33.
|
Nern, A., and R. A. Arkowitz.
1998.
A GTP-exchange factor required for cell orientation.
Nature
391:195-198[CrossRef][Medline].
|
| 34.
|
Oehlen, L. J. W. M., and F. R. Cross.
1994.
G1 cyclins CLN1 and CLN2 repress the mating factor response pathway at Start in the yeast cell cycle.
Genes Dev.
8:1058-1070[Abstract/Free Full Text].
|
| 35.
|
Oehlen, L. J. W. M., and F. R. Cross.
1998.
The role of Cdc42 in signal transduction and mating of the budding yeast Saccharomyces cerevisiae.
J. Biol. Chem.
273:8556-8559[Abstract/Free Full Text].
|
| 36.
|
Pawson, T., and J. D. Scott.
1997.
Signaling through scaffold, anchoring, and adaptor proteins.
Science
278:2075-2080[Abstract/Free Full Text].
|
| 37.
|
Peter, M.,
A. M. Neiman,
H.-O. Park,
M. van Lohuizen, and I. Herskowitz.
1996.
Functional analysis of the interaction between the small GTP binding protein Cdc42 and the Ste20 protein kinase in yeast.
EMBO J.
15:7046-7059[Medline].
|
| 38.
|
Pringle, J. R.,
E. Bi,
H. A. Harkins,
J. E. Zahner,
C. De Virgilio,
J. Chant,
K. Corrado, and H. Fares.
1995.
Establishment of cell polarity in yeast.
Cold Spring Harbor Symp. Quant. Biol.
60:729-744[Abstract/Free Full Text].
|
| 39.
|
Pryciak, P. M., and L. H. Hartwell.
1996.
AKR1 encodes a candidate effector of the  complex in the Saccharomyces cerevisiae pheromone response pathway and contributes to control of both cell shape and signal transduction.
Mol. Cell. Biol.
16:2614-2626[Abstract].
|
| 40.
|
Pryciak, P. M., and F. A. Huntress.
1998.
Membrane recruitment of the kinase cascade scaffold protein Ste5 by the G complex underlies activation of the yeast pheromone response pathway.
Genes Dev.
12:2684-2697[Abstract/Free Full Text].
|
| 41.
|
Reed, S. I.,
J. Ferguson, and J. Groppe.
1982.
Preliminary characterization of the transcriptional and translational products of the Saccharomyces cerevisiae cell division cycle gene CDC28.
Mol. Cell. Biol.
2:415-425.
|
| 41a.
|
Richardson, H. E.,
C. Wittenberg,
F. Cross, and S. I. Reed.
1989.
An essential G1 function for cyclin-like proteins in yeast.
Cell
59:1127-1133[CrossRef][Medline].
|
| 42.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 43.
|
Schild, D.,
A. J. Brake,
M. C. Kiefer,
D. Young, and P. J. Barr.
1990.
Cloning of three multifunctional de novo purine biosynthetic genes by functional complementation of yeast mutants.
Proc. Natl. Acad. Sci. USA
87:2916-2920[Free Full Text].
|
| 44.
|
Shinjo, K.,
K. G. Koland,
M. J. Hart,
V. Narasimhan,
D. I. Johnson,
T. Evans, and R. A. Cerione.
1990.
Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division cycle protein CDC42.
Proc. Natl. Acad. Sci. USA
87:9853-9857[Abstract/Free Full Text].
|
| 45.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 46.
|
Simon, M. N.,
C. De Virgilio,
B. Souza,
J. R. Pringle,
A. Abo, and S. I. Reed.
1995.
Role for the Rho-family GTPase Cdc42 in yeast mating-pheromone signal pathway.
Nature
376:702-705[CrossRef][Medline].
|
| 47.
|
Stevenson, B. J.,
B. Ferguson,
C. De Virgilio,
E. Bi,
J. R. Pringle,
G. Ammerer, and G. F. Sprague, Jr.
1995.
Mutation of RGA1, which encodes a putative GTPase-activating protein for the polarity-establishment protein Cdc42p, activates the pheromone-response pathway in the yeast Saccharomyces cerevisiae.
Genes Dev.
9:2949-2963[Abstract/Free Full Text].
|
| 48.
|
Trueheart, J.,
J. Boeke, and G. R. Fink.
1987.
Two genes required for cell fusion during yeast conjugation: evidence for a pheromone-induced surface protein.
Mol. Cell Biol.
7:2316-2328[Abstract/Free Full Text].
|
| 49.
|
Tu, H., and M. Wigler.
1999.
Genetic evidence for Pak1 autoinhibition and its release by Cdc42.
Mol. Cell. Biol.
19:602-611[Abstract/Free Full Text].
|
| 50.
|
Whiteway, M.,
L. Hougan, and D. Y. Thomas.
1990.
Overexpression of the STE4 gene leads to mating response in haploid Saccharomyces cerevisiae.
Mol. Cell. Biol.
10:217-222[Abstract/Free Full Text].
|
| 51.
|
Whiteway, M. S.,
C. Wu,
T. Leeuw,
K. Clark,
A. Fourest-Lieuvin,
D. Y. Thomas, and E. Leberer.
1995.
Association of the yeast pheromone response G protein beta gamma subunits with the MAP kinase scaffold Ste5p.
Science
269:1572-1575[Abstract/Free Full Text].
|
| 52.
|
Zenke, F. T.,
C. C. King,
B. P. Bohl, and G. M. Bokoch.
1999.
Identification of a central phosphorylation site in p21-activated kinase regulating autoinhibition and kinase activity.
J. Biol. Chem.
274:32565-32573[Abstract/Free Full Text].
|
| 53.
|
Zhao, Z. S.,
T. Leung,
E. Manser, and L. Lim.
1995.
Pheromone signalling in Saccharomyces cerevisiae requires the small GTP-binding protein Cdc42p and its activator Cdc24p.
Mol. Cell. Biol.
15:5246-5257[Abstract].
|
| 54.
|
Zhao, Z. S.,
E. Manser,
X. Q. Chen,
C. Chong,
T. Leung, and L. Lim.
1998.
A conserved negative regulatory region in alphaPAK: inhibition of PAK kinases reveals their morphological roles downstream of Cdc42 and Rac1.
Mol. Cell. Biol.
18:2153-2163[Abstract/Free Full Text].
|
| 55.
|
Ziman, M.,
J. M. O'Brien,
L. A. Ouellette,
W. R. Church, and D. I. Johnson.
1991.
Mutational analysis of CDC42Sc, a Saccharomyces cerevisiae gene that encodes a putative GTP-binding protein involved in the control of cell polarity.
Mol. Cell. Biol.
11:3537-3544[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 2000, p. 7559-7571, Vol. 20, No. 20
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kohli, M., Galati, V., Boudier, K., Roberson, R. W., Philippsen, P.
(2008). Growth-speed-correlated localization of exocyst and polarisome components in growth zones of Ashbya gossypii hyphal tips. J. Cell Sci.
121: 3878-3889
[Abstract]
[Full Text]
-
Strickfaden, S. C., Pryciak, P. M.
(2008). Distinct Roles for Two G{alpha} G Interfaces in Cell Polarity Control by a Yeast Heterotrimeric G Protein. Mol. Biol. Cell
19: 181-197
[Abstract]
[Full Text]
-
Takahashi, S., Pryciak, P. M.
(2007). Identification of Novel Membrane-binding Domains in Multiple Yeast Cdc42 Effectors. Mol. Biol. Cell
18: 4945-4956
[Abstract]
[Full Text]
-
Gao, X.-D., Sperber, L. M., Kane, S. A., Tong, Z., Tong, A. H. Y., Boone, C., Bi, E.
(2007). Sequential and Distinct Roles of the Cadherin Domain-containing Protein Axl2p in Cell Polarization in Yeast Cell Cycle. Mol. Biol. Cell
18: 2542-2560
[Abstract]
[Full Text]
-
Park, H.-O., Bi, E.
(2007). Central Roles of Small GTPases in the Development of Cell Polarity in Yeast and Beyond. Microbiol. Mol. Biol. Rev.
71: 48-96
[Abstract]
[Full Text]
-
Heinrich, M., Kohler, T., Mosch, H.-U.
(2007). Role of Cdc42-Cla4 Interaction in the Pheromone Response of Saccharomyces cerevisiae. Eukaryot Cell
6: 317-327
[Abstract]
[Full Text]
-
Barale, S., McCusker, D., Arkowitz, R. A.
(2006). Cdc42p GDP/GTP Cycling Is Necessary for Efficient Cell Fusion during Yeast Mating. Mol. Biol. Cell
17: 2824-2838
[Abstract]
[Full Text]
-
Chasse, S. A., Flanary, P., Parnell, S. C., Hao, N., Cha, J. Y., Siderovski, D. P., Dohlman, H. G.
(2006). Genome-Scale Analysis Reveals Sst2 as the Principal Regulator of Mating Pheromone Signaling in the Yeast Saccharomyces cerevisiae. Eukaryot Cell
5: 330-346
[Abstract]
[Full Text]
-
Gladfelter, A. S., Kozubowski, L., Zyla, T. R., Lew, D. J.
(2005). Interplay between septin organization, cell cycle and cell shape in yeast. J. Cell Sci.
118: 1617-1628
[Abstract]
[Full Text]
-
Wang, Y., Chen, W., Simpson, D. M., Elion, E. A.
(2005). Cdc24 Regulates Nuclear Shuttling and Recruitment of the Ste5 Scaffold to a Heterotrimeric G Protein in Saccharomyces cerevisiae. J. Biol. Chem.
280: 13084-13096
[Abstract]
[Full Text]
-
Winters, M. J., Pryciak, P. M.
(2005). Interaction with the SH3 Domain Protein Bem1 Regulates Signaling by the Saccharomyces cerevisiae p21-Activated Kinase Ste20. Mol. Cell. Biol.
25: 2177-2190
[Abstract]
[Full Text]
-
Bassilana, M., Hopkins, J., Arkowitz, R. A.
(2005). Regulation of the Cdc42/Cdc24 GTPase Module during Candida albicans Hyphal Growth. Eukaryot Cell
4: 588-603
[Abstract]
[Full Text]
-
Fitch, P. G., Gammie, A. E., Lee, D. J., de Candal, V. B., Rose, M. D.
(2004). Lrg1p Is a Rho1 GTPase-Activating Protein Required for Efficient Cell Fusion in Yeast. Genetics
168: 733-746
[Abstract]
[Full Text]
-
Gladfelter, A. S., Zyla, T. R., Lew, D. J.
(2004). Genetic Interactions among Regulators of Septin Organization. Eukaryot Cell
3: 847-854
[Abstract]
[Full Text]
-
Harrison, J. C., Zyla, T. R., Bardes, E. S. G., Lew, D. J.
(2004). Stress-specific Activation Mechanisms for the "Cell Integrity" MAPK Pathway. J. Biol. Chem.
279: 2616-2622
[Abstract]
[Full Text]
-
Wang, Y., Elion, E. A.
(2003). Nuclear Export and Plasma Membrane Recruitment of the Ste5 Scaffold Are Coordinated with Oligomerization and Association with Signal Transduction Components. Mol. Biol. Cell
14: 2543-2558
[Abstract]
[Full Text]
-
Keniry, M. E., Sprague, G. F. Jr.
(2003). Identification of p21-Activated Kinase Specificity Determinants in Budding Yeast: a Single Amino Acid Substitution Imparts Ste20 Specificity to Cla4. Mol. Cell. Biol.
23: 1569-1580
[Abstract]
[Full Text]
-
Zhang, M., Bennett, D., Erdman, S. E.
(2002). Maintenance of Mating Cell Integrity Requires the Adhesin Fig2p. Eukaryot Cell
1: 811-822
[Abstract]
[Full Text]
-
Hurtado, C. A. R., Rachubinski, R. A.
(2002). Isolation and Characterization of YlBEM1, a Gene Required for Cell Polarization and Differentiation in the Dimorphic Yeast Yarrowia lipolytica. Eukaryot Cell
1: 526-537
[Abstract]
[Full Text]
-
Rodriguez-Pachon, J. M., Martin, H., North, G., Rotger, R., Nombela, C., Molina, M.
(2002). A Novel Connection between the Yeast Cdc42 GTPase and the Slt2-mediated Cell Integrity Pathway Identified through the Effect of Secreted Salmonella GTPase Modulators. J. Biol. Chem.
277: 27094-27102
[Abstract]
[Full Text]
-
Lamson, R. E., Winters, M. J., Pryciak, P. M.
(2002). Cdc42 Regulation of Kinase Activity and Signaling by the Yeast p21-Activated Kinase Ste20. Mol. Cell. Biol.
22: 2939-2951
[Abstract]
[Full Text]
-
Elion, E. A.
(2002). The Ste5p scaffold. J. Cell Sci.
114: 3967-3978
[Abstract]
[Full Text]
-
Ushinsky, S. C., Harcus, D., Ash, J., Dignard, D., Marcil, A., Morchhauser, J., Thomas, D. Y., Whiteway, M., Leberer, E.
(2002). CDC42 Is Required for Polarized Growth in Human Pathogen Candida albicans. Eukaryot Cell
1: 95-104
[Abstract]
[Full Text]
-
Parrish, W., Eilers, M., Ying, W., Konopka, J. B.
(2002). The Cytoplasmic End of Transmembrane Domain 3 Regulates the Activity of the Saccharomyces cerevisiae G-Protein-Coupled {alpha}-Factor Receptor. Genetics
160: 429-443
[Abstract]
[Full Text]
-
Callow, M. G., Clairvoyant, F., Zhu, S., Schryver, B., Whyte, D. B., Bischoff, J. R., Jallal, B., Smeal, T.
(2002). Requirement for PAK4 in the Anchorage-independent Growth of Human Cancer Cell Lines. J. Biol. Chem.
277: 550-558
[Abstract]
[Full Text]
-
Zhang, X., Bi, E., Novick, P., Du, L., Kozminski, K. G., Lipschutz, J. H., Guo, W.
(2001). Cdc42 Interacts with the Exocyst and Regulates Polarized Secretion. J. Biol. Chem.
276: 46745-46750
[Abstract]
[Full Text]
-
Adamo, J. E., Moskow, J. J., Gladfelter, A. S., Viterbo, D., Lew, D. J., Brennwald, P. J.
(2001). Yeast Cdc42 functions at a late step in exocytosis, specifically during polarized growth of the emerging bud. JCB
155: 581-592
[Abstract]
[Full Text]
-
Drees, B. L., Sundin, B., Brazeau, E., Caviston, J. P., Chen, G.-C., Guo, W., Kozminski, K. G., Lau, M. W., Moskow, J. J., Tong, A., Schenkman, L. R., McKenzie, A. III, Brennwald, P., Longtine, M., Bi, E., Chan, C., Novick, P., Boone, C., Pringle, J. R., Davis, T. N., Fields, S., Drubin, D. G.
(2001). A protein interaction map for cell polarity development. JCB
154: 549-576
[Abstract]
[Full Text]
-
Gladfelter, A. S., Moskow, J. J., Zyla, T. R., Lew, D. J.
(2001). Isolation and Characterization of Effector-Loop Mutants of CDC42 in Yeast. Mol. Biol. Cell
12: 1239-1255
[Abstract]
[Full Text]
-
Bose, I., Irazoqui, J. E., Moskow, J. J., Bardes, E. S. G., Zyla, T. R., Lew, D. J.
(2001). Assembly of Scaffold-mediated Complexes Containing Cdc42p, the Exchange Factor Cdc24p, and the Effector Cla4p Required for Cell Cycle-regulated Phosphorylation of Cdc24p. J. Biol. Chem.
276: 7176-7186
[Abstract]
[Full Text]