Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7634-7642, Vol. 20, No. 20
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Attachment of HeT-A Sequences to
Chromosomal Termini in Drosophila melanogaster May
Occur by Different Mechanisms
Tatyana
Kahn,
Mikhail
Savitsky, and
Pavel
Georgiev*
Department of Control of Genetic Processes,
Institute of Gene Biology, Russian Academy of Sciences, 117334 Moscow, Russia
Received 19 June 2000/Accepted 31 July 2000
 |
ABSTRACT |
Drosophila telomeres contain arrays of the
retrotransposonlike elements HeT-A and TART.
Their transposition to broken chromosomal termini has been implicated
in chromosome healing and telomere elongation. The HeT-A
element is attached by its 3' end, which contains the promoter. To
monitor the behavior of HeT-A elements, we used the yellow
gene with terminal deficiencies consisting of breaks in the
yellow promoter region that result in the
y-null phenotype. Attachment of the HeT-A
element provides the promoterless yellow gene with a
promoter that activates yellow expression in bristles. The
frequency of HeT-A transpositions to the yellow terminal deficiency depends on the genotype of the line and varies from
2 × 10
3 to less than 2 × 105.
Loss of the attached HeT-A due to incomplete replication at the telomere leads to inactivation of yellow expression,
which is restored by attachment of a new HeT-A element
upstream of yellow. New HeT-A additions occur
at a frequency of about 1.2 × 103. Short DNA
attachments are generated by gene conversion using the homologous
telomeric sequences as templates. Longer DNA attachments are generated
either by conventional transposition of an HeT-A element to
the chromosomal terminus or by recombination between the 3' terminus of
telomeric HeT-A elements and the receding end of
HeT-A attached to the yellow gene.
| |
INTRODUCTION |
Specialized mechanisms have evolved
to add DNA to the termini of eukaryotic chromosomes, balancing the loss
that occurs as a result of incomplete terminal DNA replication
(11, 37). In most eukaryotes a special reverse
transcriptase, telomerase, adds telomeric DNA repeats to the
chromosomal ends by using an internal RNA template (11, 25, 26,
38). In contrast, Drosophila telomeres consist of
multiple copies of HeT-A and TART elements sharing similarities with non-LTR-type retrotransposons (7, 33,
36, 38). In particular, they have an oligo(A) tract at the 3'
end. HeT-A and TART in telomeres have
head-to-tail orientation (28, 33, 36, 38). Telomeres are
believed to elongate by transposition of these elements to the ends of
chromosomes (5, 6, 7, 36, 38, 42). All available data
suggest that the HeT-A and TART elements are
attached with 3' oligo(A) tails to their target sites (4, 5,
42). The structures and functions of HeT-A and
TART reveal similarities with telomeres: the TART reverse transcriptase is related to the catalytic subunit of telomerase (38). Still, the mechanism and the regulation of the
telomere elongation by transposition remain unclear.
The terminal deficiencies that remove the chromosome end and are broken
within the yellow gene have been used to study the mechanism
of telomere recession and elongation (2, 3, 4, 5, 6, 35).
The yellow gene is required for larval and adult cuticle
pigmentation and is transcribed in the distal-to-proximal direction.
The enhancers that control yellow expression in the wings
and body cuticle are located in the 5' upstream region of the
yellow gene, whereas the enhancer controlling
yellow expression in bristles resides in the intron (2,
24, 32). Therefore, flies with the terminal DNA breakpoints in
the 5' upstream region removing the wing and body enhancers display a
y2-like phenotype: wild-type pigmentation in bristles and
lack of pigmentation in the body cuticle and wing blade (2).
Terminal deficiencies with breaks located at the yellow
promoter or within the yellow transcription unit result in
the y1-like phenotype, i.e., complete repression of
yellow function (2, 3). Biessmann et al.
(4) described the RT394 strain carrying a HeT-A
element attached to the 5' end of the yellow transcription
unit. RT394 flies displayed the y2-like phenotype in spite
of deletion of the yellow promoter. Danilevskaya et al.
(16) showed that HeT-A elements have a promoter
element at the 3' end. As a result, the HeT-A promoter
initiates transcription of sequences downstream of the element. One can
suggest that the HeT-A promoter restores yellow
expression in bristles.
Using these observations, we have developed a genetic method to analyze
the frequency of HeT-A transposition to the receding promoterless yellow terminus. Here we have found that
transposition depends on the genotype of a line and varies from
less than 2 × 105 to 2 × 103.
Thus, the genotype strongly affects the frequency of
HeT-A transposition to the broken chromosomal end.
Previously, we observed that the ends of the yellow terminal
deficiencies could also be elongated by gene conversion if the
yellow gene on the homologous chromosome served as a
template (35). It was suggested that elongation of the
HeT-A array might occur not only by virtue of transposition but also by an alternative mechanism, such as gene conversion.
To monitor the fate of the receding HeT-A element, we
exploited the observation that less than 300 bp of the 3' end of
HeT-A could not activate yellow transcription.
Addition of a new HeT-A element to the 5' end of a truncated
element renews yellow transcription. Using such a genetic
screen we isolated a number of flies with elongated chromosomal
termini. Southern blot analysis and sequencing showed that some
HeT-A attachments were generated by transposition to the
chromosome terminus, while others were generated by gene conversion
using as a template a HeT-A element from the homologous chromosome. A significant fraction of HeT-A attachments were
characterized by a large size, exceeding 20 kb. Their structure might
be explained in terms of recombination between the 3' terminus of the
telomeric HeT-A element and the receding end of
HeT-A attached to the yellow gene. As a result,
the terminal deficiency carrying a single HeT-A element
acquired a large array of telomere sequences. Our results suggest that
Drosophila HeT-A arrays can be elongated not only by transposition but also by gene conversion and/or recombination mechanisms.
| |
MATERIALS AND METHODS |
Genetic crosses.
All Drosophila stocks were
maintained at 25°C on a standard yeast medium. Genetic symbols for
the yellow alleles and their origin were described elsewhere
(22, 35). Most of genetic markers used were described by
Lindsley and Zimm (30). The yac chromosome
contains a deletion of the yellow and achaete
genes but not of any vital genes and thus provides an opportunity to examine the behavior of the yellow gene on a homologue in
the absence of other yellow sequences.
For determination of the yellow phenotype, the levels of
pigmentation in different tissues of adult flies were estimated
visually in 3- to 5-day-old males and females developing at 25°C as
described in reference 22.
Molecular methods.
For Southern blot hybridization, DNA from
adult flies was isolated using the protocol described by Ashburner
(1). Treatment of DNA with restriction endonucleases,
blotting, fixation, and hybridization with radioactive probes prepared
by random primer extension were performed as described in the
protocols for Hybond-N+ nylon membrane (Amersham, Arlington
Heights, Ill.) and in the laboratory manual (41).
The junctions between newly transposed mobile elements and the DNA
terminus were cloned by DNA amplification with two oligonucleotide
primers. PCR was done by standard techniques (
21). The
primers
used in DNA amplification were from the
yellow gene
and the
HeT-A element. The numbers of nucleotide map
positions are given below
in parentheses in accordance with the
yellow sequences (
23)
and the
HeT-A
element (
6). The primers for the
yellow gene
are
as follows: y1, CCTGGAACATTGCAC (3053 to 3039); y2,
AAGACGGCGTCACCAAGGTGATC
(3101 to 3078); and y3,
ACTTCCACTTACCATCACGCCAG (3293 to 3271).
The primers in the
HeT-A element are as follows: h1,
ATACTGCAAGTGGCGCGCATCC
(455 to 434); and h2,
GGTGCTTCCGTACTTCTGGCGG (359 to
338).
The products of amplification were fractionated by electrophoresis in
1.5% agarose gels. The successfully amplified products
were cloned in
a Bluescript plasmid (Stratagene, La Jolla, Calif.)
and were sequenced
using the Amersham sequence
kit.
| |
RESULTS |
Determination of the yellow promoter region which is
sufficient for maintaining yellow expression at the
chromosome terminus.
In order to study the frequency of
HeT-A transposition to a broken chromosomal end, we used the
alleles with terminal deficiencies consisting of breaks in the
yellow gene, designated yellow terminal deficiencies (yTD). Breaks that place the end of
the chromosome at the yellow promoter or within the
yellow transcription unit result in the y1-like
phenotype (Fig. 1). Transposition of a
promoter-containing HeT-A element to the end of a deficient
chromosome should activate yellow expression in bristles
(y2-like phenotype) if the yellow translation
start site has not been deleted. This model system provides a simple
genetic screen for monitoring HeT-A additions.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Minimal promoter region responsible for
yellow activation at the tip of the terminal deficiencies.
(A) A schematic presentation of terminal yellow deficiencies
associated with different y phenotypes. The localization of
regulatory regions, promoter, and start of translation are indicated
according to the transcription start site of the yellow
gene. The coding yellow region is shown as a black box. The
sequence and localization of the yellow promoter is
presented. The start of yellow transcription is shown by an
arrow. The translation start codon (ATG) is indicated. The thin
horizontal lines show the regions of yellow sequence in
which the termini of the yTD line that
correspond to the same class of y phenotype have been mapped. A
BamHI-KpnI genomic fragment used as a probe for
Southern blot analysis is indicated by a thick line in the upper part
of the figure. Restriction enzyme abbreviations: B, BamHI;
K, KpnI. (B) Scheme used to study the correlation between
the DNA structure and y phenotype. In subsequent generations two or
three yTD/yac sisters displaying either the
y2-like or the yv or y1-like
phenotype were crossed individually with yac males. Other
females in groups of six to eight were combined according to their
phenotypes and used for DNA preparation. (C) Southern blot analysis of
DNAs prepared from six to eight yTD/yac sisters
displaying either y2-like or yv or
y1-like phenotype. DNAs were digested with KpnI.
The filter was hybridized with the BamHI-KpnI
probe.
|
|
To establish the model system we determined the minimal regulatory
region in the deficient chromosomes that allows
yellow activation in bristles (Fig.
1). By Southern blot analysis four
lines
carrying deficiencies terminating in the region from
400
bp to
300
bp upstream of the
yellow transcription start site
were
selected. Flies of these lines displayed a y
2-like
phenotype due to
yellow activation in bristles by the
enhancer
located in the
yellow intron (
2,
24,
32). The
yellow terminal
deficiencies displaying a
y
2-like phenotype were designated as
y2TD. The
y2TD/yac
females were crossed individually with
yac males. After
several
generations exceptional flies with variegated bristle
pigmentation
(y
v phenotype) were found among
y2-like females (Fig.
1). A few of the
y2-like and
yv-like
females were taken for DNA preparation; other
yv
females and their
y2-like sisters were crossed
individually with
yac males (Fig.
1B).
Among their progeny
yv females gave rise to
y1-like (designated
y1TD)
females. In the next generation all progeny exhibited a y
1
phenotype. DNA was isolated from groups of six to eight sisters
with
the same phenotype, as shown in Fig.
1B.
Southern blot analysis (Fig.
1C) showed that the distance between the
end of the chromosome and the transcription start site
was 140 bp or
more in
y2-like flies and less than 70 bp in
y1-like flies. It varied from 140 to 70 bp in
yv-like flies. Thus, deficiency chromosomes that
terminate at position
70 bp have slightly less than the minimal
sequence necessary
to express the
yellow gene in any
tissue.
The model system also allowed us to identify additions of HeT-A
elements into the ends of these deficient chromosomes. Transposition
of
a
HeT-A element onto the end of the deficient chromosome can
be detected visually in progeny of
y1TD females
carrying a terminal deficiency chromosome broken in the
interval
between
70 bp and +171 bp (the position of the translation
start
codon of the
yellow gene). Such transposition produces
y2-like progeny of
y1-like parents. If the
HeT-A element
is attached to the
yellow sequence downstream of +171 bp,
the bristle pigmentation is not
restored. As the deficiency terminus
loses about 70 bp per generation
on average (
2-6,
27,
42),
the interval between
70 bp and
+171 bp is expected to be lost over a
period of three
generations.
The frequency of the HeT-A transposition to the broken
chromosome terminus in the yellow gene depends on the
genotype.
The above system was used to determine the frequency of
HeT-A transposition. We obtained nine independent
y2TD/yac lines that had a terminally deficient
chromosome broken approximately 300 bp upstream of the
yellow transcription start site. The terminal yellow deficiencies in these lines originated as described
previously (35) from single females after crosses with
different laboratory strains, such as those with the genotype
y1w or yacw or
yacw+ or Oregon-R. As a result, the
lines had similar but not identical chromosomal contexts.
y2TD/yac lines were propagated for several
generations, and newly arising
y1-like females
were crossed individually with
yac males for three
subsequent generations. For any of the nine
y1TD/yac lines we examined 6,000 to 14,000 flies
(altogether about
65,000 flies were examined). Approximately the same
number of
flies from each generation was
scored.
The appearance of
y2-like flies among the
y1-like offspring was observed in only one of
these lines. Fourteen independent
y1 
y2 transitions were found among ca. 6,900 flies
scored; i.e., the
frequency of y
2-phenotype appearance was
about 2 × 10
3. No
y2-like
females were found in the other eight
y1TD/yac
lines (58,100 flies scored). Thus, the frequency of terminal
elongation
in these lines was lower than 2 × 10
5. These
results suggest that the frequency of the
HeT-A
transposition
strongly depends on the particular chromosomal context of
the
line.
To determine the molecular nature of
y1 y2 transitions, the DNAs of the
y2-like derivatives were studied with the aid of
Southern blot analysis
(Fig.
2). In all
y2-like alleles, the appearance of an additional
DNA sequence at
the broken end was observed. The sizes of DNA additions
were measured
by Southern blot hybridization of genomic DNA restricted
with
NruI, which usually does not cleave
HeT-A
DNA (
5); and the
sizes varied from 1.4 to 6.6 kb. These
y2 derivatives were referred to as
yhTD (
HeT-A-healed terminal
deletions) and numbered from 1 to 14.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
HeT-A transpositions to the broken chromosome
terminus in the yellow gene. (A) Partial restriction map of
the wild-type yellow gene region, indicating the position of
the BamHI-KpnI probe that was used for Southern
blot analysis. The coding yellow region is shown as a black
box. Restriction enzyme abbreviations: B, BamHI; K,
KpnI; N, NruI. The primers in the
HeT-A element and the yellow gene used for DNA
amplification are shown by arrows. (B) HeT-A additions as
indicated by Southern blot hybridization of genomic DNA restricted with
NruI and probed with the BamHI-KpnI
fragment. The NruI site is at position +1835 relative to the
transcription start site of the yellow gene. (C) Attachment
points of HeT-A elements in the yellow gene. The
start of yellow transcription is shown by a bent arrow. The
translation start codon ATG is underlined. The points of
HeT-A attachment are shown by small arrows. The attachment
of HeT-A in the yhTD3 line is
indicated by a large arrow. One or two A bases at the junctions may
originate either from the receding yellow sequences or from
the oligo(A) tail of the 3' end of the attached HeT-A
element.
|
|
To directly show the transposition of the
HeT-A elements to
ends broken at
yellow, we amplified by PCR the DNA between
primers
in the
yellow coding region and the 3' region of the
HeT-A element
(Fig.
2). The junctions between mobile
elements and the
yellow gene were sequenced in eight
y2-like derivatives (Fig.
2C). In all cases, a
string of adenine
residues was present between the
yellow and
HeT-A sequences. The
3'
HeT-A sequences (5' CCTCCACCAGCAAAGTT 3')
were highly conserved
and identical to the previously
sequenced
HeT-A elements (
4,
5,
6). These results
suggest that
HeT-A addition to broken
chromosomal termini
occurs through transposition if the homologous
sequences allowing gene
conversion (
35) are
absent.
Estimation of a minimal HeT-A region that is sufficient
for maintaining yellow expression in bristles.
In
order to monitor the fate of the HeT-A element attached
previously to the yellow sequences, we first determined the
minimal HeT-A region sufficient for yellow
expression in bristles (Fig. 3). For this
the yhTD3 line, carrying a yellow
deficiency terminating with a 1.4-kb HeT-A sequence, was
selected (Fig. 2B). Using Southern blot hybridization of DNA from the
progeny of individual yhTD3/yac females, two
yhTD3 sublines carrying yellow
terminal deficiencies with an approximately 500-bp HeT-A
sequence attached were isolated. These yhTD3/yac
females were crossed individually with yac males; after
several generations some females acquired variegated bristle
pigmentation (yv phenotype). Sisters displaying either
y2-like or yv phenotypes were mated
individually with yacw males (Fig. 3B). Six to eight
y2-like or yv sisters
were collected for DNA preparation and Southern blot analysis. In the
next generation, the progeny of yv females
displayed the y1-like phenotype, whereas progeny
of y2-like sisters acquired variegated bristle
pigmentation. Again, six to eight sisters displaying either the
y1-like or yv phenotype were collected for DNA
preparation.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Minimal region of the HeT-A element which is
sufficient for compensation of the yellow promoter deletion
at the tip of the X chromosome. (A) Scheme of terminal deficiencies
associated with different y phenotypes. The yellow coding
region is shown by a black box. The thin horizontal lines in the lower
part of the scheme show the regions of the HeT-A element
(numbered from the 3' HeT-A end) in which termini that
correspond to the y phenotype have been mapped. The figures show the
distance from the first nucleotide of the 3' end of the
HeT-A element. Restriction enzyme abbreviation: H,
SphI. Other designations are as in Fig. 1. (B) The scheme
used to study the relationship between the length of the terminal
HeT-A element and the y phenotype. (C) Southern blot
analysis of yhTD3/yac sisters displaying
y2-like, yv, or y1-like phenotypes.
DNAs were digested with SphI. The filter was hybridized with
the BamHI-KpnI fragment indicated by the thick
line in panel A. The SphI site is 1435 bp from the
HeT-A attachment in yhTD3.
|
|
The results of Southern blot analysis showed that the terminal
HeT-A element was longer than 400 bp in
y2-like flies and shorter than 300 bp in
y1-like flies (Fig.
3C). The size of the
HeT-A element varied from
300 to 400 bp in
yv flies. Thus, 400 bp of the
HeT-A
3' terminus is sufficient for
wild-type levels of
yellow
expression in
bristles.
Detection of new HeT-A attachments to the terminal
HeT-A element.
As shown above, the presence of less
than 300 bp from the 3' end of HeT-A does not compensate for
the absence of the yellow promoter. It may be expected that
the attachment of a new HeT-A element should restore the
yellow activation. If this is the case, it is possible to
monitor the addition of novel HeT-A elements to a
preexisting HeT-A element by visual analysis of bristle pigmentation.
To monitor the behavior of receding
HeT-A termini, we
obtained four
yhTD3 sublines started from a
single
yhTD3 female. These lines were termed A,
B, C, and D. At the beginning
of the experiment the X chromosome in all
four sublines carried
about 400 bp of
HeT-A sequence
attached at position +152 bp of
yellow sequence and as a
result displayed a y
2-like phenotype. In the offspring of
yhTD3/yac females we selected females with
y
1-like phenotype and individually crossed them with
yac males for
three successive generations. For any of four
yhTD3 lines we examined about 14,000 flies
(altogether 53,500 flies
were scored). In all sublines,
y2-like females were found as single events (31 cases) or in clusters
(10 cases). Sixty-four
y2-like females were found altogether. This
gives an average frequency
of y
1y
2 phenotype
transition of ca. 1.2 × 10
3.
DNA was prepared from the offspring of these selected
y2-like females for Southern blot analysis (Fig.
4). Many
HeT-A elements
have
sites for
KpnI and
EcoRI restriction
endonucleases at the
3' end, have sites for
SpeI and
EcoRV in the central region, and
have no sites for
NruI (
4-6). On the other hand, all these
endonucleases
have sites in the
yellow transcription unit in
the vicinity of
the
HeT-A attachment (Fig.
4A). Therefore,
these enzymes were
used for DNA hydrolysis. The
BamHI-
KpnI fragment subcloned from
the
yellow gene was used as a probe (Fig.
4).
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Molecular additions to the tip of the X chromosome. (A)
Partial restriction map of the wild-type yellow gene region,
indicating the position of sites for restriction enzymes used for
Southern blot analysis. The HeT-A addition is shown by a
shaded box. The coding yellow regions are shown by black
boxes. Restriction enzyme abbreviations: B, BamHI; K,
KpnI; E, EcoRV; H, SphI; S,
SpeI; N, NruI; R, EcoRI. Other
designations are as in Fig. 1 and 2. (B through D) Southern blot
analysis of DNAs prepared from y2-like lines.
DNAs were digested with NruI (B), EcoRI (C), and
KpnI (D). The filters were hybridized with the
BamHI-KpnI fragment.
|
|
Usually, different individual
y2-like lines
derived from the same cluster have identical restriction maps of the
new
HeT-A attachments (Fig.
4 and
5), suggesting that DNA additions
happened
at the premeiotic stage in the germ line. Most of the DNA
attachments
had
KpnI and
EcoRI sites at the 3'
end, as is typical of the 3'
end of the
HeT-A element (Fig.
5). The size of new DNA additions
varied widely, from less than 1 kb to
more than 20 kb. In the
case of large DNA additions, we could not
precisely estimate their
size because of a possible existence of
additional restriction
sites in the new DNA sequences and also due to
the low resolution
of large DNA fragments by conventional Southern blot
analysis.
For convenience, we divided the DNA attachments into two
groups
according to their size: those with a size between 0.5 and 8 kb
(Fig.
5A) and those with a size exceeding 10 kb (Fig.
5B).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Restriction map of the DNA additions to the terminal
HeT-A element as inferred from genomic Southern blot
analysis. The maps of the DNA additions obtained as clusters of
identical events are linked by vertical lines. The maps start from the
BamHI site located in the yellow gene at 39 bp
from the HeT-A attachment site in the
yhTD3 line. (A) Restriction maps of the DNA
attachments with a determined size; (B) restriction maps of the DNA
attachments with undetermined size. The lines described in Fig. 6 and 7
are underlined. Abbreviations of restriction enzymes are as in Fig.
4.
|
|
Mechanisms of attachment of short HeT-A sequences:
transposition of new HeT-A elements and terminal DNA
extension by gene conversion.
To study the mechanisms of
attachment of HeT-A sequences we cloned by PCR and sequenced
junctions between terminal HeT-A elements and new DNA
attachments (Fig. 6 and
7). Two primers were used for DNA
amplification, one located in the yellow gene and the other
in the conserved region of the HeT-A element between 330 and
460 bp from the 3' end (Fig. 4A). The latter was absent from the
terminal HeT-A element in y1-like
derivatives but present in the newly attached HeT-A
elements. The junctions were identified by comparing the relevant
sequences from y2-like derivative lines and the
original yhTD3 line.
View larger version (82K):
[in this window]
[in a new window]
|
FIG. 6.
Aligned sequences of the original HeT-A
element and four y2-like derivatives. All
sequences end with the last nucleotide at the 3' end of the original
HeT-A element. The sequences are shown in the 5'-to-3'
orientation. Only the last 350 nucleotides of aligned sequences are
shown. The small letters show the substitutions in the sequence.
Asterisks indicate missing nucleotides. Arrows represent the 3' ends of
new HeT-A elements. The sequences that may refer to the
original HeT-A element in the yhTD3
line are shown by bold letters.
|
|
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 7.
Diagram of HeT-A additions to the receding
HeT-A element. The numbers in parentheses show the
approximate sizes of the attachments. The arrows indicate the
directions of the HeT-A elements. The bold arrows correspond
to the original HeT-A element. The numbers above the arrows
indicate distances of either the 5' terminus or the 5' and 3' termini
of the HeT-A element from the 3' terminus of a standard
element. For this, the terminal HeT-A element present in the
original yhTD3 line was used (Fig. 6). A base at
the junctions may originate either from the terminal HeT-A
element or from the 3' oligo(A) tail of the new HeT-A
element. The base pairs at the junction between new and old
HeT-A elements are shown. The lowercase letters indicate
substitutions in the conserved sequence at the 3' end of the
HeT-A element.
|
|
We analyzed a total of 23
y2-like lines. In the
cases where two
y2-like lines were obtained from
the same progenitor fly, the restriction
maps and nucleotide sequences
were identical between the two lines
(Fig.
5 and
7). Further, the
structure of only independently obtained
y2-like
lines will be discussed
below.
Sequencing of four
y2 lines showed no oligo(A)
tracts. Further, the extension on the chromosome end in these lines
contained
sequences internal to the
HeT-A element
immediately 5' of the
old element and not at the 3'-most end of the
element (Fig.
6).
The newly attached DNA of these two
y2-like lines (3B2 and 3C4) contained many
nucleotide substitutions
and small gaps compared to the original
HeT-A element attached
to the
yellow terminal
deficiency in the
yhTD3 line (Fig.
6). The
presence of multiple changes in the DNA sequence
suggests the DNA
elongation by gene conversion on the template
of a homologous, but not
identical,
HeT-A sequence located somewhere
else in other
telomeres. In two other lines (1A2 and 1B1), the
elongated
HeT-A element had the same structure as the original,
suggesting the use of a
HeT-A element whose structure was
identical
to that of receding
HeT-A as the template (data
not
shown).
In two lines (2D1 and 3A4) we found an oligo(A) tract and the
conservative 3' end of a new
HeT-A element. However,
sequences
proximal to the
HeT-A 3' terminus contained many
nucleotide substitutions
compared to the original
HeT-A
element. This suggests that such
attachments are also generated by gene
conversion. A short, truncated
HeT-A element and the 3'
terminus of an adjacent
HeT-A element
may serve as the
template in this
case.
All these attachments were no longer than 2.7 kb. This is consistent
with our previous observation that the average length
of converted
tracts as determined for terminal deficiencies in
the
yellow
gene was an estimated 2.6 kb (
34).
Finally, in the 3B31 line the sequence of the original
HeT-A
element was interrupted at the position of 104 bp (numbered relative
to
the 3' end of the
HeT-A element). Attached at this point
were
a short, altered sequence from another
HeT-A element
(from 301
to 330 bp), two T bases, and the 3' terminus of the third
HeT-A element (Fig.
7). The small size of the
HeT-A attachment (0.6
to 0.7 kb) and the presence of an
additional DNA tract between
the receding
HeT-A element and
the 3' end of the new
HeT-A addition
suggest DNA elongation
by gene conversion. Possibly a homologous
HeT-A region was
used as a conversion template. Thus, in 6 or
7 out of the 18 independent
HeT-A attachments tested, gene conversion
is
implicated.
In two lines (2A31 and 3B1),
HeT-A elements appear to have
used their oligo(A) tails of different lengths to attach to the
target
sites (Fig.
7). Sequences of the 3'
HeT-A ends
(5'CCAGCAAAGTT
3') were conserved as in all the cases of
HeT-A transposition
to the
yellow locus at the
deficient terminus (see above). These
observations suggest DNA
elongation by true transposition of the
HeT-A elements. The
size of attachments (3 to 6 kb) is also consistent
with these
data.
Two independent lines (1D11 and 1D3) displayed a more complex structure
at the junction. In the 1D11 line, the newly attached
sequence begins
with three A bases representing the oligo(A) tail
and an additional
sequence, TCAG, inserted between the oligo(A)
and the conserved 3'
terminus of the new
HeT-A element (Fig.
7).
In the 1D3 line,
we found a duplication of the
HeT-A 3' tail consisting
of
two tandem 3'
HeT-A regions (Fig.
7). The sizes of the
attachments
were 5 and 1 kb, respectively. The structures of the newly
attached
HeT-A sequences in the 1D11 and 1D3 lines are
difficult to explain
in terms of either of the two terminal DNA
elongation mechanisms
discussed here. Still, neither of them can be
ruled
out.
The large HeT-A attachments may be generated by
an alternative mechanism.
Seven independent DNA
attachments (1A1, 2A11, 2B2, 2B4, 2D3, 3C11, and 3C2) belong to
the second group characterized by extension exceeding 10 kb (Fig. 5B).
Apart from large size, all these DNA attachments (Fig.
7) begin with an
oligo(A) tail and a conserved 3' end typical of
HeT-A elements. Sequence comparison revealed that the target
HeT-A
element
contains several A bases at the junction. Thus, some of these
A
bases may belong to either the oligo(A) of the new
HeT-A
element
or the target
HeT-A element. All of these newly
attached
HeT-A elements bear different base substitutions in
the normally conserved
3' terminal GTT triplet. The generation of such
DNA attachments
as well as their large size may not be explained
by
HeT-A transposition
or gene conversion. The presence of
several A bases at the target
sequence, the extremely large size of DNA
attachments, and the
aberrant 3' terminal sequence suggest that they
were formed as
a result of recombination between the receding
HeT-A element at
the
yellow locus and some other
telomeric
HeT-A element rather
than transposition (see
Discussion).
| |
DISCUSSION |
Transposition of HeT-A elements to terminally deficient
X chromosomes.
The HeT-A element has a promoter at the
3' end (16). Here, we show that the 400-bp sequence at the
3' end of the HeT-A element is sufficient for activation of
yellow expression in bristles. Specific activation of
yellow transcription by the HeT-A promoter in
bristles only is probably due to the presence of the bristle enhancer
located in the yellow intron. The body and wing enhancers are upstream of the yellow promoter and have been removed. A
possible role of the HeT-A promoter specificity should also
be considered.
The attachment of
HeT-A or
TART elements to the
terminally deficient X chromosome may be considered real transposition
events
because of the absence of extended homology between the mobile
elements and target site within the
yellow locus, which is
necessary
for DNA elongation by gene conversion. In all cases, the
oligo(A)
track and the conserved 3' end sequence of
HeT-A
necessary for
transposition were found at the junction, confirming the
transposition
mechanism for
HeT-A attachments
(
4-6; this study). The joining
of the 3' end of
TART or
HeT-A to the broken end is explained
by a
model for terminal transposition in which reverse transcription
of the
retrotransposon is initiated at its 3' end by using the
chromosome end
as a primer (
4,
5,
7,
8,
28,
33,
38,
42,
45). This model
explains the invariant orientation
of the
HeT-A and
TART copies which were isolated from native
telomere.
The genetic system described here selectively visualizes only
attachments of
HeT-A elements. The
TART element
seems to contain
no promoter at the 3' terminus (
19), and
its attachments seem
to fail to support
yellow expression.
We found that the frequency
of
HeT-A additions to the
yellow sequences was relatively low
and depended strongly on
chromosomal
context.
Attachment of a new HeT-A element to the terminal HeT-A
may occur by different mechanisms.
Recombination of repetitive
telomeric ends has been considered an alternative reserve pathway for
telomere elongation (8, 9, 11, 15, 29, 31, 34, 38, 39, 40,
46). Indirect evidence exists that telomeres of
Chironomus and Anopheles gambiae are extended by
recombination and gene conversion mechanisms involving long complex
terminal repeats (8, 15, 31, 39). This pathway has been well
documented for yeast, where telomeres are extended by telomerase, but
recombination and/or gene conversion serves as an efficient bypass
mechanism for chromosome length maintenance when telomerase is inactive
(11, 12, 29, 38). Recombination has also been suggested as
the mechanism for telomere maintenance in several immortalized human
cell lines that harbor no telomerase activity (10, 13, 14, 25, 26,
43, 44). Thus, recombination-based mechanisms are present in most
organisms as an alternative mechanism of unregulated telomere
elongation (37). Normally, the recombination pathway may be
blocked by a special class of telomere-bound proteins and may be
tightly regulated during DNA replication (38).
Previous data (
4,
5) and our observations showed that the
attachment of new
HeT-A element(s) to the receding end of
a
terminal
HeT-A element happened with a rather high
frequency.
However, in contrast to previous observations, we found that
DNA
elongation did not occur only by transposition of the mobile
elements.
Short DNA attachments were more frequently generated by DNA
extension
through conversion using homologous
HeT-A
sequences located on
another telomere as a template. The average size
of DNA extensions
is approximately the same as that obtained in the
experiments
with terminal DNA elongation of the
yellow
sequences by conversion
mechanisms (
35). Sometimes the 3'
sequence of a new
HeT-A element
was found in close vicinity
to the start of the conversion track.
This may reflect the structure of
telomeres, which often contain
arrays of truncated 3' ends of
HeT-A elements (
17,
28,
37).
The mechanism of long DNA attachments.
Unexpectedly, many
HeT-A attachments had a large size exceeding severalfold the
size expected for the full-length transcript of the HeT-A
element (17, 38). Interestingly, the large DNA attachments
occur frequently. Previously, among four independent HeT-A
attachments to a terminal HeT-A, two exceeded 14 kb
(5). In our experiments they comprised 13 of 33 DNA
elongations. The second feature of this class of attachments is the
presence of substitutions in the 3' terminal nucleotides of the
HeT-A element. These nucleotides were conserved among all 10 studied HeT-A additions to the terminal yellow
sequences, suggesting their importance for transposition. These
observations argue against the transposition mechanism for the long DNA attachments.
The existence of a small amount of high-molecular-weight RNA homologous
to
HeT-A (
19) still does not allow one to exclude
the transposition of long
HeT-A arrays via an RNA
intermediate.
This minor fraction of
HeT-A RNA is thought to
represent readthrough
transcripts of tandem
HeT-A elements
(
19). However, it is difficult
to imagine that such long
transcripts are much more efficient
in transposition than the truncated
or full-length
HeT-A transcripts.
It is more likely that the large DNA attachments are generated by
site-specific recombination using several A bases at the
terminal
HeT-A and the oligo(A) tail of a
HeT-A located at
another
telomere. As a result, a large fragment of telomere sequence is
transferred to the chromosome
end.
Analysis of the sequenced
HeT-A elements showed that the 3'
noncoding region of
HeT-A was rather conserved, and only a
few
HeT-A subfamilies existed (
17,
18). This
conservation of sequences
within
HeT-A subfamilies is
difficult to explain from the viewpoint
that telomeres are elongated
only by transposition of
HeT-A elements
via an RNA-templated
step. Rapid sequence change has been reported
for many elements with
an RNA-based step in replication (
20).
The conservation
of
HeT-A sequence was explained by postulating
a limited
number of replicatively active
HeT-A elements
(
17).
In this case, the majority of elements in the genome
would be
separated from a transcriptionally active
HeT-A
element by only
one step of reverse transcription. Another explanation
may be
that the homogeneity of
HeT-A sequences has been
established by
a conversion and/or recombination mechanism. The same
mechanism
was suggested to explain the gradient homogenization of
termini
in the yeast (
12); the sequences closest to the ends
share the
highest degree of homology. More likely, both mechanisms are
responsible
for the
HeT-A conservation and for telomere
elongation.
| |
ACKNOWLEDGMENTS |
We are sincerely grateful to James Mason for critical reading of
the manuscript, corrections, and comments. We also are greatly indebted
to Tatyana Loukianova for manuscript editing and to the anonymous
reviewers for helpful suggestions. We greatly appreciate A. Soldatov's
help with DNA sequencing.
This work was supported by the Russian State Program "Frontiers in
Genetics," by the Russian Foundation for Basic Research, and by an
International Research Scholar award from the Howard Hughes Medical
Institute to P.G.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Gene Biology, Russian Academy of Sciences, 34/5 Vavilov St., 117334 Moscow, Russia. Phone: 7-095-1359734. Fax: 7-095-1354105. E-mail:
pgeorg&biogen.msk.su and
gpg{at}mx.ibg.relarn.ru.
| |
REFERENCES |
| 1.
|
Ashburner, M.
1989.
Drosophila: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 2.
|
Biessmann, H., and J. M. Mason.
1988.
Progressive loss of DNA sequences from terminal chromosome deficiencies in Drosophila melanogaster.
EMBO J.
7:1081-1086[Medline].
|
| 3.
|
Biessmann, H.,
S. B. Carter, and J. M. Mason.
1990.
Chromosome ends in Drosophila without telomeric DNA sequences.
Proc. Natl. Acad. Sci. USA
87:1758-1761[Abstract/Free Full Text].
|
| 4.
|
Biessmann, H.,
J. M. Mason,
K. Ferry,
M. d'Hulst,
K. Valgeirsdottir,
K. L. Traverse, and M. L. Pardue.
1990.
Addition of telomere-associated HeT DNA sequences "heals" broken chromosome ends in Drosophila.
Cell
61:663-673[CrossRef][Medline].
|
| 5.
|
Biessmann, H.,
L. E. Champion,
K. O'Hair,
K. Ikenaga,
B. Kasravi, and J. M. Mason.
1992.
Frequent transpositions of Drosophila melanogaster HeT-A transposable elements to receding chromosome ends.
EMBO J.
11:4459-4469[Medline].
|
| 6.
|
Biessmann, H.,
K. Valgeirsdottir,
A. Lofsky,
C. Chin,
B. Ginther,
R. W. Levis, and M.-L. Pardue.
1992.
HeT-A, a transposable element specifically involved in "healing" broken chromosome ends in Drosophila melanogaster.
Mol. Cell. Biol.
12:3910-3918[Abstract/Free Full Text].
|
| 7.
|
Biessmann, H.,
M. F. Walter, and J. M. Mason.
1997.
Drosophila telomere elongation.
Ciba Found. Symp.
211:53-67[Medline].
|
| 8.
|
Biessmann, H., and J. M. Mason.
1997.
Telomere maintenance without telomerase.
Chromosoma
106:63-69[CrossRef][Medline].
|
| 9.
|
Biessmann, H.,
F. Kobeski,
M. F. Walter,
A. Kasravi, and C. W. Roth.
1998.
DNA organization and length polymorphism at the 2L telomeric region of Anopheles gambiae.
Insect Mol. Biol.
7:83-93[CrossRef][Medline].
|
| 10.
|
Blasco, M. A.,
H. W. Lee,
M. P. Hande,
E. Samper,
P. M. Lansdorp,
R. A. DePinho, and C. W. Greider.
1997.
Telomere shortening and tumor formation by mouse cells lacking telomerase RNA.
Cell
91:25-34[CrossRef][Medline].
|
| 11.
|
Blasco, M. A.,
S. M. Gasser, and J. Lingner.
1999.
Telomeres and telomerase.
Genes Dev.
13:2353-2359[Free Full Text].
|
| 12.
|
Bosco, G., and J. E. Haber.
1998.
Chromosome break-induced DNA replication leads to nonreciprocal translocations and telomere capture.
Genetics
150:1037-1047[Abstract/Free Full Text].
|
| 13.
|
Bryan, T. M.,
L. Marusic,
S. Bacchetti,
M. Namba, and R. R. Reddel.
1995.
Telomere elongation in immortal human cells without detectable telomerase activity.
EMBO J.
14:4240-4248[Medline].
|
| 14.
|
Bryan, T. M.,
A. Englezou,
J. Gupta,
S. Bacchetti, and R. R. Reddel.
1997.
The telomere lengthening in telomerase-negative immortal human cells does not involve the telomerase RNA subunit.
Hum. Mol. Genet.
6:921-926[Abstract/Free Full Text].
|
| 15.
|
Cohn, M., and J. E. Edstrom.
1992.
Telomere-associated repeats in Chironomus form discrete subfamilies generated by gene conversion.
J. Mol. Evol.
35:114-122[Medline].
|
| 16.
|
Danilevskaya, O. N.,
I. R. Arkhipova,
K. L. Traverse, and M. L. Pardue.
1997.
Promoting in tandem: the promoter for telomere transposon HeT-A and implications for the evolution of retroviral LTRs.
Cell
88:647-655[CrossRef][Medline].
|
| 17.
|
Danilevskaya, O. N.,
K. Lowenhaupt, and M. L. Pardue.
1998.
Conserved subfamilies of the Drosophila HeT-A telomere-specific retrotransposon.
Genetics
148:233-242[Abstract/Free Full Text].
|
| 18.
|
Danilevskaya, O. N.,
C. Tan,
J. Wong,
M. Alibhal, and M. L. Pardue.
1998.
Unusual features of the Drosophila melanogaster telomere transposable element HeT-A are conserved in Drosophila yakuba telomere elements.
Proc. Natl. Acad. Sci. USA
95:3770-3775[Abstract/Free Full Text].
|
| 19.
|
Danilevskaya, O. N.,
K. L. Traverse,
N. C. Hogan,
P. G. DeBaryshe, and M. L. Pardue.
1999.
The two Drosophila telomeric transposable elements have very different patterns of transcription.
Mol. Cell. Biol.
19:873-881[Abstract/Free Full Text].
|
| 20.
|
Drake, J. W.
1993.
Rates of spontaneous mutation among RNA viruses.
Proc. Natl. Acad. Sci. USA
90:4171-4175[Abstract/Free Full Text].
|
| 21.
|
Erlich, H. A.
1989.
PCR technology.
Stockton Press, New York, N.Y.
|
| 22.
|
Georgiev, P.,
T. Tikhomirova,
V. Yelagin,
T. Belenkaya,
E. Gracheva,
A. Parshikov,
M. B. Evgen'ev,
O. P. Samarina, and V. G. Corces.
1997.
Insertions of hybrid P elements in the yellow gene of Drosophila cause a large variety of mutant phenotypes.
Genetics
146:583-594[Abstract].
|
| 23.
|
Geyer, P. K.,
C. Spana, and V. G. Corces.
1986.
On the molecular mechanism of gypsy-induced mutations at the yellow locus of Drosophila melanogaster.
EMBO J.
5:2657-2662[Medline].
|
| 24.
|
Geyer, P. K., and V. G. Corces.
1987.
Separate regulatory elements are responsible for the complex pattern of tissue-specific and developmental transcription of the yellow locus in Drosophila melanogaster.
Genes Dev.
1:996-1004[Abstract/Free Full Text].
|
| 25.
|
Greider, C. W.
1996.
Telomere length regulation.
Annu. Rev. Biochem.
65:337-365[CrossRef][Medline].
|
| 26.
|
Greider, C. W.
1998.
Telomerase activity, cell proliferation, and cancer.
Proc. Natl. Acad. Sci. USA
95:90-92[Free Full Text].
|
| 27.
|
Levis, R. W.
1989.
Viable deletions of a telomere from a Drosophila chromosome.
Cell
58:791-801[CrossRef][Medline].
|
| 28.
|
Levis, R. W.,
R. Ganesan,
K. Houtchens,
L. A. Tolar, and F.-M. Sheen.
1993.
Transposons in place of telomere repeats at a Drosophila telomere.
Cell
75:1083-1093[CrossRef][Medline].
|
| 29.
|
Li, B., and A. J. Lustig.
1996.
A novel mechanism for telomere size control in Saccharomyces cerevisiae.
Genes Dev.
10:1310-1326[Abstract/Free Full Text].
|
| 30.
|
Lindsley, D. L., and G. G. Zimm.
1992.
The genome of Drosophila melanogaster.
Academic Press, New York, N.Y.
|
| 31.
|
López, C. C.,
L. Nielsen, and J.-E. Edström.
1996.
Terminal long tandem repeats in chromosomes from Chironomus pallidivittatus.
Mol. Cell. Biol.
16:3285-3290[Abstract].
|
| 32.
|
Martin, M.,
Y. B. Meng, and W. Chia.
1989.
Regulatory elements involved in the tissue-specific expression of the yellow gene of Drosophila.
Mol. Gen. Genet.
218:118-126[CrossRef][Medline].
|
| 33.
|
Mason, J. M., and H. Biessmann.
1995.
The unusual telomeres of Drosophila.
Trends Genet.
11:58-62[CrossRef][Medline].
|
| 34.
|
McEachern, M. J., and E. H. Blackburn.
1996.
Cap-prevented recombination between terminal telomeric repeat arrays (telomere CPR) maintains telomeres in Kluyveromyces lactis lacking telomerase.
Genes Dev.
10:1822-1834[Abstract/Free Full Text].
|
| 35.
|
Mikhailovsky, S.,
T. Belenkaya, and P. Georgiev.
1999.
Broken chromosome ends can be elongated by conversion in Drosophila melanogaster.
Chromosoma
108:114-120[CrossRef][Medline].
|
| 36.
|
Pardue, M. L.,
O. N. Danilevskaya,
K. Lowenhaupt,
F. Slot, and K. L. Traverse.
1996.
Drosophila telomeres: new views on chromosome evolution.
Trends Genet.
12:48-52[CrossRef][Medline].
|
| 37.
|
Pardue, M. L.,
O. N. Danilevskaya,
K. Lowenhaupt,
J. Wong, and K. Erby.
1996.
The gag coding region of the Drosophila telomeric retrotransposon, HeT-A, has an internal frame shift and a length polymorphic region.
J. Mol. Evol.
43:572-583[CrossRef][Medline].
|
| 38.
|
Pardue, M. L., and P. G. DeBaryshe.
1999.
Telomeres and telomerase: more than the end of the line.
Chromosoma
108:73-82[CrossRef][Medline].
|
| 39.
|
Pluta, A. F., and V. A. Zakian.
1989.
Recombination occurs during telomere formation in yeast.
Nature
337:429-433[CrossRef][Medline].
|
| 40.
|
Roth, C. W.,
F. Kobeski,
M. F. Walter, and H. Biessmann.
1997.
Chromosome end elongation by recombination in the mosquito Anopheles gambiae.
Mol. Cell. Biol.
17:5176-5183[Abstract].
|
| 41.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning:a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 42.
|
Sheen, F. M., and R. W. Levis.
1994.
Transposition of the LINE-like retrotransposon TART to Drosophila chromosome termini.
Proc. Natl. Acad. Sci. USA
91:12510-12514[Abstract/Free Full Text].
|
| 43.
|
Stoppler, H.,
D. P. Hartmann,
L. Sherman, and R. Schlegel.
1997.
The human papilloma virus type 16 E6 and E7 oncoproteins dissociate cellular telomerase activity from the maintenance of telomere length.
J. Biol. Chem.
272:13332-13337[Abstract/Free Full Text].
|
| 44.
|
Strahl, C., and E. H. Blackburn.
1996.
Effects of reverse transcriptase inhibitors on telomere length and telomerase activity in two immortalized human cell lines.
Mol. Cell. Biol.
16:53-65[Abstract].
|
| 45.
|
Traverse, K. L., and M. L. Pardue.
1988.
A spontaneously opened ring chromosome of Drosophila melanogaster has acquired He-T DNA sequences at both new telomeres.
Proc. Natl. Acad. Sci. USA
85:8116-8120[Abstract/Free Full Text].
|
| 46.
|
Wang, S. S., and V. A. Zakian.
1990.
Telomere-telomere recombination provides an express pathway for telomere acquisition.
Nature
345:456-458[CrossRef][Medline].
|
Molecular and Cellular Biology, October 2000, p. 7634-7642, Vol. 20, No. 20
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Frydrychova, R. C., Mason, J. M., Archer, T. K.
(2008). HP1 Is Distributed Within Distinct Chromatin Domains at Drosophila Telomeres. Genetics
180: 121-131
[Abstract]
[Full Text]
-
Villasante, A., Abad, J. P., Planello, R., Mendez-Lago, M., Celniker, S. E., de Pablos, B.
(2007). Drosophila telomeric retrotransposons derived from an ancestral element that was recruited to replace telomerase. Genome Res
17: 1909-1918
[Abstract]
[Full Text]
-
Shpiz, S., Kwon, D., Uneva, A., Kim, M., Klenov, M., Rozovsky, Y., Georgiev, P., Savitsky, M., Kalmykova, A.
(2007). Characterization of Drosophila Telomeric Retroelement TAHRE: Transcription, Transpositions, and RNAi-based Regulation of Expression. Mol Biol Evol
24: 2535-2545
[Abstract]
[Full Text]
-
Frydrychova, R. C., Biessmann, H., Konev, A. Y., Golubovsky, M. D., Johnson, J., Archer, T. K., Mason, J. M.
(2007). Transcriptional Activity of the Telomeric Retrotransposon HeT-A in Drosophila melanogaster Is Stimulated as a Consequence of Subterminal Deficiencies at Homologous and Nonhomologous Telomeres. Mol. Cell. Biol.
27: 4991-5001
[Abstract]
[Full Text]
-
Savitsky, M., Kwon, D., Georgiev, P., Kalmykova, A., Gvozdev, V.
(2006). Telomere elongation is under the control of the RNAi-based mechanism in the Drosophila germline. Genes Dev.
20: 345-354
[Abstract]
[Full Text]
-
Andreyeva, E. N., Belyaeva, E. S., Semeshin, V. F., Pokholkova, G. V., Zhimulev, I. F.
(2005). Three distinct chromatin domains in telomere ends of polytene chromosomes in Drosophila melanogaster Tel mutants. J. Cell Sci.
118: 5465-5477
[Abstract]
[Full Text]
-
Biessmann, H., Prasad, S., Semeshin, V. F., Andreyeva, E. N., Nguyen, Q., Walter, M. F., Mason, J. M.
(2005). Two Distinct Domains in Drosophila melanogaster Telomeres. Genetics
171: 1767-1777
[Abstract]
[Full Text]
-
Melnikova, L., Biessmann, H., Georgiev, P.
(2005). The Ku Protein Complex Is Involved in Length Regulation of Drosophila Telomeres. Genetics
170: 221-235
[Abstract]
[Full Text]
-
Abad, J. P., de Pablos, B., Osoegawa, K., de Jong, P. J., Martin-Gallardo, A., Villasante, A.
(2004). Genomic Analysis of Drosophila melanogaster Telomeres: Full-length Copies of HeT-A and TART Elements at Telomeres. Mol Biol Evol
21: 1613-1619
[Abstract]
[Full Text]
-
Abad, J. P., de Pablos, B., Osoegawa, K., de Jong, P. J., Martin-Gallardo, A., Villasante, A.
(2004). TAHRE, a Novel Telomeric Retrotransposon from Drosophila melanogaster, Reveals the Origin of Drosophila Telomeres. Mol Biol Evol
21: 1620-1624
[Abstract]
[Full Text]
-
Savitsky, M., Kahn, T., Pomerantseva, E., Georgiev, P.
(2003). Transvection at the End of the Truncated Chromosome in Drosophila melanogaster. Genetics
163: 1375-1387
[Abstract]
[Full Text]
-
Mason, J. M., Konev, A. Y., Golubovsky, M. D., Biessmann, H.
(2003). Cis- and trans-acting Influences on Telomeric Position Effect in Drosophila melanogaster Detected With a Subterminal Transgene. Genetics
163: 917-930
[Abstract]
[Full Text]
-
George, J. A., Pardue, M.-L.
(2003). The Promoter of the Heterochromatic Drosophila Telomeric Retrotransposon, HeT-A, Is Active When Moved Into Euchromatic Locations. Genetics
163: 625-635
[Abstract]
[Full Text]
-
Melnikova, L., Georgiev, P.
(2002). Enhancer of terminal gene conversion, a New Mutation in Drosophila melanogaster That Induces Telomere Elongation by Gene Conversion. Genetics
162: 1301-1312
[Abstract]
[Full Text]
-
Casacuberta, E., Pardue, M.-L.
(2002). Coevolution of the Telomeric Retrotransposons Across Drosophila Species. Genetics
161: 1113-1124
[Abstract]
[Full Text]
-
Savitsky, M., Kravchuk, O., Melnikova, L., Georgiev, P.
(2002). Heterochromatin Protein 1 Is Involved in Control of Telomere Elongation in Drosophila melanogaster. Mol. Cell. Biol.
22: 3204-3218
[Abstract]
[Full Text]
-
Melnikova, L., Gause, M., Georgiev, P.
(2002). The gypsy Insulators Flanking yellow Enhancers Do Not Form a Separate Transcriptional Domain in Drosophila melanogaster: The Enhancers Can Activate an Isolated yellow Promoter. Genetics
160: 1549-1560
[Abstract]
[Full Text]
-
Siriaco, G. M., Cenci, G., Haoudi, A., Champion, L. E., Zhou, C., Gatti, M., Mason, J. M.
(2002). Telomere elongation (Tel), a New Mutation in Drosophila melanogaster That Produces Long Telomeres. Genetics
160: 235-245
[Abstract]
[Full Text]
Top
Abstract
Introduction
