Previous Article | Next Article 
Molecular and Cellular Biology, October 2000, p. 7654-7661, Vol. 20, No. 20
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Regulation of Yeast H+-ATPase by Protein Kinases
Belonging to a Family Dedicated to Activation of Plasma
Membrane Transporters
Alain
Goossens,1
Natalia
de la Fuente,2
Javier
Forment,1
Ramon
Serrano,1,* and
Francisco
Portillo2
Instituto de Biologia Molecular y Celular de
Plantas, Universidad Politecnica de Valencia-C.S.I.C., 46022 Valencia,1 and Instituto de
Investigaciones Biomedicas, Universidad Autonoma de
Madrid-C.S.I.C., 28029 Madrid,2 Spain
Received 9 June 2000/Returned for modification 19 July
2000/Accepted 31 July 2000
 |
ABSTRACT |
The regulation of electrical membrane potential is a fundamental
property of living cells. This biophysical parameter determines nutrient uptake, intracellular potassium and turgor, uptake of toxic
cations, and stress responses. In fungi and plants, an important determinant of membrane potential is the electrogenic proton-pumping ATPase, but the systems that modulate its activity remain largely unknown. We have characterized two genes from Saccharomyces
cerevisiae, PTK2 and HRK1
(YOR267c), that encode protein kinases implicated in
activation of the yeast plasma membrane H+-ATPase
(Pma1) in response to glucose metabolism. These kinases mediate,
directly or indirectly, an increase in affinity of Pma1 for ATP,
which probably involves Ser-899 phosphorylation. Ptk2 has the strongest
effect on Pma1, and ptk2 mutants exhibit a pleiotropic phenotype of tolerance to toxic cations, including sodium, lithium, manganese, tetramethylammonium, hygromycin B, and norspermidine. A
plausible interpretation is that ptk2 mutants have a
decreased membrane potential and that diverse cation transporters are
voltage dependent. Accordingly, ptk2 mutants exhibited
reduced uptake of lithium and methylammonium. Ptk2 and Hrk1 belong to a
subgroup of yeast protein kinases dedicated to the regulation of plasma membrane transporters, which include Npr1 (regulator of Gap1 and Tat2
amino acid transporters) and Hal4 and Hal5 (regulators of Trk1 and Trk2
potassium transporters).
 |
INTRODUCTION |
The plasma membrane
H+-ATPase plays a crucial role in the
physiology of fungi and plants (51, 52), and the activity of this electrogenic proton pump must be finely regulated to match the
requirements for nutrient uptake, osmotic balance, ion
homeostasis, and stress tolerance. Accordingly,
H+-ATPase activities correlate with growth
rates (42) and stress responses (4, 32, 39).
One mechanism of plasma membrane H+-ATPase
regulation occurs at the transcriptional level. In the yeast
Saccharomyces cerevisiae, the transcription factors
Rap1 and Gcr1 mediate the increase in H+-ATPase
expression triggered by glucose metabolism. On the other hand,
the transcription factor Gln3 determines increased expression of the
enzyme under conditions of ammonium starvation. In addition to these
nutritional responses, the H+-ATPase gene
(PMA1) is also regulated by the Mcm1 transcription factor,
which connects the proton pump with regulatory pathways for cell growth
cycle and cell wall integrity (40).
The H+-ATPase activity is reversibly regulated by
several nutritional, environmental, and stress factors. The mechanism
of this posttranslational regulation is similar in yeasts and plants: the activators overcome negative regulation by an inhibitory domain located at the carboxyl terminus of the enzyme (40, 43). In S. cerevisiae, glucose metabolism activates the ATPase
(49) and increases its proton-pumping efficiency
(59), as required by the high growth rate induced by this
preferred carbon source (15). Several conserved residues at
the carboxyl terminus play an important role in the glucose activation
of yeast H+-ATPase, and they include the potential
phosphorylation sites Ser-899 and Thr-912 (12, 44).
Very little is known about the machinery mediating activation of fungal
and plant H+-ATPases. Preliminary evidence points
to phosphorylation of the inhibitory domain as part of the activating
mechanism (40). In yeast cells, the results of site-directed
mutagenesis suggest that phosphorylation of Ser-899 activates the
H+-ATPase (12), but the nature of the
protein kinase(s) participating in this activation is not clear.
Glucose metabolism in yeast is known to activate protein kinase A
(61), but this kinase does not seem to participate in the
glucose activation of the H+-ATPase (30,
37).
Genetic analysis of the machinery which activates yeast
H+-ATPase has been complicated by the fact that
mutations in multiple genes affecting the level of expression of the
enzyme (see above) mimic the effect of mutations in the activation
system (16). In addition, the presence in centromeric
genomic libraries of several allele-nonspecific
suppressors which increase the expression level of the
H+-ATPase further complicates genetic analysis (N. de la Fuente, A. Goossens, R. Serrano, and F. Portillo, unpublished
results). Biochemical analysis of H+-ATPase
phosphorylation in isolated membranes has demonstrated the
participation of casein kinase I. The activity of this essential and
multifunctional kinase is inhibitory for the
H+-ATPase, and the existence of another, yet
uncharacterized, "upregulating" kinase activated by glucose was
postulated (13). Actually, a correlation between
glucose-induced phosphorylation and activation of yeast
H+-ATPase has been demonstrated (6).
In the present work, a genetic screen based on lithium tolerance and a
systematic analysis of mutant phenotypes of yeast protein kinases have
converged on the identification of a protein kinase, Ptk2, which
mediates the Ser-899-dependent part of the glucose activation of yeast
H+-ATPase. This kinase belongs to a subfamily
of protein kinases dedicated to the regulation of plasma membrane transporters.
 |
MATERIALS AND METHODS |
Yeast strains, culture conditions, and analysis of salt
tolerance.
The S. cerevisiae strains used for this
work, with the exception of those described in the next section, are
listed in Table 1. Strains were derived
by transformation (24), and crosses and standard methods for
yeast culture and manipulation were used (18, 54). In order
to test for tolerance to toxic salts, the different strains were grown
to saturation (48 h) in liquid synthetic minimal medium (SD) containing
2% glucose, 0.7% yeast nitrogen base without amino acids (Difco,
Detroit, Mich.), 50 mM succinic acid adjusted to pH 5.5 with Tris base,
and adenine (30 µg/ml), histidine (30 µg/ml), leucine (100 µg/ml), tryptophan (80 µg/ml), and uracil (30 µg/ml) as required
by the different strains. Cultures were diluted 10-, 100-, and
1,000-fold, and volumes of about 3 µl were dropped with a stainless
steel replicator (Sigma, St. Louis, Mo.) on plates containing 2% Bacto
Agar (Difco) and either SD or rich medium with the toxic cations. Rich
medium (YPD) contained 1% yeast extract (Difco), 2% Bacto Peptone
(Difco), and 2% glucose. MnCl2, norspermidine, and
hygromycin B were added to the autoclaved medium before it was poured.
All the other salts and sorbitol were added before autoclaving. In the
case of SD plates with acetic acid, no succinic acid was included, but
pH was also adjusted to pH 5.5 with Tris.
Isolation and genetic analysis of sen mutants.
Spontaneous mutations which suppressed the lithium sensitivity of
strain SKY697 (ena1-4::HIS3 derivative
of W303-1A) were isolated as colonies growing after 7 days in SD plates
supplemented with methionine (100 µg/ml) and 50 mM LiCl. The salt
tolerance mutations were designated sen for suppression of
ena1-4 and appeared with a frequency of about
10
5. Such a high frequency may reflect the large number
of genes related to salt homeostasis in yeast (10). Of 250 independent mutants, 6 were selected as the most resistant in plates
with 75 mM LiCl. After crossing with strain AG86 (ena1-4 but
opposite mating type to SKY697), sporulation, and tetrad dissection,
all six mutations proved to be monogenic recessive and defined two complementation groups: sen1 with one allele
(sen1-1) and sen2 with five alleles
(sen2-1 to sen2-5).
Sequencing of the sen1-1 mutation.
A
complementation test crossing the sen1-1 mutant
(strain AG151) with the ptk2 mutant (strain AG149)
demonstrated that these mutations are allelic. A genomic
PCR with primers sp (5'-ATTCACCTTCGTCTTCTGCTG) and
asp (5'-AAGGGGAACATCCGTATCTT), corresponding to positions +202 and +683 from the start codon of the PTK2 open reading
frame, respectively (see Fig. 3), amplified a fragment in the
sen1-1 mutant of 818 bp, with an insertion of 336 bp
compared to the wild type. This fragment was sequenced using the
primers described above with a 310 ABI Prism Genetic Analyzer and cycle
sequencing (Applied Biosystems, Foster City, Calif.).
Yeast strains with disruptions of the protein kinase genes of the
NPR1 subfamily.
Yeast strains derived from W303-1A
(60) with disruptions of the SAT4/HAL4
(YCR008w) and HAL5 (YJL165c) genes have already been
described (SKY655, hal4::LEU2; SKY656,
hal5::HIS3) (33). KanMX disruptions of the other NPR1-related genes
(22) were obtained from EUROSCARF (European
Saccharomyces cerevisiae Archive for Functional
Analysis;
http://www.rz.uni -frankfurt.de/FB/fb16/mikro/euroscarf/). The disruptions in PTK2/STK2 (YJR059w), YDL214c, YDL025c,
and YOR267c were made in the FY1679 background (MATa
ura3-52 trp1-
63 leu2-
1 his3-
200) while those
of KKQ8 (YKL168c), PTK1 (YKL198c), and
NPR1 (YNL183c) were made in the BY4741 background (MAT
his3-
1 leu2-
0 ura3-
0 lys2-
0). The in
vivo and in vitro plasma membrane H+-ATPase
activities of the different mutants were referred to those of the
corresponding wild-type strain.
Cloning and disruption of PTK2 and YOR267c.
Plasmid YEp352::PTK2 was made by subcloning a
3.4-kb BamHI fragment from plasmid pYCGYJR056w (EUROSCARF)
in the BamHI site of plasmid YEp352 (multicopy and
URA3 marker) (20). Plasmid YEp352::YOR267c was made by subcloning a 3.3-kb
HindIII fragment from plasmid pYCGYOR267c
(EUROSCARF) in the HindIII site of YEp352.
Disruption of YOR267c with the
KanMX marker was made by
transformation of yeast strains with a 2.3-kb
NotI
fragment from plasmid
pYORCYOR267c (EUROSCARF). Gene disruption was
tested by genomic
PCR with primers YOR267-A1
(5'-CAAGACAGTTCCCAACCGCTTAA; 394 bp
upstream of start codon)
and YOR267-A4 (AATTCAGAATTGGTAGCTACGA;
329 bp
downstream of stop codon). The primers for the
KanMX
gene
were K2 (5'-CGATAGATTGTCGCACCTG) and K3
(5'-CCATCCTATGGAACTGCCTC).
Disruption of
PTK2 with the
KanMX marker was made
by transformation of yeast strains with a 3-kb
NotI fragment
from plasmid
pYORCYJR059w (EUROSCARF). Alternatively, a disruption
cassette
of
PTK2 with the
TRP1 marker gene was a
generous gift of R. Poulin
(Quebec, Canada). It consisted of the 3.4-kb
BamHI fragment (
26)
subcloned in pBluescript
(Stratagene, La Jolla, Calif.) and with
the
HpaI-
NdeI fragment of 2.6 kb containing all of
the
PTK2 open
reading frame (ORF) but the first 80 bp
replaced by a 3-kb fragment
containing the
TRP1 gene. Gene
disruption was tested by genomic
PCR with primers CSHT1
(5'-CATACCCGCGTCCTATAGGC; 360 bp upstream
of start
codon) and CSKY2 (5'-GGTGGTCCCGCCTGATCCGA; 277 bp
downstream
of stop
codon).
Expression of constitutively active Pma1.
The chromosomal
copy of PMA1 was placed under control of the
galactose-dependent GAL1 promoter by integrative
transformation with the URA3 plasmid pRS-61 as described
(7). The constitutively active pma1-245 mutant
ATPase, lacking the last 18 amino acids of the enzyme, was
expressed from plasmid pRS-496 (centromeric and with LEU2
marker) (43).
Replacement of pma1-Ser899Asp and
pma1-Ser899Ala mutant alleles with chromosomal wild-type
PMA1.
The pma1-Ser899Asp and
pma1-Ser899Ala mutant alleles (12) were subcloned
in plasmid pFP36 by exchange of a 2.2-kb XbaI fragment as
described (29). This plasmid contains a 5-kb
HindIII fragment including the PMA1 gene and
a downstream URA3 marker. The
pma1::URA3 fragments containing the
mutations were used for yeast transformation.
Assays for the Pma1 ATPase.
Proton efflux from the cells
was measured at pH 4.0 after starvation and readdition of glucose
(48). This assay has been demonstrated to correlate with the
in vivo activity of the Pma1 ATPase (41, 42, 48). Yeast
total membrane fraction and purified plasma membranes were isolated
with or without treatment of the cells with glucose, and specific
ATP hydrolysis corresponding to Pma1 activity was assayed (with 2 mM ATP unless otherwise indicated) (49, 50). Protein
concentration was measured with the Bio-Rad (Hercules, Calif.) protein
assay reagent and bovine globulin as the standard. The amount of Pma1
in membranes was quantified by immunoassay with specific antibody as
described (11).
Uptake of lithium and methylammonium. (i) Lithium uptake.
Cells growing in YPD medium were supplemented with 40 mM LiCl and
incubated for 90 min; the steady-state intracellular lithium concentration was measured by atomic absorption spectrometry after centrifugation, washing, and extraction of the cells as described (33).
(ii) Methylammonium uptake.
Cells were grown in SD medium,
washed, and incubated for 90 min in 50 mM succinate-Tris buffer (pH
5.5) with 2% glucose and 0.25 mM [14C]methylammonium;
the steady-state intracellular [14C]methylammonium
concentration was measured by liquid scintillation counting after
filtration and washing as described (33).
 |
RESULTS |
Mutation suppressing the lithium sensitivity of ena1-4
disruptants.
The ENA1 gene, encoding a cation extrusion
pump, is a major determinant of salt tolerance in S. cerevisiae (19). Accordingly, most screenings for
either gain or loss of salt tolerance result in mutations of either
this gene or the multiple components of its complex regulatory
system (53). In order to identify novel determinants of salt tolerance and ion homeostasis, we have performed a
screening based on the isolation of mutations suppressing the lithium
sensitivity of ena1-4 disruptants in medium supplemented with methionine. Deletion of the ENA1 gene obviated the
complex regulatory system of this important determinant of salt
tolerance (53), and methionine supplementation precluded
mutations of the salt-sensitive methionine biosynthetic pathway
(17). The use of lithium as the toxic cation instead of
sodium offered the advantage that this cation inhibits growth at
concentrations low enough to pose no osmotic problems. We considered
that this approach could lead to the regulatory system of the plasma
membrane H+-ATPase because of the observation that
mutations which decrease the activity of the enzyme result in tolerance
to toxic cations (38, 56, 57, 62).
We have characterized two complementation groups of spontaneous
recessive mutations resulting in lithium tolerance. Mutations
at the
SEN2 locus (suppressor of Ena) are the most abundant, with
frequencies of about 10
6. They confer specific lithium
tolerance and have no effect on
the sensitivity of yeast cells to other
toxic cations, such as
sodium, hygromycin B, manganese, and
tetramethylammonium. Until
now it has not been possible to clone the
responsible gene by
complementation.
One of the lithium tolerance mutations corresponded to the
SEN1 locus and exhibited pleiotropic phenotypes related to
cation
homeostasis. As indicated in Fig.
1, the
sen1-1 mutant is
tolerant
to concentrations of lithium, sodium, manganese, hygromycin B,
and tetramethylammonium which are highly toxic to wild-type cells.
On
the other hand, the mutation causes sensitivity to acetic acid
and
has no effect on sorbitol stress.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
sen1-1 and
ptk2::TRP1 mutations confer tolerance
to different toxic cations and sensitivity to acetic acid. Strain
SKY697 (wt) and its derivatives AG149 (ptk2) and AG151
(sen1) were grown in liquid SD medium to saturation, and
serial dilutions were dropped on SD plates with either NaCl (0.2 M),
LiCl (40 mM), KCl (1.2 M), sorbitol (1.8 M), acetic acid (0.12 M), or
tetramethylammonium chloride (TMA, 1 M) or on YPD plates with
MnCl2 (2 mM) or hygromycin B (HygB, 125 µg/ml), as
indicated. Growth was recorded after 2 days in the absence of toxic
cations and after 3 to 4 days in its presence.
|
|
Reduced cation accumulation and ATPase activity in the
sen1-1 mutant.
Toxic cation tolerance may be due to
reduced cellular uptake and, as indicated in Table
2, steady-state uptake of lithium and
methylammonium is reduced by the sen1-1 mutation.
Therefore, a reasonable hypothesis to explain the phenotype of
sen1-1 mutants (Fig. 1) is that the uptake of diverse
toxic cations is reduced. The cellular uptake of cations is driven by
the plasma membrane electrical potential (negative inside) (28,
52, 57), and as these toxic cations are unlikely to use a common
transporter, the results could be explained by a decrease in this
biophysical parameter as the primary effect of the sen1-1
mutation.
A simple model for the regulation of membrane potential in yeast is
that it is determined by the concerted activities of the
electrogenic
proton-pumping H
+-ATPase (the generator of
electrical potential) and of the Trk1,2
potassium uptake system, a
major consumer of electrical potential
(
28,
33). The high
rates of proton efflux balanced by potassium
uptake which can be
measured in yeast cells suggest that these
could be the most active
electrogenic systems (
48,
52). As
indicated in Fig.
2A, the
sen1-1 mutant
exhibited decreased proton-pumping
activity in vivo (26% of wild-type
value). Western blot and quantitative
scanning analysis, on the other
hand, indicated normal levels
of the enzyme (Fig.
2B). Assay
of ATP hydrolysis in isolated membranes
also indicated
decreased plasma membrane H
+-ATPase activity in the
sen1-1 mutant (70% of wild-type value;
data not shown).
Therefore, the hypothesis was advanced that the
sen1-1
mutation, by reducing the activity of the plasma membrane
H
+-ATPase, decreases the electrical potential and
the uptake of
toxic cations. The sensitivity to acetic acid of this
mutant is
in agreement with previous work demonstrating that the level
of
ATPase activity is a positive determinant of tolerance to acid
stress (
42,
57). In addition, the
sen1-1 mutant
exhibited
no growth phenotype in medium with limiting potassium
concentrations
(data not shown), at variance with mutations in the
Trk1,2 transport
system (
14,
33).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of the sen1-1 mutation on the yeast
Pma1 proton pump. Cells of strains SKY697 (wt) and AG151
(sen1 mutant) were grown in YPD, and the in vivo activity
(A) and amount (B) of the Pma1 proton-pumping ATPase were
determined as described in the text. (A) pH changes of yeast
suspensions induced by glucose. Cells (50 mg) were suspended in 10 ml
of assay buffer, and pH changes were recorded after addition of 200 µmol of glucose. Calibration with 400 nmol of HCl was made as
indicated. (B) Immunological quantification of Pma1 in yeast. Total
membrane protein (25 µg) from strains SKY697 (wild type [wt] for
PTK2, lanes 1 and 2) and AG151 (sen1-1, lanes 3 and 4) was immunodetected with anti-Pma1 antibody after sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and electroblotting. Lane 5 contains molecular size standards as indicated.
|
|
sen1-1 mutation is a "solo
-LTR" insertion in
the PTK2 gene.
As no complementation of the
sen1 mutation could be achieved with the PMA1
H+-ATPase gene, we hypothesized that it was the
regulatory system of the enzyme which was affected. Recently, a protein
kinase subfamily has been identified in yeast, the Npr1 subgroup
(22), which seems to be dedicated to the regulation of
plasma membrane transporters. Members of this subfamily regulate the
Gap1 amino acid permease (Npr1) (55, 58), polyamine uptake
mediated by an uncharacterized transporter (Ptk1,2) (25, 26,
36), and the Trk1,2 potassium transporter (Hal4,5)
(33). It was tempting to speculate that a kinase of this
subfamily could regulate the plasma membrane H+-ATPase and be responsible for the
sen1-1 mutation.
The Npr1 subfamily of yeast protein kinases has nine members, but
disruption of only two of these genes significantly affected
proton
pumping in vivo. They corresponded to YJR059w and YOR267c,
whose
disruptions resulted in rates of proton pumping that were
27 and 50%
of the wild-type value, respectively. ATP hydrolysis
by purified
plasma membranes was also reduced in the disruptions
of YJR059w and
YOR267c to 65 and 75% of the wild-type value, respectively,
but not in
the mutations of the other seven genes of the subfamily.
YJR059w
corresponds to
PTK2/STK2, the protein kinase gene previously
described as being required for polyamine transport (
26,
36).
A phenotype for YOR267c has not previously been
described.
In the process of checking the gene disruption of YJR059w, we made the
fortuitous observation that the
sen1-1 strain had an
insertion at its
PTK2 locus (Fig.
3). Cloning and sequencing
demonstrated
that this insertion corresponded to a "solo

-LTR" derived from
the yeast Ty retrotransposon (
3)
interrupting the
PTK2 ORF
at position 467. Accordingly,
disruption of the
PTK2 gene resulted
in the same pleiotropic
growth phenotypes and H
+-ATPase alterations as the
original
sen1-1 mutation (Fig.
1).
Crossing the
sen1-1 and
ptk2 strains demonstrated that these
recessive
mutations were allelic, and these results indicate that
sen1-1 is a null allele of
PTK2. The
sen1-1 and
ptk2 mutations could
be complemented
with the 3.4-kb
BamHI genomic fragment (
26,
36) containing the
PTK2 gene in the 2µm multicopy
plasmid. However,
complementation by this fragment in a single-copy,
centromeric
plasmid was only partial, as previously reported
(
36). This
can be explained if regulatory regions of the
PTK2 gene extend
into 5'- and/or 3'-flanking genes
(
CDC8 and
CBF1, respectively).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
sen1-1 mutation is a solo -LTR insertion
at the PTK2 locus. (A) Scheme of the region of chromosome X
between positions 545000 and 548000, containing the PTK2
locus and the site of insertion of a solo -LTR. The ORF spans
positions 545475 to 547931 on the w-strand, and the 336-bp insertion is
at position 545942. sp and asp correspond to the primers used for the
PCR in panel B. (B) Products of the PCR performed with chromosomal DNA
from strains SKY697 (wt) and AG151 (sen1-1 mutant) with the
primers indicated in panel A. Lane M, size markers; their sizes (in
base pairs) and that of the amplified bands are indicated at the right
and at the left of the figure, respectively.
|
|
The
ptk2 mutation affects the glucose-induced change in
Km of the plasma membrane
H
+-ATPase. The glucose activation of the
H
+-ATPase can be separated into two kinetic effects
assigned to
two independent regulatory sites within the carboxyl
terminus:
a glucose-induced decrease in the
Km
for ATP probably depends
on phosphorylation of Ser-899, while a
glucose-induced increase
in the
Vmax of the
enzyme requires Arg-909 and Thr-912 by a mechanism
more complex than
simple phosphorylation (
10,
40,
44). As
indicated in Table
3, the
ptk2 mutation blocks
the affinity (
Km)
change in the
H
+-ATPase induced by glucose, with no effect on the
increase in
Vmax. Therefore, we next
investigated the effect of mutations
at the carboxyl terminus of the
ATPase on the phenotype of the
ptk2 mutant.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Effect of glucose and of the ptk2 and
yor267c mutations on the kinetic properties of the plasma
membrane H+-ATPase
|
|
Suppression of ptk2 by mutations at the carboxyl
terminus of Pma1.
In order to investigate if Ptk2 regulates
the H+-ATPase by acting on its C-terminal
regulatory domain, we tested if deletion of this inhibitory domain,
which results in a constitutively active H+-ATPase
(43), suppressed the phenotypes of the ptk2
mutation. As indicated in Fig. 4 (column
3), ectopic expression of a truncated Pma1 ATPase in a
single-copy, centromeric plasmid partially suppressed the
tolerance to sodium and lithium caused by the ptk2 mutation. The Pma1 ATPase is known to be oligomeric, probably hexameric (1, 31, 52), and the partial nature of the suppression could be explained if the simultaneous expression of wild-type and
truncated copies resulted in mixed ATPase oligomers with only partial deregulation. Because of the essential nature of the
PMA1 gene, exclusive expression of the truncated
ATPase required the use of a yeast strain in which the
wild-type chromosomal PMA1 gene is under galactose control
and which, in glucose medium, expresses only the truncated ATPase
(43). Complete suppression of ptk2 phenotypes
could be obtained with this strain (Fig. 4, column 4). The tolerance to
hygromycin B and tetramethylammonium of the ptk2 mutant was
also suppressed by deletion of the regulatory domain of Pma1 (not
shown).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion of the inhibitory domain of Pma1 suppresses the
growth phenotypes of the ptk2 mutation. Strains SKY697 (wild
type for PTK2, column 1), AG149 (ptk2, column 2),
AG205 (ptk2 with plasmid pRS496 expressing truncated Pma1,
column 3) and AG224 (ptk2 pma1::URA3-GAL1
promoter-PMA1 with chromosomal ATPase under
galactose control and plasmid pRS496 expressing truncated Pma1, column
4) were grown in liquid SD medium to saturation, and serial dilutions
were dropped on SD plates with either NaCl (0.2 M) or LiCl (40 mM) as
indicated. Growth was recorded after 2 or 4 days in the absence or
presence of toxic cations, respectively.
|
|
Phosphorylation of Ser-899 at the C terminus has been proposed to
result in Pma1 activation because the Ser899Ala mutation
reduced
glucose activation and the Ser899Asp mutation mimicked
the
glucose-activated state (
12). As indicated in Fig.
5, the
Ser899Ala mutation of the
H
+-ATPase produced a phenotype of resistance to
sodium, hygromycin
B (Fig.
5), and lithium (not shown) similar to that
of the
ptk2 mutation. On the other hand, the
Ser899Asp-mutated H
+-ATPase suppressed the
phenotypes caused by the
ptk2 mutation.
These results are
consistent with the idea that Ptk2 acts on the
C terminus of the
ATPase through phosphorylation of Ser-899.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of mutations of Pma1 Ser-899 on tolerance to
hygromycin B and NaCl of Ptk2+ (upper panels) and
Ptk2 (lower panels) yeast cells. Wild-type yeast strain
W303-1B (PMA1 PTK2) and derivatives with
pma1-Ser899 and ptk2 mutations as indicated
(strains FPY398, FPY402, FPY1434, FPY1500, and FPY1502) were grown in
liquid medium to saturation and diluted 20-fold, and 3 µl was
dropped on YPD plates with no addition or containing hygromycin B (50 µg/ml) or NaCl (1.2 M), as indicated. Growth was recorded after 4 days.
|
|
Protein kinase YOR267c affects the sensitivity of yeast cells
to hygromycin B.
As indicated above, the protein kinase
YOR267c also affected Pma1 activity, although to a lesser extent
than Ptk2. As indicated in Table 3, in the ptk2 mutant,
glucose does not at all improve the affinity of the ATPase for
ATP, while in the case of the yor267c mutant,
glucose still increases this affinity somewhat, although to a lesser
extent than in the control strain. Also, the growth phenotypes of
mutants with gain and loss of function of YOR267c were weaker
than those of PTK2 mutants. Disruption of YOR267c increased
tolerance to hygromycin B but not to sodium (Fig.
6), lithium, or norspermidine (not
shown). Disruption of PTK2 increased the tolerance of yeast
cells to all these toxic cations. Also, overexpression of YOR267c only
partially reduced the tolerance to hygromycin B of ptk2
mutants, without affecting tolerance to NaCl (Fig. 6), lithium,
or norspermidine (not shown). Overexpression of PTK2
in either wild-type yeast, YOR267c mutants, or ptk2 mutants decreases the tolerance of yeast cells to all these toxic cations (Fig.
6 and data not shown).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of gain and loss of function of
YOR267c and PTK2 on tolerance of yeast cells to
hygromycin B and NaCl. Wild-type yeast strain (wt, FPY1506) and
derivatives with disruptions ( ) of either yor267c (strain
FPY1456) or ptk2 (FPY1459) were transformed with either
empty plasmid (YEp352) or multicopy plasmids with
YOR267c and PTK2 as indicated. Experimental
conditions were as described in the legend to Fig. 5.
|
|
 |
DISCUSSION |
The participation of the protein kinase Ptk2 in the regulation of
ion transport in yeast represents the merging of two apparently independent lines of research, polyamine transport and salt tolerance. Ptk2 was initially identified as a yeast protein kinase required for
polyamine transport (26, 36), and we now report that Ptk2 is
required for the sensitivity of yeast cells to several toxic cations,
including lithium, sodium, hygromycin B, manganese,
tetramethylammonium, and polyamines. Although previous work
suggested a direct regulation of the polyamine transporter by Ptk2
(26, 36), we interpret the effects of this kinase on cation
transport as probably being indirect. Ptk2 is required for the full
activation of the yeast plasma membrane proton pump (Pma1) by glucose
and therefore for the glucose-energized uptake of different cations
such as lithium, methylammonium, and polyamines. A plausible
interpretation is that, by activating Pma1, Ptk2 increases the
electrical membrane potential of the yeast plasma membrane, negative
inside, and that this biophysical parameter determines the uptake of
toxic cations mediated by different transport systems (Fig.
7). As it is unlikely that lithium,
tetramethylammonium, hygromycin B, and polyamines use the same
transport system, the energization of different cation transport
systems by the electrical membrane potential could explain the
pleiotropic nature of ptk2 mutations. The nature of the
polyamine transporter in yeast is not known (23). Monovalent
cations may enter yeast cells by a low-affinity transporter which has
only been identified at the electrophysiological level (45)
and which may correspond to the plant LCT1 gene
(46).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Model for the role of Pma1 and Trk1,2 on yeast salt
tolerance by modulation of the electrical membrane potential ( ),
which determines the uptake of toxic cations by different
voltage-sensitive transporters.
|
|
As indicated in the model in Fig. 7, the major determinants of plasma
membrane potential in yeast are the Pma1 proton pump (the electrical
generator) and the Trk1,2 high-affinity K+ transport
system, a major consumer of electrical potential because of the high
rates of K+ uptake in K+-starved cells
(52). Our hypothesis is that the relative activity of these
two systems sets the steady-state value of the electrical potential and
in so doing modulates the activity of secondary active transport
systems such as those involved in nutrient and toxic cation uptake. In
addition, the Pma1 and Trk1,2 systems modulate important biophysical
parameters, such as internal and external pH, cell turgor, and
intracellular K+ concentrations. Therefore, the regulation
of major determinants of ion homeostasis such as Pma1 and Trk1,2 is
crucial for cell metabolism and growth and for the sensitivity to toxic
cations. Although the absolute values of the yeast plasma membrane
potential cannot be measured by electrophysiological methods
(28), a series of indirect measurements indicate that this
biophysical parameter correlates with the uptake of cations such as
hygromycin B, methylammonium, and tetraphenylphosphonium (28, 33,
38, 57).
Mutations of the Pma1 ATPase which decrease the electrogenic
activity of the enzyme cause the same pleiotropic growth phenotypes of
tolerance to toxic cations as the ptk2 mutations described in the present work (38, 56, 62). It would be interesting to
determine the causal relationship between the different mutations affecting the activity of Pma1 and the different growth phenotypes exhibited by cells. As a tentative interpretation, the electrogenic activity of the proton pump, modified by either mutation or altered phosphorylation, would set different levels of the electrical membrane
potential (Fig. 7). Cation transporters would then exhibit a
differential response according to their specific voltage
sensitivities. The different phenotypes of YOR267c and Ptk2 protein
kinase mutants, as well as the different phenotypes exhibited by
pma1 mutants (31), may be explained by their
different levels of proton-pumping activity. Additional complications
include the fact that decreased activity of the plasma membrane
ATPase somehow enhances vacuolar compartmentation of toxic
cations (34).
Npr1, the founding member of a subfamily of yeast protein kinases,
regulates the activity and stability of the amino acid permeases Gap1
and Tat2 in response to ammonium availability, probably by direct
phosphorylation of these membrane proteins (47). We have
previously described two redundant protein kinases of the Npr1
subfamily (Hal4 and Hal5) which regulate Trk1,2, the major
high-affinity K+ transport system of yeast, in response to
K+ starvation (33). Now we report that another
member of the Npr1 group, Ptk2, regulates the yeast proton pump Pma1 in
response to glucose metabolism. In addition, two other protein kinases of the Npr1 group, Ptk1 and YOR267c, seem to modulate Pma1. Ptk1 is
highly homologous to Ptk2, and its gene was discovered as a multicopy
suppressor of the polyamine uptake defect of ptk2 mutants (25). Disruption of ptk1 causes no growth or Pma1
activity phenotype (F. Portillo, unpublished results). It could
correspond to a protein kinase similar in function to but less active
than Ptk2. Although YOR267c is much more related to Npr1 than to Ptk2,
it also regulates Pma1 activity. However, the growth phenotypes of gain
and loss of function for this kinase are restricted to hygromycin B,
and we propose to rename YOR267c HRK1, for hygromycin
resistance kinase. According to the model developed above, the unknown
transporter for hygromycin B may be more sensitive than other cation
transporters to the small changes in membrane potential determined by
the YOR267c mutations. Finally, Npr1 itself seems to regulate ion
homeostasis, because although its disruption has no significant effect
on Pma1 activity (F. Portillo, unpublished results), it reduces
polyamine transport (27) and slightly increases sodium
tolerance (S. Kron, personal communication), as if this kinase also
contributed to Pma1 activity.
The emerging picture is that yeast cells contain a subfamily of protein
kinases which are dedicated to the regulation of plasma membrane
transporters and which may exhibit some promiscuity. Ptk2 and Hal4,5
are the major regulators of Pma1 and Trk1,2, respectively, while Npr1
modulates the amino acid transporters Gap1 and Tat2, although it may
also act on Pma1, together with less active kinases such as Ptk1 and
Hrk1. The specificity of these protein kinases is unknown, and it
remains to be demonstrated at the biochemical level that they act
directly on the Pma1 protein and other transporters, because the
observed effects could be indirect. The existence of kinase cascades
dedicated to ion homeostasis is plausible, and the signalling pathways
should have sensors of basic cellular parameters such as energy
metabolism, membrane potential, pH, K+ concentration, and
turgor. These mechanisms, and the nature of the protein phosphatases
counteracting the activating kinases, are currently under investigation.
The glucose-induced affinity change of the ATPase requires, in
addition to the protein kinase Ptk2, the ubiquitin-protein ligase Rsp5
(8), suggesting that the turnover of some protein(s) is also
important for the regulation of the ATPase. The glucose-induced increase in the Vmax of the ATPase depends
on Arg-909 and Thr-912, which define a potential phosphorylation site
for calmodulin-dependent protein kinase II. However, mutational
analysis has indicated that the mechanism of
Vmax regulation is more complex than simple phosphorylation (12) and involves the membrane protein
YOR137c (9) and the small heat shock protein Hsp30
(4). Other pieces of the puzzle of ion homeostasis in yeast
include the calcium-regulated protein phosphatase calcineurin, which
regulates both Trk1,2 and the ATPase (62), and, as
demonstrated in fission yeast, some type I protein phosphatases
and mitogen-activated protein kinases (2).
Ptk2 (present work) and Hal4,5 (33) represent the first
protein kinases which modulate the major electrogenic transporters of
yeast cells (Fig. 7). Future studies should help to convert this
glimpse of the mechanisms of ion homeostasis into a detailed picture of
the complex network of signaling pathways which, since early times of
evolution, were probably needed to adjust the basic biophysical
parameters of cells in response to growth and environmental changes
(21, 53). As the modulation of membrane potential is crucial
for the uptake of toxic cations (Fig. 7), it may be part of the
cellular responses to salt stress. The recent identification of a
conserved proteolipid which seems to depolarize the plasma membrane
(35) and which is induced in plants by salt stress (5) supports this hypothesis.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Spanish DGICYT
(Madrid) (PB97-0054 and PB98-0565-C04-1). A.G. was a fellow of the Marie Curie Research Training Grants (European Commission, Brussels, Belgium). N.D.L.F. was a fellow of the Ministerio de Educación y
Ciencia (Madrid, Spain), and J.J.F. was a fellow of the Conselleria de
Educació i Ciencia (Valencia, Spain).
We thank Richard Poulin (Quebec, Canada) for the
ptk2::TRP1 disruption cassette,
André Goffeau (Louvain-la-Neuve, Belgium) for a copy of his
manuscript on PMP3 before publication (35), and
Lynne Yenush for critical reading of the manuscript.
The first two authors contributed equally to this work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Instituto de
Biologia Molecular, Universidad Politecnica, Camino de Vera, 46022 Valencia, Spain. Phone: 34-96-3877883. Fax: 34-96-3877859. E-mail:
serrano{at}ibmcp.upv.es.
 |
REFERENCES |
| 1.
|
Auer, M.,
G. A. Scarborough, and W. Kühlbrandt.
1998.
Three-dimensional map of the plasma membrane H+-ATPase in the open conformation.
Nature
392:840-843[CrossRef][Medline].
|
| 2.
|
Balcells, L.,
R. Martin,
M. C. Ruiz,
N. Gomez,
J. Ramos, and J. Ariño.
1998.
The Pzh1 protein phosphatase and the Spm1 protein kinase are involved in the regulation of the plasma membrane H+-ATPase in fission yeast.
FEBS Lett.
435:241-244[CrossRef][Medline].
|
| 3.
|
Boeke, J. D., and S. B. Sandmeyer.
1991.
Yeast transposable elements, p. 193-261.
In
J. R. Broach, E. W. Jones, and J. R. Pringle (ed.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis and energetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 4.
|
Braley, R., and P. W. Piper.
1997.
The C-terminus of yeast plasma membrane H+-ATPase is essential for the regulation of this enzyme by heat shock protein Hsp30, but not for stress activation.
FEBS Lett.
418:123-126[CrossRef][Medline].
|
| 5.
|
Capel, J.,
J. Jarillo,
J. Salinas, and L. Martinez-Zapater.
1997.
Two homologous low-temperature genes from Arabidopsis encode highly hydrophobic proteins.
Plant Physiol.
115:569-576[Abstract].
|
| 6.
|
Chang, A., and C. W. Slayman.
1991.
Maturation of the yeast plasma membrane [H+]ATPase involves phosphorylation during intracellular transport.
J. Cell Biol.
115:289-295[Abstract/Free Full Text].
|
| 7.
|
Cid, A.,
R. Perona, and R. Serrano.
1987.
Replacement of the promoter of the yeast plasma membrane ATPase gene by a galactose-dependent promoter and its physiological consequences.
Curr. Genet.
12:105-110[CrossRef][Medline].
|
| 8.
|
de la Fuente, N.,
A. M. Maldonado, and F. Portillo.
1997.
Glucose activation of the yeast plasma membrane H+-ATPase requires the ubiquitin-proteasome proteolytic pathway.
FEBS Lett.
411:308-312[CrossRef][Medline].
|
| 9.
|
de la Fuente, N.,
A. M. Maldonado, and F. Portillo.
1997.
Yeast gene YOR137c is involved in the activation of the yeast plasma membrane H+-ATPase by glucose.
FEBS Lett.
420:17-19[CrossRef][Medline].
|
| 10.
|
Entian, K.-D., et al.
1999.
Functional analysis of 150 deletion mutants in Saccharomyces cerevisiae by a systematic approach.
Mol. Gen. Genet.
262:683-702[CrossRef][Medline].
|
| 11.
|
Eraso, P.,
A. Cid, and R. Serrano.
1987.
Tight control of the amount of yeast plasma membrane ATPase during changes in growth conditions and gene dosage.
FEBS Lett.
224:193-197[CrossRef][Medline].
|
| 12.
|
Eraso, P., and F. Portillo.
1994.
Molecular mechanism of regulation of yeast plasma membrane H+-ATPase by glucose: interaction between domains and identification of new regulatory sites.
J. Biol. Chem.
269:10393-10399[Abstract/Free Full Text].
|
| 13.
|
Estrada, E.,
P. Agostinis,
J. R. Vandenheede,
J. Goris,
W. Merlevede,
J. Francois,
A. Goffeau, and M. Ghislain.
1996.
Phosphorylation of yeast plasma membrane H+-ATPase by casein kinase I.
J. Biol. Chem.
271:32064-32072[Abstract/Free Full Text].
|
| 14.
|
Gaber, R. F.
1992.
Molecular genetics of yeast ion transport.
Int. Rev. Cytol.
137A:299-353[Medline].
|
| 15.
|
Gancedo, C., and R. Serrano.
1989.
Energy-yielding metabolism, p. 205-259.
In
A. H. Rose, and J. S. Harrison (ed.), The yeasts, 2nd ed., vol. 3: metabolism and physiology of yeast. Academic Press, London, England.
|
| 16.
|
Garcia-Arranz, M.,
A. M. Maldonado,
M. J. Mazón, and F. Portillo.
1994.
Transcriptional control of yeast plasma membrane H+-ATPase by glucose: cloning and characterization of new genes involved in this regulation.
J. Biol. Chem.
269:18076-18082[Abstract/Free Full Text].
|
| 17.
|
Gläser, H.-U.,
D. Thomas,
R. Gaxiola,
F. Montrichard,
Y. Surdin-Kerjan, and R. Serrano.
1993.
Salt tolerance and methionine biosynthesis in Saccharomyces cerevisiae involve a putative phosphatase gene.
EMBO J.
12:3105-3110[Medline].
|
| 18.
|
Guthrie, C., and G. R. Fink (ed.).
1991.
Guide to yeast genetics and molecular biology.
Academic Press, Inc., New York, N.Y.
|
| 19.
|
Haro, R.,
B. Garciadeblas, and A. Rodriguez-Navarro.
1991.
A novel P-type ATPase from yeast involved in sodium transport.
FEBS Lett.
291:189-191[CrossRef][Medline].
|
| 20.
|
Hill, J. E.,
A. M. Myers,
T. J. Koerner, and A. Tzagoloff.
1986.
Yeast/E. coli shuttle vectors with multiple unique restriction sites.
Yeast
2:163-167[CrossRef][Medline].
|
| 21.
|
Hoffman, J. F. (ed.).
1964.
The cellular functions of membrane transport.
Prentice-Hall, Inc., Englewood Cliffs, N.J.
|
| 22.
|
Hunter, T., and G. D. Plowman.
1997.
The protein kinases of budding yeast: six score and more.
Trends Biochem. Sci.
22:14-22[Medline].
|
| 23.
|
Igarashi, K., and K. Kashiwagi.
1999.
Polyamine transport in bacteria and yeast.
Biochem. J.
344:633-642.
|
| 24.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells treated with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 25.
|
Kakinuma, Y.,
T. Maruyama,
T. Nozaki,
Y. Wada,
Y. Ohsumi, and K. Igarashi.
1995.
Cloning of the gene encoding a putative serine/threonine protein kinase which enhances spermine uptake in Saccharomyces cerevisiae.
Biochem. Biophys. Res. Commun.
216:985-992[CrossRef][Medline].
|
| 26.
|
Kaouass, M.,
M. Audette,
D. Ramotar,
S. Verma,
D. de Montigny,
I. Gamache,
K. Torossian, and R. Poulin.
1997.
The STK2 gene, which encodes a putative Ser/Thr protein kinase, is required for high-affinity spermidine transport in Saccharomyces cerevisiae.
Mol. Cell. Biol.
17:2994-3004[Abstract].
|
| 27.
|
Kaouass, M.,
I. Gamache,
D. Ramotar,
M. Audette, and R. Poulin.
1998.
The spermidine transport system is regulated by ligand inactivation, endocytosis, and by the Npr1 Ser/Thr protein kinase in Saccharomyces cerevisiae.
J. Biol. Chem.
273:2109-2117[Abstract/Free Full Text].
|
| 28.
|
Madrid, F.,
M. J. Gomez,
J. Ramos, and A. Rodriguez-Navarro.
1998.
Ectopic potassium uptake in trk1 trk2 mutants of Saccharomyces cerevisiae correlates with a highly hyperpolarized membrane potential.
J. Biol. Chem.
273:14838-14844[Abstract/Free Full Text].
|
| 29.
|
Maldonado, A. M.,
N. de la Fuente, and F. Portillo.
1998.
Characterization of an allele-nonspecific intragenic suppressor in the yeast plasma membrane H+-ATPase gene (PMA1).
Genetics
150:11-19[Abstract/Free Full Text].
|
| 30.
|
Mazon, M. J.,
M. M. Behrens,
F. Portillo, and R. Piñón.
1989.
cAMP- and RAS-independent nutritional regulation of plasma-membrane H+-ATPase activity in Saccharomyces cerevisiae.
J. Gen Microbiol.
135:1453-1460[Medline].
|
| 31.
|
McCusker, J. H.,
D. S. Perlin, and J. E. Haber.
1987.
Pleiotropic plasma membrane ATPase mutations of Saccharomyces cerevisiae.
Mol. Cell. Biol.
7:4082-4088[Abstract/Free Full Text].
|
| 32.
|
Moskvina, E.,
E.-M. Imre, and H. Ruis.
1999.
Stress factors acting at the level of the plasma membrane induce transcription via the stress response element (STRE) of the yeast Saccharomyces cerevisiae.
Mol. Microbiol.
32:1263-1272[CrossRef][Medline].
|
| 33.
|
Mulet, J. M.,
M. P. Leube,
S. J. Kron,
G. Rios,
G. R. Fink, and R. Serrano.
1999.
A novel mechanism of ion homeostasis and salt tolerance in yeast: the Hal4 and Hal5 protein kinases modulate the Trk1-Trk2 potassium transporter.
Mol. Cell. Biol.
19:3328-3337[Abstract/Free Full Text].
|
| 34.
|
Nass, R.,
K. W. Cunningham, and R. Rao.
1997.
Intracellular sequestration of sodium by a novel Na+/H+ exchanger in yeast is enhanced by mutations in the plasma membrane H+-ATPase.
J. Biol. Chem.
272:26145-26152[Abstract/Free Full Text].
|
| 35.
|
Navarre, C., and A. Goffeau.
2000.
Membrane hyperpolarization and salt sensitivity induced by deletion of PMP3, a highly conserved small protein of yeast plasma membrane.
EMBO J.
19:2515-2524[CrossRef][Medline].
|
| 36.
|
Nozaki, T.,
K. Nishimura,
A. J. Michael,
T. Maruyama,
Y. Kakinuma, and K. Igarashi.
1996.
A second gene encoding a putative serine/threonine protein kinase which enhances spermine uptake in Saccharomyces cerevisiae.
Biochem. Biophys. Res. Commun.
228:452-458[CrossRef][Medline].
|
| 37.
|
Passos, J. B.,
M. Vanhalewyn,
R. L. Brandao,
I. M. Castro,
J. R. Nicoli, and J. M. Thevelein.
1992.
Glucose-induced activation of plasma membrane H+-ATPase in mutants of the yeast Saccharomyces cerevisiae affected in cAMP metabolism, cAMP-dependent protein phosphorylation and the initiation of glycolysis.
Biochim. Biophys. Acta
1136:57-67[Medline].
|
| 38.
|
Perlin, D. S.,
C. L. Brown, and J. E. Haber.
1988.
Membrane potential defect in hygromycin B-resistant pma1 mutants of Saccharomyces cerevisiae.
J. Biol. Chem.
263:18118-18122[Abstract/Free Full Text].
|
| 39.
|
Piper, P. W.
1993.
Molecular events associated with acquisition of heat tolerance by the yeast Saccharomyces cerevisiae.
FEMS Microbiol. Rev.
11:339-356[CrossRef][Medline].
|
| 40.
|
Portillo, F.
2000.
Regulation of plasma membrane H+-ATPase in fungi and plants.
Biochim. Biophys. Acta
1469:31-42[Medline].
|
| 41.
|
Portillo, F., and R. Serrano.
1988.
Dissection of functional domains of the yeast proton-pumping ATPase by directed mutagenesis.
EMBO J.
7:1793-1798[Medline].
|
| 42.
|
Portillo, F., and R. Serrano.
1989.
Growth control strength and active site of yeast plasma membrane ATPase studied by site-directed mutagenesis.
Eur. J. Biochem.
186:501-507[Medline].
|
| 43.
|
Portillo, F.,
I. F. de Larrinoa, and R. Serrano.
1989.
Deletion analysis of yeast plasma membrane H+-ATPase and identification of a regulatory domain at the carboxyl-terminus.
FEBS Lett.
247:381-385[CrossRef][Medline].
|
| 44.
|
Portillo, F.,
P. Eraso, and R. Serrano.
1991.
Analysis of the regulatory domain of yeast plasma membrane H+-ATPase by directed mutagenesis and intragenic suppression.
FEBS Lett.
287:71-74[CrossRef][Medline].
|
| 45.
|
Roberts, S. K.,
M. Fischer,
G. K. Dixon, and D. Sanders.
1999.
Divalent cation block of inward currents and low-affinity K+ uptake in Saccharomyces cerevisiae.
J. Bacteriol.
181:291-297[Abstract/Free Full Text].
|
| 46.
|
Schachtman, D. P.,
R. Kumar,
J. I. Schroeder, and E. L. Marsh.
1997.
Molecular and functional characterization of a novel low-affinity cation transporter (LCT1) in higher plants.
Proc. Natl. Acad. Sci. USA
94:11079-11084[Abstract/Free Full Text].
|
| 47.
|
Schmidt, A.,
T. Beck,
A. Koller,
J. Kunz, and M. N. Hall.
1998.
The TOR nutrient signalling pathway phosphorylates NPR1 and inhibits turnover of the tryptophan permease.
EMBO J.
17:6924-6931[CrossRef][Medline].
|
| 48.
|
Serrano, R.
1980.
Effects of ATPase inhibitors on the proton pump of respiratory-deficient yeast.
Eur. J. Biochem.
105:419-424[Medline].
|
| 49.
|
Serrano, R.
1983.
In vivo glucose activation of the yeast plasma membrane ATPase.
FEBS Lett.
156:11-14[CrossRef][Medline].
|
| 50.
|
Serrano, R.
1988.
H+-ATPase from plasma membranes of Saccharomyces cerevisiae and Avena sativa roots: purification and reconstitution.
Methods Enzymol.
157:533-544[Medline].
|
| 51.
|
Serrano, R.
1989.
Structure and function of plasma membrane ATPase.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
40:61-94[CrossRef].
|
| 52.
|
Serrano, R.
1991.
Transport across yeast vacuolar and plasma membranes, p. 523-585.
In
J. R. Broach, E. W. Jones, and J. R. Pringle (ed.), The molecular and cellular biology of the yeast Saccharomyces: genome dynamics, protein synthesis, and energetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 53.
|
Serrano, R.
1996.
Salt tolerance in plants and microorganisms: toxicity targets and defense responses.
Int. Rev. Cytol.
165:1-52[Medline].
|
| 54.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1986.
Methods in yeast genetics: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 55.
|
Stanbrough, M., and B. Magasanik.
1995.
Transcriptional and posttranscriptional regulation of the general amino acid permease of Saccharomyces cerevisiae.
J. Bacteriol.
177:94-102[Abstract/Free Full Text].
|
| 56.
|
Ulaszewski, S.,
E. Balzi, and A. Goffeau.
1987.
Genetic and molecular mapping of the pma1 mutation conferring vanadate resistance to the plasma membrane ATPase from Saccharomyces cerevisiae.
Mol. Gen. Genet.
207:38-46[CrossRef][Medline].
|
| 57.
|
Vallejo, C., and R. Serrano.
1989.
Physiology of mutants with reduced expression of plasma membrane H+-ATPase.
Yeast
5:307-319[CrossRef][Medline].
|
| 58.
|
Vandenbol, M.,
J.-C. Jauniaux, and M. Grenson.
1990.
The Saccharomyces cerevisiae NPR1 gene required for the activity of ammonia-sensitive amino acid permeases encodes a protein kinase homologue.
Mol. Gen. Genet.
222:393-399[CrossRef][Medline].
|
| 59.
|
Venema, K., and M. G. Palmgren.
1995.
Metabolic modulation of transport coupling ratio in yeast plasma membrane H+-ATPase.
J. Biol. Chem.
270:19659-19667[Abstract/Free Full Text].
|
| 60.
|
Wallis, J. W.,
G. Chrebet,
G. Brodsky,
M. Rolfe, and R. Rothstein.
1989.
A hyperrecombination mutation in S. cerevisiae identifies a novel eukaryotic topoisomerase.
Cell
58:409-419[CrossRef][Medline].
|
| 61.
|
Winde, J. H.,
J. M. Thevelein, and J. Winderickx.
1997.
From feast to famine: adaptation to nutrient depletion in yeast, p. 7-52.
In
S. Hohmann, and W. H. Mager (ed.), Yeast stress responses. Springer, Heidelberg, Germany.
|
| 62.
|
Withee, J. L.,
R. Sen, and M. S. Cyert.
1998.
Ion tolerance of Saccharomyces cerevisiae lacking the Ca2+/CaM-dependent phosphatase (calcineurin) is improved by mutations in URE2 or PMA1.
Genetics
149:865-878[Abstract/Free Full Text].
|
Molecular and Cellular Biology, October 2000, p. 7654-7661, Vol. 20, No. 20
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lecchi, S., Nelson, C. J., Allen, K. E., Swaney, D. L., Thompson, K. L., Coon, J. J., Sussman, M. R., Slayman, C. W.
(2007). Tandem Phosphorylation of Ser-911 and Thr-912 at the C Terminus of Yeast Plasma Membrane H+-ATPase Leads to Glucose-dependent Activation. J. Biol. Chem.
282: 35471-35481
[Abstract]
[Full Text]
-
Perez-Valle, J., Jenkins, H., Merchan, S., Montiel, V., Ramos, J., Sharma, S., Serrano, R., Yenush, L.
(2007). Key Role for Intracellular K+ and Protein Kinases Sat4/Hal4 and Hal5 in the Plasma Membrane Stabilization of Yeast Nutrient Transporters. Mol. Cell. Biol.
27: 5725-5736
[Abstract]
[Full Text]
-
Cowart, L. A., Hannun, Y. A.
(2007). Selective Substrate Supply in the Regulation of Yeast de Novo Sphingolipid Synthesis. J. Biol. Chem.
282: 12330-12340
[Abstract]
[Full Text]
-
Thornton, G., Wilkinson, C. R. M., Toone, W. M., Jones, N.
(2005). A novel pathway determining multidrug sensitivity in Schizosaccharomyces pombe. GENES CELLS
10: 941-951
[Abstract]
[Full Text]
-
Aouida, M., Leduc, A., Poulin, R., Ramotar, D.
(2005). AGP2 Encodes the Major Permease for High Affinity Polyamine Import in Saccharomyces cerevisiae. J. Biol. Chem.
280: 24267-24276
[Abstract]
[Full Text]
-
Munson, A. M., Haydon, D. H., Love, S. L., Fell, G. L., Palanivel, V. R., Rosenwald, A. G.
(2004). Yeast ARL1 encodes a regulator of K+ influx. J. Cell Sci.
117: 2309-2320
[Abstract]
[Full Text]
-
Ali, R., Brett, C. L., Mukherjee, S., Rao, R.
(2004). Inhibition of Sodium/Proton Exchange by a Rab-GTPase-activating Protein Regulates Endosomal Traffic in Yeast. J. Biol. Chem.
279: 4498-4506
[Abstract]
[Full Text]
-
Merchan, S., Bernal, D., Serrano, R., Yenush, L.
(2004). Response of the Saccharomyces cerevisiae Mpk1 Mitogen-Activated Protein Kinase Pathway to Increases in Internal Turgor Pressure Caused by Loss of Ppz Protein Phosphatases. Eukaryot Cell
3: 100-107
[Abstract]
[Full Text]
-
Aouida, M., Page, N., Leduc, A., Peter, M., Ramotar, D.
(2004). A Genome-Wide Screen in Saccharomyces cerevisiae Reveals Altered Transport As a Mechanism of Resistance to the Anticancer Drug Bleomycin. Cancer Res.
64: 1102-1109
[Abstract]
[Full Text]
-
Hikkel, I., Lucau-Danila, A., Delaveau, T., Marc, P., Devaux, F., Jacq, C.
(2003). A General Strategy to Uncover Transcription Factor Properties Identifies a New Regulator of Drug Resistance in Yeast. J. Biol. Chem.
278: 11427-11432
[Abstract]
[Full Text]
-
Miranda, M., Pardo, J. P., Allen, K. E., Slayman, C. W.
(2002). Stalk Segment 5 of the Yeast Plasma Membrane H+-ATPase. LABELING WITH A FLUORESCENT MALEIMIDE REVEALS A CONFORMATIONAL CHANGE DURING GLUCOSE ACTIVATION. J. Biol. Chem.
277: 40981-40988
[Abstract]
[Full Text]
-
Kuhlbrandt, W., Zeelen, J., Dietrich, J.
(2002). Structure, Mechanism, and Regulation of the Neurospora Plasma Membrane H+-ATPase. Science
297: 1692-1696
[Abstract]
[Full Text]
-
Williams-Hart, T., Wu, X., Tatchell, K.
(2002). Protein Phosphatase Type 1 Regulates Ion Homeostasis in Saccharomyces cerevisiae. Genetics
160: 1423-1437
[Abstract]
[Full Text]
-
Liu, T., Mirschberger, C., Chooback, L., Arana, Q., Dal Sacco, Z., MacWilliams, H., Clarke, M.
(2002). Altered expression of the 100 kDa subunit of the Dictyostelium vacuolar proton pump impairs enzyme assembly, endocytic function and cytosolic pH regulation. J. Cell Sci.
115: 1907-1918
[Abstract]
[Full Text]
-
De Craene, J.-O., Soetens, O., Andre, B.
(2001). The Npr1 Kinase Controls Biosynthetic and Endocytic Sorting of the Yeast Gap1 Permease. J. Biol. Chem.
276: 43939-43948
[Abstract]
[Full Text]
-
Souza, M. A. A., Tropia, M. J., Brandao, R. L.
(2001). New aspects of the glucose activation of the H+-ATPase in the yeast Saccharomyces cerevisiae. Microbiology
147: 2849-2855
[Abstract]
[Full Text]
-
Miranda, M., Allen, K. E., Pardo, J. P., Slayman, C. W.
(2001). Stalk Segment 5 of the Yeast Plasma Membrane H+-ATPase. MUTATIONAL EVIDENCE FOR A ROLE IN GLUCOSE REGULATION. J. Biol. Chem.
276: 22485-22490
[Abstract]
[Full Text]
-
Goossens, A., Dever, T. E., Pascual-Ahuir, A., Serrano, R.
(2001). The Protein Kinase Gcn2p Mediates Sodium Toxicity in Yeast. J. Biol. Chem.
276: 30753-30760
[Abstract]
[Full Text]