Previous Article | Next Article 
Molecular and Cellular Biology, November 2000, p. 7853-7866, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Analysis of Fission Yeast Primase Defines the
Checkpoint Responses to Aberrant S Phase Initiation
Siyuan
Tan and
Teresa S.-F.
Wang*
Department of Pathology, Stanford University
School of Medicine, Stanford, California 94305-5324
Received 17 April 2000/Returned for modification 30 May
2000/Accepted 4 August 2000
 |
ABSTRACT |
To investigate the checkpoint response to aberrant initiation, we
analyzed the cell cycle checkpoint response induced by mutations of
Schizosaccharomyces pombe DNA primase. DNA primase has two subunits, Spp1 and Spp2 (S. pombe primases 1 and 2). Spp1
is the catalytic subunit that synthesizes the RNA primer, which is then extended by DNA polymerase
(Pol
) to synthesize an initiation DNA
structure, and this catalytic function of Pol
is a
prerequisite for generating the S-M phase checkpoint. Here we show that
Spp2 is required for coupling the function of Spp1 to
Pol
. Thermosensitive mutations of spp2+
destabilize the Pol
-primase complex, resulting in an
allele-specific S phase checkpoint defect. The mutant exhibiting a more
severe checkpoint defect also has a higher extent of
Pol
-primase complex instability and deficiency in the
hydroxyurea-induced Cds1-mediated intra-S phase
checkpoint response. However, this mutant is able to activate the Cds1
response to S phase arrest induced by temperature. These findings
suggest that the Cds1 response to the S-phase arrest signal(s)
induced by a initiation mutant is different from that induced by
hydroxyurea. Interestingly, a pol
ts
mutant with a defective S-M phase checkpoint and an
spp2 mutant with an intact checkpoint have a similar
Pol
-primase complex stability, and the Cds1 response
induced by hydroxyurea or by the mutant arrests at the
restrictive temperature. Thus, the Cds1-mediated intra-S phase
checkpoint response induced by hydroxyurea can also be
distinguished from the S-M phase checkpoint response that requires the
initiation DNA synthesis by Pol
.
 |
INTRODUCTION |
To maintain genomic integrity,
eukaryotic cells have the checkpoint mechanisms to delay progression of
the cell cycle when cells encounter perturbation of DNA replication or
DNA damage (18). In fission yeast, a group of proteins,
Rad1, Rad3, Rad9, Rad17, Rad26, and Hus1, known as checkpoint Rad
proteins, function early in the surveillance of both the replication
perturbation and DNA damage (1, 13). These checkpoint Rad
proteins are thought to sense and transduce signals of aberrant
replication and DNA damage to activate two downstream protein kinases,
Cds1 and Chk1, to arrest the cell cycle (5-8, 40). In
response to S phase arrest by hydroxyurea, cdc
mutant arrest, or DNA damage induced during S phase, Cds1 is
phosphorylated and activated (19). Cds1 activation delays
the progression of S phase (termed intra-S phase checkpoint) and
contributes to preventing mitosis (3, 19, 26). The Cds1
structural counterpart of budding yeast, RAD53, has been
shown to be an essential factor for maintaining the intra-S phase
checkpoint to prevent the firing of late replication origins when the
progression of replication forks from early-firing origins is blocked
by hydroxyurea (12, 33, 34).
Another downstream kinase, Chk1, is required to arrest mitosis when DNA
is damaged in late S phase and G2 phase and is also required to prevent mitosis when cdc replication mutants are
used to perturb S phase (7). Chk1 is not required to prevent
mitosis in response to hydroxyurea block. Following DNA damage,
Chk1 protein is phosphorylated in a cell-cycle-specific manner
(23), and Chk1 phosphorylation is correlated to cell cycle
arrest (4). Chk1 phosphorylation allows binding of 14-3-3 proteins with Chk1 that is thought to direct Chk1 for specific
substrate (9). Although Chk1 is not phosphorylated in
hydroxyurea block or during early S phase perturbation
(23), Chk1 is phosphorylated when S phase is blocked by
hydroxyurea in a cds1
background (4, 19). Chk1 kinase has been shown to phosphorylate in vitro two Cdc2 kinase regulators, Wee1 kinase and Cdc25 phosphatase (15, 30,
32). Phosphorylation of Cdc25 by Chk1 allows Cdc25 to associate
with 14-3-3 proteins, leading to nuclear exclusion of Cdc25 (21,
31, 42).
These findings strongly suggest that checkpoint signals generated
from early-S-phase perturbation are different from those generated during ongoing or late S phase. Early-S-phase
perturbation activates Cds1 kinase to maintain an intra-S phase
checkpoint, while ongoing or late-S-phase perturbation results in Chk1
phosphorylation to prevent mitosis. Thus, Cds1 and Chk1 function in two
distinct but mutually reinforced ways in the cell cycle surveillance mechanisms.
We are interested in defining the requirements for generating the
checkpoint response to aberrant S phase initiation. To achieve this
goal, we investigated the effect of mutations of DNA polymerase
(Pol
)-primase on the cell cycle events. DNA Pol
-primase, a four-subunit enzyme complex, is the principal enzyme that initiates DNA
replication on both leading and lagging strands. DNA primase synthesizes an RNA primer which is then extended by Pol
to
synthesize an initiation DNA structure (39, 41). DNA primase
is a heterodimeric enzyme complex, consisting of a catalytic subunit
that synthesizes the RNA primer, named p49 in mammalian cells and
PRI1 in budding yeast, and a second subunit that has no
detectable enzymatic activity, named p58 in mammalian cells and
PRIII in budding yeast (41).
We and others have previously demonstrated that deletion or mutation of
DNA Pol
results in the cells entering inappropriate mitosis (2,
11). We have previously shown that germinating spores derived
from a Schizosaccharomyces pombe heterozygous diploid containing one copy of the pol
+ gene with a
mutation at a critical metal activator binding residue (Asp984 in region I) display an abnormal mitotic phenotype
(see Fig. 2 of reference 2). In vitro studies have
shown that Pol
-primase complex containing this specific Pol
mutation abolishes only the catalytic function and not the physical
association of Pol
and primase, and the mutant complex is able to
synthesize the RNA primer in vitro but is unable to extend the RNA
primer (10). These experiments strongly suggest that the
catalytic function of Pol
is required for generating the
checkpoint to prevent inappropriate mitotic entry.
We isolated the fission yeast genes and cDNAs of both primase subunits,
named spp1+ and spp2+ for
S. pombe primases 1 and 2, respectively, and generated
conditional mutants of spp1+ and
spp2+. In this report, we investigate the effect
of spp2 mutations on the cell cycle checkpoint response.
The results of our studies indicate that Spp2 is the subunit that
couples the function of Spp1 with Pol
. Mutations of spp2
cause instability of Pol
-primase complex. Analyses of the
checkpoint effector kinase response to mutations of spp2
indicate that the requirement for Cds1 checkpoint response to an S
phase initiation mutant arrest is different from that for Cds1 response
to replication stall induced by the DNA synthesis inhibitor
hydroxyurea. The requirements for intra-S phase Cds1 response
can also be distinguished from the Pol
activity-dependent S-M phase
checkpoint response.
 |
MATERIALS AND METHODS |
Yeast strains, media, and genetic, cell biological, and molecular
methods.
The strains used in this study were listed in Table
1. Cells were maintained either in rich
medium (YE5S) or Edinburgh minimal medium with appropriate supplements
as described elsewhere (25). All genetic methods were
performed as described previously (17). Molecular biology
techniques were performed as described by Maniatis et al.
(22). Transformation of fission yeast was performed as described previously (16). Growth and viability analysis of cells were performed as described previously (2, 16). Cell extracts were prepared by glass bead disruption as described by Al-Khodairy et al. (2).
Plasmids.
A disruption vector pUS-Ura-DS, which contains an
ura4+ gene placed between upstream and
downstream of spp2+ coding sequence, was
constructed as follows. First, the ura4+ gene
was cloned into SalI/BamHI sites of pBluescript
SK(
) (Stratagene) to generate pBS-Ura. Then, the ~600-bp downstream
region of spp2+ coding sequence was amplified
from genomic DNA by PCR using Spp2-5'-DS/Pst and Spp2-3'-DS/Kpn as
primers and subcloned into the PstI/KpnI sites of
pBS-Ura to create pUra-DS. Finally, the ~500-bp upstream region of
spp2+ coding sequence was amplified from genomic
DNA by PCR using Spp2-5'-US/Xba and Spp2-3'-US/Bam as primers and
subcloned into the XbaI/BamHI sites of pUra-DS to
create pUS-Ura-DS. The coding region of spp2+
cDNA was amplified from the spp2+-cDNA clone (as
described below) by PCR using Spp2-5'-Xho and Spp2-3'-Bam as primers
and subcloned into pET expression vector to create pET-Spp2. The
oligonucleotides used for PCR were as follows: Spp2-5'-US/Xba,
AGATCTAGAAGTCTTTACGATGCATTATCTAATG; Spp2-3'-US/Bam, CGCGGATCCGGTGGTTAGGGAAGAGTCTATTTG; Spp2-5'-DS/Pst,
AAACTGCAGTAAGCTAAGATACTTTTAGTTCACG; SPP2-3'-DS/Kpn,
AAAGGTACCGGTGGTGTTCTTATGCTTATCG; Spp2-5'-Xho, CCGCTCGAGATGTTCAGAACGACCAAAAGTCGAG; and Spp2-3'-Bam, AAGGGATCCTTATGATTCTAAACTAAGTTGAAAATATTG.
Identification and isolation of spp2+
gene and cDNA.
Spp2 protein was initially identified as a 54-kDa
polypeptide tightly associated with DNA Pol
purified from S. pombe cell extract (R. Davis and T. Wang, unpublished). Mass
spectrometric analysis of the 54-kDa protein identified several peptide
sequences overlapping with an open reading frame in chromosome II
(cosmid SPBC17D11) from the Sanger fission yeast genome database. The spp2+ cDNA was isolated by screening a
-ZAP
cDNA library from S. pombe (S. Tan and T. Wang, unpublished
results). A full-length spp2+ cDNA was assembled
from overlapping clones and was subcloned into pET expression vector.
Homology searching through GenBank found that Spp2 shares 37, 37, and
40% sequence identity to the primase subunits p58 of humans
(35) and mice (24) and of PRIII of S. cerevisiae (14), respectively.
Construction of spp2
strain.
Heterozygous
diploid strain ST101 (spp2+/spp2
)
carrying a deletion of one copy of spp2+ was
constructed by one-step gene replacement. The DNA fragment, which
contains a ~500-bp spp2+ upstream sequence, a
functional ura4+ gene, and a ~600-bp
spp2+ downstream region, was released from
pUS-Ura-DS by digesting it with XbaI and KpnI and
transformed into the diploid strain KG23. The transformants were
selected on minimal medium lacking uracil and screened for several
rounds for the stability of the ura4+ marker.
Successful replacement of one copy of spp2+
coding region by ura4+ gene was confirmed by
genomic Southern analysis. Tetrad dissection of spores derived from
ST101 (spp2+/spp2
) resulted in two
viable uracil auxotrophic spores, confirming that Spp2 is essential for
cell growth. To analyze the phenotype of spp2
germinating
spores, the spores isolated from ST101
(spp2+/spp2
) were selectively
germinated in minimal medium lacking uracil. Samples were taken at
indicated times to determine the DNA contents by fluorescence-activated
cell sorter (FACS) analysis. A heterozygous ST23 containing only one
copy of ura4+ was constructed and used as a
wild-type control.
Isolation of spp2 temperature-sensitive mutants.
Mutations were introduced into the spp2+ gene by
mutagenic PCR as described earlier (37). Briefly,
spp2+ cDNA was amplified from pET-Spp2 by
Taq DNA polymerase in a buffer containing 20 mM Tris (pH
8.4), 50 mM KCl, 7 mM MgCl2, 0.5 mM MnCl2,
0.1% gelatin, 200 µM dATP, 200 µM dGTP, 1 mM dCTP, and 1 mM dTTP.
The primers for PCR amplification were Spp2-3'-BamH and T7 primer
(AATACGACTCACTATAG). The PCR reaction was carried out in a
100-µl reaction and performed with 25 cycles at 94°C for 1 min,
55°C for 1 min, and 72°C for 3 min. An spp2 mutation library was constructed by cloning the mutagenized spp2 cDNA
into XbaI/BamHI sites of pUra-DS. The DNA
fragments, which contain the mutagenized spp2 cDNA, a
ura4+ gene, and ~600 bp of downstream of the
spp2+ coding region, were isolated by digesting
the library with XbaI and KpnI and transformed
into the haploid strain KG2. Transformants were screened by replica
plating onto minimal medium lacking uracil and then tested for
temperature sensitivity. Stable temperature-sensitive ura+ transformants were selected and backcrossed
with wild-type strain three times. Correct chromosomal integration of
the spp2 mutant was verified by genomic Southern blot
analysis. All of the temperature-sensitive spp2 mutants
isolated can be rescued by pREP81 plasmid carrying spp2+.
Generation and purification of Spp2 antibody.
Recombinant
Spp2 protein was expressed in bacteria by using pET expression system
(Novagen). The entire coding region of spp2+ was
cloned into pET vector. The resulting plasmid, pET-Spp2, which contains
the translation initiation codon ATG, a six-histidine tag, and the
spp2+ coding region, was transformed into strain
BL21(DE3). Spp2 protein expressed from BL21(DE3) harboring pET-Spp2 was
purified on Ni2+-nitrilotriacetic acid column
chromatography as described elsewhere (36). The recombinant
Spp2 protein eluted from the Ni2+-nitrilotriacetic acid
column was further purified to near homogeneity by Mono S
chromatography via the SMART system (Pharmacia Biotech). Briefly, an
Spp2 protein fraction isolated from the
Ni2+-nitrilotriacetic acid column was first dialyzed
against buffer containing 50 mM HEPES (pH 7.9), 0.5 mM EDTA, and 50 mM
KCl and then applied to a 0.12-ml Mono S column (Pharmacia Biotech).
Spp2 protein was eluted with a 1-ml linear gradient from 50 to 500 mM
KCl in the same buffer. The purified recombinant Spp2 protein was used
as antigen to raise antibodies against Spp2 in rabbit. The antisera
were affinity purified on an Spp2 protein column prepared by
immobilizing the recombinant Spp2 on
N-hydroxysuccinimide-activated Sepharose (Pharmacia Biotech).
Cds1 kinase assay.
In vitro Cds1 kinase assay was performed
as described elsewhere (2, 19) with the following
modifications. One milligram of total protein from cell extract was
mixed with 2 µl of affinity-purified rabbit anti-Cds1 antibody at
4°C for 2 h. Twenty microliters of protein A-agarose (as 50%
slurry) was added to the mixture and incubated at 4°C for an
additional hour. The immunocomplexes were precipitated and washed two
times in a lysis buffer containing 150 mM HEPES (pH 7.9), 250 mM KCl, 1 mM EDTA, 6 µM leupeptin, 2 µM pepstatin A, 2 mM benzamidine, and 1 mM phenylmethylsulfonyl fluoride, followed by washing three times with
the kinase buffer containing 10 mM HEPES (pH 7.5), 75 mM KCl, 5 mM
MgCl2, 0.5 mM EDTA, and 1 mM dithiothreitol. As a control
for equal amounts of Cds1 used for the kinase assay, 3% of each sample
was removed prior to immunoprecipitation and quantitated by Western
blotting with anti-Cds1 antibodies. A kinase reaction was performed at 30°C for 15 min in the kinase buffer containing the Cds1
immunoprecipitate, 5 µg of myelin basic protein (MBP), 5 µCi of
[
-32P]ATP, and 100 µM ATP. Reactions were terminated
by the addition of sodium dodecyl sulfate (SDS) sample buffer. After
being boiled for 3 min, the samples were fractionated on an SDS-15%
polyacrylamide gel. Gels were fixed in 40% methanol and 10% acetic
acid and dried. The kinase activity was quantitated using an IS-1000
digital imaging system (Alpha Innotech, San Leandro, Calif.).
Immunoprecipitation of Pol
-primase complex.
The
Pol
-primase complex was immunoprecipitated from cell lysates by
using anti-Pol
antibody (27) immobilized on protein A-agarose. One milligram of total cell extract protein was mixed with
15 µl of the anti-Pol
antibody beads in the cell lysis buffer described above. After incubation at 4°C for 4 h, the
immunocomplexes were collected and washed five times with the lysis
buffer. The pellets were resuspended in 30 µl of SDS sample loading
buffer and analyzed by Western blotting using antibodies against
Pol
, Spp1, and Spp2 as probes.
Flow cytometry analysis.
Cells were harvested, washed in
water, and fixed in 70% ethanol prior to staining with propidium
iodide as described earlier (28). DNA contents were measured
by using a Coulter Electronics FACS.
Cytology analysis.
Cells were fixed in 70% ethanol and
stained by DAPI (4',6'-diamidino-2-phenylindole) followed by calcofluor
as described previously (38).
 |
RESULTS |
Characterization of cells with spp2 mutations.
To
investigate the effect of spp2+ mutation on the
cell cycle checkpoint response, we isolated a panel of
thermosensitive mutants of spp2+. At the
restrictive temperature of 36°C, the spp2 mutants
exhibited two distinct phenotypes. Two representative mutants of each
phenotype, spp2-8 and spp2-9, were characterized
in this study. At 6 h after the shift to 36°C, spp2-8
exhibited heterogeneous cell size, with ~60% of the cells displaying
aberrant mitotic nuclear phenotype. In contrast, spp2-9
cells had elongated cell morphology with nominal levels of cells
displaying abnormal mitotic nuclear phenotype (Fig.
1A). Consistent with their phenotypes,
spp2-8 cells died more rapidly than spp2-9 cells
when mid-log-phase cultures were shifted to 36°C (Fig. 1B). At 6 h after the shift to 36°C, <2% of the spp2-8 cells
remained viable, while >30% of the spp2-9 cells were
viable (Fig. 1B). FACS profiles of these two mutants correlated with
their phenotypes and their kinetics of viability loss (Fig. 1C).
Wild-type and mutant cells initially had 2C DNA contents, since
asynchronous S. pombe cultures are predominantly in the
G2 phase. The DNA content of wild-type cells remained at 2C, the peak of the FACS profile of spp2-8 and
spp2-9 cells shifted to about 1.5C after 3 h at 36°C
and then shifted toward 2C. After 6 h, the FACS profile of
spp2-8 showed that a portion of the cells had a less than 1C
DNA content and a portion of the spp2-8 cells had a greater
than 2C DNA content, which reflected the observed heterogeneous cell
size and aberrant mitotic nuclear phenotype (Fig. 1A). At 6 h
after the shift to 36°C, the majority of the spp2-9 cells
exhibited a greater-than-2C profile, which correlated with the observed
elongated phenotype of spp2-9 (Fig. 1A). None of the
spp2 mutants was substantially sensitive to UV or
hydroxyurea at 30°C.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 1.
Characterization of temperature-sensitive mutants of
spp2+. Early-log-phase wild-type
972h , ST118 (spp2-8), and ST119
(spp2-9) cells grown at 25°C were shifted to 36°C.
Samples were removed at the indicated times and processed for
morphological, survival, and FACS analysis. (A) Photomicrographs of
wild-type and spp2 mutant cells 6 h after the shift to
36°C. Arrows indicate spp2-8 cells that entered
inappropriate mitosis. (B) Viability of wild-type and spp2
mutant cells. (C) FACS analysis of wild-type and spp2 mutant
cells.
|
|
To determine the phenotype of absence of
spp2+,
a heterozygous diploid of
spp2
and
spp2+ was constructed as described in Materials
and Methods. Tetrad
analysis of the diploid yielded two viable
ura4
spores, indicating that
spp2+ is essential for cell viability. We have
previously shown that
germinating spores carrying
pol

enter mitosis with a 1C DNA
content (
2). Since Spp2 is a
component of the Pol

-primase
complex, we expect that the germinating
spores carrying
spp2
would display a phenotype similar to
that of
pol

. Spores carrying
spp2
derived from the
spp2+/
spp2
diploid were selected for germination in medium lacking
uracil. As a
control, spores carrying
spp2+ derived from a
ura4-D18/ura4+ diploid strain were analyzed in
parallel. Spores carrying
spp2+ entered S phase
8 h after inoculation, and most cells completed
S phase with 2C
DNA content after 10 h (Fig.
2A, 8 to 10 h). In
contrast, 10 h after inoculation, spores
carrying
spp2
showed
a delay in entering S phase, with a
fraction of the cells having
a 2C DNA profile similar to the wild-type
spores and a fraction
of the cells having 1C DNA content (Fig.
2A, 8 to
10 h). After
14 h,
spp2
cells completed S phase
and had a DNA content identical
to that of the
spp2+ cells (Fig.
2A, 14 h). The
germinating
spp2
spores exhibited
elongated cell
morphology with <3% of the cells exhibiting aberrant
mitotic nuclear
morphology (Fig.
2B, middle panel). This is in
striking contrast to
pol

, where ~60% of
pol

germinating
spores
display aberrant mitotic phenotype (
2).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 2.
Germinating spores harboring spp2 and
spp2-8 arrested with a cdc phenotype. (A) FACS
profiles of spp2+ (left panel),
spp2 (middle panel), and spp2-8 (right panel)
germinating spores at 36°C. (B) Phenotype of germinating spores
carrying spp2+ (left panel), spp2
(middle panel), and spp2-8 14 h after inoculation into
selective medium. The diploid strains used for spores harboring
spp2+, spp2 , and spp2-8
were ST23, ST101, and ST 138, respectively.
|
|
Since
spp2-8 mutant exhibits aberrant mitotic phenotype at
36°C (Fig.
1A), it is surprising that germinating
spp2
spores
display an elongated phenotype. It is possible that Spp2 is a
stable protein and that the residual Spp2 carried over from the
original diploid has allowed the
spp2
cells to initiate S
phase
in the absence of Spp2 transcription and translation. To test
this possibility, we constructed a heterozygous diploid of
spp2+ and
spp2-8 and selectively
germinated the spores harboring
spp2-8 at 36°C. The
spp2-8 germinating spores had a similar FACS profile
to that
of the spores harboring
spp2
(Fig.
2A). At 14 h
following
inoculation, the
spp2-8 germinating spores
exhibited an elongated
cell morphology with normal nuclear morphology
(Fig.
2B, right
panel) and not the aberrant mitotic phenotype of
spp2-8 shown
in Fig.
1A. It is worth mentioning that
spp2+/spp2-8 and
spp2+/ssp2-9 diploids grow normally at 36°C,
indicating that both mutant
alleles are
recessive.
To further analyze the phenotype of
spp2
germinating
spores in the absence of DNA replication, we treated the germinating
spp2
spores with hydroxyurea, an inhibitor of DNA
synthesis,
at 0 and 6 h following inoculation in selective medium
lacking
uracil. Under these conditions, germinating spores carrying
spp2+ remained arrested with 1C DNA for up to 12 to 14 h postinoculation
with elongated cell morphology. Similarly,
germinating spores
carrying
spp2
arrested with 1C DNA
content with normal nuclear
morphology (data not shown). These
experiments indicate that the
observed elongated phenotype of
spp2
is indeed due to residual
wild-type Spp2 carried
over from the original
diploid.
Analysis of the stability of Pol
-primase complex in
spp2 and pol
ts mutants.
Since the two
spp2 mutants have a difference in their phenotype, we tested
the possible protein structural differences in the mutant's
Pol
-primase complex. To this end, we immunoprecipitated Pol
by
anti-Pol
antibody from cell lysates of wild type and of
pol
ts13, spp2-8 and spp2-9 mutants
and tested for coimmunoprecipitation of Spp1 and Spp2 proteins by
Western blot using antibodies against Pol
, Spp1, and Spp2 as probes.
To ensure that mutations of spp2+ did not affect
the expression of Pol
, Spp1, and Spp2 in cells, lysates from each
strain grown for 4.5 h at 36°C were probed with appropriate
antibodies. Wild-type and mutant cells had comparable levels of Pol
,
Spp1, and Spp2 (Fig. 3A, lanes 1 to 3).
We then tested the stability of the Pol
-primase complex in these
strains after incubation at semipermissive and restrictive temperatures for 4.5 h. Spp1 and Spp2 coimmunoprecipitated with Pol
from
wild-type-cell extracts, indicating that the Pol
-primase complex of
wild-type cells was stable at either 33 or 36°C (Fig. 3B, lanes 4 and
7). In contrast, the amounts of Spp1 and Spp2 coimmunoprecipitated with
Pol
from spp2-8 and spp2-9 cell extracts
varied substantially. Cell lysates prepared from spp2-9 at
both 33 and 36°C had reduced levels of Spp1 and Spp2
coimmunoprecipitated with Pol
(Fig. 3A, lanes 6 and 9). This
indicated that at either a semipermissive or a restrictive temperature,
the Pol
-primase complex in spp2-9 was slightly
compromised. Mutant spp2-8 grown at 33°C had barely detectable Spp1 and Spp2 coimmunoprecipitated with Pol
(Fig. 3B,
lane 8). At 36°C, no detectable Spp1 and Spp2 coimmunoprecipitated with Pol
from spp2-8 cell lysates when the blot was
exposed for the same length of time as the immunoblots from wild-type
and spp2-9 cells (Fig. 3A, lane 5). However, with a longer
exposure of the spp2-8 blot, coimmunoprecipitation of Spp1
and Spp2 with Pol
was detectable (data not shown). These results
indicated that the Pol
-primase complex in spp2-8 cells
was severely compromised.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
Stability of Pol -primase complex in wild-type and
mutant cells. (A) Expression of Pol , Spp1, and Spp2 in wild-type and
spp2 mutant cells. Wild-type 972h , ST118
(spp2-8), and ST119 (spp2-9) cells grown at
25°C were incubated at 36°C for 4.5 h. Equal amounts of
protein from cell extracts were analyzed by Western blot using
antibodies against Pol , Spp1, and Spp2 as probes (lanes 1 to 3). To
test the coimmunoprecipitation of primase and Pol , cells were grown
at the indicated temperatures for 4.5 h. Pol -primase complex
was immunoprecipitated from the cell extracts by using anti-Pol
antibody and probed with appropriate antibodies as described in
Materials and Methods (lanes 4 to 9). (B) Checkpoint-defective
pol ts13 mutant has a stable Pol -primase complex. (Left
panel) Spp1 and Spp2 coimmunoprecipitated with Pol in DBts13
(pol ts13) cells. DBts13 (pol ts13) cells
were grown at 25 or 36°C for 4.5 h. Pol -primase complex was
immunoprecipitated from the cell extracts by using anti-Pol antibody
and probed with antibodies against Pol , Spp1, and Spp2. (Right
panel) Phenotype of wild type and DBts13 (pol ts13) grown
at 36°C for 6 h. The arrows indicate pol ts13 cells
that displayed an abnormal mitotic phenotype.
|
|
We observed equal proportions of Spp1 and Spp2 reproducibly being
coimmunoprecipitated with Pol

from either wild-type cells
or
spp2 mutants. This suggests that neither
spp2
mutant alleles
affect the affinity between Spp1 and Spp2. In our
separate mutational
studies of
spp1+, under the
condition when Spp1 protein failed to coimmunoprecipitate
with Pol

,
Spp2 protein was still able to coimmunoprecipitate
with Pol

in all
spp1 mutants (D. Griffiths, V. Liu, P. Nurse,
and T. Wang,
manuscript submitted). The
spp1 mutation results
indicate
that Spp1 is not require for the Pol

-Spp2 complex formation
and
strongly suggest that Spp2 physically couples Spp1 with Pol

.
The
spp1 results and the concomitant decrease of Spp1 and Spp2
coimmunoprecipitated with Pol

in
spp2 mutants shown in
Fig.
3 indicate that Spp2 is the bridge protein between Spp1 and
Pol

.
These immunoprecipitation experiments thus indicated that
thermosensitive
mutations of
spp2+ affected the
stability of Pol

-primase complex. The Pol

-primase
complex in
spp2-8 cells was severely compromised, while the complex
in
spp2-9 was mildly
compromised.
Finding that mutations of
spp2+ affect the
stability of Pol

-primase complex and
spp2-8 has a severe
instability of its Pol

-primase
complex, as well as an abnormal
mitotic phenotype, led us to analyze
the stability of the complex in
the checkpoint-defective
pol
ts13 at the restrictive
temperature. Pol

was able to coimmunoprecipitate
comparable amounts
of Spp1 and Spp2 from the
pol
ts13 mutant when
cells were
grown at either 36 or 25°C for 4.5 h (Fig.
3B, left
panel). The
amounts of Spp1 and Spp2 coimmunoprecipitated with
Pol

in the
pol
ts13 mutant at either 25 or 36°C, however, were
lower than that of the wild type, indicating that the complex,
although
intact, was slightly compromised (compare Fig.
3B to
3A, lanes
4 and 6). Although the integrity of the four-subunit
Pol

-primase
complex was not substantially affected by mutations
in
pol
ts13, the mutant had large fractions of the cells that
entered aberrant mitosis exhibiting anucleated phenotype (Fig.
3B,
right panel [
2]). It is important to point out that
the
Pol

-primase complex of the S-M phase checkpoint-defective
pol
ts13 had a stability similar to that of the complex of
the S-M phase
checkpoint-intact
spp2-9. These indicate
that the checkpoint defect
of
pol
ts13 mutant is not
due to the mutant-Pol

protein's inability
to associate with the
primase
proteins.
Mutations of spp2+ affect S phase entry and
progression.
Since Spp2 couples the Spp1 and Pol
, we analyzed
whether mutations of spp2+ could affect the
cells' S phase entry. Wild-type and spp2-8 mutant cells
were synchronized in G1 phase by nitrogen starvation for 18 h at 25°C. Cells were then released into rich medium at
36°C. FACS analysis showed that wild-type cells completed S phase
within 2 to 3 h after release, whereas spp2-8 cells
remained with 1C DNA content for 2 to 3 h (Fig.
4A) and required about 6 h to reach a near-2C DNA content. Thus, when spp2 cells were released
from nitrogen starvation, mutations of spp2 caused an
approximately 3-h delay in entering S phase. As shown in Fig. 4B, this
defect resulted in spp2-8 cells losing viability after
2 h. After 6 h, <1% of spp2-8 cells remained
viable and >40% of spp2-8 cells displayed an abnormal
mitotic phenotype.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
Spp2 is essential for S phase entry and progression.
Wild-type 972h and mutant ST118 (spp2-8) cells
were synchronized in G1 phase by maintaining them in
minimal medium lacking a nitrogen source for 18 h at 25°C. The
cultures were then released into YES medium at 36°C and collected at
the indicated times for analysis. (A) FACS analysis of wild-type and
spp2-8 cells. The wild type is shown in the overlaid
histograms, and the spp2-8 mutant is shown in the shaded
histograms. (B) Viability and percentage of cells displaying an
abnormal mitotic "cut" phenotype quantified by microscopic
examination of DAPI-stained cells. (C) Wild-type 972h and
ST118 (spp2-8) mutant cells were synchronized in 12 mM
hydroxyurea for 4 h at 25°C and then released into YES
medium at 36°C. Samples were removed after release from the
hydroxyurea block at the indicated times for FACS analysis. The
wild type is shown in the shaded histograms, and the spp2-8
mutant is shown in the overlaid histograms. (D) Wild-type
972h and ST118 (spp2-8) mutant cells were
synchronized in 12 mM hydroxyurea for 4 h at 25°C,
followed by 1 h of incubation at 36°C, and then released into
YES medium at 36°C. Samples were removed for FACS analysis at the
indicated times after release. The wild type is shown in the shaded
histograms, and the spp2-8 mutant is shown in the overlaid
histograms.
|
|
We then tested whether mutations of
spp2+ could
affect the progression of S phase. Wild-type and
spp2-8
cells were arrested
postinitiation in early S phase by using
hydroxyurea for 4 h at
25°C. Cells were then released
into fresh medium at 36°C, and
samples were taken every 30 min for
FACS analysis. Both wild-type
and
spp2-8 cells were arrested
by hydroxyurea at 25°C with a 1C
DNA content. After release
from the hydroxyurea block, wild-type
and
spp2-8
cells had nearly identical FACS profiles (Fig.
4C).
We believe this
observation may be due to the
S. pombe having
a short S
phase. After the shift to 36°C, it requires a period
of time for the
temperature to have an effect on the
spp2 mutant.
It is
possible that the time required to remove the hydroxyurea
and
shift the temperature is sufficient to allow the cells to
progress
through S phase before the 36°C temperature exerts an
effect on the
Spp2 protein. To circumvent this possibility, we
arrested the cells for
4 h in hydroxyurea at 25°C, shifted them
to 36°C for
1 h before release from the hydroxyurea block, and
continued incubating them at 36°C. With this approach, wild-type
cells completed S phase within 1 h after release from
hydroxyurea,
whereas
spp2-8 cells showed a 0.5- to
1-h delay of progression
through S phase (Fig.
4D). Thus, the
spp2 mutant delayed S phase
entry and progression at both
before and after the hydroxyurea
arrest point. Similar results
were observed with the
spp2-9 mutant
(data not
shown).
spp2 mutants require checkpoint Rad and Cds1, but
not Chk1, for growth at the semipermissive temperature.
The
finding that at the restrictive temperature spp2-8 displayed
aberrant mitotic phenotype and that spp2-9 exhibited
cdc phenotype led us to investigate the cell cycle
checkpoint response induced by these two mutant alleles. We
found that in the rad1
, rad3
,
rad9
, rad17
, rad26
, or
hus1
background, spp2-8 and spp2-9
were viable in liquid culture at up to 32°C and on plates at up to
33°C. This is different from the pol
ts mutants, which are synthetic lethal in these checkpoint rad deletion
backgrounds at 25°C (2). At the semipermissive temperature
of 34°C on solid media, both spp2-8 and spp2-9
required all six checkpoint Rad proteins and Cds1 for viability but
not Chk1 (Fig. 5A). To test whether the
kinase activity of Cds1 is required for the viability of
spp2 mutants, cds1+ or a cds1 kinase
dead mutant, cds1-kd, was ectopically expressed from the
pREP1 vector in the presence of thiamine in the spp2-8 cds1
or spp2-9 cds1
double mutant. Moderate
expression of cds1+ rescued the viability of the
double mutants at 34°C. In contrast, the expression of kinase dead
mutant of cds1 (cds1-kd) was unable to rescue the
double mutants at 34°C (Fig. 5B), suggesting that Cds1 kinase
activity is required for the viability of spp2 mutants at
the semipermissive temperature. Thus, at the semipermissive temperature, cells with S phase perturbation due to
mutations of spp2+ require the checkpoint
Rad proteins and Cds1 kinase, but not Chk1 kinase, for maintaining cell
viability.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 5.
spp2 mutants require checkpoint Rads and
Cds1, but not Chk1, for growth at the semipermissive temperature. (A)
Serial dilutions of spp2-8 and spp2-9 mutants and
the spp2-8 and spp2-9 alleles in rad3,
cds1, and chk1 deletion background were spotted
on YES plates in duplicate. One set of plates was incubated at 30°C,
and the other set was incubated at 34°C. (B) Ectopic expression of
Cds1, but not a kinase-dead Cds1 mutant, rescues the growth of
spp2 cds1 double mutants at 34°C. pREP1
plasmid, carrying either cds1+ or kinase-dead
cds1 mutant, was introduced into spp2 cds1
double mutants in minimal medium lacking leucine. Thiamine was included
in the medium to reduce the expression of Cds1 since the overexpression
of Cds1 is toxic to the cells. Serial dilutions of transformants were
spotted on the selective medium in duplicates and incubated
independently at 30 and 34°C. The transformants of
cds1+ and kinase-dead cds1 mutant are
indicated as "+" and "kd," respectively. Cell density,
104 cells per spot.
|
|
Chk1 response in spp2 mutants.
Since Chk1 was not
required for maintaining growth of spp2 mutants at the
semipermissive temperature, we tested how Chk1 responds to mutations of
spp2+ at the restrictive temperature. As shown
above, majority of the spp2-9 cells and a fraction of the
spp2-8 cells displayed an elongated phenotype with normal
nuclear morphology at the restrictive temperature (Fig. 1A). In the
chk1
deletion background, both spp2-8 and
spp2-9 cells died rapidly and exhibited a small cell size
with aberrant mitotic nuclear morphology at 36°C (Fig.
6A). In contrast, chk1
cells grew normally and exhibited normal nuclear morphology. Thus, the
elongated phenotype seen in spp2-8 and spp2-9
cells requires the function of Chk1.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 6.
Chk1 response to spp2 mutation at 36°C. (A)
DAPI staining of chk1 , spp2-8 chk1 , and
spp2-9 chk1 cells after incubation at 36°C for 6 h. (B) Chk1 phosphorylation induced by mutation of spp2 at
36°C. Mid-log-phase cells grown at 25°C were shifted to 36°C. At
the indicated times, cells were collected and lysed. A portion (30 µg) of cell lysates was fractionated on an SDS-polyacrylamide gel,
transferred to a polyvinylidene difluoride membrane, and probed with
mouse anti-HA monoclonal antibody (12CA5) as described previously
(2). As a control, each strain was treated with 0.2% MMS at
25°C for 1 h. The HA-tagged chk1+ strains
used for wild-type, spp2-8, and spp2-9 cells were
NW222, ST128, and ST129, respectively. The phosphorylated and
unphosphorylated HA-Chk1 proteins are indicated as HA-Chk1-p and
HA-Chk1, respectively.
|
|
We then analyzed the phosphorylation status of Chk1 protein in
spp2 mutant cells. Mutant
spp2 cells containing
three hemagglutinin
(HA) epitopes tagged
chk1+
(
40) were constructed for the detection of Chk1
phosphorylation
by 12CA5 monoclonal antibody. As a control, wild-type
cells containing
the HA tagged
chk1+ were
treated with the DNA-damaging agent methyl methane sulfonate
(MMS), which had been shown to induce Chk1 phosphorylation
(
40).
As expected, Chk1 became readily phosphorylated in
response to
MMS treatment (Fig.
6B). In both
spp2-8 and
spp2-9 cells, only
after 3 to 4.5 h of incubation at
36°C was a weak, slower-migrating
Chk1 protein detectable. This is
consistent with the finding that
phosphorylation of Chk1 primarily
responds to late S phase or
G
2 phase perturbation and not
early S phase perturbation (
23).
These results indicated
that Chk1 was not required for
spp2 mutants
to maintain
viability at the semipermissive temperature and that
mutation of
spp2+ also did not substantially induce Chk1
phosphorylation at 36°C.
However, at the restrictive temperature,
Chk1 did play a critical
role in preventing aberrant mitotic entry of
spp2-9 cells and
of a fraction of the
spp2-8 cells.
Cds1 response in spp2 and pol
mutants.
Since Cds1 is required for both spp2-8 and
spp2-9 cells to maintain viability at the semipermissive
temperature (Fig. 5) and since Cds1 kinase is activated in
thermosensitive pol
mutants (2, 19), we
analyzed the Cds1 response to S phase arrest by spp2 mutants
and compared it to that of the pol
ts13 mutant. Cds1
protein immunoprecipitated from cell extracts was assayed for kinase
activity in vitro using MBP as the substrate (Fig. 7). The Cds1 kinase in spp2-8,
spp2-9, and pol
ts13 was activated three- to
fourfold over the wild-type level after incubation of the cells at
36°C for 4.5 h (Fig. 7, lanes 1 to 4). The kinase activity
measured under these conditions was Cds1 specific because the
phosphorylation of MBP was not detected in cds1
cells
(Fig. 7, lane 5). It is important to mention that the Pol
-primase
complex is extremely unstable in spp2-8 cells, whereas the
complex is only mildly compromised in spp2-9 and
pol
ts13 cells (Fig. 3). Nonetheless, the Cds1 kinase was
activated to a similar extent when all three mutants were arrested in
early S phase at the restrictive temperature. These results suggest
that early S phase arrest by these initiation mutants, regardless of
the extent of their Pol
-primase complex instability, generates a
signal to moderately activate Cds1 kinase.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
Cds1 response to spp2 mutations. Cds1 kinase
activity of wild-type 972h , ST118 (spp2-8),
and ST119 (spp2-9) in the absence or presence of 12 mM
hydroxyurea at 36°C. Mid-log-phase cells grown at 25°C were
shift to 36°C for 1 h, and incubation continued at 36°C for
3.5 h in the absence ( Hydroxyurea) or presence (+Hydroxyurea) of
12 mM hydroxyurea. Cds1 kinase was purified from cell extracts
and assayed for kinase activity as described in Materials and Methods.
The relative amounts of Cds1 proteins used in the kinase assay were
estimated by Western blot (upper panel, Cds1). The kinase activity was
measured by phosphorylation of MBP (lower panel, 32P-MBP)
and quantified by PhosphorImager analysis.
|
|
Cds1 kinase is highly activated when S phase is arrested by
hydroxyurea (
19). We therefore examined the
hydroxyurea-induced
Cds1 response in
spp2 and
pol
mutants. Mid-log-phase cells grown
at 25°C were
shifted to 36°C for 1 h and then incubated for an
additional
3.5 h at 36°C in 12 mM hydroxyurea. As expected, Cds1
kinase was activated >20-fold by hydroxyurea in wild-type
cells
(Fig.
7, compare lane 6 to lane 1). The
hydroxyurea-induced Cds1
kinase activity in
spp2-9
cells was about 65 to 70% of the wild-type
level (Fig.
7, lane 8),
whereas the hydroxyurea-induced Cds1 kinase
activity in
spp2-8 cells was only about 25% of the wild-type level
(Fig.
7, lane 7). Therefore, although the Cds1 kinase can be activated
to a similar extent in
spp2-8 and
spp2-9 mutants
when they are
arrested by temperature, there is a striking difference
in their
hydroxyurea-induced Cds1 kinase activation at 36°C.
Thus, at the
restrictive temperature, the Cds1 response to signals
generated
from S phase arrest induced by an initiation mutant is
different
from that induced by hydroxyurea
arrest.
As shown in this study and elsewhere (
2), at 36°C
pol
ts13 cells exhibit heterogeneous cell morphology with
>40% of the
cells displaying abnormal nuclear phenotype; however, the
Pol

-primase
complex in
pol
ts13 was only slightly
compromised (Fig.
3B). We
therefore tested the
hydroxyurea-induced Cds1 response in the
pol
ts13
mutant. Surprisingly, the Cds1 kinase was activated to
approximately
75% of the wild-type level (Fig.
7, lane 9), which
was comparable to
the levels of the checkpoint-proficient mutant
spp2-9.
Thus, the abnormal mitotic phenotype of
pol
ts13 is due
to
a checkpoint defect that can be distinguished from the
hydroxyurea-induced
Cds1-mediated checkpoint
pathway.
Maintenance of the hydroxyurea-induced Cds1 kinase in
spp2 and pol
mutants.
We then tested
the ability of the mutants to maintain the hydroxyurea-induced
Cds1 kinase activation. Wild-type and mutant cells were first incubated
in hydroxyurea at 25°C for 3.5 h to activate the Cds1
kinase. Cells were then shifted to 36°C with fresh
hydroxyurea added and further incubated at 36°C. At the indicated times, cell samples were taken for analysis of the Cds1 kinase activity (Fig. 8A), the percentage
of cells passing mitosis (Fig. 8B), and the percentage of cells
entering inappropriate mitosis (Fig. 8C). After incubation of the cells
for 3.5 h in hydroxyurea at 25°C, Cds1 kinase was
activated in spp2-8, spp2-9, and
pol
ts13 cells to 80 to 90% of the wild-type cells levels (Fig. 8A, 3.5 h, compare lanes 6, 10, and 14 to lane 2; quantified in the lower graph). After 1.5 h at 36°C (Fig. 8A, 5-h time
point), the Cds1 kinase activity in wild-type cells decreased to
approximately 75 to 80% of the original level (Fig. 8A, 5-h time
point, lane 3 [quantified in the lower graph]). After 3 h at
36°C (Fig. 8A, 6.5-h time point), the hydroxyurea-induced
Cds1 kinase activity established at the permissive temperature in
wild-type cells decreased to approximately 60% of the original level
(Fig. 8A, 6.5-h time point, lane 4 [quantified in the lower graph]).
The level of Cds1 kinase activity in spp2-8 after 1.5 h
at 36°C decreased to 50% of its original levels that had been
established at 25°C (Fig. 8A, 5-h time point, compare lane 7 to lane
6 [quantified in the lower graph]), whereas the Cds1 kinase activity
in spp2-9 was maintained at its original level established
at 25°C (Fig. 8A, compare lanes 10 and 11). The Cds1 kinase activity
in pol
ts13 after 1.5 h at 36°C decreased to
approximately 75% of the levels established at 25°C (Fig. 8A,
compare lanes 14 and 15 [quantified in the lower graph]).
Interestingly, after 3 h at 36°C (Fig. 8A, 6.5-h time points),
the Cds1 kinase activity in spp2-8 was maintained at 15% of
its original levels established at 25°C, while both spp2-9
and pol
ts13 decreased to approximately 40% of the levels established at 25°C (Fig. 8A, lanes 8, 12, and 16 [lower
quantification graph]).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 8.
Maintenance of hydroxyurea-induced Cds1 kinase
activity. Cds1 activation was induced in wild-type and mutant cells by
12 mM hydroxyurea at 25°C for 3.5 h. The cells were then
shifted to 36°C with 12 mM hydroxyurea added. At the
indicated times, samples were removed and analyzed for Cds1 kinase
activity (A and B), the percentage of cells passing mitosis (C), and
the percentage of cells entering into aberrant mitosis described as the
cut phenotype (D). The relative amounts of Cds1 proteins used in the
kinase assay were estimated by Western blot (A, upper panel, Cds1). The
kinase activity was measured by phosphorylation of MBP (A, lower panel,
32P-MBP) and was quantified by PhosphorImager analysis
(B).
|
|
The observed hydroxyurea-induced Cds1 response in these mutants
was also consistent with their kinetics of passing mitosis
(Fig.
8B)
and the appearance of abnormal mitotic phenotype (Fig.
8C). At 4 h
after the shift to 36°C (7.5-h time point of Fig.
8B and C), >50%
of the
spp2-8 cells passed mitosis and >20% of
the
spp2-8 cells displayed an abnormal mitotic phenotype. At the
same time point, <20% of the wild-type,
spp2-9, and
pol
ts13 cells
passed mitosis and ~2% of the cells
exhibited an abnormal mitotic
phenotype. Interestingly, after the shift
to 36°C for 5 h (8.5-h
time point of Fig.
8B and C), <15% of
the
pol
ts13 cells entered
mitosis, while >45% of the
wild-type and
spp2-9 cells entered
mitosis, suggesting that
pol
ts13 and hydroxyurea arrest the cell
cycle at
close
proximity.
Together, these results indicated that both the induction and the
maintenance of the hydroxyurea-induced Cds1 response were
severely compromised in
spp2-8 cells and moderately
compromised
in
spp2-9 and
pol
ts13 cells. It is
important to note that
spp2-8 which has the most unstable
Pol

-primase complex, also has the
lowest ability to induce and
maintain the hydroxyurea-induced
Cds1
response.
 |
DISCUSSION |
The goal of this study was to determine the checkpoint
response(s) to aberrant initiation of S phase. Here, we analyzed the mutational effects of the DNA primase gene spp2+
encoding the primase subunit, Spp2, on the cell cycle checkpoint response and compared to that of pol
mutation. Four main
points emerged from our studies. First, Spp2 is required for coupling RNA primer synthesis by Spp1 to initiation DNA synthesis by Pol
, suggesting that Spp2 is the bridge protein between Spp1 and Pol
. Second, mutations of spp2+ destabilize the
mutant's Pol
-primase complex. The spp2 mutant that
has a severely compromised Pol
-primase complex also exhibits the aberrant mitotic phenotype at the restrictive temperature, suggesting a correlation between the stability of the complex and the
aberrant mitotic phenotype. Third, the spp2 mutant that has
the most severely compromised Pol
-primase complex also has the
lowest ability to activate and maintain the hydroxyurea-induced Cds1 response; however, this mutant is able to activate the Cds1 response induced by its temperature arrest. Fourth, a checkpoint defective pol
ts mutant has an intact Cds1 response in
either the presence or the absence of hydroxyurea and a similar
Pol
-primase complex stability as a checkpoint intact
spp2 mutant.
Based on these findings, we propose a model of how different types of
perturbation of S phase initiation could induce different checkpoint responses: an unstable initiation complex or a stalled initiation generates a signal to moderately activate the Cds1 kinase to
stabilize and/or recover the initiation complex to prevent replication
fork collapse and accumulation of mutations (Fig. 9A). Following an early S phase stall
caused by hydroxyurea, a stable and intact Pol
-primase
complex is required to signal high levels of Cds1 kinase activation to
prevent progression of the early replication fork and premature
initiation of the late-firing replicons (Fig. 9B). Once DNA replication
is initiated, the synthesis of an initiation DNA structure by Pol
is
required for generating the S phase checkpoint to prevent
inappropriate mitotic entry (Fig. 9C).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9.
Model illustrating the proposed Cds1 responses to the
aberrant initiation of S phase. The proposed Cds1 response to unstable
replication complex (A), a stalled replication fork (B), and the
requirement for cells to generate a signal (C) for the intra-S phase
checkpoint and the S-M phase checkpoint as described in the
Discussion.
|
|
A moderately activated Cds1 kinase is required to maintain an
unstable Pol
-primase complex.
Cds1 was originally identified as
a high-copy suppressor of a temperature-sensitive pol
mutant, swi7-H4 (26). The Cds1 structural
counterpart in budding yeast, RAD53, has been reported to
modulate phosphorylation of the B subunit of Pol
-primase complex (29). We showed in this study that mutations of
spp2 destabilize the Pol
-primase complex (Fig. 3) and
that Cds1 kinase is moderately activated in the spp2 and
pol
mutants at the restrictive temperature (Fig. 7). We
have previously shown that deletion of Cds1 decreases the
semipermissive temperature of several thermosensitive mutant alleles of
pol
and exacerbates the mutator phenotypes of these mutants (20). Thus, mutations of either spp2 or
pol
require the function of Cds1 kinase at both the
semipermissive and the restrictive temperatures. It is not yet clear
whether Cds1 directly or indirectly interacts with the Pol
-primase
complex and what the substrates of Cds1 kinase are. The results of this
study and in combination with our previous studies (20)
suggest that an unstable or stalled Pol
-primase complex of
pol
or spp2 mutants requires a moderate levels
of Cds1 kinase activation to stabilize and/or to prevent the formation
of unrecoverable replication complex, replication fork collapse, and/or
the accumulation of mutations (Fig. 9A).
It is important to mention that both
spp2-8 and
pol
ts13 display a mixed phenotype. The elongated cells
seen in the
spp2 population
(Fig.
1A) and
pol
ts13 mutants (Fig.
3B and reference
2) can
be attributed to the Chk1 response to prevent
aberrant mitotic
entry of these initiation mutants (Fig.
6A). Chk1 is
not significantly
phosphorylated during early-S-phase arrest by
spp2 mutants (Fig.
6B). It is possible that the unstable
initiation complex in
spp2-8 and/or the stalled initiation
complex in
pol
ts13 are not sufficient
to activate Chk1 to
a level that can fully prevent inappropriate
mitotic entry, thus
resulting in a mixed
phenotype.
A stable Pol
-primase complex is required for activation of the
Cds1-mediated intra-S phase checkpoint.
We propose that
following an early S phase stall caused by hydroxyurea, a
stable and intact Pol
-primase complex is required to signal the
activation of high levels of Cds1 kinase to prevent the premature
initiation of the late-firing replicons. In budding yeast, it has been
shown that, following hydroxyurea-induced arrest, the
initiation complexes of the late-firing replicons remain in an
initiation-competent state for a long period of time (12, 33). In fission yeast, after hydroxyurea-induced arrest,
the Cds1-mediated checkpoint response is also thought to prevent
the initiation of late-firing replicons, and/or stabilize existing replicons (19). This process is termed intra-S phase checkpoint.
We found that at the restrictive temperature, the
hydroxyurea-induced Cds1 kinase of
spp2-8 was only
activated at 25% of the
wild-type cell's level (Fig.
7). After 3 h at 36°C,
spp2-8 was
unable to maintain the
hydroxyurea-induced Cds1 kinase established
at 25°C (Fig.
8A). As shown in Fig.
8B and in our previous mutational
studies of
pol
(
2), hydroxyurea arrests the S
phase at point
close to the arrest point of
pol
ts mutant,
causing a stalled
replication. It is not yet clear at the molecular
level how Cds1
kinase inhibits the progression of the replication fork
of the
early-firing replicons and prevents initiation of the
late-firing
replicons following hydroxyurea-induced arrest. It
is possible
that a stable Pol

-primase complex in the replication
complex
is required to generate the signal for high levels of Cds1
kinase
activation to prevent progression of the early-firing
replication
fork and initiation of late-firing replicons. The rationale
for
this hypothesis is our finding that
spp2-8 with a
severely compromised
Pol

-primase complex also has the lowest
ability to activate and
maintain the
hydroxyurea-induced Cds1 kinase (Fig.
3,
7, and
8).
The inability of
spp2-8 to activate and to maintain the
hydroxyurea-induced
Cds1 kinase activity may cause the cell to
be unable to prevent
the progression of early-firing replication fork
and/or premature
firing of the late replicons. Thus,
spp2-8
has a higher percentage
of cells entering abnormal mitosis than does
spp2-9 (Fig.
8B and
C).
spp2-9 and
pol
ts13 both have mildly compromised Pol

-primase
complex. The mildly compromised complex might be sufficient to
generate
a signal to activate sufficient levels of Cds1 to prevent
the
firing of late replicons. The activated Cds1 kinase in
spp2-9 and
pol
ts13, however, is insufficient
to fully prevent inappropriate
mitotic entry as the wild-type cells
after 3.5 h at 36°C (Fig.
8A). Thus,
spp2-9 and
pol
ts13, despite having the wild-type-like
percentage of
cells passing mitosis and mitotic phenotype after
5 h in 36°C
(Fig.
8B and C, 8.5-h time point), these mutants eventually
die. These
results suggest that, upon hydroxyurea-induced arrest,
a
functional Spp2 coupling Spp1 and Pol

to establish a stable
Pol

-primase complex is required to generate a signal for high
levels
of Cds1 activation for the intra-S phase checkpoint (Fig.
9B).
As shown in Fig.
7, in all of the mutants, the levels of Cds1 kinase
activity induced by hydroxyurea are much higher than
the levels
induced by
spp2 or
pol
ts mutant arrest (Fig.
7). It
is not clear whether, following hydroxyurea-induced
arrest or
early S-phase arrest by
spp2 and
pol
ts, Cds1 proteins are being
phosphorylated at the same
or different sites, thus being activated
at different levels. However,
our results suggest that mutations
of
spp2+
cause an unstable initiation complex, resulting in an aberrant
initiation that induces a moderate level of Cds1 response to recover
from the perturbation. Upon hydroxyurea inhibition, a stable
Pol

-primase
complex is required to induce higher levels of Cds1
kinase for
the intra-S phase checkpoint response. Thus, Cds1
response(s)
to the early-S-phase arrest signals induced by a
replication initiation
mutant is different from that induced by
hydroxyurea.
The requirement for the S-M phase checkpoint can be
distinguished from the requirement for the intra-S phase
checkpoint.
We showed in this study that at the restrictive
temperature, pol
ts mutant exhibits an aberrant mitotic
phenotype but has an intact but mildly compromised Pol
-primase
complex (Fig. 3B). Importantly, the checkpoint-defective
pol
ts13 and the checkpoint-intact spp2-9
at 36°C have similar Pol
-primase complex stabilities and similar
abilities to activate and maintain the hydroxyurea-induced Cds1
kinase. These suggest that the S-M phase checkpoint defect of
pol
ts mutant most likely is not due to an unstable
Pol
-primase complex or to inability to activate and maintain Cds1
kinase activity. This also suggests that Cds1 activation does not play
a major role in preventing the inappropriate mitotic entry of
pol
ts13. We have previously shown that the catalytic
activity of Pol
to synthesize an initiation DNA structure is
required for generating the replication checkpoint to prevent
inappropriate mitosis during S phase (2). Thus, we propose
that, upon S phase initiation, the requirement for generating the
replication checkpoint to prevent inappropriate mitotic entry is
the initiation DNA synthesis of Pol
(Fig. 9C) and that this
requirement is distinguished from the requirements for generating the
hydroxyurea-induced Cds1-mediated intra-S phase checkpoint response.
 |
ACKNOWLEDGMENTS |
We thank A. M. Carr for providing us the checkpoint rad
deletion strains, D. Bhaumik for help in isolation of the
spp2+ gene, and T. Enoch for
pREP1-cds1+ and pREP-cds1-kd (kinase
dead mutant) plasmids. We especially thank members of our laboratory
for helpful discussion during the course of this work.
S. Tan is sponsored by a postdoctoral training grant CA09151 awarded by
National Cancer Institute. This study was supported by a grant CA54415
from The National Cancer Institute of The National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Pathology, Stanford University School of Medicine, Stanford, CA
94305-5324. Phone: (650) 725-4907. Fax: (650) 725-6902. E-mail:
twang{at}cmgm.stanford.edu.
 |
REFERENCES |
| 1.
|
Al-Khodairy, F.,
E. Fotou,
K. S. Sheldrick,
D. J. Griffiths,
A. R. Lehmann, and A. M. Carr.
1994.
Identification and characterization of new elements involved in checkpoint and feedback controls in fission yeast.
Mol. Biol. Cell
5:147-160[Abstract].
|
| 2.
|
Bhaumik, D., and T. S.-F. Wang.
1998.
Mutational effect of fission yeast Pol on cell cycle events.
Mol. Biol. Cell
9:2107-2123[Abstract/Free Full Text].
|
| 3.
|
Boddy, M. N.,
B. Furnari,
O. Mondesert, and P. Russell.
1998.
Replication checkpoint enforced by kinase Cds1 and Chk1.
Science
280:909-912[Abstract/Free Full Text].
|
| 4.
|
Brondello, J.-M.,
M. N. Broddy,
B. Furnari, and P. Russell.
1999.
Basis for the checkpoint signal specificity that regulates Chk1 and Cds1 protein kinases.
Mol. Cell. Biol.
19:4262-4269[Abstract/Free Full Text].
|
| 5.
|
Carr, A. M.
1998.
Analysis of fission yeast DNA structure checkpoints.
Microbiology
144:5-11[Free Full Text].
|
| 6.
|
Carr, A. M.
1996.
Checkpoints take the next step.
Science
271:314-315[CrossRef][Medline].
|
| 7.
|
Carr, A. M.
1995.
DNA-structure checkpoint in fission yeast.
Semin. Cell Biol.
6:65-72[CrossRef][Medline].
|
| 8.
|
Carr, A. M., and M. F. Hoekstra.
1995.
The cellular responses to DNA damage.
Trends Cell Biol.
5:32-40[CrossRef][Medline].
|
| 9.
|
Chen, L.,
T.-H. Liu, and N. C. Walworth.
1999.
Association of Chk1 with 14-3-3 proteins is stimulated by DNA damage.
Genes Dev.
13:675-685[Abstract/Free Full Text].
|
| 10.
|
Copeland, W. C., and T. S.-F. Wang.
1993c.
Enzymatic characterization of the individual mammalian primase subunits reveals a biphasic mechanism for initiation of DNA replication.
J. Biol. Chem.
268:26179-26189[Abstract/Free Full Text].
|
| 11.
|
D'Urso, G.,
B. Grallert, and P. Nurse.
1995.
DNA polymerase alpha, a component of the replication initiation complex, is essential for the checkpoint coupling S phase to mitosis in fission yeast.
J. Cell Sci.
108:3109-3118[Abstract].
|
| 12.
|
Desany, B. A.,
A. A. Alcasabas,
J. B. Bachant, and S. J. Elledge.
1998.
Recovery from DNA replicational stress is the essential function of the S-phase checkpoint pathway.
Genes Dev.
12:2956-2970[Abstract/Free Full Text].
|
| 13.
|
Enoch, T.,
A. M. Carr, and P. Nurse.
1992.
Fission yeast genes involved in coupling mitosis to completion of DNA replication.
Genes Dev.
6:2035-2046[Abstract/Free Full Text].
|
| 14.
|
Foiani, M.,
C. Santocanale,
P. Plevani, and G. Lucchini.
1989.
A single essential gene, PRI2, encodes the large subunit of DNA primase in Saccharomyces cerevisiae.
Mol. Cell. Biol.
9:3081-3087[Abstract/Free Full Text].
|
| 15.
|
Furnari, B.,
N. Rhind, and P. Russell.
1997.
cdc25 mitotic inducer targeted by chk1 DNA damage checkpoint kinase.
Science
277:1495-1497[Abstract/Free Full Text].
|
| 16.
|
Griffiths, D. J. F.,
N. C. Barbet,
S. McCready,
A. R. Lehmann, and A. M. Carr.
1995.
Fission yeast rad17: a homologue of budding yeast RAD24 that shares regions of sequence similarity with DNA polymerase accessory proteins.
EMBO J.
14:5812-5823[Medline].
|
| 17.
|
Gutz, H.,
H. Heslot,
U. Leupold, and N. Loprieno.
1974.
Schizosaccharomyces pombe, p. 395-446.
In
R. C. King (ed.), Handbook of genetics 1, vol. I. Plenum Press, New York, N.Y.
|
| 18.
|
Hartwell, L. H., and T. A. Weinert.
1989.
Checkpoints: controls that ensure the order of cell cycle events.
Science
246:629-634[Abstract/Free Full Text].
|
| 19.
|
Lindsay, H. D.,
D. J. F. Griffiths,
R. Edwards,
J. M. Murray,
P. U. Christensen,
N. Walworth, and A. M. Carr.
1998.
S-phase specific activation of Cds1 kinase defines a subpathway of the checkpoint response in S. pombe.
Genes Dev.
12:382-395[Abstract/Free Full Text].
|
| 20.
|
Liu, V. F.,
D. Bhaumik, and T. S.-F. Wang.
1999.
Mutator phenotype induced by aberrant replication.
Mol. Cell. Biol.
19:1126-1135[Abstract/Free Full Text].
|
| 21.
|
Lopez-Girona, A.,
B. Furnari,
O. Mondesert, and P. Russell.
1999.
Nuclear localization of Cdc25 is regulated by DNA damage and a 14-3-3 protein.
Nature
397:172-175[CrossRef][Medline].
|
| 22.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 23.
|
Martinho, R. G.,
H. D. Lindsay,
G. Flaggs,
A. J. DeMaggio,
M. F. Hoekstra,
A. M. carr, and N. J. Bentley.
1998.
Analysis of Rad3 and Chk1 protein kinases defines different checkpoint responses.
EMBO J.
17:7239-7249[CrossRef][Medline].
|
| 24.
|
Miyazawa, H.,
M. Izumi,
S. Tada,
R. Takada,
M. Masutani,
M. Ui, and F. Hanaoka.
1993.
Molecular cloning of the cDNAs for the four subunits of mouse DNA polymerase alpha-primase complex and their gene expression during cell proliferation and the cell cycle.
J. Biol. Chem.
268:8111-8122[Abstract/Free Full Text].
|
| 25.
|
Moreno, S.,
A. Klar, and P. Nurse.
1991.
Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.
Methods Enzymol.
194:795-823[Medline].
|
| 26.
|
Murakami, H., and H. Okayama.
1995.
A kinase from fission yeast responsible for blocking mitosis in S phase.
Nature
374:817-819[CrossRef][Medline].
|
| 27.
|
Park, H.,
S. Francesconi, and T. S.-F. Wang.
1993.
Cell cycle expression of two replicative DNA polymerases and from Schizosaccharomyces pombe.
Mol. Biol. Cell
4:145-157[Abstract].
|
| 28.
|
Paulovich, A. G., and L. H. Hartwell.
1995.
A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage.
Cell
82:841-847[CrossRef][Medline].
|
| 29.
|
Pellicioli, A.,
C. Lucca,
G. Liberi,
F. Marini,
M. Lopes,
P. Plevani,
A. Romano,
P. P. D. Fiore, and M. Foiani.
1999.
Activation of Rad53 kinase in response to DNA damage and its effect in modulating phosphorylation of the lagging strand DNA polymerase.
EMBO J.
18:6561-6572[CrossRef][Medline].
|
| 30.
|
Peng, C.-Y.,
P. R. Graves,
R. S. Thoma,
Z. Wu,
S. A. Shaw, and H. Piwnica-Worms.
1997.
Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of cdc25C on serine-216.
Science
277:1501-1505[Abstract/Free Full Text].
|
| 31.
|
Rhind, N., and P. Russell.
1998.
Mitotic DNA damage and replication checkpoints in yeast.
Curr. Opin. Cell Biol.
10:749-758[CrossRef][Medline].
|
| 32.
|
Sanchez, Y.,
C. Wong,
R. S. Thoma,
R. Richman,
Z. Wu,
H. Piwnica-Worms, and S. J. Elledge.
1997.
Conservation of the chk1 checkpoint pathway in mammals: linkage of DNA damage to cdk regulation through cdc25.
Science
277:1497-1501[Abstract/Free Full Text].
|
| 33.
|
Santocanale, S., and J. F. X. Diffley.
1998.
A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication.
Nature
395:615-618[CrossRef][Medline].
|
| 34.
|
Shirahige, K.,
Y. Hori,
K. Shirishi,
M. Yamashita,
K. Takahashi,
C. Obuse,
T. Tsurimoto, and H. Yoshikawa.
1998.
Regulation of DNA-replication origins during cell-cycle progression.
Nature
395:618-621[CrossRef][Medline].
|
| 35.
|
Stadlbauer, F.,
A. Brueckner,
C. Rehfuess,
C. Eckerskorn,
F. Lottspeich,
V. Forster,
B. Y. Tseng, and H. P. Nasheuer.
1994.
DNA replication in vitro by recombinant DNA-polymerase-alpha-primase.
Eur. J. Biochem.
222:781-793[Medline].
|
| 36.
|
Tan, S.,
R. C. Conaway, and J. W. Conaway.
1994.
A bacteriophage vector suitable for site-directed mutagenesis and high level expression of multisubunit proteins in E. coli.
BioTechniques
16:824-828[Medline].
|
| 37.
|
Tatebayashi, K.,
J. Katoa, and H. Ikedaa.
1998.
Isolation of a Schizosaccharomyces pombe rad21ts mutant that is aberrant in chromosome segregation, microtubule function, DNA repair and sensitive to hydroxyurea: possible involvement of Rad21 in ubiquitin-mediated proteolysis.
Genetics
148:49-58[Abstract/Free Full Text].
|
| 38.
|
Uchiyama, M.,
I. Galli,
D. J. F. Griffiths, and T. S.-F. Wang.
1997.
A novel mutant allele of Schizosaccharomyces pombe rad26 defective in monitoring S phase progression to prevent premature mitosis.
Mol. Cell. Biol.
17:3103-3115[Abstract].
|
| 39.
|
Waga, S., and B. Stillman.
1998.
The DNA replication fork in eukaryotic cells.
Annu. Rev. Biochem.
67:721-751[CrossRef][Medline].
|
| 40.
|
Walworth, N. C., and R. Bernards.
1996.
rad-dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint.
Science
271:353-356[Abstract].
|
| 41.
|
Wang, T. S.-F.
1996.
Cellular DNA polymerases, p. 461-493.
In
M. L. DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 42.
|
Zeng, Y., and H. Piwnica-Worms.
1999.
DNA damage and replication checkpoints in fission yeast require nuclear exclusion of the Cdc25 phosphatase via 14-3-3 binding.
Mol. Cell. Biol.
19:7410-7419[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 2000, p. 7853-7866, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chabes, A., Stillman, B.
(2007). Constitutively high dNTP concentration inhibits cell cycle progression and the DNA damage checkpoint in yeast Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA
104: 1183-1188
[Abstract]
[Full Text]
-
Lee, B.-S., Grewal, S. I. S., Klar, A. J. S.
(2004). Biochemical Interactions between Proteins and mat1 cis-Acting Sequences Required for Imprinting in Fission Yeast. Mol. Cell. Biol.
24: 9813-9822
[Abstract]
[Full Text]
-
Uchiyama, M., Wang, T. S.-F.
(2004). The B-Subunit of DNA Polymerase {alpha}-Primase Associates with the Origin Recognition Complex for Initiation of DNA Replication. Mol. Cell. Biol.
24: 7419-7434
[Abstract]
[Full Text]
-
Dahlen, M., Sunnerhagen, P., Wang, T. S.-F.
(2003). Replication Proteins Influence the Maintenance of Telomere Length and Telomerase Protein Stability. Mol. Cell. Biol.
23: 3031-3042
[Abstract]
[Full Text]
-
You, Z., Kong, L., Newport, J.
(2002). The Role of Single-stranded DNA and Polymerase alpha in Establishing the ATR, Hus1 DNA Replication Checkpoint. J. Biol. Chem.
277: 27088-27093
[Abstract]
[Full Text]
-
Liang, D. T., Forsburg, S. L.
(2001). Characterization of Schizosaccharomyces pombe mcm7+ and cdc23+ (MCM10) and Interactions With Replication Checkpoints. Genetics
159: 471-486
[Abstract]
[Full Text]
-
Kai, M., Tanaka, H., Wang, T. S.-F.
(2001). Fission Yeast Rad17 Associates with Chromatin in Response to Aberrant Genomic Structures. Mol. Cell. Biol.
21: 3289-3301
[Abstract]
[Full Text]
-
Griffiths, D. J. F., Liu, V. F., Nurse, P., Wang, T. S.-F.
(2001). Role of Fission Yeast Primase Catalytic Subunit in the Replication Checkpoint. Mol. Biol. Cell
12: 115-128
[Abstract]
[Full Text]