INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Src homology (SH) domains, including SH2 and SH3 domains, are protein modules found in many otherwise functionally distinct molecules (25). The ligands for SH2 and SH3 domains are phosphotyrosine-containing peptides (pY-X-X-X) and proline-rich peptides (P-X-X-P), respectively. The C-terminal amino acid residues of the phosphotyrosines and the flanking amino acid residues of proline-rich segments determine binding affinity and specificity (26, 35). A family of SH2 and SH3 domain-containing proteins, including Crk, Grb2, and Nck, contain only SH2 and SH3 domains and have no other functional motifs (2, 19). They are therefore regarded as adapters. They act by binding to tyrosine-phosphorylated proteins via SH2 domains and associating with P-X-X-P motif-containing proteins through SH3 domains. SH3-associated proteins often get translocated to the proximity of phosphotyrosine proteins (32). Thus, SH2 and SH3 domains act as a second messenger connecting protein tyrosine phosphorylation to a variety of intracellular signaling networks. The best-characterized adapter is the SH3-SH2-SH3 protein Grb2. Grb2 binds to two separate pY-X-N-V motifs in the epidermal growth factor receptor (EGFR) via its SH2 domain and associates through its two SH3 domains to the PPPVPPRRR motifs in Sos, a guanine nucleotide exchange factor for Ras. As a result, Sos is translocated to the plasma membrane and activates Ras (32).

Nck contains three consecutive SH3 domains and one SH2 domain, which together occupy more than 70% of Nck's 377 amino acids (16). Similar to Grb2, Nck is widely expressed in various types of cells and acts as an adapter by linking receptor tyrosine kinases to downstream signaling networks. It has also been reported that there is a fraction of Nck that is associated with Sam68 in the nucleus (14), although its function remains unknown. The SH2 domain of Nck has been shown to bind either directly or indirectly to EGFR, platelet-derived growth factor receptor (PDGFR), Eph receptor, insulin receptor substrate 1, p130^cas, and p62^Dok (16, 20). For example, tyrosine 751 (Y751) in human PDGFR- was identified as the binding site for Nck. Since Y751 is also one of the two binding sites in the PDGFR for the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) (the p85 subunit has two SH2 domains), Nck and PI3-K may either compete with each other for binding to the PDGFR and thereby antagonize each other's function or bind to different pools of the cell surface PDGFR (22). There has been no evidence so far for or against either of these hypotheses. Stein et al. identified a binding site for Nck in the Eph family receptor, Eph1 (ELK). They showed that Y-594 in the juxtamembrane region of Eph1 recruits Nck to the plasma membrane. The membrane-bound Nck in turn causes, apparently via Nck-interacting kinase (NIK), activation of the JNK/SAPK pathway (1, 36, 37). The current list of Nck (, , or both) SH3-binding molecules includes the Abl protein tyrosine kinase, Sos, Nck-associated kinase (NAK), p21^cdc42/rac-activated kinases (PAK), Rho effector PKN-related kinase PRK2, protooncogene c-cbl, human Wiskott-Aldrich syndrome protein (WASp), the novel serine threonine kinase NIK, casein kinase 1 gamma-2, Sam-68, Nap1 (Nck-associated protein 1), and NAP4 (Nck-, Ash- and PLC-binding protein 4) (16). We and others recently reported that Nck represents a family of genes including two human (Nck/hNck and hNck/Nck2) and two mouse (mNck and mNck/Grb4) Nck genes (3, 4, 25, 40). hNck and hNck reside in different chromosomes (4, 10, 41) and are coexpressed in most but not all cells (3). The newly identified Nck binds significantly better than Nck (Nck) to both receptor and nonreceptor tyrosine kinases (3, 4, 40). Moreover, Nck and Nck appear to have distinct functional assignments in the same cells (4).

Recently, a growing number of studies have suggested that Nck plays an important role in mediating receptor tyrosine kinase signaling to the actin cytoskeleton. Rockow et al. showed that overexpression of Nck blocks nerve growth factor- and basic fibroblast growth factor-induced neurite outgrowth, a Rac1/Cdc42 GTPase-dependent actin cytoskeletal change, in rat adrenal pheochromocytoma cells PC12, through an extracellular signal-regulated kinase-independent mechanism (29). Two Nck-SH3-binding proteins, WASp and PAK1, have clear roles in regulation of the actin cytoskeleton through either Cdc42- and Rac-dependent or -independent mechanisms. Symons et al. showed that WASp binds to GTP-bound Cdc42 and clusters in polymerized actin (38). N-WASp (richest in neural tissues) is also involved in Cdc42 signaling to the actin cytoskeleton (21). Sells et al. reported that PAK1-induced actin organization depends upon binding to Nck but not upon PAK1 kinase activity or binding to Rac1 and Cdc42 (33). They showed that a kinase-dead PAK1 could mimic the effect of Rac and induce lamellipodia formation (33). Consistent with their observations, Obermeier et al. showed that brain-specific PAK (PAK/PAK3) induces cell spreading, membrane ruffling, and increased lamellipodia formation (24). The strongest support of the notion that Nck links tyrosine kinases to the actin cytoskeleton comes from a genetic study of Drosophila melanogaster. Each of the eight R cells (R1 to R8) of the Drosophila compound eye is a distinct neuron and acts as a photoreceptor. Guidance and target recognition of these R cells toward axons are believed to be regulated by receptors at the surface of the growth cone, which resides at the leading edge of the axon. The growth cones receive extracellular cues and in turn control the intracellular actin cytoskeletol rearrangement. Zipursky and his colleagues found that the gene called Dreadlocks, or Dock, was concentrated in the R-cell growth cone and essential for R-cell guidance and target recognition. Mutations in the Dock gene disrupted signaling from the surface of the growth cone to the intracellular actin cytoskeleton, resulting in defects in R-cell fasciculation, targeting, and retinotopy (5). Dock is structurally related to and has an overall 40% amino acid identity with the mammalian Nck genes (4). Rao and Zipursky showed that the first and third SH3 domains and the SH2 domain are functionally redundant, whereas the middle SH3 domain is always required (27). Depending upon the specific neuron type, the middle SH3 domain could act with the SH2 domain or with the first and third SH3 domains. The critical downstream pathways for Dock include the Cdc42-Pak1 pathway (9) and the Ste20-like kinase misshapen pathway (30). In contrast, important questions regarding the function of the mammalian Nck genes remain unanswered. Does Nck play roles in mammals similar to that of Dock in Drosophila? Are both Nck and Nck involved in regulation of the actin cytoskeleton? It has previously been demonstrated that PDGF induces actin polymerization at the plasma membrane of fibroblast cells to produce edge ruffles and lamellipodia (6, 28). This signaling event appears to involve the Rho family GTPase Rac1 (23, 28) and PI3-K (23, 42, 43). PI3-K appears to act upstream of Rac1 (8). Because Nck is a direct target for PDGFR, we set out to compare the roles of Nck and Nck in PDGF-stimulated actin cytoskeletal rearrangement in NIH 3T3 cells. We found that Nck is specifically involved in PDGF-induced membrane ruffling and formation of lamellipodia. Our results suggest that Nck acts either parallel to or downstream of Rac1, a mediator between PDGFR and the actin cytoskeleton.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Site-directed mutagenesis. Human Nck and Nck genes have been described previously (4). Mutagenesis was carried out using the QuikChange site-directed mutagenesis kit (Stratagene). PCRs were carried out using an overlap extension by Pfu DNA polymerase (Boehringer Mannheim) in order to generate both the SH2 domain mutant, in which the conserved arginine residue (R) in the FLVRES motif was changed to lysine (K), and the SH3 domain mutants, in which the first tryptophan residue (W) in the conserved WW motif was changed to lysine (K). These residues have previously been identified as being essential for binding to their ligands (17). The oligonucleotides used in the mutageneses were GCTTCTGGATGATTCTAAGTCCAAGTGGCGAGTTCGAAATTCC for Nck (W38K), GGAGAAATCGAGTGATGGGAAGTGGCGTGGTAGCTACAATGG for Nck (W143K), CCTGAAAATGACCCAGAGAAGTGGAAATGCAGGAAGATCAATGG for Nck (W229K), GGGGATTTCCTCATTAAGGATAGTGAATCTTCGCC for Nck (R308K), GGACGACTCCAAGACGAAGTGGCGGGTGAGGAACGCG for Nck (W39K), GGAGAAGTGCAGCGACGGTAAGTGGCGGGGCAGCTACAACG for Nck (W149K), CCGGAGAACGACCCCGAGAAGTGGAAATGCAAAAATGCC for Nck (W235K), and GGCGACTTCCTCATTAAGGACAGCGAGTCCTCG for Nck (R312K). After DpnI digestion of the parental cDNA templates, mutant DNA clones were subcloned into the pRK5 mammalian expression vector (15) and transformed into XL1-Blue competent bacteria. Plasmids were isolated and purified. Mutations were confirmed by nucleotide sequencing analysis (at the DNA Sequencing Facility of the University of Chicago). Double or triple mutations were carried out by sequentially repeating the above procedure.

Construction of membrane-attached Nck and Nck. Wild-type Nck genes were linked in frame with the Ras farnesylation sequence, KLNPPDESGPGCMSCKCVLS, encoded by AAACTTAATCCTCCTGATGAATCTGGTCCTGGTTGTATGTCTTGTAAATGTGTTCTTTCT, at their carboxyl termini through three sequential PCRs. The sequence of the 5'-end oligonucleotide was AGCTGGTACCAAGCTTGGCACCATGTTTTACCCATACGAT for all three PCRs. The sequences of the 3'-end oligonucleotides for the three sequential PCRs were AGATTCATCAGGAGGATTAAGTTTCTGCAGGGCCCTGACGAGGTA, TTTACAAGACATACAACCAGGACCAGATTCATCAGGAGGATTAAGTTT, and GGATCCGAATTCGTCATCAAGAAAGAACACATTTACAAGACATACAACCAGGACC. The hemagglutinin (HA)-tagged wild-type Nck genes were used as templates for the PCRs. Two percent (vol/vol) of each PCR was used as the template for the following PCR. Products of the final PCR were purified and subcloned into pRK5 at the XbaI site, and sequences were confirmed by DNA sequencing analyses. The constructs were transfected into NIH 3T3 cells, and membrane attachment was confirmed by a cell fractionation study (see below).

Cell fractionation, immunoprecipitation, and immunoblotting. Transfected NIH 3T3 cells in 15-cm tissue culture dishes were scraped off in 2 ml of ice-cold phosphate-buffered saline (PBS) containing 1 mM iodoacetate, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), and 0.1 mM orthovanadate. Cell pellets, obtained through centrifugation at 400 × g for 5 min, were swollen in 8 volumes of hypotonic buffer (5 mM Tris-HCl [pH 7.4], 10 mM sodium pyrophosphate, 10 mM sodium fluoride, 1 mM sodium iodoacetate, 0.5 mM sodium orthovanadate, 1 mM PMSF) for 15 min and Dounce homogenized on ice until over 90% of the cells were broken (the percentage of broken cells was monitored under the microscope). Then 0.25 volume of compensation buffer (20 mM Tris-HCl [pH 6.7], 0.95 M sucrose, 0.1 M sodium chloride, 30 mM sodium pyrophosphate, 100 µM sodium fluoride, 0.5 mM sodium orthovanadate, 0.025 mM zinc chloride) was added to bring back isotonicity. Nuclei were separated from the rest of the cell extract by centrifugation at 2,200 rpm for 1 min. The pellet was the nucleus fraction. The supernatant was further centrifuged at 30,000 rpm (100,000 × g) in a Beckman SW60.1 for 30 min at 4°C. The supernatant was the postnuclear cytosol fraction, and the pellet was the membrane fraction. Equal portions of the cytosol fraction and Triton- X-100 (in lysis buffer)-soluble fractions of the nuclei and membrane pellets were either directly analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting (Western) or immunoprecipitated with anti-HA monoclonal antibody 12CA5. Immunoprecipitates were then analyzed through SDS-PAGE and immunoblotting. Results were visualized through enhanced chemiluminescence (ECL) reactions according to the manufacturer's instructions (Amersham).

Identification of Nck binding site in the human PDGFR-. Dog kidney epithelial cells (TRMP) expressing wild-type or mutant human PDGF -receptors were maintained as described previously (12). TRMP cells were grown to 80% confluence in 6-cm tissue culture dishes and incubated in medium containing 0.5% fetal calf serum for 16 h. Cells were then treated or not with human recombinant PDGF (400 ng/ml; Sigma) at 37°C for 5 min, at which time maximum protein tyrosine phosphorylation was detected (15). Cells were washed three times with ice-cold PBS buffer and solubilized in lysis buffer. The supernatants of the clarified cell lysates were resolved in an SDS gel, transferred to a nitrocellulose membrane, and incubated with purified glutathione S-transferase (GST) alone or GST-Nck (3 µg/ml) for 2 h at 4°C. The GST-Nck-bound PDGFR was visualized by further immunoblotting with anti-GST antibody, followed by ECL.

Generation of anti-Nck-specific antibodies. Full-length Nck and Nck cDNAs were fused with the bacterial GST gene in the pGEX vector and expressed in the bacterial strain XL-1. Fusion proteins were purified and used to immunize three rabbits per antigen. All the initial antisera cross-reacted to various degrees with both Nck and Nck. To further isolate anti-Nck-specific antibodies, each of the anti-Nck antisera was passed through a GST-Nck fusion protein column to remove Nck--binding immunoglobulin G (IgG) molecules. The leftover supernatant was subjected to purification by a GST-Nck fusion protein affinity column, in accordance with a previously published procedure (7). Likewise, to isolate anti-Nck-specific antibodies, each of the anti-Nck antisera was passed through a GST-Nck fusion protein column to remove the portion of Nck-interacting antibodies. Anti-Nck antibodies were further purified from the leftover supernatant with a GST-Nck protein affinity column. Antibodies were washed and concentrated in 0.9% NaCl by Cetricon-50. These antibodies were tested for recognizing and neutralizing the function of the cellular Nck proteins. To test whether the antibodies recognize native Nck proteins, increasing concentrations of each antibody were added to a fixed amount of cellular extract and tested for complete depletion of the cellular Nck or Nck proteins. The antibodies were removed by protein A-Sepharose, and the lysates were examined by immunoblotting with the same anti-Nck antibody. To test whether the antibodies block interactions between Nck and activated EGFR or PDGFR, lysates of EGF- or PDGF-stimulated cells were added simultaneously with GST-Nck on agarose beads and increasing amounts of the purified antibodies. The bead-bound EGFR or PDGFR was analyzed by immunoblotting analysis with anti-EGFR or anti-PDGFR and antiphosphotyrosine antibodies.

Cell culture, transfection, and microinjection. NIH 3T3 cells expressing endogenous PDGF receptors (10⁵ binding sites/cell) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS), streptomycin, and penicillin (50 U/ml). Cells were transfected with the individual DNA constructs for 2 h using SuperFect reagent (Qiagen), according to the manufacturer's instructions. The ratio of DNA to SuperFect reagent was 1:2. Three hours following transfection, medium was changed to fresh DMEM with 10% FCS and incubated for 48 h prior to further analysis. As a control for detecting doubly transfected cells for cotransfection experiments, duplicate cells were transfected with one of the two DNA constructs, using vector DNA to replace the other DNA construct so that the total amounts of DNA were equal.

Immunofluorescence microscopy. Serum-starved parental cells, transfected cells, and microinjected cells on coverslips were either untreated or treated with PDGF-bb (100 ng/ml) for 15 min at 37°C. Cells were rinsed with PBS and fixed in freshly prepared 4% (wt/vol) paraformaldehyde in PBS for 10 min. Cells were rinsed twice with PBS and permeabilized in PBS containing 0.2% Triton X-100 for 5 min. Following a PBS rinse, cells were incubated with primary antibodies anti-HA (12CA5, 2 µg/ml) or rabbit anti-Myc antibody (N-262; Santa Cruz; 4 µg/ml) or both in PBS containing 1% BSA for 2 h. Cells were rinsed and incubated with secondary antibody mixtures containing FITC-conjugated rabbit anti-mouse IgG (Jackson Laboratory; 10 µg/ml) and/or AMCA (coumarin)-conjugated goat anti-rabbit IgG (Sigma, 10 µg/ml) together with TRITC (rhodamine)-conjugated phalloidin (0.1 µg/ml; Molecular Probes) for 45 min. Therefore, in cells simultaneously transfected with Myc-tagged Rac/Cdc42 and HA-tagged Nck, expression of these genes and changes in actin polymerization in a single cell could be visualized by triple (green [FITC], blue [AMCA], and red [TRITC]) staining. Cells were rinsed three times with PBS (10 min of incubation each time) and air dried. The coverslips were mounted with antifade reagent (Molecular Probes). Expression of transfected genes and actin polymerization in the cells was examined by confocal microscopy (at the University of Southern California Confocal Core Facility), using ZEISS 100X 1.0 oil immersion objectives. Thirty to 120 randomly selected cells from either vector-transfected population or gene-transfected double (FITC and TRITC)- or triple-stained (FITC, AMCA, and TRITC) populations were analyzed for peripheral filamentous actin in membrane ruffles. Images shown are representative of significantly responding cells under each condition. The percentage of cells that had undergone membrane ruffling was calculated as responding cells over total positively stained cells.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Overexpression of Nck but not Nck blocked PDGF-induced actin polymerization. Prompted by the finding that the Drosophila Nck-like gene, Dock, plays a critical role in mediating extracellular cues to intracellular actin cytoskeleton at the growth cone during axon guidance and targeting (5, 27), we were interested in understanding whether or not Nck has a similar function in mammalian cells. We chose PDGFR signaling in fibroblasts as the biological system, because it has been well established that in these cells PDGF stimulates, via Rac, actin polymerization, which leads to formation of membrane ruffles and lamellipodia (23, 28), and Nck is a direct target for the PDGFR (15, 22). We started out by confirming the PDGF effect in NIH 3T3 cells and by testing whether or not Nck regulates PDGFR signaling to the actin cytoskeleton. It is shown in Fig. 1 that in quiescent (serum-starved) cells, a fine ring of polymerized actin at the periphery of the cell was seen by staining with rhodamine-labeled phalloidin (Fig. 1A). Following PDGF treatment for 15 min, a dramatic alteration in the actin cytoskeleton of the cell, including accumulation of polymerized actin in the peripheral plasma membrane and formation of lamellipodia and membrane edge ruffles, could be visualized (Fig. 1B) under the fluorescent microscope. Of the 212 parental cells examined, 208 showed this phenotype (see statistical analyses in Fig. 5). Similar results were observed in cells transfected with an empty pRK5 expression vector (Fig. 1D versus C). These results have established NIH 3T3 cells as an adequate cell culture system for studying PDGFR signaling to the actin cytoskeleton.

View larger version (56K): [in this window] [in a new window]   FIG. 1.   Overexpression of Nck but not Nck blocks PDGF-stimulated membrane ruffling. NIH 3T3 cells, cultured in fibronectin-coated (10 µg/ml, 2 h) eight-chamber culture slides, were either untransfected (A and B), transfected with vector alone mixed with a GFP-containing vector (C and D), or transfected with the wild-type Nck (E to F') or Nck (G to H') construct at 0.5 µg/well. After 48 h, cells were starved in low-serum medium for an additional 18 h and treated (B, D, F, and H) or not (A, C, E, and G) with PDGF-bb (100 ng/ml) at 37°C for 15 min. Expression of the Nck proteins was monitored by anti-HA antibody blotting, followed by a secondary antibody conjugated with FITC. The actin cytoskeleton was revealed by rhodamine-labeled phalloidin staining. Eighty to 100 cells which showed positive FITC staining were selected and analyzed in each experiment. Vector-transfected cells were identified as GFP positive. Images were recorded with a Zeiss confocal microscope. Magnifications, × 150. This experiment was repeated four times.

Nck binds to a distinct site in the PDGFR and does not compete with PI3-K binding. One could argue that the inhibitory effect of Nck was due to nonspecific binding competition for PDGFR, occupying the binding sites of other signaling proteins such as PI3-K and Nck, which have a common binding site, Y751 (22). To address this problem, we set out to identify the Nck binding site in human PDGFR-. TRMP cells expressing all the possible PDGFR phosphotyrosine mutants, previously described (12), were used for the experiment. Lysates of these cells either untreated or treated with PDGF were resolved in duplicate in SDS gels, transferred to a nitrocellulose membrane, and blotted either with an antiphosphotyrosine antibody or with purified GST-Nck proteins. The GST-Nck-bound PDGFR was further visualized by anti-GST antibody immunoblotting, followed by ECL. The advantage of this technique is that it allows determination of direct interaction between Nck and PDGFR. It is shown in Fig. 2Aa that comparable amounts of PDGFR in various cell lines were subjected to the binding study. While GST-Nck was able to bind the wild type and most of the PDGFR mutants (Fig. 2Ab, lanes 2 to 8 lane 11), its binding to the PDGFR with a single mutation at Y1009 or double mutations at Y1009 and Y1021 was dramatically reduced (lanes 9 and 10). The slightly reduced binding to the Y740/751F mutant was not always reproducible.

View larger version (32K): [in this window] [in a new window]   FIG. 2.   Nck binds at Y1009 in the PDGFR and its overexpression did not affect PI3-K binding to the PDGFR. (A) TRMP cells expressing wild-type (wt) or mutant PDGFR were serum starved and either untreated or treated with PDGF-bb (400 ng/ml) for 5 min. Total lysates (50 µg of protein per lane) of the cells were resolved in an SDS gel, transferred to a nitrocellulose membrane, and blotted with either antiphosphotyrosine (anti-PY) (a) or purified GST-Nck (3 µg/ml), followed by anti-GST antibody blotting (b) at 4°C for 2 h. Membranes were washed, and the results were visualized with ECL. (B) Lysates of cells (2 × 106 cells/dish), untransfected (lanes 1 and 2) or transfected with 1.5 µg (lanes 3 and 4) or 5 µg (lanes 5 and 6) of Nck cDNA, and either untreated or treated with PDGF (5 min, 37°C), were immunoprecipitated (IP) with an anti-p85 antibody (Z-8; Santa Cruz). The immunoprecipitates were resolved in an SDS gel, transferred to a nitrocellulose membrane, and immunoblotted with either monoclonal anti-PDGFR antibody (61520.11; R&D Systems) (a) or the anti-p85 antibody (b), or the same set of total lysates (30 µg of protein/lane) were directly analyzed by Western blot using anti-HA (12CA5) antibody (c). Results were visualized by ECL. (C) Schematic representation of binding of the two Ncks to human PDGFR- together with their shared binding partners.

Mutations in the SH2 and SH3 domains of Nck abolish its interfering effect. To study the possible mechanism of Nck's action, we generated HA-tagged SH2 and SH3 mutants of these two genes, as schematically shown in Fig. 3. The highly conserved arginine (R) of the FLVRES motif in the SH2 domains and the first tryptophan (W) of the characteristic double tryptophans in the SH3 domains were replaced with lysine residues (K). Figure 3A and B show the list of HA-tagged wild-type and SH2 mutants and SH3 mutants of Nck and Nck, respectively. To confirm the expression of these transgenes, pRK5-cDNA constructs were transfected into NIH 3T3 cells, and lysates of the transfected cells were immunoblotted with anti-HA-tagged antibody (the transfection efficiency by Superfect reagent was around 35% for NIH 3T3 cells). It is shown in Fig. 3C and D that a similar level of protein expression of the various forms of Nck (C) and Nck (D) genes was achieved. When the same samples were immunoblotted with an anti-Nck or anti-Nck antibody (71-2800; Zymed), which recognize both HA-tagged and endogenous Nck, five- to sevenfold-higher expression of HA-Nck over endogenous Nck was observed (data not shown).

View larger version (40K): [in this window] [in a new window]   FIG. 3.   Schematic representation of Nck (A) and Nck (B) mutant constructs and their expression. A nucleotide fragment encoding three repeats of the HA peptide YPYDVPDY was linked in frame to the N termini of the Nck genes. Site-directed mutagenesis was carried out to generate point mutations in the previously established conserved sites within the SH2 and SH3 domains (see text). (C and D) Expression of the transgenes in NIH 3T3 cells following transfection is indicated by Western blot analysis (30 µg of total cellular protein/lane) using anti-HA monoclonal antibody 12CA5. The results were visualized by ECL.

View larger version (158K): [in this window] [in a new window]   FIG. 4.   SH2 and middle SH3 domains of Nck are required for the regulatory effect of Nck on PDGFR signaling. Cells were transfected with either the SH2 mutant Nck-R312K (A, A', B, and B'), with the triple SH3 mutant Nak-W39/149/235K (C, C', D, and D'), or with the individual SH3 mutants indicated (E to J'). The rest of the experimental procedures were identical to those described for Fig. 1. Three independent experiments were carried out, and they showed similar results.

View larger version (17K): [in this window] [in a new window]   FIG. 5.   Statistical analysis of data shown in Fig. 1 and 4. FITC-staining cells (80 to 100 cells for each of the conditions) were randomly selected and analyzed for membrane ruffling and lamellipodium formation in response to PDGF stimulation.Values are [(number of actin-polymerized cells)/(total number of cells)] × 100. Due to variations in exogenous expression levels of any given HA-tagged Nck construct in different cells, degrees of PDGF-stimulated actin polymerization vary. Nck-WTK, Nck-W38/143/229K triple mutant.

Microinjection of anti-Nck-specific antibody inhibits PDGF-stimulated actin polymerization. As mentioned previously, since Y1009 is also the binding site for SHP2, the PDGFR-Y1009F mutant became less useful for determining the specific effect of Nck on PDGFR-mediated actin polymerization. Therefore, we undertook a microinjection approach. We first generated anti-Nck and anti-Nck antibodies that recognize the native forms of Nck and Nck, respectively. It is shown in Fig. 6A that a commercial anti-Nck antibody (71-2800; Zymed) recognized both HA-tagged Nck and Nck proteins (lanes 1 and 2). In contrast, our anti-Nck and anti-Nck antibodies only recognized HA-tagged Nck (lanes 3 versus 4) and HA-tagged Nck (lanes 5 versus 6), respectively. To confirm that both Nck and Nck are expressed in NIH 3T3 cells, total lysates of NIH 3T3 and seven other cell lines were immunoblotted with either anti-Nck (Fig. 6B) or anti-Nck (Fig. 6C) antibody. It is clearly shown that Nck is expressed in all the cells tested (Fig. 6B), whereas Nck is expressed in most but not all of the eight cell lines tested (Fig. 6C). Nonetheless, Nck and Nck are coexpressed in NIH 3T3 cells (indicated by arrows). The anti-Nck and anti-Nck antibodies showed neutralizing effects in vitro, since they blocked GST-Nck and GST-Nck binding to PDGFR in a concentration-dependent fashion (data not shown).

View larger version (52K): [in this window] [in a new window]   FIG. 6.   Microinjection of anti-Nck but not anti-Nck antibodies blocks PDGF-stimulated actin polymerization. (A) Lysates of HA-Nck-transfected (lanes 1, 3, and 5) or HA-Nck-transfected (lanes 2, 4, and 6) cells were resolved in an SDS gel, transferred to a nitrocellulose membrane, and blotted with either 71-2800 (Zymed; cross-reacting with  and ) (lanes 1 and 2), anti-Nck (lanes 3 and 4), or anti-Nck (lanes 5 and 6) antibody. Results were visualized by ECL. (B and C) Total lysates of the eight indicated cell lines were resolved in duplicate SDS gels and subjected to Western blotting using either anti-Nck (B) or anti-Nck (C) antibody, followed by ECL. (D to F') Serum-starved NIH 3T3 cells, cultured in eight-chamber coverslips, were microinjected with either control IgG or antibodies (500 ng/µl), together with FITC-dextran as a marker protein to identify injected cells. Cells were then stimulated with PDGF-bb (100 ng/ml) for 15 min at 37°C. The actin cytoskeleton was revealed by rhodamine-labeled phalloidin staining as described in the text. Images were recorded with a Zeiss confocal microscope (magnification, × 150). For one experiment, 25 to 50 cells were injected with each antibody, and the experiment was repeated three times.

Membrane-bound Nck inhibits Rac signaling. To gain further insights into the mechanisms of Nck action, we tested whether or not Nck interferes with Rac1 signaling, which is known to mediate PDGF-induced formation of lamellipodia and membrane ruffles (28). A Myc-tagged, constitutively active Rac1 (Rac1-L61) was introduced into NIH 3T3 cells with and without cotransfection with Nck or Nck. Constitutively active Cdc42 (Cdc42-L61) and Rho (Rho-L63) were included as controls. Previous studies indicate that membrane localization is the key step for Nck to activate PAK (17, 34). Therefore, we speculated that if the binding of Nck to PDGFR, i.e., relocation from the cytoplasm to the plasma membrane, is an essential step for Nck to execute its interfering effect on PDGFR signaling, one would need to construct a constitutively membrane-bound Nck to mimic the "active stage" (PDGFR bound) of Nck.

View larger version (58K): [in this window] [in a new window]   FIG. 7.   Construction of membrane-bound Nck and Nck. The Ras farnesylation sequence, KLNPPDESGPGCMSCKCVLS, was linked in frame to the C termini (immediately following the last amino acid residues) of the Nck genes (A). Wild-type (wt) HA-Nck and HA-Nck-mem gene constructs (B) or HA-Nck and HA-Nck-mem and constructs (C) were transfected into NIH 3T3 cells. After 48 h, cells were subjected to a cellular fractionation procedure (see text) to obtain the membrane (m), cytosol (c), and nuclear (n) factions. Equal portions of each of the fractions were analyzed by Western blot analysis using anti-HA monoclonal antibody 12CA5. The results were visualized by ECL.

View larger version (115K): [in this window] [in a new window]   FIG. 8.   Nck-mem but not Nck-mem inhibits Rac1-induced membrane ruffling and lamellipodium formation. Cells were transfected with Rac1-L61 (A) or Cdc42-L61 (F) (0.3 mg/well) alone or cotransfected with Rac1-L61 plus wild-type Nck (B), Rac1-L61 plus Nck-mem (C), Rac1-L61 plus wild-type Nck (D), Rac1-L61 plus Nck-mem (E), Cdc42-L61 plus wild-type Nck. (G), Cdc42-L61 plus Nck-mem (H), Cdc42-L61 plus wild-type Nck (I) or Cdc42-L61 plus wild-type Nck-mem (J) (Rac/Cdc42:Nck ratio, 0:3:2.5). To identify the double-transfected Rac1/Cdc42 plus Nck cells, staining with a combination of mouse anti-HA antibody 12CA5 followed by FITC-conjugated rabbit anti-mouse IgG and rabbit anti-Myc antibody followed by AMCA-conjugated goat anti-rabbit IgG was used. Changes in actin polymerization were detected by TRITC-conjugated phalloidin. Statistical analysis of Rac1 (K) and Cdc42 (L) was made from 80 to 100 randomly selected FITC and AMCA double-stained positive cells. Values represent [(number of actin-polymerized cells)/(total number of cells selected)] × 100. Four independent experiments were carried out, and they showed similar results.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Nck has been implicated to play a role in cell mitogenesis and morphogenesis. Recent genetic studies in Drosophila suggest that Nck links cell surface tyrosine phosphorylation to the actin cytoskeleton during neuronal guidance and targeting (5). Whether or not Nck has a similar function in mammalian cells remained unclear. We and others have recently shown that Nck represents a two-gene family including Nck (formerly Nck) and Nck (also known as Grb4/Nck2) (3, 4, 38). It is of interest to understand whether or not different Nck species have their own specific functions in cells. In the current study, we have investigated the roles of Nck and Nck in PDGF-stimulated actin polymerization and subsequent membrane ruffling in NIH 3T3 cells. The results of these experiments show that Nck but not Nck plays a specific role in PDGFR signaling to the actin cytoskeleton. This function of Nck requires binding to PDGFR, because the SH2 domain mutant of Nck failed to act in a dominant negative fashion and membrane-bound Nck showed a constitutive interfering effect. Mutations in the SH3 domains of Nck also abolished the interfering effect of Nck, and the middle SH3 domain of Nck appeared to play the most important role. Interestingly, only membrane-attached, not cytoplasmic, Nck blocked the function of Rac1, a mediator between PDGFR and membrane ruffling and formation of lamellipodia. Under similar conditions, membrane-bound Nck had no inhibitory effect on Cdc42-induced formation of filopodia. In comparison, Nck, either cytoplasmic or membrane bound, had no effect on either Rac1 or Cdc42 signaling. These results suggest that Nck acts either downstream of or in parallel with Rac1 signaling in response to PDGF. We hypothesize that following PDGF stimulation, Nck associates, via its SH2 domain, with the activated PDFGR, thereby relocating its SH3-bound molecules to the plasma membrane. These Nck-SH3-associated molecules then participate in Rac1 signaling to the actin cytoskeleton.

The observation that overexpression of wild-type Nck produced a dominant negative instead of an enhancing effect on PDGFR signaling and that, in comparison, overexpression of wild-type Nck had no such effect was somewhat unexpected. A likely explanation is that Nck orchestrates a number of SH3-binding proteins and maintains them in a certain stoichiometry in order to execute its function. Increasing the cellular concentration of Nck alone would disrupt or titrate the ratio between Nck and its SH3-interacting proteins. For instance, if the middle SH3-binding protein plays a critical role, the overexpressed Nck would have its middle SH3 domain unoccupied due to lack of free middle-SH3-binding proteins in the cytoplasm. Rao and Zipursky showed that in Drosophila, Dock requires multiple domains acting in cis. Either a combination between the middle SH3 domain and the SH2 domain or a combination between the middle SH3 domain and the first and the third SH3 domains could mediate the signaling events (27). In Dock, it was the middle SH3 domain, not the SH2 domain, that was always required. Furthermore, none of the domain mutations in the Dock gene could act in a dominant negative fashion either by itself or in combination (27). We made similar observations. We initially predicted that the middle SH3 mutation and the SH3 triple mutations should act in a strong dominant negative fashion, but they did not. It is possible that the binding of the middle SH3 domain to its target molecule plays a role in stabilizing the binding of the SH2 domain to PDGFR. The second possible explanation for the dominant negative effect of wild-type Nck is that Nck plays a negative role in the PDGFR signaling to the actin cytoskeleton. Overexpression of Nck, similar to overexpression of a negative regulator such as a protein tyrosine phosphatase, would enhance its endogenous inhibitory effect. In fact, the results of our mutagenesis studies favor this hypothesis, in which both the SH2 and the triple and middle SH3 mutants are no longer able to block PDGFR signaling, or the negative signal can no longer be propagated through these mutants. While future studies will be required to further distinguish between these possibilities, the results of our microinjection experiments strongly argue that Nck plays a direct role in PDGFR signaling to the actin cytoskelton.

During the course of this study, a critical issue was the specificity of Nck action. We initially argued that overexpressed Nck may have had nonspecific competition for binding to other phosphotyrosine sites in addition to binding to its own site in the activated PDGFR. In this case, overexpressed Nck could prevent other PDGFR-binding molecules from getting into their sites, by which PDGFR signaling to the actin cytoskeleton was indirectly blocked. This argument has since been challenged by three lines of evidence that strongly suggest that the interfering effect of the overexpressed Nck was specific for Nck. First, overexpression of the other Nck family member Nck, which has previously been shown to share a phosphotyrosine binding site with one of the two SH2 domains of the p85 subunit of PI3-K (22), did not show any interfering effect on either PDGFR or Rac-L61 signaling to the actin cytoskeleton, even though the SH2 domains of Nck and Nck have a high degree (85%) of homology. In particular, since PI3-K has been reported to play a role in PDGF signaling to the actin cytoskeleton (6, 8), Nck, not Nck, would be considered more likely to block PDGF-stimulated actin polymerization. The fact that Nck did not inhibit PDGFR/PI3-K signaling to the actin cytoskeleton can be explained by the fact that the p85 subunit has two SH2 domains and its binding to Y740 has a much higher affinity than the binding to Y751 (11). p85 could even bind PDGFR with a mutation at Y751, where Nck binds. It has recently been shown that tyrosine-778 (its binding protein remains unknown) in PDGFR- plays an important role in PDGFR signaling to the actin cytoskeleton (31). Thus, multiple PDGFR-binding proteins may be involved in regulation of the actin cytoskelton. Second, overexpression of membrane-bound Nck inhibited the constitutively active Rac-L61-induced membrane ruffling and lamellipodium formation, in which SH2 domain binding was apparently not involved because of a lack of PDGFR activation. This observation suggests that Nck acts either downstream of or in parallel with Rac1. Nck could play such a role as "feeding" (i.e., relocation of critical effector molecules to the GTP-bound Rac1) Rac1 with cytoplasmic targets such as PAK1 kinase. Again, under similar conditions, membrane-bound Nck had no effect. Third, we have recently generated anti-Nck and anti-Nck antibodies which recognize the native forms of the gene products. Microinjection of anti-Nck antibody but not anti-Nck antibody or irrelevant immunoglobulin molecules significantly blocked PDGF-induced actin polymerization. The exact mechanism by which the microinjected anti-Nck antibodies blocked the function of the endogenous Nck in the cells remains unknown. Assuming that the antibodies block PDGFR signaling by binding to Nck and preventing it from interacting with PDGFR, based on the fact that they had a neutralizing effect in an in vitro test by blocking GST-Nck binding to PDGFR, the microinjection results strongly support the hypothesis that Nck acts between PDGFR and the actin cytoskeleton.

The specific function of Nck remains to be further studied. Both Northern and Western analyses showed that Nck is expressed in all the cell lines so far tested, in comparison to Nck, whose expression is absent in certain cell types. It is possible that Nck has a similar function to Nck but mediates signaling by a different cell surface receptor(s). For instance, Nck may mediate Eph receptor signaling in the pathway of Eph/Nck/NIK/JNK (1). It is also possible that Nck in different cell types has different functions. In T lymphocytes, Nck (whether it is Nck or Nck remains unknown) is required for T-cell receptor-mediated interleukin-2 gene expression and, therefore, cell proliferation (44) and cytoskeletal assembly (3a). Now, having recognized Nck as a multiple gene family, we have begun to reveal the cellular function and specificity of different Nck adapters. Mice deficient in either Nck or Nck have been made available (T. Pawson, personal communication). Cell lines derived from these Nck-knockout mice or embryos will provide powerful tools for better understanding Nck signaling and function. Continued genetic studies of Drosophila and Caenorhabditis elegans will provide more guidance for studying the mammalian Nck genes. Lastly, the chromosomal locations of the Nck genes coincide with the locations of mutations which are associated with a number of human diseases, including cancer (9, 38). It would be interesting to study whether Nck gene mutations influence the occurrence or frequency of human diseases.