Previous Article | Next Article 
Molecular and Cellular Biology, November 2000, p. 7903-7913, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Down-Regulation of Cyclin D1 Expression by
Prostaglandin A2 Is Mediated by Enhanced Cyclin D1
mRNA Turnover
Shankung
Lin,1
Wengong
Wang,1
Gerald M.
Wilson,2
Xiaoling
Yang,1
Gary
Brewer,2
Nikki J.
Holbrook,1 and
Myriam
Gorospe1,*
Laboratory of Biological Chemistry, National
Institute on Aging, National Institutes of Health, Baltimore, Maryland
21224,1 and Department of Molecular
Genetics and Microbiology, UMDNJ-Robert Wood Johnson Medical
School, Piscataway, New Jersey 088542
Received 26 June 2000/Returned for modification 21 July
2000/Accepted 1 August 2000
 |
ABSTRACT |
Prostaglandin A2 (PGA2), an experimental
chemotherapeutic agent, causes growth arrest associated with decreased
cyclin D1 expression in several cancer cell lines. Here, using human
non-small-cell lung carcinoma H1299 cells, we investigated the
mechanisms whereby PGA2 down-regulates cyclin D1
expression. Transcription rates of the cyclin D1 gene, studied using a
cyclin D1 promoter-luciferase construct and nuclear run-on assays, were
not affected by PGA2 treatment. Instead, the cyclin D1 mRNA
was rendered unstable after exposure to PGA2. Since the
stability of labile mRNA is modulated through binding of proteins to
specific mRNA sequences, we sought to identify protein(s) recognizing
the cyclin D1 mRNA. In electrophoretic mobility-shift assays using
radiolabeled RNA probes derived from different regions of cyclin D1
mRNA, we observed that (i) lysates prepared from
PGA2-treated cells exhibited enhanced protein-cyclin D1 RNA
complex formation; (ii) the kinetics of complex formation correlated
closely with that of cyclin D1 mRNA loss; and (iii) binding occurred
within a 390-base cyclin D1 3' untranslated region (UTR) (K12). This
binding activity could be cross-linked, revealing proteins ranging from
30 to 47 kDa. The RNA-binding protein AUF1, previously associated with
the degradation of target mRNAs, bound cyclin D1 mRNA, because
anti-AUF1 antibodies were capable of supershifting or
immunoprecipitating cyclin D1 mRNA-protein complexes. Finally, insertion of K12 in the 3'UTR of reporter genes markedly reduced the
expression and half-life of the resulting chimeric mRNAs in transfected, PGA2-treated cells. Our data demonstrate that
PGA2 down-regulates cyclin D1 expression by decreasing
cyclin D1 mRNA stability and implicates a 390-base element in the 3'UTR
in this regulation.
 |
INTRODUCTION |
Progression of eucaryotic cells
through the division cycle is a highly ordered process involving the
sequential activation of cyclin-dependent kinases (cdks) (22,
37). This process is regulated in large part through their
interaction with specific cyclins, which function during different
phases of the cell cycle. D-type cyclins and cyclin D1 in particular
play a critical role in regulating G1 progression (4,
43, 54) as cyclin D1-cdk4 complexes phosphorylate and thereby
inactivate the retinoblastoma protein, a critical event required for
G1-S transition (60). Cyclin D1 is present in
low abundance in quiescent cells, but it rapidly accumulates after
stimulation with serum or mitogens. Inhibition of cyclin D1 expression
prevents transition of cells from G1 into S phase, while
ectopic expression of cyclin D1 shortens the G1 interval in
many cell types (40, 43, 45, 46). Although cyclin D1 levels
remain relatively constant in normally growing cells, withdrawal of
serum results in the rapid disappearance of the protein as cells enter
a state of quiescence (56). In addition to serum withdrawal,
treatment of cells with other agents known to induce growth arrest
(e.g., retinoic acid) likewise results in reduced cyclin D1 expression
(31). Support for the importance of cyclin D1 in regulating
cell proliferation in vivo and contributing to tumorigenesis has come
from observations that cyclin D1 is overexpressed in many different
tumor types and that its transgenic overexpression in breast tissue
leads to development of mammary tumors in mice (13, 25, 41,
57).
Consistent with its critical function in regulating cell proliferation,
expression of cyclin D1 protein appears to be tightly regulated and
subject to control at multiple levels. A number of studies have
provided evidence that mitogen stimulation up-regulates cyclin D
expression through effects on transcription. Transcriptional activation
by serum appears to be mediated largely through events regulated by Ras
and extracellular signal-regulated kinase, but the c-Jun N-terminal
kinase (JNK) and STAT5 pathways have also been implicated in the
regulation of cyclin D1 by mitogens (1, 5, 32, 36). Serum
stimulation also elevates cyclin D1 expression by enhancing the
translation of cyclin D1 mRNA through a mechanism involving the
phosphatidylinositol 3-kinase/Akt signaling pathway (38).
Treatments that result in the down-regulation of cyclin D1 expression
also appear to act through multiple mechanisms, but these are poorly
understood. The stress-activated kinase p38 has been shown to inhibit
the activity of the cyclin D promoter, suggesting a mechanism through
which stresses might down-regulate the transcriptional activity of the
gene (32). Rapamycin and retinoic acid have been shown to
enhance proteolysis of the protein, while rapamycin also appears to
decrease the stability of cyclin D1 mRNA (23, 31).
Although the importance of mRNA stability in regulating gene expression
has long been appreciated (3, 48, 49), it is only recently
that the mechanisms contributing to such regulation have begun to be
identified. The expression of many genes associated with growth
regulation, including cytokines (interferon, interleukin-1, interleukin-2, tumor necrosis factor
) growth factors
(granulocyte-macrophage colony-stimulating factor), proto-oncogenes
(c-fos, c-myc), and cell cycle-regulatory genes
(p21, cyclin A, cyclin B1, and
cdc25), is regulated through alterations in mRNA stability
(6, 7, 18, 19, 34, 48, 58, 59). This regulation is largely exerted through the adenosine and uridine (AU)-rich elements present in
their 3' untranslated regions (UTRs), which often encompass reiterations of an AUUUA motif, and through the 3' poly(A) tail (6, 8, 9, 17, 19, 30, 50, 53). Several classes of
RNA-binding proteins that are capable of interacting with AU-rich elements and influencing mRNA stability have been identified
(9-11, 61, 64). While the functional significance of the
associations between these RNA-binding proteins and target transcripts
remains largely unknown, some of them, such as the Elav family of
RNA-binding proteins, appear to enhance mRNA stability (14, 15,
44, 58, 59), while others, such as AUF1, appear to increase mRNA degradation (11, 35).
The cyclopentenone prostaglandin A2 (PGA2) is a
potent inhibitor of growth of cultured cells and exhibits antitumor
activity in vivo (16, 20, 28, 29, 42, 51, 52). Growth arrest following PGA2 treatment occurs primarily in the
G1 phase of the cell cycle, but the mechanisms responsible
for eliciting this effect are not well understood. Along with several
growth-regulatory genes whose expression is altered following treatment
with PGA2 or with related prostaglandins (2, 24,
27), we previously reported that PGA2-mediated growth
inhibition was associated with a rapid and dramatic loss in cyclin D1
expression (20). Here, we have investigated the mechanisms
contributing to this down-regulation. We show that PGA2
acts primarily by decreasing the stability of cyclin D1 mRNA
transcripts through a specific 390-base region in the 3'UTR and provide
biochemical and functional evidence for how this element may influence
cyclin D1 mRNA turnover.
 |
MATERIALS AND METHODS |
Cell culture, treatment, constructs, transfections and
luciferase/galactosidase assays.
The human lines H1299
(non-small-cell lung carcinoma), MCF-7, and MDA-MB-453 (breast
carcinoma) were obtained from American Type Culture Collection. H1299
and MCF-7 cells were maintained in RPMI 1640 medium and MDA-MB-453
cells in McCoy's 5A medium (GIBCO-BRL, Gaithersburg, Md.). Media were
supplemented with 10% fetal calf serum (Hyclone) and antibiotics. All
experiments were performed using exponentially growing cells.
Transfections were carried out using standard calcium phosphate
precipitation methods. For the study of cyclin D1 promoter activity,
H1299 cells were transfected with plasmids pD1Luc (a kind gift from H. Müller [39]) and pTK-Hyg (Clontech, Palo Alto,
Calif.), selected in the presence of 250 µg of hygromycin B per ml,
and stable transfectants were used for luciferase assays. To assess the
influence of specific regions of the cyclin D1 mRNA on the expression
of the luciferase reporter gene, PCR-amplified DNA fragments CR
(encompassing nucleotides 640 through 1030 of the cyclin D1 cDNA) and
K12 (described below) were subcloned into the XbaI site of
the plasmid pGL3 promoter to generate pGL3-CR and pGL3-K12,
respectively. Cotransfection with a
-galactosidase reporter
construct served as an internal control for normalization of transient
transfections. For direct assessment of the influence of specific
regions of the cyclin D1 mRNA on the half-life of chimeric mRNAs,
PCR-amplified fragments CR and K12 were subcloned into the
XbaI site of pTRE-d2EGFP (Clontech). For this experiment,
H1299 cells were initially transfected with the pTet-Off plasmid
(Clontech) and selected in the presence of 500 µg of neomycin per ml;
out of ~60 stably transfected clones tested, clone H2 exhibited low
background expression of reporter constructs and >20-fold repression
of reporter constructs upon addition of doxycycline (1 µg/ml) and was
thus chosen for subsequent transfection with either pTRE-d2EGFP,
pTRE-d2EGFP-CR, or pTRE-d2EGFP-K12. Following transfection of these
constructs into H2, enhanced green fluorescent protein (EGFP) mRNA or
the chimeric mRNAs EGFP-CR and EGFP-K12 were transiently expressed.
Transcription of these mRNAs was shut off 20 h later through the
addition of doxycycline (1 µg/ml), and the rate of elimination of
each transcript was measured in cells that had either been treated with
PGA2 or left untreated.
Northern and Western blot analyses.
Total RNA was isolated
using STAT-60 reagent (Tel-Test B; Friendswood, Tex.) according to the
manufacturer's protocol and Northern blot analysis carried out as
previously described (20). Human cyclin D1 mRNA, p21 mRNA,
18S rRNA, and EGFP-containing transcripts were detected with oligomers
GAGGTTGGCATCGGGGTACGCGCGGCGGATGGTTTCCACTTCGCAGCACAGGAGCTGGTG, CTGGGCCGAAGAGGCGGCGGCAGGCCTTGCTGCCGCATGGGTTCTG,
ACGGTATCTGATCGTCTTCGAACC, and
TGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTG, respectively, that were 3'-end labeled with [
-32P]dATP using terminal
transferase (Boehringer Mannheim). Signals were visualized and
quantitated with a PhosphorImager (Molecular Dynamics, Sunnyvale,
Calif.). For Western blot analysis, 40 µg of cell lysate was resolved
on sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred
onto polyvinylidene difluoride membranes. Cyclin D1 was detected with
monoclonal anti-cyclin D1 antibody (Santa Cruz Biotech, Santa Cruz,
Calif.), and AUF1 was detected with a polyclonal antibody
(64). For the detection of p45AUF1, the peptide
SPRHSEAATAQRE, encoded by exon 2 of the human AUF1 gene, was
synthesized with an N-terminal cysteine residue by Genemed Synthesis,
Inc. (South San Francisco, Calif.), its purity assessed by
high-performance liquid chromatography, and its identity verified by
mass spectrometry. A keyhole limpet hemocyanin conjugate of this
peptide was used to immunize and boost rabbits for production of
antisera. Signals were detected with the ECL reagent (Amersham).
Nuclear run-on analysis.
Assays were performed as previously
described (21). Briefly, 5 µg of DNA from either the
pBlueScript plasmid or plasmid pRSV-D1 harboring cyclin D1 (a kind gift
from C. J. Sherr) or a plasmid containing
-actin was linearized
and blotted onto nitrocellulose membranes. Nuclei from 2 × 107 H1299 cells were collected from each treatment group
(i.e., untreated or PGA2-treated) and nascent RNA was
isolated using the STAT-60 reagent. Membranes were blocked with 100 µg of tRNA for 4 h, then hybridized with 4 × 106 cpm of nascent 32P-labeled RNA in 2 ml of
hybridization buffer for 72 h at 65°C, and washed extensively at
65°C with wash buffer. Signals were visualized with a PhosphorImager.
Transcription shut-off assays for measuring mRNA half-life.
Assays were carried out essentially as described before
(63), except that doxycycline was used to shut off
transcription and the sequences of interest (CR and K12) were subcloned
into pTRE-d2EGFP (Clontech), and thus the chimeric transcript contained the EGFP-coding region. H2 cells plated at a density of 200,000 cells
in 100-mm dishes were transfected by calcium phosphate precipitation using 5 µg each of pTRE-d2EGFP, pTRE-d2EGFP-CR, or pTRE-d2EGFP-K12 plasmids. Twenty hours later, cells were treated either with a combination of doxycycline (1 µg/ml) and PGA2 (30 µM)
or with doxycycline alone, whereupon RNA was collected at the times
indicated and analyzed for expression of EGFP-containing transcripts,
cyclin D1 mRNA (not shown), and 18S rRNA.
Preparation of cell fractions.
Cells (2 × 106 cells per sample) were harvested by trypsinization,
collected by low-speed centrifugation, resuspended into 200 µl of
cold buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 1.5 mM
MgCl2, 1 µg of leupeptin per ml, 1 µg of aprotinin per
ml, and 0.5 mM phenylmethylsulfonyl fluoride) and incubated for 15 min
on ice. After addition of 25 µl of buffer A containing 2.5% NP-40,
lysed cells were centrifuged (1,500 × g, 6 min, 4°C) to separate nuclei; supernatants (cytoplasmic fraction) were collected and
stored at
80°C. Nuclear pellets were resuspended into buffer C (20 mM HEPES [pH 7.9], 0.45 M NaCl, and 1 mM EDTA plus protease inhibitors), and the suspensions were subjected to constant shaking for
20 min at 4°C, followed by centrifugation (20,800 × g, 10 min, 4°C) and collection of the supernatants (nuclear fraction). Whole-cell lysates were obtained after collection of cells in lysis
buffer (20 mM HEPES [pH 7.4], 50 mM
-glycerolphosphate, 1% Triton
X-100, 2 mM EGTA, and 10% glycerol plus protease inhibitors), centrifugation, and collection of supernatants.
Preparation of radiolabeled RNA transcripts.
Eight
micrograms of total RNA from H1299 cells was used for reverse
transcription using SuperScript reverse transcriptase (GIBCO-BRL),
following the manufacturer's protocol. The cDNAs generated were
used as templates in PCRs to amplify various regions of cyclin D1 cDNA.
All of the 5' primers used in this study contain the sequence of the T7
RNA polymerase promoter (T7):
CCAAGCTTCTAATACGACTCACTATAGGGAGA. The 5' primers used
were as follows: A, (T7)TAGCAGCGAGCAGCAGAGT; B,
(T7)ACATCTGAGGGCGCCAGG; C, (T7)AGATGTTTCACACCGGAAGG;
H, (T7)GTACTTGTTTCTCTGTTGTAA; I,
(T7)GACCTGTTTATGAGATGCTGG; J,
(T7)GCTTTTCCTGATAAAGCACAG; K, (T7)CGTGGCCGTGTGCATGTC;
L, (T7)GTTGTGTGTGCAGGGAGG; M,
(T7)GGTTTGCATTCTCACATTGC; N, (T7)CAGCGACAAACCATCCAGTG;
O, (T7)CGCTACTATAAAGAGAAGAC; P,
(T7)CAGGTTCAACCCACAGCTAC; and Q,
(T7)CCAATAGGTGTAGGAAATAG. The 3' primers used were as
follows: 1, CTCAGATGTCCACGTCCCG; 2, TTCCGGTGTGAAACATCTAAG; 3, CAAGAATTACATAGCCAAGATG; 4, CCACCTCCCTTCAACACTTC; 8, CTTACAACAGACAAACAAGTAC; 9, CCAGCATCTCATAAACAGGTC; 10, CTGTGCTTTATCAGGAAAAGC; 11, GACATGCACACGGCCACG; 12, CCTCCCTGCACACACAAC; 13, GCAATGTGAGAATGCAAACC; 14, GTAGCTGTGGGTTGAACCTG;
and 15, CTATTTCCTACACCTATTGG.
PCR-amplified products were resolved on agarose gels, purified to serve
as templates for RNA synthesis, and incubated at 37°C for 90 min in
transcription buffer supplemented with 10 mM dithiothreitol, 2 mM rATP,
2 mM rCTP, 2 mM rGTP, 1 mM UTP, 80 U of RNasin, 40 U of T7 RNA
polymerase, and 50 µCi of [
-32P]UTP in a 50-µl
reaction volume. RNA transcripts were purified through spin columns,
and 1 µl of each RNA transcript was resolved on formaldehyde-agarose
gels, vacuum-transferred onto GeneScreen membranes, and examined to
determine the integrity, quality, and specific activity of radiolabeled
RNA probes. Nonradiolabeled RNAs for in vitro binding-competition
assays were synthesized similarly, except that the final concentration
of unlabeled UTP was 2 mM.
Binding assays.
Electrophoretic mobility-shift assays (EMSA)
were carried out to detect the formation of complexes between cellular
proteins and various cyclin D1 transcripts. Ten-microgram aliquots of
either cytoplasmic or nuclear fractions were incubated with 100,000 cpm of RNA transcript on ice for 20 min in a 10-µl mixture containing 15 mM HEPES [pH 7.9], 10 mM KCl, 10% glycerol, 5 mM MgCl2,
1 mM dithiothreitol, and 1 µg of tRNA. After addition of RNase
T1 (1,000 U/reaction mixture), reaction mixtures were
incubated at 37°C for 20 min and electrophoresed through 7% (or 5%,
for supershift analysis) nondenaturing polyacrylamide gels containing
0.25× Tris-borate-EDTA at 150 V for 2 h at 4°C. For
cross-linking experiments, RNase T1-treated RNA-protein
mixtures were exposed to UV using a Stratalinker (Stratagene), then
electrophoresed through SDS-polyacrylamide gels. Gels were dried and
radioactive signals visualized with a PhosphorImager. For supershift
analysis, 2.5-µg cytoplasmic protein aliquots were incubated with 1 µg each of polyclonal antibodies recognizing AUF1 (64),
JNK1, p27Kip1, or p53 (Santa Cruz) on ice for 30 min, then
incubated with 100,000 cpm of radiolabeled transcripts for 15 min on
ice. RNase T1 digestion and native gel electrophoresis were
then performed as described above.
In vitro binding assays were carried out essentially as previously
described (
61), except that the binding buffer used is
the
same as that used for EMSA
analysis.
Immunoprecipitation.
The coating of protein A beads with
anti-AUF1 antibody (Sigma) was performed as previously described
(64). For immunoprecipitation of the RNA-protein complexes,
in vitro RNA-protein binding reaction mixtures were digested with RNase
T1 and subjected to UV cross-linking as described above.
Each reaction mixture was then mixed with 10 µl of either
antibody-coated or uncoated protein A beads in 100 µl of NET (64)-gel
buffer for 2 h at 4°C, centrifuged, and washed three times. The
pellets were then mixed with 20 µl of gel-loading buffer, boiled, and
resolved on SDS-12% polyacrylamide gels. Signals on dried gels were
visualized with a PhosphorImager.
 |
RESULTS |
PGA2 treatment decreases cyclin D1 expression in H1299
cells in a dose- and time-dependent manner associated with growth
arrest.
We have previously shown that PGA2 causes
growth arrest of a variety of human cell lines, concomitant with
alterations in the expression of cell cycle genes (20).
Consistent with these previous observations, growth of
PGA2-treated H1299 cells was quickly and strongly inhibited
(Fig. 1). Most of
PGA2-treated cells acquired a flattened morphology within
24 h, and after 48 h, a small proportion of treated cells
detached from the surface (data not shown). PGA2 treatment
also led to the loss of cyclin D1 expression (Fig.
2). This reduction was specific for
cyclin D1, as PGA2 treatment led to the elevated expression
of other transcripts, such as that encoding the cdk inhibitor p21.
Dose-response studies revealed that treatment with 30 to 40 µM
PGA2 results in a maximal decrease (80%) in cyclin D1 mRNA
levels by 24 h; hence 30 µM PGA2 was selected for
use in all further studies. Kinetic analyses revealed a marked
reduction in cyclin D1 mRNA expression by 8 h with a maximum
reduction achieved by 16 h after addition of the drug (Fig. 2B).
The decline in cyclin D1 mRNA expression likewise correlated with a
loss in cyclin D1 protein expression (Fig. 2C).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
PGA2 treatment results in cell growth
arrest. H1299 cells were either left untreated or were treated with 30 µM PGA2. Cell numbers were determined every 24 h
using a hemacytometer. Open squares, untreated cells; filled squares,
PGA2-treated cells. Values shown are the means ± SEM
from three independently performed experiments.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Cyclin D1 expression after exposure to PGA2.
(A) Dose-response analysis of PGA2 treatment on cyclin D1
expression. H1299 cells were treated for the times shown with the
indicated doses of PGA2. RNA was then isolated, and the
expression of cyclin D1 and p21 was assessed by Northern blot analysis.
(B) Kinetics of cyclin D1 mRNA down-regulation. Cyclin D1 mRNA levels
in H1299 cells that were either treated with the indicated doses of
PGA2 for 16 h (right) or treated with 30 µM
PGA2 for the times shown (left) were examined by Northern
blot analysis. Cyclin D1 mRNA signal was normalized to 18S rRNA signal.
Data represent the means ± SEM from three independently performed
experiments. (C) Western blot analysis of cyclin D1 expression was
carried out using 40 µg of whole-cell lysates prepared from either
untreated or PGA2-treated H1299 cells, as described in
Materials and Methods.
|
|
PGA2 reduces cyclin D1 expression through changes in
mRNA stability.
To investigate the mechanism of the
PGA2-triggered decrease in cyclin D1 mRNA levels, we first
examined the effect of PGA2 on cyclin D1 promoter activity.
H1299 cells stably transfected with a plasmid harboring a luciferase
reporter under control of the cyclin D1 promoter were examined for
changes in luciferase activity after treatment with PGA2.
PGA2 treatment did not result in any substantial change in
luciferase activity at either 8 or 12 h following treatment,
indicating a lack of effect of PGA2 on cyclin D1 promoter
activity (Fig. 3A).

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Influence of PGA2 on transcriptional
activation of the cyclin D1 gene. (A) Effect of PGA2 on
cyclin D1 promoter activity. Cells stably transfected with a plasmid
harboring a luciferase reporter gene driven by the human cyclin D1
promoter (mg37) were either left untreated or were treated with 30 µM
PGA2 for the times indicated. Luciferase activity was then
determined on cell lysates (30 to 50 µg of protein) and expressed as
percentages relative to luciferase activity in untreated cells. (B)
Effect of PGA2 on the transcription rate of cyclin D1.
Cells that were either left untreated or treated with 30 µM
PGA2 for 8 h were subjected to nuclear run-on assay.
Membranes were blotted with cDNAs encoding -actin, cyclin D1, and a
control plasmid without an insert (pBlueScript). The signals were
visualized with a PhosphorImager.
|
|
The results from the cyclin D1 promoter-luciferase studies suggested
that changes in transcriptional regulation are unlikely
to account for
the marked loss of cyclin D1 mRNA after PGA
2 exposure
(Fig.
2A and B). To further examine whether there was a transcriptional
component in the PGA
2-regulated cyclin D1 expression, we
performed
nuclear run-on assays to compare the transcription rates of
the
cyclin D1 gene in untreated and PGA
2-treated cells. As
shown in
Fig.
3B, we observed no differences between the rate of cyclin
D1 transcription in untreated and PGA
2-treated cells. Given
the
lack of influence of PGA
2 on transcription of the
cyclin D1 gene,
we hypothesized that the loss of cyclin D1 expression
was due
to enhanced degradation of its mRNA. Attempts to study the
half-life
of the cyclin D1 mRNA using standard actinomycin D-based
methods
were unsuccessful due to its artifactual stabilization of
cyclin
D1 mRNA. Thus, we set out to investigate the influence of
PGA
2 on cyclin D1 mRNA stability by other
methods.
Identification of a PGA2-inducible cyclin D1
RNA-protein binding activity and its correlation with the elimination
of cyclin D1 mRNA.
The process of mRNA turnover involves
RNA-binding proteins that recognize specific RNA sequences on target
transcripts. Therefore, we sought to identify the RNA-protein-binding
activities involved in the turnover of cyclin D1 mRNA. Cell lysates
prepared from untreated or PGA2-treated cells were
fractionated into nuclear and cytoplasmic components and subsequently
incubated with radiolabeled RNA transcripts corresponding to different
regions of the cyclin D1 mRNA encompassing the 5'UTR, coding region,
and 3'UTR (Fig. 4A; see Materials and
Methods). As shown, abundant proteins in both cytoplasmic and nuclear
lysates bound to cyclin D1 RNA probes (Fig. 4B), but proteins in each
fraction displayed very different binding patterns. Nuclear proteins
formed complexes with all transcripts tested (A1, B2, B3, and C4), but
the binding patterns remained unchanged with PGA2
treatment. These observations suggested that complexes forming between
nuclear proteins and cyclin D1 transcripts were relatively nonspecific,
and nuclear fractions were not studied further. By contrast,
cytoplasmic proteins exhibited distinct binding patterns. A transcript
encompassing the coding region (A1) did not result in significant
complex formation with cytoplasmic proteins, whether derived from
untreated or from PGA2-treated cells. On the other hand,
B2 and B3 transcripts generated significant RNA-protein
complexes, whose intensities were significantly enhanced by
PGA2 treatment. Transcript C4, which contains six AUUUA
motifs, also bound to cytoplasmic proteins. Unexpectedly, however, this binding activity was relatively low when compared with that seen with
transcripts B2 and B3 and was not affected by PGA2
treatment. These findings suggest that a responsive element involved in
PGA2-mediated RNA-protein binding is located within the B2
region of the cyclin D1 mRNA.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
Binding to cyclin D1 transcripts. (A) Schematic
representation of the full-length cyclin D1 cDNA and various
transcripts derived from the 5'UTR, coding region, and 3'UTR used in
this study. Transcripts were synthesized after preparation of DNA
templates by RT-PCR, as described in the Materials and Methods section.
The 5' end of each fragment contains the T7 RNA polymerase promoter
sequence. (B) Detection of RNA-protein binding activity by EMSA
analysis. PCR-amplified cDNA fragments were used as templates to
synthesize 32P-radiolabeled RNA probes (A1, B2, B3, and
C4). Following treatment of H1299 cells with 30 µM PGA2
for the times indicated, cytoplasmic and nuclear fractions (10 µg
each) were assayed for binding to the indicated RNA probes. Reaction
mixtures were resolved on 7% native polyacrylamide gels. Signals were
visualized with a PhosphorImager. Brackets indicate complexes forming
with B2 and B3 fragments in a PGA2-dependent fashion. f,
radiolabeled RNA digested with RNase T1 without incubation
with cell lysate. (C) Correlation between PGA2-mediated
degradation of cyclin D1 mRNA and PGA2-induced
RNA-protein-binding activity. Cyclin D1 mRNA levels in H1299 cells that
were either left untreated or treated with 30 µM PGA2 for
the times indicated were determined by Northern blot analysis (top);
lysates (cytoplasmic fraction) prepared from H1299 cells treated in
parallel were incubated with 32P-radiolabeled B2 transcript
and then subjected to EMSA (bottom). Radioactive signals were
visualized with a PhosphorImager.
|
|
To further characterize the formation of cyclin D1 RNA-protein
complexes, we studied the kinetics of B2-protein complex formation
following exposure to PGA
2. As shown in Fig.
4C, untreated
cells
exhibited a basal level of RNA-protein binding by EMSA analysis.
An increase in this RNA-protein binding was evident as early as
2 h after treatment and further increased with time (Fig.
4C).
Parallel
examination of cyclin D1 levels by Northern blot analysis
showed a
concomitant reduction in the levels of cyclin D1 mRNA
after exposure to
PGA
2 (Fig.
4C). Thus, the PGA
2-induced decrease
in cyclin D1 mRNA correlated well with the increase in cyclin
D1
RNA-protein binding. These findings provide further evidence
that the
formation of RNA-protein complexes may be important for
cyclin D1 mRNA
turnover in PGA
2-treated cells, and they support
the notion
that the B2 region of cyclin D1 mRNA plays a critical
role in this
post-transcriptional regulation
process.
Further characterization of binding region(s) in the cyclin D1
3'UTR.
In order to identify the region(s) within the B2 segment of
cyclin D1 mRNA that was recognized by cytoplasmic proteins, we examined
a panel of transcripts encompassing the entire B2 region by EMSA
analysis (Fig. 5A). As shown in Fig. 5B,
proteins specifically bound to the K9 and I12 probes, indicating that
these two adjacent regions comprise the PGA2-inducible
protein-binding site. We therefore combined K9 and I12 to generate a
390-base sequence (K12), which displayed a pattern of complex formation
identical to that seen with the B2 transcript (Fig. 5B). Competition
assays revealed that an excess of unlabeled K12 transcript was capable
of blocking PGA2-triggered binding to B2 transcript (Fig.
5C): a 50-fold molar excess of cold K12 completely inhibited the
formation of protein-B2 RNA complexes, while a 50-fold molar excess of
A1 probe, which does not form PGA2-induced RNA-protein
complexes, failed to compete with B2 for protein binding. These results
further support the hypothesis that the K12 region contains the site
responsive to PGA2-triggered protein binding observed with
the B2 transcript. Given the complexity of binding between cellular
proteins and K12, further testing of smaller transcripts generally
resulted in the loss of one or several radiolabeled bands (Fig. 5D).
These results indicate that the majority of the K12 region is important for binding, and we used K12 in subsequent experiments.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Binding region. (A) Schematic representation of regions
within the B2 fragment of the cyclin D1 mRNA assayed for protein
binding. (B) Binding of cytoplasmic proteins (10 µg) derived from
either PGA2-treated or untreated cells, to various RNA
transcripts encompassing the B2 region of cyclin D1 mRNA. Complex
formation was assayed by EMSA as described in the legend of Figure 4.
Note that fragment K12 is composed of fragments K9 and I12. f,
radiolabeled transcript not incubated with protein lysate, then
digested with RNase T1. (C) Competition assays. Cytoplasmic
lysates from PGA2-treated cells (24-h exposure to the drug)
were incubated with a 5-, 10-, or 50-fold molar excess of either cold
K12 or cold A1 RNA on ice for 20 min, then with radiolabeled B2 RNA on
ice for an additional 20 min. After RNase T1 digestion,
reactions were analyzed by EMSA. (D) Schematic representation of
regions within the K12 fragment (left) and transcripts assayed by EMSA
after incubation either without ( ) or with protein lysates (lysate)
from PGA2-treated (30 µM, 8 h) H1299 cells (right).
Transcripts not incubated with protein lysate, then subjected to RNase
T1 digestion.
|
|
RNA-protein-binding complexes contain AUF1 protein, and AUF1
expression is induced by treatment with PGA2.
To
further investigate the nature of the proteins forming complexes with
the K12 RNA transcript, reaction mixtures were subjected to analysis by
UV cross-linking followed by SDS-polyacrylamide gel electrophoresis.
Our results revealed the presence of multiple K12 RNA-protein-binding
complexes with molecular sizes ranging from 30 to 47 kDa (Fig.
6A). Since the RNA-binding protein AUF1 exists as four isoforms of 37, 40, 42, and 45 kDa, we directly examined
whether AUF1 is part of the RNA-protein complexes. We allowed
protein-K12 complexes to form, then cross-linked the complexes and
subjected them to immunoprecipitation using an anti-AUF1 antibody. Subsequent analysis by SDS-polyacrylamide gel electrophoresis revealed
that the anti-AUF1 antibody immunoprecipitated RNA-protein complexes of
about 40 to 45 kDa (Fig. 6A). This observation constitutes strong
evidence that AUF1 binds to the K12 region of cyclin D1 mRNA. To
further investigate whether AUF1 binds to the K12 transcript, we
examined whether the anti-AUF1 antibody could supershift the protein-K12 RNA complexes. As shown in Fig. 6B,
PGA2-induced complexes were supershifted by anti-AUF1
antibody, but not by irrelevant antibodies recognizing JNK1,
p27Kip1, or p53. Because the AUF1-binding activity was
increased by PGA2 treatment, we performed Western blot
analysis to determine whether PGA2 also induces AUF1
expression. Expression of the 45-kDa isoform was absent in whole-cell
lysates from untreated cells, but it was markedly induced by
PGA2 (Fig. 7A), while
expression of the other isoforms remained unchanged. Further
confirmation for the specific elevation in expression of this isoform
was obtained through use of a recently available antibody (described in
the Materials and Methods section) capable of recognizing the p40 and
p45 AUF1 isoforms. The inducible expression of a 45-kDa species was
detected using this antibody (Fig. 7B). Taken together, our data
indicate that PGA2 treatment induced binding of cellular proteins to the K12 region of cyclin D1 mRNA and strongly suggest that
at least one such binding protein is the AUF1 isoform p45.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 6.
Detection of AUF1 in the cyclin D1 RNA-protein
complexes. (A) Detection of AUF1-cyclin D1 associations by
immunoprecipitation. Cytoplasmic lysates from cells that were either
left untreated (0 h) or treated with 30 µM PGA2 for 8 or
24 h were first allowed to bind radiolabeled RNA (either K12 or
A1), and then the RNA-protein complexes were UV cross-linked. Complexes
were either resolved directly by electrophoresis through SDS-12%
polyacrylamide gels or first immunoprecipitated using protein A beads
(Beads) or protein A beads coated with anti-AUF1 antibody (Beads+AUF1)
or after no immunoprecipitation (No IP), and then resolved by
electrophoresis through SDS-12% polyacrylamide gels. f, free
radiolabeled RNA, not incubated with protein lysate. (B) Supershift
analysis. Cytoplasmic proteins isolated from cells treated with
PGA2 for 24 h were preincubated with anti-AUF1,
anti-p27Kip1, anti-JNK1, or anti-p53 antibodies for 30 min
on ice, prior to addition of radiolabeled K12 RNA. Complexes were
subjected to EMSA analysis through 5% native gels. Native and
SDS-containing polyacrylamide gels were dried and signals visualized
with a PhosphorImager. Arrow indicates the band supershifted by the
AUF1 antibody. f, radiolabeled transcript not incubated with protein
lysate but digested with RNase T1.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 7.
PGA2-induced AUF1 expression. (A)
Forty-microgram aliquots of whole-cell lysate prepared from H1299 cells
that were either left untreated (0 h) or treated with PGA2
for 8 or 24 h were subjected to Western blot analysis using
anti-AUF1 antibody (64). Molecular weights of AUF1 isoforms
are shown. (B) Forty-microgram aliquots of cytoplasmic lysates from
cells treated as described in panel A were examined for the expression
of p45AUF1 using an antibody that specifically recognizes a
unique 19-amino-acid region present in the p45 isoform. This antibody
also recognizes p40AUF1 (not shown). control, lysate from
K562 cells. (C) Gel mobility shift of recombinant p45AUF1
(1 to 50 nM) binding either K16 or O14 radiolabeled transcripts. NP, no
protein.
|
|
Additional evidence that p45
AUF1 binds the cyclin D1 mRNA
came from in vitro studies. As we needed to use a fragment smaller than
K12, we decided to employ the 128-base fragment encompassing the
O14
region (Fig.
5D), whose binding to H1299 cytoplasmic proteins
exhibited
a pattern that was almost identical to that seen with
full-length K12
(with the exception of the uppermost band). Fragment
K16 was employed
as a negative control. As shown in Fig.
7C, incubation
of each
transcript with purified recombinant p45
AUF1 revealed
binding in vitro, although O14 was clearly the preferred
substrate. In
addition, the highly cooperative association exhibited
by
p45
AUF1 and O14 could allow for significant changes in mRNA
decay rates
even if changes in its concentration are
modest.
Influence of K12 on the expression of chimeric transcripts.
To
investigate the functional role of the
cyclin D1 K12 region in regulating gene expression, we carried out two
series of experiments using chimeric RNAs. First, we constructed
pGL3-derived plasmids in which either K12 or an equivalent-length
fragment from the cyclin D1 mRNA-coding region (CR) was placed 3' to
the coding region of a luciferase reporter gene. The plasmids were cotransfected with a
-galactosidase reporter plasmid into H1299 cells, and the cells were subsequently examined for their
responsiveness to PGA2 treatment. In each transfection
group, luciferase activities were normalized to
-galactosidase
activities, and the relative luciferase activity in
PGA2-treated cells was compared with that seen in untreated
cells (100%). Luciferase activities from either the empty pGL3 vector
or the chimeric construct containing CR linked to luciferase (pGL3-CR)
were unchanged by PGA2 treatment; by contrast, insertion of
K12 into the 3'UTR of the luciferase gene (pGL3-K12) resulted in a
significant decrease (approximately 70%) in luciferase activity of the
chimeric gene following treatment with PGA2. These results
provide functional evidence that the K12 sequence acts in a
PGA2-dependent manner to reduce expression of an unrelated
reporter gene, presumably by altering the stability of the chimeric
mRNA.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 8.
Influence of the K12 region of the cyclin D1 mRNA on the
expression of a chimeric luciferase reporter construct after
PGA2 treatment. Three micrograms of each pGL3-promoter
(pGL3), pGL3-K12, and pGL3-CR plasmid was transiently transfected into
H1299 cells along with 1 µg of -galactosidase reporter as a
control. Transfected cells were either treated with PGA2
for 24 h or left untreated. Luciferase activities were determined
and normalized against -galactosidase measurements. Values, shown as
the means ± SEM from five independently performed experiments,
represent the luciferase values in PGA2-treated populations
relative to those measured in untreated cells (to which a value of
100% was assigned).
|
|
Second, we employed a transcriptional pulsing strategy based on the
Tet-regulatory system (similar to that previously reported
[
63]) to monitor the influence of various cyclin D1
sequences
on the mRNA turnover rates. Briefly, a stably transfected
H1299
clonal cell line (designated H2) that constitutively expresses
the tetracycline-controlled transactivator was established. H2
cells
express high levels of transfected, Tet-regulated reporter
genes, and
addition of doxycycline potently suppresses this activity,
as they
exhibit >20-fold-lower gene expression by 12 h in the
presence of
1 µg of doxycycline per ml. To test the effect of
the K12 region of
cyclin D1 mRNA on mRNA stability, the Tet-regulated
construct
pTRE-d2EGFP-K12 was prepared and transfected into H2
cells. Control
transfection groups included populations transfected
with either the
unmodified Tet-controlled vector pTRE-d2EGFP (expressing
the EGFP
transcript) or the construct pTRE-d2EGFP-CR, expressing
a chimeric
transcript bearing a sequences of the coding region
of cyclin D1 mRNA
(EGFP-CR). Following a 20-h transcriptional
pulse, the Tet
promoter-driven transcription was effectively shut
off by the addition
of doxycycline (1 µg/ml), and the rate of
clearance of the three
transcripts (EGFP, EGFP-CR, or EGFP-K12)
was monitored by Northern blot
analysis (Fig.
9) in cells that
were
either treated with PGA
2 at the time of doxycycline
addition
or left untreated. As shown in Fig.
9, the stability of all
three
transcripts was comparable (with half-lives of 3 to 4 h) in
untreated
populations; importantly, in the PGA
2-treated
populations, only
the K12-containing chimeric transcripts exhibited a
reduction
in half-life (1.2 h), while the half-lives of both the EGFP
and
EGFP-CR mRNAs were similar to that seen in each untreated
population
(3 or 4 h, respectively).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 9.
Influence of the K12 region of the cyclin D1 mRNA on the
expression of a chimeric EGFP reporter construct after PGA2
treatment. Five micrograms of each pTRE-d2EGFP, pTRE-d2EGFP-CR, or
pTRE-d2EGFP-K12 plasmid was transiently transfected into H2 cells
(previously transfected with pTet and selected based on its strong
induced and high doxycycline-dependent repression of reporter gene
expression), along with 1 µg of -galactosidase reporter as a
control. Twenty hours after transfection, cells were treated either
with doxycycline alone (control) or with a combination of doxycycline
and PGA2 (30 µM, PGA2). At the
times indicated following addition of the drug(s), RNA was prepared for
Northern blot analysis; assessment of the expression levels of the
EGFP, EGFP-CR, or EGFP-K12 transcripts was followed by that of cyclin
D1 expression (not shown) and 18S rRNA, through sequential rounds of
stripping and hybridization. Representative Northerns are shown. Graphs
depict the relative abundance of each EGFP-derived transcript at
various times after addition of doxycycline (time 0, 100%),
represented on a logarithmic scale. Dashed line, 50% mRNA, which
served to obtain the half-life values for each transcript.
|
|
Together, our results support the notion that PGA
2-induced
events resulting in decreased cyclin D1 mRNA half-life are mediated
through the K12 region. We further propose that binding of proteins
such as AUF1 to the K12 region of cyclin D1 mRNA may decrease
its
stability.
3'UTR-deleted cyclin D1 mRNA is resistant to
PGA2-mediated down-regulation.
Further evidence that
the 3'UTR of cyclin D1 mRNA is critical for PGA2-mediated
down-regulation of its mRNA was obtained using MDA-MB-453 cells. This
cell line expresses high levels of a mutant cyclin D1 mRNA bearing a
large deletion in its 3'UTR. The resulting ~1.2-kb transcript lacks
the putative target sequence for PGA2-mediated destabilization. A comparative analysis of the
PGA2-triggered down-regulation of cyclin D1 mRNA was then
undertaken to compare the rate of cyclin D1 mRNA loss in MDA-MB-452
cells with that seen in another breast carcinoma cell line, MCF-7,
which expresses the normal, 4.2-kb cyclin D1 transcript. As shown in
Fig. 10, PGA2-treated MCF-7
cells exhibited approximately a 70% decrease in cyclin D1 mRNA levels
by 8 h posttreatment. By contrast, the amount of truncated cyclin
D1 mRNA transcript in MDA-MB-453 cells was essentially unaltered by
PGA2 treatment. These results lend further support to our
hypothesis that the 3'UTR of cyclin D1 mRNA is critical for modulating
cyclin D1 expression during exposure to PGA2.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 10.
Expression of cyclin D1 mRNA in MDA-MB-453 and MCF-7
cells following PGA2 treatment. (A) MDA-MB-453 and MCF-7
cells were treated with PGA2 for the times indicated, and
Northern blot analysis was used to assess cyclin D1 expression. (B)
Quantitation of cyclin D1 mRNA signals after normalization to 18S rRNA
signals on the same blot. Values shown are the means ± SEM from
three independently performed experiments.
|
|
 |
DISCUSSION |
Cyclin D plays a critical role in regulating cell proliferation
and mediating progression of cells through G1 into S phase. It is not surprising, therefore, that changes in the extracellular environment can greatly influence cyclin D expression. We had previously observed that treatment of several different types of
mammalian cells with PGA2 leads to growth arrest in
G1 associated with a rapid and marked reduction in cyclin
D1 mRNA expression (20). In the present study we
investigated the mechanisms contributing to the loss in cyclin D1
expression following PGA2 treatment. Our results indicate
that PGA2 reduces cyclin D1 expression by decreasing the
stability of cyclin D1 mRNA transcripts and have identified a region
within the cyclin D1 3'UTR that is critical for regulating mRNA turnover.
The lack of involvement of transcriptional events in regulating the
PGA2-mediated decline in cyclin D1 expression was supported by two critical findings: expression of a cyclin D1 promoter-reporter construct was not down-regulated in response to PGA2
treatment, and no repression of cyclin D1 transcription was evident by
nuclear run-on assay (Fig. 3). While several other studies have
likewise suggested that cyclin D1 expression can be regulated at the
level of mRNA stability (23, 26, 33, 47), none of these
examined the mechanisms contributing to this effect. Using gel
mobility-shift analysis, we have demonstrated that lysates prepared
from PGA2-treated cells contain proteins capable of binding
to the 3'UTR of cyclin D1 mRNA. One of these segments, a 390-base
region designated K12, was of particular interest as the relative
amount of protein binding to it increased following treatment with
PGA2. Indeed, when assaying this fragment, the kinetics of
complex formation coincided with the decrease in cyclin D1 mRNA. That
this region and the protein(s) capable of interacting with it are
important in regulating the stability of cyclin D1 mRNA was further
supported by two additional experiments. First, linking of this
sequence to the coding sequence of the luciferase gene led to reduced
luciferase expression after treatment with PGA2, presumably
due to destabilization of the mRNA. Second, transcriptional-pulse
strategies revealed that the half-life of a chimeric transcript
containing K12 was considerably shorter in PGA2-treated
populations than in untreated groups, while the half-life of control
transcripts was unaffected by treatment with the drug.
Based on immunoprecipitation experiments and supershift analysis, our
studies have identified the RNA-binding protein AUF1 as one component
of the complexes interacting with K12. AUF1 has been implicated in the
destabilization of labile mRNAs through its interaction with 3'UTR
regions (11, 35). Although the precise sequence requirements
for AUF1 binding have not been determined, binding generally occurs in
regions which are AU-rich and harbor reiterations of AUUUA pentamers,
such as those found in the c-myc, c-fos, and
tumor necrosis factor mRNAs, all established targets of AUF1 in vitro
(11, 12, 35, 64). While the findings in our study could
support a function for AUF1 in regulating cyclin D1 mRNA decay in cells
treated with PGA2, the 390-base sequence encompassing the
cyclin D1 mRNA K12 region is unique in that it does not contain any
AUUUA sequences. Several AUUUA sequences are present in the cyclin D1
3'UTR downstream of K12, but they do not appear to influence the
binding to K12. Moreover, the cyclin D1 3'UTR segment encompassing six
AUUUA elements (designated C4 [Fig. 4]), does not seem to be a major
target for binding by other proteins in either untreated or
PGA2-treated H1299 cells, as only weak bands appear on gel
mobility shift assays (Fig. 4). Among other RNA-binding proteins that
could potentially interact with these AU-rich sequences and/or
other segments of the cyclin D1 3'UTR, we tested the elav-related
protein HuR and hnRNP C and A1. However, in no instance did we obtain
any evidence that these proteins bound the cyclin D1 mRNA (data not shown).
The AUF1 gene gives rise to four distinct protein isoforms through
alternative splicing of the pre-mRNAs that also influences the relative
expression of each isoform (55, 62). The functional distinctions between the four isoforms, with apparent molecular masses
of 37, 40, 42, and 45 kDa, are unclear, but the p37 and p42 isoforms
appear to display the most profound destabilizing effect on
c-fos mRNA in K562 cells (35). Although we cannot say with absolute certainty which isoform is responsible for binding to
K12, our findings indicate that expression of p45AUF1 is
specifically elevated after PGA2 treatment and in a time
frame consistent with enhanced protein-RNA complex formation, while none of the other isoforms were altered with PGA2
treatment. Purified recombinant p45AUF1 was indeed found to
bind, in a highly cooperative fashion, a fragment of the K12 transcript
in vitro (Fig. 7C), although p37AUF1 and
p40AUF1 were also capable of binding this sequence (not
shown). Finally, this study provides, to our knowledge, the first
evidence that the endogenous p45AUF1 isoform is
preferentially induced under certain conditions and provides further
support for the emerging view that the various isoforms display
different RNA-binding patterns and may have different functions.
Nevertheless, definitive demonstration that AUF1 regulates the turnover
of cyclin D1 mRNA awaits the development of additional experimental
systems in which the expression of specific AUF1 isoforms can be
overexpressed or inhibited.
It is known that, in addition to PGA2, other stresses
and/or growth-arresting treatments can result in reduced cyclin D1
expression. It remains to be determined whether regulated mRNA turnover
is involved in the down-regulation of cyclin D1 expression in a general sense by other stresses; however, it is worth noting that, in preliminary studies, we have seen evidence of enhanced protein binding
to the K12 region using lysates from cells treated with various stress
agents. For example, exposure to brefeldin A, which interferes with
protein trafficking resulting in stress to the endoplasmic reticulum,
led to both increased binding to cyclin D1 mRNA on gel mobility shift
assays (with patterns of binding identical to those seen after
PGA2 treatment) and reduced cyclin D1 mRNA expression by
Northern blotting. Thus, the down-regulation of cyclin D1 mRNA by
K12-dependent turnover may not be limited to PGA2 treatment.
Finally, cyclin D1 has been shown to be overexpressed in a number of
different tumors. The elevated levels of cyclin D1 are believed to
contribute directly to tumorigenicity (13, 25, 41, 57), and
therapeutic approaches targeting cyclin D1 have been described
(31). Although many different mechanisms are believed to
contribute to the enhanced cyclin D1 expression, it is interesting to
note that a number of studies have reported cyclin D1 gene mutations
that result in truncated mRNAs with greater stability than that of
wild-type full-length mRNA (26, 33, 47; Fig. 10).
The region we have implicated in down-regulating cyclin D1 mRNA
stability is likewise absent in these truncated mRNAs. Indeed, we had
the opportunity to test a cell line which harbored one such mutant
cyclin D1 mRNA and found that PGA2 failed to down-regulate
its expression (Fig. 10). Thus, our studies provide additional support
for the view that mutations that alter the posttranscriptional control
of cyclin D1 expression could play an important role in tumorigenesis.
Better understanding of these processes could lead to improved
treatment strategies.
 |
ACKNOWLEDGMENT |
This study was supported by NIH R01 grant no. CA52443 to G.B.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Box 12, Laboratory of Biological Chemistry, GRC, National Institute on Aging,
National Institutes of Health, 5600 Nathan Shock Drive, Baltimore, MD
21224. Phone: (410) 558-8443. Fax: (410) 558-8386. E-mail:
myriam-gorospe{at}nih.gov.
 |
REFERENCES |
| 1.
|
Albanese, C.,
J. Johnson,
G. Watanabe,
N. Eklund,
D. Vu,
A. Arnold, and R. G. Pestell.
1995.
Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions.
J. Biol. Chem.
270:23589-23597[Abstract/Free Full Text].
|
| 2.
|
Amici, C.,
A. T. Palamara, and M. G. Santoro.
1993.
Induction of thermotolerance by prostaglandin A in human cells.
Exp. Cell Res.
207:230-234[CrossRef][Medline].
|
| 3.
|
Atwater, J. A.,
R. Wisdom, and I. M. Verma.
1990.
Regulated mRNA stability.
Annu. Rev. Genet.
24:519-541[CrossRef][Medline].
|
| 4.
|
Baldin, V.,
J. Lukas,
M. J. Marcote,
M. Pagano, and G. Draetta.
1993.
Cyclin D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev.
7:812-821[Abstract/Free Full Text].
|
| 5.
|
Beier, F.,
R. J. Lee,
A. C. Taylor,
R. G. Pestell, and P. LuValle.
1999.
Identification of the cyclin D1 gene as a target of activating transcription factor 2 in chrondrocytes.
Proc. Natl. Acad. Sci. USA
96:1433-1438[Abstract/Free Full Text].
|
| 6.
|
Brewer, G.
1991.
An A + U-rich element RNA binding factor regulates c-myc mRNA stability in vitro.
Mol. Cell. Biol.
11:2460-2466[Abstract/Free Full Text].
|
| 7.
|
Buzby, J. S.,
S. M. Lee,
P. Van Winkle,
C. T. DeMaria,
G. Brewer, and M. S. Cairo.
1996.
Increased GM-CSF mRNA stability in cord vs. adult mononuclear cells is translation dependent and associated with increased levels of A+U-rich element binding factor.
Blood
88:2889-2897[Abstract/Free Full Text].
|
| 8.
|
Caput, D.,
B. Beutler,
K. Hartog,
R. Thayer,
S. Brown-Shimer, and A. Cerami.
1986.
Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators.
Proc. Natl. Acad. Sci. USA
83:1670-1674[Abstract/Free Full Text].
|
| 9.
|
Chen, C.-Y. A., and A.-B. Shyu.
1995.
AU-rich elements: characterization and importance in mRNA degradation.
Trends Biochem. Sci.
20:465-470[CrossRef][Medline].
|
| 10.
|
Chung, S. L.,
L. Jiang,
S. Cheng, and H. Furneaux.
1996.
Purification and properties of HuD, a neuronal RNA-binding protein.
J. Biol. Chem.
271:11518-11524[Abstract/Free Full Text].
|
| 11.
|
DeMaria, C. T., and G. Brewer.
1996.
AUF1 binding affinity to A+U-rich elements correlates with rapid mRNA degradation.
J. Biol. Chem.
271:12179-12184[Abstract/Free Full Text].
|
| 12.
|
DeMaria, C. T.,
Y. Sun,
L. Long,
B. J. Wagner, and G. Brewer.
1997.
Structural determinants in AUF1 required for high affinity binding to A + U-rich elements.
J. Biol. Chem.
272:27635-27643[Abstract/Free Full Text].
|
| 13.
|
Dickson, C.,
V. Fantl,
C. Gillett,
S. Brookes,
J. Bartek,
R. Smith,
C. Fisher,
D. Barnes, and G. Peters.
1995.
Amplification of chromosome band 11q13 and a role for cyclin D1 in human breast cancer.
Cancer Lett.
90:43-50[CrossRef][Medline].
|
| 14.
|
Fan, X. C., and J. A. Steitz.
1998.
Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs.
EMBO J.
17:3448-3460[CrossRef][Medline].
|
| 15.
|
Ford, L. P.,
J. Watson,
J. D. Keene, and J. Wilusz.
1999.
ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system.
Genes Dev.
13:188-201[Abstract/Free Full Text].
|
| 16.
|
Fukushima, M.,
H. Sasaki, and S. Fukushima.
1994.
Prostaglandin J2 and related compounds: mode of action in G1 arrest and preclinical results.
Ann. N. Y. Acad. Sci.
744:161-165[Medline].
|
| 17.
|
Gao, F.-B., and J. D. Keene.
1996.
Hel-N1/Hel-N2 proteins are bound to poly(A)+ mRNA in granular RNP structures and are implicated in neuronal differentiation.
J. Cell Sci.
109:579-589[Abstract/Free Full Text].
|
| 18.
|
Gorospe, M.,
S. Kumar, and C. Baglioni.
1993.
Tumor necrosis factor increases the stability of interleukin-1 mRNA by activating protein kinase C.
J. Biol. Chem.
268:6214-6220[Abstract/Free Full Text].
|
| 19.
|
Gorospe, M., and C. Baglioni.
1994.
Degradation of unstable interleukin-1 alpha mRNA in a rabbit reticulocyte cell-free system. Localization of the instability determinant to a cluster of AUUUA motifs.
J. Biol. Chem.
269:11845-11851[Abstract/Free Full Text].
|
| 20.
|
Gorospe, M.,
Y. Liu,
Q. Xu,
F. J. Chrest, and N. J. Holbrook.
1996.
Inhibition of G1 cyclin-dependent kinase activity during growth arrest of human breast carcinoma cells by prostaglandin A2.
Mol. Cell. Biol.
16:762-770[Abstract].
|
| 21.
|
Gorospe, M.,
X. Wang, and N. J. Holbrook.
1998.
p53-dependent elevation of p21Waf1 expression by UV light is mediated through mRNA stabilization and involves a vanadate-sensitive regulatory system.
Mol. Cell. Biol.
18:1400-1407[Abstract/Free Full Text].
|
| 22.
|
Grana, X., and E. P. Reddy.
1995.
Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs).
Oncogene
11:211-219[Medline].
|
| 23.
|
Hashemolhosseini, S.,
Y. Nagamine,
S. J. Morley,
S. Desrivieres,
L. Mercep, and S. Ferraie.
1998.
Rapamycin inhibition of the G1 to S transition is mediated by effects on cyclin D1 mRNA and protein stability.
J. Biol. Chem.
273:14424-14429[Abstract/Free Full Text].
|
| 24.
|
Holbrook, N. J.,
S. G. Carlson,
A. M. Choi, and J. Fargnoli.
1992.
Induction of HSP70 gene expression by the antiproliferative prostaglandin PGA2: a growth-dependent response mediated by activation of heat shock transcription factor.
Mol. Cell. Biol.
12:1528-1534[Abstract/Free Full Text].
|
| 25.
|
Hosokawa, Y., and A. Arnold.
1998.
Mechanism of cyclin D1 (CCND1, PRAD1) overexpression in human cancer cells: analysis of allele-specific expression.
Genes Chr. Cancer
22:66-71[CrossRef][Medline].
|
| 26.
|
Hosokawa, Y.,
R. Suzuki,
T. Joh,
Y. Maeda,
S. Nakamura,
Y. Kodera,
A. Arnold, and M. Seto.
1998.
A small deletion in the 3'-untranslated region of the cyclin D1/PRAD1/bcl-1 oncogene in a patient with chronic lymphocytic leukemia.
Int. J. Cancer
76:791-796[CrossRef][Medline].
|
| 27.
|
Hughes-Fulford, M.
1994.
Cell cycle arrest by prostaglandin A1 at the G1/S phase interface with up-regulation of oncogenes in S-49 cyc- cells.
J. Cell Biochem.
54:265-272[CrossRef][Medline].
|
| 28.
|
Kikuchi, Y.,
T. Kita,
M. Miyauchi,
J. Hirata,
H. Sasa,
I. Nagata, and M. Fukushima.
1992.
Adjuvant effects of antineoplastic prostaglandins to cisplatin in nude mice bearing human ovarian cancer cells.
J. Cancer Res. Clin. Oncol.
118:453-457[CrossRef][Medline].
|
| 29.
|
Kikuchi, Y.,
T. Kita,
J. Hirata,
E. Kuki,
I. Nagata, and M. Fukushima.
1992.
Modulation of human lymphocyte response to phytohemagglutinin by antineoplastic prostaglandins.
Int. J. Immunopharmacol.
14:105-110[CrossRef][Medline].
|
| 30.
|
Lagnado, C. A.,
C. Y. Brown, and G. J. Goodall.
1994.
AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU-rich elements may be UUAUUUA(U/A)(U/A).
Mol. Cell. Biol.
14:7984-7995[Abstract/Free Full Text].
|
| 31.
|
Langenfeld, J.,
H. Kiyokawa,
D. Sekula,
J. Boyle, and E. Dmitrovsky.
1997.
Posttranslational regulation of cyclin D1 by retinoic acid: a chemoprevention mechanism.
Proc. Natl. Acad. Sci. USA
94:12070-12074[Abstract/Free Full Text].
|
| 32.
|
Lavoie, J. N.,
G. L'Allemain,
A. Brunet,
R. Müller, and J. Pouysségur.
1996.
Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by p38/HOGMAPK pathway.
J. Biol. Chem.
271:20608-20616[Abstract/Free Full Text].
|
| 33.
|
Lebwohl, D. E.,
R. Muise-Helmericks,
L. Sepp-Lorenzino,
S. Serve,
M. Timaul,
R. Bol,
P. Borgen, and N. Rosen.
1997.
A truncated cyclin D1 gene encodes a stable mRNA in a human breast cancer cell line.
Oncogene
9:1925-1929.
|
| 34.
|
Liebhaber, S. A.
1997.
mRNA stability and the control of gene expression.
Nucleic Acid Symp. Ser.
36:29-32.
|
| 35.
|
Loflin, P.,
C. Y. Chen, and A.-B. Shyu.
1999.
Unraveling a cytoplasmic role for hnRNP D in the in vivo mRNA destabilization directed by the AU-rich element.
Genes Dev.
13:1884-1897[Abstract/Free Full Text].
|
| 36.
|
Matsumura, I.,
T. Kitamura,
H. Wakao,
H. Tanaka,
K. Hashimoto,
C. Albanese,
J. Downward,
R. G. Pestell, and Y. Kanakura.
1999.
Transcriptional regulation of the cyclin D1 promoter by STAT5: its involvement in cytokine-dependent growth of hematopoietic cells.
EMBO J.
18:1367-1377[CrossRef][Medline].
|
| 37.
|
Morgan, D. O.
1992.
Cell cycle control in normal and neoplastic cells.
Curr. Opin. Genet. Dev.
2:33-37[CrossRef][Medline].
|
| 38.
|
Muise-Helmericks, R. C.,
H. L. Grimes,
A. Bellacosa,
S. E. Malstrom,
P. N. Tsichlis, and N. Rosen.
1998.
Cyclin D1 expression is controlled post-transcriptionally via a phosphatidylinositol 3-kinase/Akt-dependent pathway.
J. Biol. Chem.
273:29864-29872[Abstract/Free Full Text].
|
| 39.
|
Müller, H.,
J. Lukas,
A. Schneider,
P. Warthoe,
J. Bartek,
M. Eilers, and M. Strauss.
1994.
Cyclin D1 expression is regulated by the retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
91:2945-2949[Abstract/Free Full Text].
|
| 40.
|
Musgrove, E. A.,
C. S. L. Lee,
M. F. Buckley, and R. L. Sutherland.
1994.
Cyclin D1 induction in breast cancer cells shortens G1 and is sufficient for cells arrested in G1 to complete the cell cycle.
Proc. Natl. Acad. Sci. USA
91:8022-8026[Abstract/Free Full Text].
|
| 41.
|
Nakamura, S.,
Y. Yatabe, and M. Seto.
1997.
Cyclin D1 overexpression in malignant lymphomas.
Pathol. Int.
47:421-429[Medline].
|
| 42.
|
Ohno, K.,
M. Fujiwara,
M. Fukushima, and S. Narumiya.
1986.
Metabolic dehydration of prostaglandin E2 and cellular uptake of the dehydration product: correlation with prostaglandin E2-induced growth inhibition.
Biochem. Biophys. Res. Commun.
139:808-815[CrossRef][Medline].
|
| 43.
|
Ohtsubo, M., and J. M. Roberts.
1993.
Cyclin-dependent regulation of G1 in mammalian cells.
Science
259:1908-1912[Abstract/Free Full Text].
|
| 44.
|
Peng, S. S.,
C. Y. Chen,
N. Xu, and A. B. Shyu.
1998.
RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein.
EMBO J.
17:3461-3470[CrossRef][Medline].
|
| 45.
|
Quelle, D. E.,
R. A. Ashmun,
S. A. Shurtleff,
J. Kato,
D. Bar-Sagi,
M. Russel, and C. J. Sherr.
1993.
Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts.
Genes Dev.
7:1559-1571[Abstract/Free Full Text].
|
| 46.
|
Resnitzky, D.,
M. Gossen,
H. Bujard, and S. I. Reed.
1994.
Acceleration of the G1/S phase transition by expression of cyclins D1 and E with an inducible system.
Mol. Cell. Biol.
14:1669-1679[Abstract/Free Full Text].
|
| 47.
|
Rimokh, R.,
F. Berger,
C. Bastard,
B. Klein,
M. French,
E. Archimbaud,
J. P. Rouault,
B. Santa Lucia,
L. Duret,
M. Vuillaume, et al.
1994.
Rearrangement of CCND1 (BCL1/PRAD1) 3' untranslated region in mantle-cell lymphomas and t(11q13)-associated leukemias.
Blood
83:3689-3696[Abstract/Free Full Text].
|
| 48.
|
Ross, J.
1995.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:423-450[Abstract/Free Full Text].
|
| 49.
|
Ross, J.
1997.
A hypothesis to explain why translation inhibitors stabilize mRNAs in mammalian cells: mRNA stability and mitosis.
BioEssays
9:527-529.
|
| 50.
|
Sachs, A. B.
1993.
Messenger RNA degradation in eukaryotes.
Cell
74:413-421[CrossRef][Medline].
|
| 51.
|
Sasaki, H., and M. Fukushima.
1994.
Prostaglandins in the treatment of cancer.
Anticancer Drugs
5:131-138[Medline].
|
| 52.
|
Sasaki, H.,
K. Takada,
Y. Terashima,
H. Ekimoto,
K. Takahashi,
T. Tsuruo, and M. Fukushima.
1991.
Human ovarian cancer cell lines resistant to cisplatin, doxorubicin, and L-phenylalanine mustard are sensitive to delta 7-prostaglandin A1 and delta 12-prostaglandin J2.
Gynecol. Oncol.
41:36-40[CrossRef][Medline].
|
| 53.
|
Shaw, G., and R. Kamen.
1986.
A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:659-667[CrossRef][Medline].
|
| 54.
|
Sherr, C. J.
1993.
Mammalian G1 cyclins.
Cell
73:1059-1065[Medline].
|
| 55.
|
Wagner, B. J.,
C. T. DeMaria,
Y. Sun,
G. M. Wilson, and G. Brewer.
1998.
Structure and genomic organization of the human AUF1 gene: alternative pre-mRNA splicing generates four protein isoforms.
Genomics
48:195-202[CrossRef][Medline].
|
| 56.
|
Wang, M. B.,
K. R. Billings,
N. Venkatesan,
F. L. Hall, and E. S. Srivatsan.
1998.
Inhibition of cell proliferation in head and neck squamous cell carcinoma cell lines with antisense cyclin D1.
Otolaryngol. Head Neck Surg.
119:593-599[CrossRef][Medline].
|
| 57.
|
Wang, T. C.,
R. D. Cardiff,
L. Zukerberg,
E. Lees,
A. Arnold, and E. V. Schmidt.
1994.
Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice.
Nature
369:669-671[CrossRef][Medline].
|
| 58.
|
Wang, W.,
H. Furneaux,
H. Cheng,
C. Caldwell,
D. Hutter,
Y. Liu,
N. J. Holbrook, and M. Gorospe.
2000.
HuR regulates p21 mRNA stabilization by UV light.
Mol. Cell. Biol.
20:760-769[Abstract/Free Full Text].
|
| 59.
|
Wang, W.,
S. Lin,
C. M. Caldwell,
H. Furneaux, and M. Gorospe.
2000.
HuR regulates cyclin A and cyclin B1 mRNA stability during the cell division cycle.
EMBO J.
19:2340-2350[CrossRef][Medline].
|
| 60.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
81:323-330[CrossRef][Medline].
|
| 61.
|
Wilson, G. M., and G. Brewer.
1999.
Identification and characterization of proteins binding A+U-rich elements.
Methods
17:74-83[CrossRef][Medline].
|
| 62.
|
Wilson, G. M.,
Y. Sun,
J. Sellers,
H. Lu,
N. Penkar,
G. Dillard, and G. Brewer.
1999.
Regulation of AUF1 expression via conserved alternatively spliced elements in the 3' untranslated region.
Mol. Cell. Biol.
19:4056-4064[Abstract/Free Full Text].
|
| 63.
|
Xu, N.,
P. Loflin,
C.-Y. A. Chen, and A.-B. Shyu.
1998.
A broader role for AU-rich element-mediated mRNA turnover revealed by a new transcriptional pulse strategy.
Nucleic Acids Res.
26:558-565[Abstract/Free Full Text].
|
| 64.
|
Zhang, W.,
B. J. Wagner,
K. Ehrenman,
A. W. Schaefer,
C. T. DeMaria,
D. Crater,
K. DeHaven,
L. Long, and G. Brewer.
1993.
Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1.
Mol. Cell. Biol.
13:7652-7665[Abstract/Free Full Text].
|
Molecular and Cellular Biology, November 2000, p. 7903-7913, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Brennan, S. E., Kuwano, Y., Alkharouf, N., Blackshear, P. J., Gorospe, M., Wilson, G. M.
(2009). The mRNA-Destabilizing Protein Tristetraprolin Is Suppressed in Many Cancers, Altering Tumorigenic Phenotypes and Patient Prognosis. Cancer Res.
69: 5168-5176
[Abstract]
[Full Text]
-
Pautz, A., Linker, K., Altenhofer, S., Heil, S., Schmidt, N., Art, J., Knauer, S., Stauber, R., Sadri, N., Pont, A., Schneider, R. J., Kleinert, H.
(2009). Similar Regulation of Human Inducible Nitric-oxide Synthase Expression by Different Isoforms of the RNA-binding Protein AUF1. J. Biol. Chem.
284: 2755-2766
[Abstract]
[Full Text]
-
Mazan-Mamczarz, K., Kuwano, Y., Zhan, M., White, E. J., Martindale, J. L., Lal, A., Gorospe, M.
(2009). Identification of a signature motif in target mRNAs of RNA-binding protein AUF1. Nucleic Acids Res
37: 204-214
[Abstract]
[Full Text]
-
Kuwano, Y., Kim, H. H., Abdelmohsen, K., Pullmann, R. Jr., Martindale, J. L., Yang, X., Gorospe, M.
(2008). MKP-1 mRNA Stabilization and Translational Control by RNA-Binding Proteins HuR and NF90. Mol. Cell. Biol.
28: 4562-4575
[Abstract]
[Full Text]
-
Mejlvang, J., Kriajevska, M., Vandewalle, C., Chernova, T., Sayan, A. E., Berx, G., Mellon, J. K., Tulchinsky, E.
(2007). Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition. Mol. Biol. Cell
18: 4615-4624
[Abstract]
[Full Text]
-
Pavithra, L., Rampalli, S., Sinha, S., Sreenath, K., Pestell, R. G., Chattopadhyay, S.
(2007). Stabilization of SMAR1 mRNA by PGA2 involves a stem loop structure in the 5' UTR. Nucleic Acids Res
35: 6004-6016
[Abstract]
[Full Text]
-
Pullmann, R. Jr., Kim, H. H., Abdelmohsen, K., Lal, A., Martindale, J. L., Yang, X., Gorospe, M.
(2007). Analysis of Turnover and Translation Regulatory RNA-Binding Protein Expression through Binding to Cognate mRNAs. Mol. Cell. Biol.
27: 6265-6278
[Abstract]
[Full Text]
-
Dormoy-Raclet, V., Menard, I., Clair, E., Kurban, G., Mazroui, R., Di Marco, S., von Roretz, C., Pause, A., Gallouzi, I.-E.
(2007). The RNA-Binding Protein HuR Promotes Cell Migration and Cell Invasion by Stabilizing the {beta}-actin mRNA in a U-Rich-Element-Dependent Manner. Mol. Cell. Biol.
27: 5365-5380
[Abstract]
[Full Text]
-
Wiestner, A., Tehrani, M., Chiorazzi, M., Wright, G., Gibellini, F., Nakayama, K., Liu, H., Rosenwald, A., Muller-Hermelink, H. K., Ott, G., Chan, W. C., Greiner, T. C., Weisenburger, D. D., Vose, J., Armitage, J. O., Gascoyne, R. D., Connors, J. M., Campo, E., Montserrat, E., Bosch, F., Smeland, E. B., Kvaloy, S., Holte, H., Delabie, J., Fisher, R. I., Grogan, T. M., Miller, T. P., Wilson, W. H., Jaffe, E. S., Staudt, L. M., for the Lymphoma/Leukemia Molecular Profiling Proj,
(2007). Point mutations and genomic deletions in CCND1 create stable truncated cyclin D1 mRNAs that are associated with increased proliferation rate and shorter survival. Blood
109: 4599-4606
[Abstract]
[Full Text]
-
Kroger, A., Stirnweiss, A., Pulverer, J. E., Klages, K., Grashoff, M., Reimann, J., Hauser, H.
(2007). Tumor Suppression by IFN Regulatory Factor-1 Is Mediated by Transcriptional Down-regulation of Cyclin D1. Cancer Res.
67: 2972-2981
[Abstract]
[Full Text]
-
Torrisani, J., Unterberger, A., Tendulkar, S. R., Shikimi, K., Szyf, M.
(2007). AUF1 Cell Cycle Variations Define Genomic DNA Methylation by Regulation of DNMT1 mRNA Stability. Mol. Cell. Biol.
27: 395-410
[Abstract]
[Full Text]
-
Horiuchi, K., Umetani, M., Minami, T., Okayama, H., Takada, S., Yamamoto, M., Aburatani, H., Reid, P. C., Housman, D. E., Hamakubo, T., Kodama, T.
(2006). Wilms' tumor 1-associating protein regulates G2/M transition through stabilization of cyclin A2 mRNA. Proc. Natl. Acad. Sci. USA
103: 17278-17283
[Abstract]
[Full Text]
-
Fawal, M., Armstrong, F., Ollier, S., Dupont, H., Touriol, C., Monsarrat, B., Delsol, G., Payrastre, B., Morello, D.
(2006). A "liaison dangereuse" between AUF1/hnRNPD and the oncogenic tyrosine kinase NPM-ALK. Blood
108: 2780-2788
[Abstract]
[Full Text]
-
Glaser, N. D., Lukyanenko, Y. O., Wang, Y., Wilson, G. M., Rogers, T. B.
(2006). JNK activation decreases PP2A regulatory subunit B56{alpha} expression and mRNA stability and increases AUF1 expression in cardiomyocytes. Am. J. Physiol. Heart Circ. Physiol.
291: H1183-H1192
[Abstract]
[Full Text]
-
Pullmann, R. Jr., Abdelmohsen, K., Lal, A., Martindale, J. L., Ladner, R. D., Gorospe, M.
(2006). Differential Stability of Thymidylate Synthase 3'-Untranslated Region Polymorphic Variants Regulated by AUF1. J. Biol. Chem.
281: 23456-23463
[Abstract]
[Full Text]
-
Barreau, C., Paillard, L., Osborne, H. B.
(2006). AU-rich elements and associated factors: are there unifying principles?. Nucleic Acids Res
33: 7138-7150
[Abstract]
[Full Text]
-
Fernandez, V., Hartmann, E., Ott, G., Campo, E., Rosenwald, A.
(2005). Pathogenesis of Mantle-Cell Lymphoma: All Oncogenic Roads Lead to Dysregulation of Cell Cycle and DNA Damage Response Pathways. JCO
23: 6364-6369
[Abstract]
[Full Text]
-
Dong, J., Peng, J., Zhang, H., Mondesire, W. H., Jian, W., Mills, G. B., Hung, M.-C., Meric-Bernstam, F.
(2005). Role of Glycogen Synthase Kinase 3{beta} in Rapamycin-Mediated Cell Cycle Regulation and Chemosensitivity. Cancer Res.
65: 1961-1972
[Abstract]
[Full Text]
-
Skildum, A., Faivre, E., Lange, C. A.
(2005). Progesterone Receptors Induce Cell Cycle Progression via Activation of Mitogen-Activated Protein Kinases. Mol. Endocrinol.
19: 327-339
[Abstract]
[Full Text]
-
Yang, X., Wang, W., Fan, J., Lal, A., Yang, D., Cheng, H., Gorospe, M.
(2004). Prostaglandin A2-mediated Stabilization of p21 mRNA through an ERK-dependent Pathway Requiring the RNA-binding Protein HuR. J. Biol. Chem.
279: 49298-49306
[Abstract]
[Full Text]
-
Lin, S., Tsai, S.-C., Lee, C.-C., Wang, B.-W., Liou, J.-Y., Shyu, K.-G.
(2004). Berberine Inhibits HIF-1{alpha} Expression via Enhanced Proteolysis. Mol. Pharmacol.
66: 612-619
[Abstract]
[Full Text]
-
Wilson, G. M., Lu, J., Sutphen, K., Sun, Y., Huynh, Y., Brewer, G.
(2003). Regulation of A + U-rich Element-directed mRNA Turnover Involving Reversible Phosphorylation of AUF1. J. Biol. Chem.
278: 33029-33038
[Abstract]
[Full Text]
-
Galban, S., Fan, J., Martindale, J. L., Cheadle, C., Hoffman, B., Woods, M. P., Temeles, G., Brieger, J., Decker, J., Gorospe, M.
(2003). von Hippel-Lindau Protein-Mediated Repression of Tumor Necrosis Factor Alpha Translation Revealed through Use of cDNA Arrays. Mol. Cell. Biol.
23: 2316-2328
[Abstract]
[Full Text]
-
Ambrosino, C., Mace, G., Galban, S., Fritsch, C., Vintersten, K., Black, E., Gorospe, M., Nebreda, A. R.
(2003). Negative Feedback Regulation of MKK6 mRNA Stability by p38{alpha} Mitogen-Activated Protein Kinase. Mol. Cell. Biol.
23: 370-381
[Abstract]
[Full Text]
-
Campo, P. A., Das, S., Hsiang, C.-H., Bui, T., Samuel, C. E., Straus, D. S.
(2002). Translational Regulation of Cyclin D1 by 15-Deoxy-{Delta}12,14-Prostaglandin J2. Cell Growth Differ.
13: 409-420
[Abstract]
[Full Text]
-
Fan, J., Yang, X., Wang, W., Wood, W. H. III, Becker, K. G., Gorospe, M.
(2002). Global analysis of stress-regulated mRNA turnover by using cDNA arrays. Proc. Natl. Acad. Sci. USA
99: 10611-10616
[Abstract]
[Full Text]
-
Shivakumar, L., Minna, J., Sakamaki, T., Pestell, R., White, M. A.
(2002). The RASSF1A Tumor Suppressor Blocks Cell Cycle Progression and Inhibits Cyclin D1 Accumulation. Mol. Cell. Biol.
22: 4309-4318
[Abstract]
[Full Text]
-
Wang, W., Fan, J., Yang, X., Furer-Galban, S., Lopez de Silanes, I., von Kobbe, C., Guo, J., Georas, S. N., Foufelle, F., Hardie, D. G., Carling, D., Gorospe, M.
(2002). AMP-Activated Kinase Regulates Cytoplasmic HuR. Mol. Cell. Biol.
22: 3425-3436
[Abstract]
[Full Text]
-
Gouble, A., Grazide, S., Meggetto, F., Mercier, P., Delsol, G., Morello, D.
(2002). A New Player in Oncogenesis: AUF1/hnRNPD Overexpression Leads to Tumorigenesis in Transgenic Mice. Cancer Res.
62: 1489-1495
[Abstract]
[Full Text]
-
Xu, N., Chen, C.-Y. A., Shyu, A.-B.
(2001). Versatile Role for hnRNP D Isoforms in the Differential Regulation of Cytoplasmic mRNA Turnover. Mol. Cell. Biol.
21: 6960-6971
[Abstract]
[Full Text]
-
Wilson, G. M., Sutphen, K., Moutafis, M., Sinha, S., Brewer, G.
(2001). Structural Remodeling of an A + U-rich RNA Element by Cation or AUF1 Binding. J. Biol. Chem.
276: 38400-38409
[Abstract]
[Full Text]
-
Lin, S., Huang, H.-C., Chen, L.-L., Lee, C.-C., Huang, T.-S.
(2001). GL331 Induces Down-Regulation of Cyclin D1 Expression via Enhanced Proteolysis and Repressed Transcription. Mol. Pharmacol.
60: 768-775
[Abstract]
[Full Text]
-
Wang, W., Yang, X., Cristofalo, V. J., Holbrook, N. J., Gorospe, M.
(2001). Loss of HuR Is Linked to Reduced Expression of Proliferative Genes during Replicative Senescence. Mol. Cell. Biol.
21: 5889-5898
[Abstract]
[Full Text]
-
Allan, A. L., Albanese, C., Pestell, R. G., LaMarre, J.
(2001). Activating Transcription Factor 3 Induces DNA Synthesis and Expression of Cyclin D1 in Hepatocytes. J. Biol. Chem.
276: 27272-27280
[Abstract]
[Full Text]
-
Wilson, G. M., Sutphen, K., Bolikal, S., Chuang, K.-y., Brewer, G.
(2001). Thermodynamics and Kinetics of Hsp70 Association with A + U-rich mRNA-destabilizing Sequences. J. Biol. Chem.
276: 44450-44456
[Abstract]
[Full Text]