INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Splicing of nuclear pre-mRNAs in yeast and mammals occurs in the multicomponent complex called the spliceosome whose formation involves the ordered assembly of the U1, U2, and U4/U6.U5 snRNPs, together with a multitude of non-snRNP-associated protein factors on the pre-mRNA substrate (27, 67). In both systems, except for the U6 snRNP, each particle is composed of a U snRNA, a set of specific proteins associated with one particular snRNP, and a set of common (or core) proteins shared by all snRNPs. This last group is composed of the Sm proteins B, B' (in mammals), D1, D2, D3, E, F, and G, which assemble around the Sm site of the snRNA (34). In addition to the common Sm core proteins, the yeast and metazoan U6, U4/U6, and U4/U6.U5 snRNPs also contain seven distinct proteins called Lsm (like Sm) exhibiting clear homology to the Sm proteins (1, 7, 19, 21, 39, 55, 62, 68).

The Sm and Lsm proteins are highly conserved in all eukaryotic organisms. They contain the Sm domain, which consists of two conserved regions separated by a linker of variable length. Seven residues are highly conserved, and at many positions, the physicochemical property of the amino acid is maintained (7, 21, 62). The Sm motif is important for Sm protein function. Indeed, mutations at various positions in this motif, and mostly the hydrophobic conserved residues, abolish protein-protein interactions between Sm partners and hinder Sm core RNP complex formation (5, 21). Based on the crystal structures of two human Sm protein complexes (SmB/SmD3 and SmD1/SmD2), a model in which the seven Sm proteins form a doughnut-like structure has been proposed (26).

Assembly of the eukaryotic U snRNPs is a multistep process following an ordered pathway (36, 47). After transcription by RNA polymerase II, the snRNAs are exported to the cytoplasm. The Sm proteins, which are stored in the cytoplasm (35, 57), then assemble onto the snRNA Sm site. This binding allows hypermethylation of the snRNA 7-methyl cap by a methylase to form a methyl-2,2,7-guanosine cap structure (35, 46). This binding also generates a bipartite nuclear localization signal (NLS) composed of the Sm core complex and the snRNA cap structure (11, 13, 14, 20). This signal will permit the import of the newly made snRNPs to the nucleus. Addition of snRNP-specific proteins to the core snRNP, in the cytoplasm and/or the nucleus, completes the assembly of functional snRNPs (42). Competition experiments indicate that snRNPs are imported by specific receptors not shared by other classes of nuclear proteins (12, 24, 40). It has also been shown that U snRNP import is mediated by importin , which functions in this process without the NLS-specific importin  receptor (44). Recently, the import receptor for the m₃G cap structure has been identified in mammals (23). This protein, called snurportin1, enhances the m₃G-cap-dependent nuclear import of U snRNPs. Snurportin1, which is an importin -like adapter, recognizes only the m₃G cap but not the Sm core NLS, indicating that at least two distinct import receptors interact with the snRNP bipartite NLS (23).

Immunofluorescence staining experiments with mammalian cells allowed the detection of a complex subcellular localization of snRNPs. In the nucleus, in addition to a diffuse nucleoplasmic snRNP staining, the snRNP particles are localized in speckles, coiled bodies, and nucleoli (6, 30, 65, 66). The snRNP protein complexes are also localized into the cytoplasmic compartment as discrete punctuate structures which are uniformly distributed and which may represent storage particles of the snRNP core protein complexes or staging centers for snRNP core particle assembly (72).

Interest in snRNP biogenesis has increased since it has been shown that defects in this process are correlated with a human motor neuron degenerative genetic disease, spinal muscular atrophy (15, 33, 37, 45). Most of the studies of snRNP biogenesis have been performed in metazoan systems. In yeast, recent analyses indicate a conservation of the Sm protein-protein interaction sites, suggesting that snRNP structure would be conserved and that snRNP assembly could follow a pathway similar to that in mammals (5). However, it is not yet clear if, in yeast, snRNAs transit through the cytoplasm during snRNP formation. In order to get more information on the mechanisms governing snRNP biogenesis, the yeast system was further exploited. The goal of this study was to define more precisely the molecular basis of the NLS carried by the Sm core complex. In this regard, yeast SmB, SmD1, and SmD3 proteins possess, in their carboxyl-terminal regions, stretches of basic amino acids that are reminiscent of nuclear import signals found in nuclear proteins as well as in ribosomal proteins. Although similar motifs are not found in the human counterparts, it is noteworthy that the human SmB, SmD1, and SmD3 proteins also possess C-terminal extensions rich in basic amino acids (see Discussion). In this report, using fluorescence microscopy studies combined with mutational and functional analyses, I show that the yeast SmB and SmD1 NLS-like motifs exhibit nuclear localization properties. The results suggest that a basic amino acid-rich protuberance formed by the C-terminal extensions of Sm proteins may represent the nuclear localization determinant of the Sm core complex, in both yeast and human cells.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Yeast strains, media, and genetic methods. The wild-type YDL401 strain (MATa ura3-52 trp1 his3-200 leu2-1 gal2 gal108) (29) was obtained from B. Séraphin and was used for subcellular localization studies of green fluorescent protein (GFP)-Sm fusion alleles and for whole-cell extract preparation. The YAMB strain (YPH background) (64) (MATa/MAT ura3-52/ura3-52 lys2-801/lys2-801 ade2-/ade2- ade3-/ade3- trp1-63/trp1-63 his3-200/his3-200 leu2-1/leu2-1) was obtained from A. Camasses and was used for SMB and SMD1 gene disruptions. Derived haploid strains were used for phenotypic analyses. Yeast strains were grown using standard procedures and media as previously described (10). Yeast transformations were performed by the lithium acetate method (22).

Gene disruptions. DNA fragments carrying precise disruptions of SMB and SMD1 genes were generated by PCR using the KAN-MX4 cassette (70) as template with the following oligonucleotides: for SMB, S1BK (5'-AGAACCATCCGTATAACAGGTTTCCAGTAAAGTAAATAACTCGTACGCTGCAGGTCGAC) and S2BK (5'-TGCGTACACAAAAAAAGTATACGGAAACTATATTAGACTACATCGATGAATTCGAGCTCG), and for SMD1, S1D1K (5'-AGATGACTCCAAGTATCGTTTATAAATCGTCGAGAAAAAGATCGTACGCTGCAGGTCGAC) and S2D1K (5'-ACCTCTTCTTGGCCTTTTATTCGCTGGTGCACCAAAATCGCATCGATGAATTCGAGCTCG).

smd1

Plasmid constructions. Plasmid were constructed by standard methods (56). To construct the pGFP-SmB, pGFP-SmD1, pGFP-SmD2, pGFP-SmD3, and pGFP-SmG fusion alleles, the corresponding Sm coding sequences were purified as an NcoI-XhoI fragment (the NcoI being blunt ended with Klenow enzyme) after digestion of pBS1280, pBS1282, pBS1284, pBS1286, and pBS1105 (5), respectively. These fragments were transferred into pGFP-Nfus (URA3 CEN) vector (43) previously cut with XmaI, blunt ended with Klenow enzyme, and cut with XhoI. The pGFP-SmF fusion allele was constructed by subcloning a BamHI-XhoI DNA fragment (the BamHI site being blunt ended with Klenow enzyme) obtained from the pKS()SmF plasmid (5) into pGFP-Nfus cut with XmaI, blunt ended with Klenow enzyme, and cut with XhoI. The pGFP-SmE fusion allele was constructed by subcloning a BamHI-XhoI DNA fragment (the BamHI site being blunt ended with Klenow enzyme) obtained from the pACTII-SmE plasmid (5) into pGFP-Nfus cut with XmaI, blunt ended with Klenow enzyme, and cut with XhoI. In all those plasmids, the GFP-Sm fusion alleles are placed under the inducible MET25 promoter (41, 43). The sequences of cloning junctions were verified by dideoxynucleotide sequencing.

Construction of GFP-Sm mutant alleles. To construct GFP-SmB mutant alleles, the following specific pairs of primers were used: for pGFP-SmBNLSC (residues 1 to 103 of SmB), RBspeC (5'-ACTAGTGGATCCCCCGGCATGGTA) and RBspeD (5'-GTCTTTCCGAATTCTATAGTAGCGGCT), for pGFP-SmB-Cter (residues 149 to 196 of SmB), RBspeE (5'-GCGAAGCATACTGGATCCAATTCTAGG) and RBspeF (5'-CTATATTAGAATTCACTACATCAA), and for pGFP-SmBC (residues 1 to 147 of SmB), RBspeC (5'-ACTAGTGGATCCCCCGGCATGGTA) and RBspeB (5'-CCCTAGAATTCCTTTAAGTATGCTTCG). After PCR amplification using the pGFP-SmB plasmid as template, the products were cloned as BamHI-EcoRI fragments into BamHI-EcoRI-digested vector puG36 (URA3 CEN). To construct pGFP-SmD1NLS (residues 1 to 115 of SmD1) (URA3 CEN plasmid) and pGFP-H-SmD1NLS (HIS3 CEN plasmid), a PCR product was amplified from pGFP-SmD1 plasmid using oligonucleotides GFP (5'-ACGAAAAGAGAGATCACATGATC) and RBD1Eco (5'-GACCCGATCGAATTCAGGAATTAAGT). The PCR product was cut with BamHI-EcoRI and cloned into the corresponding sites of pUG36 (URA3 CEN) and pUG34 (HIS3 CEN) vectors (43). The wild-type SMD1 gene was also cloned into pUG34 (HIS3 CEN) by using the same strategy with oligonucleotides GFP (5'-ACGAAAAGAGAGATCACATGATC) and RBD1End (5'-GTGACAGTGAATTCGACAACGACA). The plasmid was called pH-GFP-SmD1.

View larger version (49K): [in this window] [in a new window]   FIG. 1.   Amino acid sequence comparison of the C-terminal extensions of yeast Sm proteins. (A) The C-terminal domains of the yeast SmB, SmD1, and SmD3 proteins contain regions rich in basic amino acids (in bold). The evolutionarily conserved Sm motif 2 is underlined. The numbers at the left correspond to the position of the first amino acid shown in the sequence. (B) Comparison of the NLS-like motifs found in the yeast Sm proteins with other nuclear localization motifs. The positions of the basic amino acid-rich regions in the yeast Sm proteins are as follows: SmB, residues 105 to 132; SmD1, residues 128 to 144; and SmD3, residues 85 to 101. The sequences of SmB and SmD1 showing similarities with classical monopartite SV40-type NLSs are underlined. (C) Mutations generated in the SmB NLS-like motif. Basic amino acids are shown in bold. The mutated and deleted positions are underlined in the sequences of the SmBmut1 and SmBmut2 alleles.

Preparation of yeast extracts, Western blot analysis, and immunoprecipitations. To analyze the stability of GFP-Sm fusion proteins, yeast whole-cell extracts were prepared as previously described (5, 61). For Western analysis, 5 optical density (OD) equivalents of extracts were mixed with dye, boiled 10 min, and loaded on sodium dodecyl sulfate (SDS)-denaturing polyacrylamide gels (28) or Tricine-SDS-denaturing polyacrylamide gels (58). After transfer to nitrocellulose membrane by electroblotting, the immunoblots were probed with anti-GFP antibodies (Molecular Probes) and then incubated with secondary antibodies conjugated to peroxidase (Promega Corp., Madison, Wis.). The blots were visualized by enhanced chemiluminescence (ECL; Amersham) according to the manufacturer's instructions.

Light microscopy. The localization of GFP-Sm fusion proteins was examined in living yeast cells. Cells transformed with pGFP-Sm constructs were grown in either liquid or solid synthetic selective media to early log phase. Cells were washed with phosphate-buffered saline, mounted on slides (10), and examined by fluorescence microscopy. Samples were observed using a Nikon fluorescence microscope. Images were acquired with an PhotonicScience camera.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

The C-terminal extensions of yeast SmB, SmD1, and SmD3 contain NLS-like motifs. All Sm proteins contain the Sm domain, which consists of two blocks of conserved amino acids (Sm motif 1 and Sm motif 2) separated by a nonconserved region (7, 21, 62). In addition, the SmB, SmD1, and SmD3 proteins from all species have C-terminal extensions beyond the Sm motif as compared to the other Sm proteins. A close inspection of the C-terminal protein sequences of the yeast Sm proteins reveals the presence of stretches rich in lysine and arginine residues (Fig. 1A). The region of yeast SmB between positions 105 and 135 contains 16 basic amino acids. In yeast SmD1, of the last 20 amino acids, 9 are arginine or lysine, and in SmD3, seven residues in the C-terminal domain are basic. These clusters of basic residues present similarities with a classical monopartite SV40 Tag-type NLS (8) as well as a bipartite NLS which is defined as two basic clusters separated by a spacer region of any 10 amino acids (8, 48). They also show homologies to nuclear import signals for human ribosomal proteins, such as rpS6 (60), rpL7a (52), or rpL23a (25). A common feature of those last signals is their very basic nature and a greater complexity as compared with the classical NLS. The similarities of the basic amino acid-rich stretches found in SmB, SmD1, and SmD3 to classical, bipartite, and ribosomal proteins nuclear import signals are shown in Fig. 1B. The basic domains found in the yeast Sm proteins were termed NLS-like motifs to distinguish them from classical NLSs.

The NLS-like motifs of SmB and SmD1 exhibit nuclear localization properties. To test whether the NLS-like motifs found in SmB, SmD1, and SmD3 may function as a nuclear targeting signal, they were fused to the C terminus of a dimeric GFP-GFP reporter protein (see Materials and Methods; Fig. 2). Immunoblotting experiments using GFP-specific antibodies demonstrated that expression of these constructs in wild-type yeast cells results in the synthesis of fusion proteins of predicted lengths (data not shown). The intracellular localization of the fusion proteins was visualized in living cells. As shown in Fig. 2, as is the case for the classical NLS of SV40 Tag, the basic motif of either SmB or SmD1 targets the reporter protein to the nucleus, whereas the dimeric GFP-GFP protein alone gives rise to a diffuse cytoplasmic staining. This result demonstrates that the NLS-like motifs of SmB and SmD1 function as nuclear targeting elements in vivo. In contrast, the dimeric GFP-GFP protein fused to the basic motif of SmD3 does not accumulate in the nuclear compartment, indicating that this motif does not possess nuclear localization properties.

View larger version (73K): [in this window] [in a new window]   FIG. 2.   Localization properties of the putative NLS-like motifs identified in yeast SmB, SmD1, and SmD3 proteins. The NLS-like motif from each indicated Sm protein was fused to the C-terminal domain of a dimeric GFP-GFP reporter protein. The portion of protein sequence used is indicated above each construct. These fusion proteins as well as a fusion carrying the NLS of SV40 Tag at the C terminus of a GFP--Gal reporter protein (SV40-GFP--Gal) were expressed in wild-type cells. Cells were observed by using differential interference contrast (DIC), and GFP was detected by fluorescence microscopy (GFP). The position of the nuclei was visualized with DAPI (4',6'-diamidino-2-phenylindole).

Cellular localization of yeast Sm proteins. If carboxyl-terminal domains of SmB and SmD1 alone confer nuclear import of the GFP-GFP reporter protein, full-length SmB and SmD1 proteins should also show nuclear localization when fused to GFP. To test this, the subcellular localization of the yeast SmB and SmD1 proteins was analyzed along with the other yeast Sm proteins. Translational fusions were constructed by placing the whole sequence of the different Sm proteins at the C terminus of GFP. The constructs were transformed into wild-type yeast cells which were grown in Ura medium to maintain the GFP-Sm fusion containing plasmid. Growth assays were performed under repressing conditions (presence of methionine in the medium), since the repression of the MET25 promoter results in a rest activity of 10 to 20% (41). To characterize the expression of the fusion proteins, whole-cell lysates were prepared from yeast cells carrying the different constructs, and proteins were analyzed by Western blotting using anti-GFP antibodies. With the exception of GFP-SmD2 (Fig. 3, lane 3), expression of the GFP-Sm fusion constructs in wild-type cells results in the synthesis of fusion proteins of predicted lengths and at approximately similar levels (Fig. 3). The cause of the instability of the GFP-SmD2 fusion protein is unknown and has not been further investigated.

View larger version (45K): [in this window] [in a new window]   FIG. 3.   Western analysis of GFP-Sm fusion proteins. Equivalent amounts of cell extracts prepared from wild-type strains carrying the indicated GFP-Sm fusion proteins were fractionated by SDS-polyacrylamide gel electrophoresis and immunoblotted with anti-GFP antibodies. Both panels represent two independent migrations. The GFP-SmD2 fusion protein (lane 3) was not stably expressed for unknown reasons. Control extract was made from a wild-type strain carrying the GFP vector alone (lane 5). The predicted molecular masses of the proteins are as follows: GFP-SmB, 55 kDa; GFP-SmD1, 45 kDa; GFP-SmD2, 42 kDa; GFP-SmD3, 37 kDa; GFP-SmE, 39 kDa; GFP-SmF, 38 kDa; GFP-SmG, 36 kDa; GFP, 27 kDa.

View larger version (75K): [in this window] [in a new window]   FIG. 4.   Cellular localizations of yeast GFP-Sm fusion proteins. (A) The indicated GFP-Sm fusion proteins were expressed in a wild-type strain, and living cells were observed using differential interference contrast (DIC) and by fluorescence microscopy (GFP). The position of the nuclei was visualized with DAPI (see text for details). (B) GFP-SmD3 localizes to the nucleus upon SmB overexpression. The YAMB haploid wild-type strain was transformed with the GFP-SmD3 fusion protein and with either the empty pGAL1 vector (a and b) or the pGAL1-SmB plasmid (c and d). Transformants were grown in galactose-containing medium, and the cells were observed using differential interference contrast (DIC) and fluorescence microscopy (GFP).

Incorporation of GFP-Sm fusion proteins into snRNP particles. To determine if the GFP-Sm fusion proteins behave like wild-type Sm proteins, the incorporation of the tagged proteins into snRNP particles was analyzed by immunoprecipitation of snRNPs from yeast cells using anti-GFP antibodies (Fig. 5). Whole-cell extracts were prepared from wild-type strains carrying the indicated GFP-Sm fusion (Fig. 5, lanes 6, 7, and 16 to 21) and, as control, from a wild-type strain expressing only GFP protein (Fig. 5, lanes 4, 5, 14, and 15). Since the GFP-SmE allele can complement a chromosomal deletion of the SME1 gene (data not shown), an extract was also prepared from an sme::HIS3 strain (4) carrying the GFP-SmE fusion as sole source of SmE protein (Fig. 5, lanes 8 and 9). Equal amounts of extracts were incubated with anti-GFP antibodies bound to protein A-Sepharose beads (see Materials and Methods) and RNA, which was recovered from the total extract (Fig. 5, Total), the supernatant (Fig. 5, lanes S), and the immunoprecipitates (Fig. 5, lanes P), and were analyzed by Northern hybridization. As shown in Fig. 5, the snRNAs were found in the immunoprecipitates from the strains expressing GFP-SmB (lane 6), GFP-SmE (lane 8), GFP-SmG (lane 18), and GFP-SmD3 (lane 20) but not from the strain expressing GFP-SmF (lane 16) and not from the control strain expressing GFP (lanes 4 and 14). The U6 snRNA was also precipitated from strains expressing GFP-SmB (lane 6), GFP-SmE (lane 8), GFP-SmG (lane 18), and GFP-SmD3 (lane 20) due to its association with the U4 snRNA in the U4/U6 and U4/U6.U5 snRNPs (34).

View larger version (48K): [in this window] [in a new window]   FIG. 5.   Incorporation of the GFP-Sm fusion proteins into snRNPs. Strains containing the indicated GFP-Sm fusion protein were grown under conditions maintaining the plasmid. Whole-cell extracts were prepared, and snRNPs were immunoprecipitated with anti-GFP antibodies. RNA was extracted from the supernatants (S), the pellets (P), and equivalent aliquots of the total lysates (Total), separated on denaturing polyacrylamide gels, and subjected to Northern analysis. Hybridization was with probes specific for the yeast U4, U5, and U6 snRNAs. W.T., wild-type strain; sme, strain carrying a chromosomal deletion of the SmE gene (4).

Subcellular localizations of GFP-Sm mutant fusion alleles. Given that GFP-SmB and GFP-SmD1 fusion proteins can substitute for the wild-type corresponding protein in vivo (see below), mutant alleles carrying mutations in the NLS-like motifs of SmB and SmD1 were constructed to test the functional importance of these sequences (Fig. 6A). These constructs were transformed into haploid wild-type cells, and the intracellular localizations of the Sm mutant fusion proteins were observed by fluorescence microscopy (Fig. 6B). Whereas the GFP-CterB fusion distributes uniformly in the cytoplasm (Fig. 6B, panel c) as does the empty GFP vector (Fig. 6C, panel c), the GFP-SmBC fusion protein localizes to the nucleus (Fig. 6B, panel d) like the full-length GFP-SmB fusion protein (Fig. 6B, panel a). In contrast, although a light nuclear signal can be observed in some cells, the GFP-SmBNLSC fusion allele gives rise mainly to a cytoplasmic staining visualized as heterogeneously distributed fluorescent sites (Fig. 6B, panel b).

View larger version (63K): [in this window] [in a new window]   FIG. 6.   Intracellular localizations of GFP-SmB and GFP-SmD1 mutant fusion alleles in wild-type cells. (A) Schematic representation of the GFP-Sm mutant alleles. The structures of the mutant fusion constructs are schematically shown: GFP represents the reporter protein, 1 and 2 represent the conserved Sm1 and Sm2 motifs, NLS represents the NLS-like motifs of SmB and SmD1, and Cter represents the SmB C-terminal region (residues 148 to 196). The mutations generated in the GFP-SmBmut1 and GFP-SmBmut2 alleles are detailed in Fig. 1C. A summary of the subcellular localizations in wild-type cells and the growth phenotypes of the mutants in an smb::KAN SmD1NLS context (see Fig. 7B) is shown at the right. nuc, nucleus; cyt. + punct., cytoplasmic staining with fluorescent sites; +++, viable; , lethal; ++ and +, viable with growth defect; n/a, not applicable. (B) Subcellular localizations of the GFP-SmB mutant alleles. The GFP-SmB fusion alleles were expressed in wild-type cells, and GFP was detected in living cells by fluorescence microscopy. The position of the nuclei was visualized with DAPI. (C) Subcellular localizations of the GFP-SmD1 fusion alleles. The GFP-SmD1 fusion alleles were expressed in wild-type cells, and GFP and DAPI were detected in living cells by fluorescence microscopy.

Growth phenotypes of GFP-Sm mutant alleles. If the NLSs from SmB and SmD1 are essential for Sm protein nuclear import and function, one would expect that deletion of these motifs will hinder the import process and therefore give rise to yeast growth defects. This was tested by constructing chromosomal SMB and SMD1 deletion strains (see Materials and Methods). The lethality of each smb::KAN and smd1::KAN strain can be rescued by complementation with plasmids carrying their respective genes under the GAL1 promoter (data not shown). To determine the effect of the GFP-Sm mutant alleles in vivo, the plasmids carrying the mutant fusions were transformed into smb::KAN and smd1::KAN strains carrying the pGAL1-SmB and pGAL1-SmD1 gene constructs, respectively. Transformed cells did not show any growth defect on galactose-containing media, indicating that the mutants had no dominant phenotype. When placed on glucose-containing media, which repress the production of wild-type SmB protein, all GFP-SmB mutant fusion proteins, except the GFP-CterB allele (data not shown), sustain yeast cell growth like the GFP-SmB protein, whereas strain smb::KAN carrying the empty GFP vector is lethal (Fig. 7A). The strain containing the GFP-SmBNLSC allele grows more slowly than the strains containing other GFP-SmB mutant alleles, giving rise to smaller colonies after 4 days at 30°C (Fig. 7A). The GFP-SmD1NLS mutant protein is also capable of replacing the GFP-SmD1 fusion protein without any obvious growth defect (data not shown).

View larger version (53K): [in this window] [in a new window]   FIG. 7.   Growth phenotypes of GFP-SmB mutant fusion alleles. (A) An smb::KAN strain carrying a pGAL1-SmB gene was transformed with the indicated GFP-SmB fusion alleles. The different strains, which grow on galactose-based media, were streaked on glucose-based media, which repress the production of the wild-type SmB gene. The phenotypes were observed after 4 days at 30°C. (B) Simultaneous deletion of the SmB- and SmD1-NLS-like motifs gives rise to yeast cell lethality. Above, strain YRB120 carries chromosomal disruptions of the SMB and SMD1 genes. This strain is able to grow on galactose-based media, since it carries the SmB gene under the GAL1 promoter [p(TRP1)GAL1-SmB plasmid] and the GFP-SmD1NLS mutant allele [p(HIS3)GFP-SmD1NLS plasmid]. This strain was transformed with different constructs of GFP-SmB mutant alleles carried by a URA3 plasmid [p(URA3)GFP-X plasmid]. When placed on glucose-based media, the wild-type SmB gene is repressed, allowing the determination of the growth phenotype of the GFP-SmB mutant alleles. Below, growth assay. The growth phenotypes of the indicated GFP-SmB mutants were determined after 4 days at 30°C.

Concomitant deletions of the SmB and SmD1 NLS-like motifs produce yeast cell lethality. If the SmB- and SmD1-NLS-like motifs are functionally redundant, deletions of both sequences should impair their functions and produce a yeast cell growth defect. This was tested, as described in the legend to Fig. 7B, in strain YRB120 carrying simultaneously smb::KAN and smd1::LEU2 disrupted alleles. Due to the production of wild-type SmB protein, the strains containing the different constructs grow on galactose-containing media (data not shown). On glucose, cells carrying the full-length GFP-SmB fusion protein grow and cells carrying the empty GFP vector die (Fig. 7B, lower panel). Under the same conditions, the GFP-SmBNLSC mutant fusion protein is unable to support growth in a GFP-SmD1NLS background, whereas the GFP-SmBC mutant fusion strain is viable but presents a growth defect (Fig. 7B). Growth curve determination shows that the generation time of this mutant is threefold longer than that of a strain expressing the GFP-SmB fusion protein. The GFP-SmBmut1 and GFP-SmBmut2 mutant strains are also viable although they show growth defects, since both mutants give rise to smaller colonies than the GFP-SmB fusion (Fig. 7B). The growth defect is stronger for the GFP-SmBmut2 allele which is more severely mutated in the NLS-like motif than the GFP-SmBmut1 allele (Fig. 1C). Comparable growth phenotypes are observed at 25°C, the growth defect of the GFP-SmBC, GFP-SmBmut1, and GFP-SmBmut2 mutant alleles being exacerbated at this temperature. Growth phenotypes have not been analyzed at 37°C, since the YRB120 strain carrying the GFP-SmB fusion protein grows very poorly at these conditions.

The SV40 Tag NLS cannot efficiently replace the NLS-like motif of SmB. The results described above show that mutations in the NLS-like motif of SmB produce mislocalization of GFP-SmB mutant alleles and induce a growth defect in an smb::KAN SmD1NLS background strain. To test whether the NLS from SV40 Tag can functionally substitute for the NLS-like motif of SmB, different SmB mutants were fused in frame to a GFP reporter protein carrying, at its N terminus, the NLS of SV40 (Fig. 8A). The NLS of SV40 was also introduced at the 3' end of the GFP-SmBNLSC construct (pGFP-SmB-SV40 plasmid). Finally, the NLS of SV40 was used to replace the NLS-like region (residues 101 to 148) of SmB (pGFP-SmB-SV40-Cter plasmid). The structure of the generated alleles is shown in Fig. 1C. The different constructs were transformed into the smb::KAN strain carrying the pGAL1-SmB plasmids, and their growth phenotypes were determined as described in Fig. 7A. All the strains with GFP-SmB mutant alleles carrying the NLS of SV40 Tag were viable when tested on galactose-containing and glucose-containing media (data not shown), showing that the fusions are able to complement an smb::KAN-deleted strain in an SmD1 wild-type background. To test whether the SV40 NLS containing GFP-SmB alleles can complement a simultaneous deletion of the NLS-like motifs of SmB and SmD1, these mutants were transformed into the YRB120 strain, and their growth phenotypes were determined as described in Fig. 7B. On galactose-containing media, all mutant fusions grew, indicating that no mutant had any obvious dominant phenotype (data not shown). When placed on glucose-containing media, the strain containing the SV40 NLS-GFP-SmB fusion grew, whereas the strain carrying the SV40 NLS-GFP--Gal vector was lethal (Fig. 8B). The strain carrying the GFP-SmB-SV40 fusion was also unable to grow (Fig. 8B, right panel). In contrast, a strain carrying the GFP-SmB-SV40-Cter allele was not lethal although it showed a severe growth defect when compared to the GFP-SmB fusion (Fig. 8B, right panel). The growth phenotypes of the SV40 NLS-GFP-SmBNLSC, SV40 NLS-GFP-SmBmut1, and SV40 NLS-GFP-SmBmut2 fusion alleles are identical to those of the GFP-SmBNLSC, GFP-SmBmut1, and GFP-SmBmut2 mutants, respectively (compare Fig. 8B and 7B).

View larger version (62K): [in this window] [in a new window]   FIG. 8.   Growth phenotypes and intracellular localizations of SV40 NLS containing GFP-SmB mutant alleles. (A) Schematic representation of the GFP-SmB mutant alleles carrying the NLS motif of SV40 Tag. The structures of the mutant fusion constructs are as described in the legend to Fig. 6A. (B) Growth assay. The constructs were transformed in the YRB120 strain, and their phenotypes were determined as described in the legend to Fig. 7B. (C) Subcellular localizations of the SV40 NLS containing GFP-SmB fusion alleles in wild-type cells as detected by fluorescence microscopy.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this study, using GFP-tagged wild-type Sm proteins and Sm mutant alleles, I show that the NLS-like motifs of yeast SmB and SmD1 proteins exhibit nuclear localization properties. Both motifs are important for nuclear localization of their respective proteins. However, deletion of either motif did not impair yeast cell growth while simultaneous deletion of both SmB- and SmD1-NLS-like sequences produces yeast cell lethality, showing that these motifs have redundant essential functions. Taken together, the results suggest that, in the heptameric ring model formed by the Sm core complex, a basic amino acid-rich protuberance composed of the positively charged residues found in the C-terminal regions of Sm proteins, may represent a nuclear localization determinant, both in yeast and human cells.

Most yeast GFP-Sm fusion proteins assemble into functional snRNPs. That the majority of yeast GFP-Sm fusion proteins behave like wild-type Sm proteins is supported by the immunoprecipitation studies and by the functional in vivo approaches. These results imply that the fusion proteins are assembled into snRNPs following a complete assembly pathway. Failure of the GFP-SmF fusion protein to assemble into snRNPs may reflect its inability to associate with the SmE partner. Consistent with this explanation, a glutathione S-transferase-SmF fusion protein (GST-SmF) is unable to interact with in vitro-translated ³⁵S-SmE in an in vitro binding assay (R. Bordonné, unpublished results), whereas a GST-SmE fusion protein binds efficiently to in vitro-translated ³⁵S-SmF (5). Therefore, the presence of a Tag at the N terminus of the SmF protein may induce a misfolding of the fusion protein which impairs its function.

Nuclear import signal of the Sm core complex. Examination of subcellular localization of the GFP-SmB and GFP-SmD1 alleles mutated in the NLS-like motifs suggest that these motifs represent nuclear import determinants (Fig. 6). Although these results cannot totally rule out the possibility that the NLS-like motifs of SmB and SmD1 might be required for efficient assembly or stabilization of the Sm core complex, this seems unlikely for the following reasons. First, unique deletion of each motif does not affect the viability of yeast GFP-SmB (Fig. 7A) and GFP-SmD1 mutants, demonstrating that the different mutant alleles are correctly assembled into snRNPs and are able to perform all subsequent steps of spliceosome formation. Second, coimmunoprecipitation studies with C-terminal truncation mutants of the human Sm proteins B' and D3 show that the amino-terminal 93 amino acids of SmB', containing the two Sm motifs, are sufficient for efficient and stable complex formation in vitro with full-length SmD3 (21). Likewise, this study shows that deletions in the C terminus of SmD3 do not affect the capability of SmD3 mutants to interact with SmB' protein. Third, fragments of human SmB (residues 1 to 91) and SmD3 (residues 1 to 75) proteins lacking the C-terminal extensions form a stable complex even in high salt (26). Finally, the heptameric ring proposed for the human Sm core protein complex has been modeled using SmB-SmD3 and SmD1-SmD2 crystals containing approximately 70 residues of each protein chain (26). Taken together, these observations strongly suggest that mutations in (or deletions of) the NLS-like motifs located in the C-terminal extensions of the Sm proteins do not affect assembly or stabilization of the Sm core complex.

KAN SmD1NLS

U snRNP import in yeast. The results presented in this paper suggest that a basic amino acid-rich protuberance composed of the NLS-like motifs found in the C-terminal extensions of Sm proteins represents the nuclear import signal formed by the complex of Sm core proteins, both in yeast and mammals. However, in yeast, it is yet unknown if the snRNAs transit through the cytoplasm or remain in the nucleus during snRNP biogenesis. Therefore, it is possible that yeast snRNP biogenesis might not require nuclear snRNA export and that the complex of Sm core proteins might be nuclear imported as an snRNA-free preassembled complex. In this regard, it is interesting to note that no homologue to snurportin1, the receptor recognizing the snRNA cap structure in mammals, has been found in the yeast genome database although snurportin1 is evolutionarily conserved in Caenorhabditis elegans, Drosophila, mice, and humans (23). Moreover, a recent study provided evidence for the presence, in mammalian fibroblasts, of an snRNA-free spliceosomal Sm protein complex (9), showing that such a heteromer exists in vivo. Further studies are needed to define whether or not yeast snRNAs transit through the cytoplasm and in which compartment of the yeast cell the Sm core is assembled. The tools generated in this work will certainly be helpful in resolving these issues.