Previous Article | Next Article 
Molecular and Cellular Biology, November 2000, p. 7971-7979, Vol. 20, No. 21
Department of Biological Sciences, Graduate School of
Science, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan
Received 18 April 2000/Returned for modification 25 May
2000/Accepted 1 August 2000
Using a two-hybrid screening with TOM1, a putative
ubiquitin-ligase gene of Saccharomyces cerevisiae, we
isolated KRR1, a homologue of human HRB2 (for
human immunodeficiency virus type 1 Rev-binding protein 2). To
characterize the gene function, we constructed temperature-sensitive
krr1 mutants and isolated two multicopy suppressors. One
suppressor is RPS14A, encoding a 40S ribosomal protein. The
C-terminal-truncated rpS14p, which was reported to have diminished
binding activity to 18S rRNA, failed to suppress the krr1
mutant. The other suppressor is a novel gene, KRI1 (for
KRR1 interacting protein; YNL308c). KRI1 is essential for
viability, and Kri1p is localized to the nucleolus. We constructed a
galactose-dependent kri1 strain by placing KRI1
under control of the GAL1 promoter, so that expression of
KRI1 was shut off when transferring the culture to glucose
medium. Polysome and 40S ribosome fractions were severely decreased in
the krr1 mutant and Kri1p-depleted cells. Pulse-chase
analysis of newly synthesized rRNAs demonstrated that 18S rRNA is not
produced in either mutant. However, wild-type levels of 25S rRNA are
made in either mutant. Northern analysis revealed that the steady-state
levels of 18S rRNA and 20S pre-rRNAs were reduced in both mutants.
Precursors for 18S rRNA were detected but probably very unstable in
both mutants. A myc-tagged Kri1p coimmunoprecipitated with a
hemagglutinin-tagged Krr1p. Furthermore, the krr1 mutant
protein was defective in its interaction with Kri1p. These data lead us
to conclude that Krr1p physically and functionally interacts with Kri1p
to form a complex which is required for 40S ribosome biogenesis in the nucleolus.
Ribosome biosynthesis is a complex
process that occurs in a specialized subnuclear compartment termed the
nucleolus in eukaryotic cells. There, 100 to 200 copies of the rDNA
unit are repeated on chromosome XII in Saccharomyces
cerevisiae. The rRNA genes are transcribed by RNA polymerase I to
produce the 35S rRNA precursor, which is rapidly processed, resulting
in the separation of the pre-rRNAs destined for the small and large
ribosomal subunits. The 20S rRNA precursor is matured to 18S rRNA for
40S ribosome subunits, and the 27S pre-rRNA is processed to the mature
25S and 5.8S rRNAs for 60S subunits (reviewed in reference 15).
These rRNA-processing events are coupled with ribosomal assembly, which
requires a large number of nonribosomal protein trans-acting factors and small nucleolar RNAs (snoRNAs) as well as ribosomal proteins. Such nucleolar proteins include rRNA-modifying enzymes, endo-
and exonucleases, RNA helicases, and components of small nucleolar
ribonucleoprotein complexes (15). For example, Nop1p, a
typical nucleolar protein (an orthologue to human fibrillarin) is a
component of C/D-box snoRNP, which is involved in pre-rRNA 2'-O-ribose methylation and rRNA processing (1, 23,
27).
TOM1 encodes a putative ubiquitin-ligase. At high
temperatures, the tom1 mutant exhibits pleiotropic
phenotypes, such as G2/M arrest in the cell cycle,
accumulation of mRNAs in the nucleus, fragmentation of the nucleolus,
and impaired heat stress responses (22, 28). Hoping to
identify the substrates of Tom1p, we screened Tom1p-interacting
proteins by the two-hybrid system and isolated the KRR1
gene. KRR1 encodes a protein containing a KRR motif
conserved from yeast to human cells and was shown to be essential for
cell viability (8), but KRR1 has not been
characterized yet. Here we report the characterization of
KRR1 and a novel KRI1 (KRR1-interacting protein;
YNL308c) gene of budding yeast cells.
Strains, plasmids, and genetic manipulations.
Strains of
S. cerevisiae used in this study are described in Table
1. Techniques for yeast genetics,
molecular biological experiments, and the composition of media are
described elsewhere (12, 21). Plasmid vector YEplac181 was
described previously (7). Plasmid pTS1010
(YCp-KRR1-TRP1) was constructed by cloning the
KRR1 open reading frame (ORF) flanked by the 304-bp upstream and 552-bp downstream regions into pRS314 (24). Plasmid
pTS1011 (YIp-KRR1-5HA) carries the KRR1 gene
fused with five copies of the hemagglutinin (HA) epitope tag at the
C-terminal region of KRR1 and was integrated into the
KRR1 locus of diploid strain W303. Haploid strain YST029-4A
containing the tagged gene was isolated by tetrad dissection. Plasmid
pTS1013 (YCp-KRR1-2HA-TRP1), pTS1053-17
(YCp-krr1-17-2HA), or pTS1053-18
(YCp-krr1-18-2HA) was constructed by cloning PCR products
into a YCplac-based vector pTS903CT, which was constructed to fuse the
codons for a double-HA tag to the 3' region of a gene of interest.
Plasmid pTS1034 (YCp-KRR1-2HA-LEU2) has the same fragment of
pTS1013 on pTS903CL, a YCplac111-based vector (7) for
tagging the HA epitope. Plasmid pTS068 (YCp-NOP1-GFP) was
constructed as follows: the DNA sequence of the NOP1 ORF
plus a 1-kb 5'-upstream region was amplified by PCR and cloned into pTS070, which was constructed to express a fusion gene with enhanced green fluorescent protein (GFP) (Clontech) at the 3' end of a gene of
interest. pTS1501 (YEp-RPS14A) was isolated from a
YEpl3-based genomic library and contained a 7.5-kb insert. The 2.4-kb
HindIII-SalI fragment carrying
RPS14A and SNR65 was cloned into YEplac181
(7), and the resulting plasmid suppressed krr1.
When a part of RPS14A was deleted with EcoRI, the
resulting plasmid lost the ability to suppress krr1. To
introduce a premature stop codon into the C-terminal region of
RPS14A, we used the following primers,
TCTACCCTGCAGAACTCAGGTGGAG for pTS1506
(rpS14-
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Yeast Krr1p Physically and Functionally Interacts
with a Novel Essential Kri1p, and Both Proteins Are Required for 40S
Ribosome Biogenesis in the Nucleolus
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
C11) and
CAATACCTGCAGAACTCATCATCTTC for pTS1508 (rpS14-CryR). Underlined nucleotides indicate
the introduced stop codons. Both pTS1506 and pTS1508 carry the 2.4-kb
HindIII-SalI fragment containing the
respective mutated genes. pTS1601 (YEp-KRI1) isolated from
the YEp13 library contained a 10-kb insert. Subcloning experiments revealed that the 3.3-kb SacII-XbaI fragment
containing only KRI1 had the ability to suppress
krr1.
TABLE 1.
Yeast strains used in this study
Construction of temperature-sensitive krr1
mutants.
To disrupt one of the KRR1 genes of the
diploid strain W303, we first constructed plasmid pTS1017 by replacing
the 578-bp HpaI (
61)-NcoI (+518)
(ATG of the start codon of KRR1 is numbered as +1) fragment of pTS1010 with the 1.2-kb
SmaI-PvuII fragment carrying URA3.
Plasmid pTS1017 was digested with EcoRI and BamHI and introduced into strain W303 to generate strain YTS039. To change
the selective marker, we replaced URA3 with HIS3
to generate YTS040. Plasmid pTS1019 (YCp-Pga1-KRR1-URA3) was
introduced into YTS040, and Ura+ transformants were
sporulated and dissected on galactose medium. This strain YTS047
(krr1 YCp-Pgal-KRR1-URA3) showed
galactose-dependent growth. Both mutagenized PCR products of the
KRR1 ORF and the cleavage products of the plasmid pTS1010
(YCp-KRR1-TRP1) with HpaI (61) and
MluI (+1159) were cotransformed into YTS047, to clone the
mutagenized PCR products into the YCp-TRP1 plasmid by the
gap repair method. Ura+ Trp+ transformants,
which could grow on glucose medium at 25°C, were screened for those
which failed to form colonies at 37°C. Out of 3,220 colonies, 60 failed to grow at 37°C. Plasmids were isolated, and the
temperature-sensitive phenotype was confirmed by reintroducing them
into strain YTS047.
Deletion of KRI1. Plasmid pTS1620 was constructed such that HIS3 was inserted between nucleotides +312 and +758 of the KRI1 ORF. The plasmid was cut with EcoRI and ScaI, and the DNA fragment was introduced into W303 to disrupt one of the KRI1 genes. Correct disruption was confirmed by PCR. The resulting heterozygous diploid is YTS100.
Construction of a strain expressing KRI1 from the GAL1 promoter. The DNA fragment from +1 to +623 of the KRI1 ORF was cloned into pTS911IU, a YIp-type plasmid constructed by deleting the SpeI-BglII fragment of CEN4 and ARS1 from YCplac33 (7) and by inserting the GAL1 promoter to express a gene of interest in a galactose-dependent manner. The resulting plasmid (pTS1613) was cleaved at the BamHI site (+312) and integrated into the chromosomal KRI1 locus in haploid strain W303-1A to generate YTS097A. When the liquid culture of YTS097A was transferred to glucose medium to shut off expression of the KRI1 gene, growth was impaired at 20 h after the shift, judging from the optical density at 600 nm.
Construction of a strain carrying a tagged KRI1. The DNA fragment containing the C-terminal region of KRI1 (+328 to +773) was amplified by PCR. The PCR product was cloned into pTS906IL and pTS904IL. These are YIp-type plasmids constructed by deleting the SpeI-BglII fragment containing CEN4 and ARS1 from YCplac111 to fuse the 3' end of a gene of interest to codons for a double-HA tag and nine copies of a myc epitope tag, respectively. The resulting plasmids were cleaved at the unique PstI site (+758) and integrated into the chromosomal KRI1 locus to generate YTS076 and YTS077. Correct integration was confirmed by PCR and Western blot analysis. Both strains grew like wild-type strains (data not shown). Thus both tagged KRI1 genes are functional.
Indirect immunofluorescence microscopy. Indirect immunofluorescence microscopy was performed as described previously (11, 19).
Fractionation of ribosomes. Ribosomal patterns were analyzed according to the method of Baim et al. (2). Cells were grown in yeast extract-peptone-dextrose (YPD) medium to mid-log phase (optical density at 660 nm, 1.0 to 1.5) and collected. Cell lysates were prepared and centrifuged through a sucrose density gradient (7 to 47%) at 20,000 rpm for 12 h at 4°C for a polysome profile or at 24,000 rpm for 16 h at 4°C for free subunits in a Beckman SW41 rotor. Absorbance at 254 nm was measured.
Analysis of pre-rRNA processing. For pulse-chase analysis, cultured cells were concentrated in 1 ml of synthetic dextrose (SD) medium, labeled for 2 min with 100 µCi of [methyl-3H]methionine, and chased by adding cold methionine (5 mM), as described previously (10). At each time point, samples were taken, centrifuged, and frozen in liquid N2. Techniques of RNA extraction, gel electrophoresis, blotting, and exposure to X-ray films were performed as described previously (14).
Northern hybridization was performed as described previously (5). Total RNA was isolated by the hot-phenol method (9). Five micrograms of total RNA was resolved through 1.2% agarose-formaldehyde gel electrophoresis, and the RNA was transferred onto Zeta-Probe membrane (Bio-Rad). The blots were hybridized with 32P-labeled oligodeoxyribonucleotide probes overnight at 37°C in 5× SSPE (1× SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA [pH 7.7])-0.1% sodium dodecyl sulfate (SDS). The membranes were washed twice with 5× SSPE-0.1% SDS at 37°C for 15 min each and once in 1× SSPE-0.1% SDS for 15 min. Oligonucleotides were those described previously (3).Immunoprecipitation experiments. Immunoprecipitation was performed as described previously (30) with some modifications. Cells expressing KRR1 or KRR1-2HA, KRI1-9myc, and NOP1-GFP were grown to log phase and broken in extraction buffer (100 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 10% glycerol, 0.1% Triton X-100, 1 mM dithiothreitol, 50 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 1 µg of leupeptin per ml, 1 µg of antipain per ml, 1 µg of pepstatin per ml, and 2 µg of aprotinin per ml). After centrifugation (10 min; 13,000 × g), 1 ml of binding buffer (extraction buffer containing 5 mg of bovine serum albumin per ml) was added to the extracts (600 µg of proteins), followed by incubation with 100 µl of protein A-Sepharose beads (Pharmacia) for 30 min. After brief centrifugation, supernatants were further incubated with 2 µl of anti-HA antibody (16B12; Promega) for 30 min and with 100 µl of protein A-Sepharose beads for 30 min. Beads were washed twice with 1 ml each of washing buffers B50, B100, and B125 (binding buffer containing different concentrations of NaCl [indicated by numbers] in millimolar) for 10 min by end-over-end rotation. Bound proteins were eluted with SDS sample buffer and detected by immunoblotting.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Isolation of KRR1 and its temperature-sensitive mutants. TOM1 encodes a putative ubiquitin ligase (28). We isolated KRR1 by two-hybrid screening, using TOM1 as bait. KRR1 is an essential and highly conserved gene among eukaryotes (8).
To explore the functions of KRR1, we constructed temperature-sensitive mutants by PCR mutagenesis, as described in Materials and Methods. We isolated 18 temperature-sensitive krr1 mutants; all of the mutations were recessive to the wild type. Two mutants, YTS094 (krr1-17) and YTS095 (krr1-18), were selected for further analysis. Both mutants grew normally at 25°C (data not shown) but failed to grow at 35°C (Fig. 1A). Sequence analysis revealed that the krr1-17 mutant contains four point mutations, K20E, K66N, C162R, and D261A, and the krr1-18 mutant has three point mutations, F45L, L95S, and R207G.
|
RPS14A is a high-dosage suppressor of krr1. To acquire information about the functions of Krr1p, we screened high-dosage suppressors of the krr1 mutant. A yeast genomic library constructed on multicopy vector YEp13 was introduced into strain YTS095 (krr1-18). Two plasmids, pTS1501 and pTS1601, were isolated. As described in Materials and Methods, subcloning and sequencing experiments revealed that one of the multicopy suppressors was RPS14A encoding a 40S ribosomal protein (6). A high dose of RPS14A suppressed the temperature sensitivity of krr1-18 at 35°C (Fig. 1A) but not at 37°C (Fig. 1B). It did not suppress krr1-17 at 35°C (Fig. 1A) or the lethality of the krr1-null mutant (data not shown).
It has been reported that a deletion of the last amino acid in the C terminus of rpS14p confers cryptopleurine resistance (CryR) and increases rpS14p RNA-binding activity by twofold, while a deletion of 11 amino acids of the C terminus interrupts binding to 18S rRNA and its own mRNA, thereby leading to inability to assemble into the mature 40S ribosome subunit (6, 16, 18). We constructed the same kinds of mutants; one contained the CryR mutation (rpS14-CryR; Leu138stop), and the other had an 11-amino-acid truncation (rpS14-C11). A
multicopy plasmid containing rpS14-CryR
(pTS1508) suppressed krr1-18 at 35°C (Fig. 1B). However, a
multicopy plasmid carrying rpS14-C11 (pTS1506)
failed to suppress even at 35°C (Fig. 1B). These results suggest that
the fully functional rpS14p is required for the suppression of the
temperature sensitivity of the krr1-18 mutant.
The other multicopy suppressor, KRI1, is a novel essential gene. As described in Materials and Methods, subcloning experiments with pTS1601 revealed that a novel gene, KRI1 (for KRR1-interacting protein 1; YNL308c), was a multicopy suppressor of the krr1-18 mutant (Fig. 1A). It suppressed the temperature sensitivity of the krr1-17 mutant at 35°C (Fig. 1A) but failed to rescue the lethality of the krr1 disruptant (data not shown). The predicted Kri1p is a very hydrophilic protein with a molecular mass of 69 kDa and has 30.0% identical amino acids to its homologue found in Schizosaccharomyces pombe.
We disrupted one of the KRI1 genes of the wild-type diploid strain (W303) by replacing the ORF with the HIS3 marker, as described in Materials and Methods. A heterozygous diploid strain (YTS100; KRI1/kri1::HIS3) was sporulated, and the tetrads were dissected on a YPD plate (Fig. 2A). Two clones from each ascus were viable, all of which were His
. Microscopic observation revealed that cells
harboring the kri1::HIS3-null allele progressed a few cell
cycles, since several but less than 10 large budded cells were observed
(data not shown). Thus we conclude that KRI1 is essential
for cell viability.
|
Kri1p as well as Krr1p is localized to the nucleolus.
Although
a large-scale analysis of protein localization revealed that Krr1p was
localized to the nucleolus, this assay used a Krr1-
-galactosidase
fusion protein which was not confirmed to be functional (4).
Furthermore, another group reported that localization of HA-tagged
Krr1p was at the nuclear rim (20). To clarify this
discrepancy, we constructed a haploid strain (YTS029-4A) expressing an
HA-tagged Krr1p as the only source of cellular Krr1p, as described in
Materials and Methods. This strain grew normally as did wild-type cells
(data not shown), indicating that the tagged Krr1p was functional.
Indirect immunofluorescence microscopy showed that Krr1-HAp was
localized to the nucleolus, because it showed a caplike or crescent
shape and colocalized with GFP-tagged Nop1p, a nucleolar marker protein
(1, 23, 27) (Fig. 3A to C). We
conclude that Krr1p is a nucleolar protein, as previously reported (4).
|
Both KRR1 and KRI1 are required for
formation of 40S ribosome subunits.
To address whether Krr1p and
Kri1p were involved in ribosome synthesis, we examined ribosomal
profiles of those mutant lysates by sucrose density gradient
centrifugation. Cells of strain YTS055 (KRR1), YTS094
(krr1-17), or YTS095 (krr1-18) were grown to
mid-log phase at 25°C, and the cultures were incubated at 37°C for
6 h. Polysome fractions severely decreased, and free 60S ribosome
subunits accumulated in either mutant (Fig.
4A, charts b and c), compared to the wild
type (Fig. 4A, chart a).
|
The processing of pre-rRNAs for 18S rRNA is impaired in both
krr1 and kri1 mutants.
To determine
whether Krr1p and Kri1p were involved in pre-rRNA processing, we
performed pulse-chase labeling of rRNAs. Cells of YTS055
(KRR1), YTS094 (krr1-17), or YTS095
(krr1-18) were grown at 37°C for 4 h, and the newly
synthesized rRNAs were labeled with
[methyl-3H]methionine for 2 min and chased by
adding cold methionine. Neither 20S pre-rRNA nor 18S rRNA were
produced, even at the 10-min chase time point in the krr1
mutants (Fig. 5A, lanes 4 through 9). In contrast, 25S rRNA was produced in the mutants, although the appearance of 25S rRNA was slightly slower in the mutants than in the wild type
(Fig. 5A, lanes 2, 5, and 8). Consistent with this, little 27S pre-rRNA
was made during the 2-min pulse in the mutants (Fig. 5A, lanes 4 and
7), and the processing of 35S and 32S pre-rRNAs was slightly delayed,
since a small amount of 35S and 32S pre-rRNAs remained at the 5-min
chase time point (Fig. 5A, lanes 5 and 8).
|
|
Krr1p forms a complex with Kri1p.
To see a physical
interaction of Krr1p with Kri1p, immunoprecipitation experiments were
performed. We constructed strains of YTS084 expressing Krr1p and a
myc-tagged Kri1p (Kri1-mycp) and YTS085 expressing the HA-tagged Krr1p
(Krr1-HAp) and Kri1-mycp. Both tagged genes were functional, as
described in Materials and Methods. These strains were transformed with
plasmid pTS068 expressing a GFP-tagged Nop1p. The lysates were
prepared, and anti-HA antibody was added for immunoprecipitation. As
shown in Fig. 7A (lane 5), Kri1-mycp was
coimmunoprecipitated with Krr1-HAp. Furthermore, Nop1-GFPp was not
coprecipitated with Krr1-HAp.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
KRR1 encodes a protein that is evolutionarily conserved among yeast, nematode, fly, rice, and human cells (8). The novel KRI1 gene isolated as a multicopy suppressor of the temperature-sensitive krr1 mutants (Fig. 1A) also seems to be a conserved gene among eukaryotes, since there are homologues in fission yeast, nematode, and fly cells. Both genes are indispensable for cell growth (Fig. 2A) (8), and the products are localized to the nucleolus (Fig. 3). These results suggest that Krr1p and Kri1p play essential roles in nucleolar functions which are common in eukaryotes.
The present analysis of the temperature-sensitive krr1 mutants revealed that Krr1p was required for biogenesis of 40S ribosome subunits, but it was dispensable for the synthesis of 60S ribosome subunits. The same phenotype was also found in Kri1p-depleted cells. Consistent with the data of the ribosomal profiles (Fig. 4), the production of 18S rRNA and 20S pre-rRNA was considerably reduced in both krr1 and kri1 mutants in the pulse-chase and Northern blotting experiments (Fig. 5 and 6).
In mutants defective in 40S ribosomal biosynthesis such as rrp7, mpp10, fal1, rok1, imp3, and imp4 mutants, the 23S and 27SA3, as well as 35S and 32S, pre-rRNAs are accumulated (3, 5, 13, 17, 29). The 23S pre-rRNA is the cleavage product at the A3 site without cleavage at A0, A1, and A2. Likewise, the cleavage at the A2 site seems to be impaired in the Kri1p-depleted cells (Fig. 6). In contrast, both 23S (A3-B-product) and 27S (A2-product) pre-rRNAs were hybridized with the A2-A3 probe in the krr1 mutants at the permissive temperature. At the high temperature, however, the 35S and 32S pre-rRNAs were accumulated (Fig. 6). Taken together, these data suggest that the precursors for 18S rRNA are very unstable in the krr1 mutants, which is consistent with the result of pulse-chase experiment (Fig. 5).
To obtain a multicopy suppressor of the krr1 mutant, we isolated RPS14A, encoding one of the 40S ribosomal proteins (Fig. 1). The C terminus of rpS14p, which is essential for binding to 18S rRNA (6), was also required to suppress krr1. These results suggest that the primary defect of the krr1 mutant is a failure in the assembly of the 43S preribosome in the nucleolus and that an excess amount of rpS14p rescued the defect by facilitating the assembly of the 43S preribosome through its binding to the precursors of 18S rRNA. This may be similar to Rrp7p, since the depletion of Rrp7p leads to a reduction of 18S rRNA synthesis and the lethality of rrp7 deletion is suppressed by overproduction of rpS27A or B that assembles late into the pre-40S ribosomal particles (3). It has been suggested that Rrp7p is required for the correct assembly of rpS27A/Bp into pre-40S ribosomal particles.
Overexpression of KRI1 partially rescued the defect of the krr1 mutant (Fig. 1). As shown in Fig. 7, Kri1p and Krr1p form a complex, which is different from the Nop1p-containing snoRNP. Furthermore, Kri1p was poorly associated with the mutant Krr1p. These results suggest that the Krr1p-Kri1p association is crucial for their functions.
Krr1p contains a putative KH domain, a conserved RNA-binding motif, which was first found as repeated sequences in hnRNP K and then in several other proteins (25, 26). Krr1p may be bound to the precursors of 18S rRNA or snoRNAs through its KH domain to facilitate the assembly of the 43S preribosome subunit.
As well as the two-hybrid interaction between Tom1p and Krr1p, KRR1 and TOM1 interact genetically, since overexpression of KRR1 severely inhibited the growth of the tom1 mutant at permissive temperatures (T. Sasaki, A. Toh-e, and Y. Kikuchi, unpublished results). Tom1p must be involved in some nucleolar functions, because the arrested cells of the tom1 mutant exhibit nucleolar fragmentation and NPI46 encoding a nucleolar protein is a potent multicopy suppressor of the tom1 mutant (28). Furthermore, in collaboration with S. Ellis, we have recently found that ribosome biogenesis is impaired in the tom1 mutant (A. Tabb, T. Utsugi, C. Wooten, T. Sasaki, S. Edling, W. Gump, Y. Kikuchi, and S. Ellis, unpublished data).
From these results, we expected that Krr1p might be a substrate of Tom1p-ubiquitin ligase. However, we have not found any evidence that Krr1p is ubiquitinated in a Tom1p-dependent way. Further work is needed to clarify the nature of the interaction between Tom1p and the nucleolar proteins.
| |
ACKNOWLEDGMENTS |
|---|
We thank Y. Ohya for the DNA bank and S. Ellis of The University of Louisville and K. Mizuta of Hiroshima University for technical suggestions.
This work was supported by grants from the Ministry of Education, Science, Sports and Culture to Y.K.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biological Sciences, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. Phone and Fax: 81-3-5684-9420. E-mail: kikuchi{at}biol.s.u-tokyo.ac.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Aris, J. P., and G. Blobel.
1988.
Identification and characterization of a yeast nucleolar protein that is similar to a rat liver nucleolar protein.
J. Cell Biol.
107:17-31 |
| 2. |
Baim, S. B.,
D. F. Pietras,
D. C. Eustice, and F. Sherman.
1985.
A mutation allowing an mRNA secondary structure diminishes translation of Saccharomyces cerevisiae iso-1-cytochrome c.
Mol. Cell. Biol.
5:1839-1846 |
| 3. | Baudin-Baillieu, A., D. Tollervey, C. Cullin, and F. Lacroute. 1997. Functional analysis of Rrp7p, an essential yeast protein involved in pre-rRNA processing and ribosome assembly. Mol. Cell. Biol. 17:5023-5032[Abstract]. |
| 4. |
Burns, N.,
B. Grimwade,
P. B. Ross-Macdonald,
E. Y. Choi,
K. Finberg,
G. S. Roeder, and M. Snyder.
1994.
Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.
Genes Dev.
8:1087-1105 |
| 5. | Dunbar, D. A., S. Wormsley, T. M. Agentis, and S. J. Baserga. 1997. Mpp10p, a U3 small nucleolar ribonucleoprotein component required for pre-18S rRNA processing in yeast. Mol. Cell. Biol. 17:5803-5812[Abstract]. |
| 6. |
Fewell, S. W., and J. L. Woolford, Jr.
1999.
Ribosomal protein S14 of Saccharomyces cerevisiae regulates its expression by binding to RPS14B pre-mRNA and to 18S rRNA.
Mol. Cell. Biol.
19:826-834 |
| 7. | Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[CrossRef][Medline]. |
| 8. | Gromadka, R., A. Kaniak, P. P. Slonimski, and J. Rytka. 1996. A novel cross-phylum family of proteins comprises a KRR1 (YCL059c) gene which is essential for viability of Saccharomyces cerevisiae cells. Gene 171:27-32[CrossRef][Medline]. |
| 9. | Guthrie, C., and G. R. Fink. 1991. Guide to yeast genetics and molecular biology. Methods Enzymol. 194:1-863[Medline]. |
| 10. | Hong, B., J. S. Brockenbrough, P. Wu, and J. P. Aris. 1997. Nop2p is required for pre-rRNA processing and 60S ribosome subunit synthesis in yeast. Mol. Cell. Biol. 17:378-388[Abstract]. |
| 11. |
Kagami, M.,
A. Toh-e, and Y. Matsui.
1998.
Sro7p, a Saccharomyces cerevisiae counterpart of the tumor suppressor 1(2)gl protein, is related to myosins in function.
Genetics
149:1717-1727 |
| 12. | Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 13. | Kressler, D., J. de la Cruz, M. Rojo, and P. Linder. 1997. Fal1p is an essential DEAD-box protein involved in 40S-ribosomal-subunit biogenesis in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:7283-7294[Abstract]. |
| 14. |
Kressler, D.,
J. de la Cruz,
M. Rojo, and P. Linder.
1998.
Dbp6p is an essential putative ATP-dependent RNA helicase required for 60S-ribosomal-subunit assembly in Saccharomyces cerevisiae.
Mol. Cell. Biol.
18:1855-1865 |
| 15. |
Kressler, D.,
P. Linder, and J. de la Cruz.
1999.
Protein trans-acting factors involved in ribosome biogenesis in Saccharomyces cerevisiae.
Mol. Cell. Biol.
19:7897-7912 |
| 16. |
Larkin, J. C., and J. L. Woolford.
1983.
Molecular cloning and analysis of the CRY1 gene: a yeast ribosomal protein gene.
Nucleic Acids Res.
11:403-420 |
| 17. |
Lee, S. J., and S. J. Baserga.
1999.
Imp3p and Imp4p, two specific components of the U3 small nucleolar ribonucleoprotein that are essential for pre-18S rRNA processing.
Mol. Cell. Biol.
19:5441-5452 |
| 18. | Paulovich, A. G., J. R. Thompson, J. C. Larkin, Z. Li, and J. L. Woolford, Jr. 1993. Molecular genetics of cryptopleurine resistance in Saccharomyces cerevisiae: expression of a ribosomal protein gene family. Genetics 135:719-730[Abstract]. |
| 19. | Pringle, J. R., R. A. Preston, A. E. Adams, T. Stearns, D. G. Drubin, B. K. Haarer, and E. W. Jones. 1989. Fluorescence microscopy methods for yeast. Methods Enzymol. 31:357-435. |
| 20. |
Rout, M. P.,
J. D. Aitchison,
A. Suprapto,
K. Hjertaas,
Y. Zhao, and B. T. Chait.
2000.
The yeast nuclear pore complex: composition, architecture, and transport mechanism.
J. Cell Biol.
148:635-651 |
| 21. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 22. | Sasaki, T., A. Toh-e, and Y. Kikuchi. 2000. Extragenic suppressors that rescue defects in the heat stress response of the budding yeast mutant tom1. Mol. Gen. Genet. 262:940-948[CrossRef][Medline]. |
| 23. | Schimmang, T., D. Tollervey, H. Kern, R. Frank, and E. C. Hurt. 1989. A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar RNA and is essential for viability. EMBO J. 8:4015-4024[Medline]. |
| 24. |
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27 |
| 25. |
Siomi, H.,
M. J. Matunis,
W. M. Michael, and G. Dreyfuss.
1993.
The pre-mRNA binding K protein contains a novel evolutionarily conserved motif.
Nucleic Acids Res.
21:1193-1198 |
| 26. | Siomi, H., M. Choi, M. C. Siomi, R. L. Nussbaum, and G. Dreyfuss. 1994. Essential role for KH domains in RNA binding: impaired RNA binding by a mutation in the KH domain of FMR1 that causes fragile X syndrome. Cell 77:33-39[CrossRef][Medline]. |
| 27. | Tollervey, D., H. Lehtonen, M. Carmo-Fonseca, and E. C. Hurt. 1991. The small nucleolar RNP protein NOP1 (fibrillarin) is required for pre-rRNA processing in yeast. EMBO J. 10:573-583[Medline]. |
| 28. | Utsugi, T., A. Hirata, Y. Sekiguchi, T. Sasaki, A. Toh-e, and Y. Kikuchi. 1999. Yeast tom1 mutant exhibits pleiotropic defects in nuclear division, maintenance of nuclear structure and nucleocytoplasmic transport at high temperatures. Gene 234:285-295[CrossRef][Medline]. |
| 29. | Venema, J., C. Bousquet-Antonelli, J. P. Gelugne, M. Caizergues-Ferrer, and D. Tollervey. 1997. Rok1p is a putative RNA helicase required for rRNA processing. Mol. Cell. Biol. 17:3398-3407[Abstract]. |
| 30. |
Zachariae, W.,
A. Shevchenko,
P. D. Andrews,
R. Ciosk,
M. Galova,
M. J. Stark,
M. Mann, and K. Nasmyth.
1998.
Mass spectrometric analysis of the anaphase-promoting complex from yeast: identification of a subunit related to cullins.
Science
279:1216-1219 |
Molecular and Cellular Biology, November 2000, p. 7971-7979, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ida, H., Suzusho, N., Suyari, O., Yoshida, H., Ohno, K., Hirose, F., Itoh, M., Yamaguchi, M.
(2009). Genetic screening for modifiers of the DREF pathway in Drosophila melanogaster: identification and characterization of HP6 as a novel target of DREF. Nucleic Acids Res
37: 1423-1437
[Abstract] [Full Text] -
Jwa, M., Kim, J.-h., Chan, C. S.M.
(2008). Regulation of Sli15/INCENP, kinetochore, and Cdc14 phosphatase functions by the ribosome biogenesis protein Utp7. JCB
182: 1099-1111
[Abstract] [Full Text] -
Perez-Fernandez, J., Roman, A., De Las Rivas, J., Bustelo, X. R., Dosil, M.
(2007). The 90S Preribosome Is a Multimodular Structure That Is Assembled through a Hierarchical Mechanism. Mol. Cell. Biol.
27: 5414-5429
[Abstract] [Full Text] -
Isono, E., Nishihara, K., Saeki, Y., Yashiroda, H., Kamata, N., Ge, L., Ueda, T., Kikuchi, Y., Tanaka, K., Nakano, A., Toh-e, A.
(2007). The Assembly Pathway of the 19S Regulatory Particle of the Yeast 26S Proteasome. Mol. Biol. Cell
18: 569-580
[Abstract] [Full Text] -
Kim, Y.-H., Ishikawa, D., Ha, H. P., Sugiyama, M., Kaneko, Y., Harashima, S.
(2006). Chromosome XII context is important for rDNA function in yeast. Nucleic Acids Res
34: 2914-2924
[Abstract] [Full Text] -
Bachand, F., Lackner, D. H., Bahler, J., Silver, P. A.
(2006). Autoregulation of ribosome biosynthesis by a translational response in fission yeast.. Mol. Cell. Biol.
26: 1731-1742
[Abstract] [Full Text] -
Takahashi, Y., Yong-Gonzalez, V., Kikuchi, Y., Strunnikov, A.
(2006). SIZ1/SIZ2 Control of Chromosome Transmission Fidelity Is Mediated by the Sumoylation of Topoisomerase II. Genetics
172: 783-794
[Abstract] [Full Text] -
Dong, J., Lai, R., Jennings, J. L., Link, A. J., Hinnebusch, A. G.
(2005). The Novel ATP-Binding Cassette Protein ARB1 Is a Shuttling Factor That Stimulates 40S and 60S Ribosome Biogenesis. Mol. Cell. Biol.
25: 9859-9873
[Abstract] [Full Text] -
Takahashi, Y., Kikuchi, Y.
(2005). Yeast PIAS-type Ull1/Siz1 Is Composed of SUMO Ligase and Regulatory Domains. J. Biol. Chem.
280: 35822-35828
[Abstract] [Full Text] -
Xin, D.-D., Wen, J.-F., He, D., Lu, S.-Q.
(2005). Identification of a Giardia krr1 Homolog Gene and the Secondarily Anucleolate Condition of Giaridia lamblia. Mol Biol Evol
22: 391-394
[Abstract] [Full Text] -
Becht, P., Vollmeister, E., Feldbrugge, M.
(2005). Role for RNA-Binding Proteins Implicated in Pathogenic Development of Ustilago maydis. Eukaryot Cell
4: 121-133
[Abstract] [Full Text] -
Bernstein, K. A., Gallagher, J. E. G., Mitchell, B. M., Granneman, S., Baserga, S. J.
(2004). The Small-Subunit Processome Is a Ribosome Assembly Intermediate. Eukaryot Cell
3: 1619-1626
[Abstract] [Full Text] -
Dong, J., Lai, R., Nielsen, K., Fekete, C. A., Qiu, H., Hinnebusch, A. G.
(2004). The Essential ATP-binding Cassette Protein RLI1 Functions in Translation by Promoting Preinitiation Complex Assembly. J. Biol. Chem.
279: 42157-42168
[Abstract] [Full Text] -
Dez, C., Froment, C., Noaillac-Depeyre, J., Monsarrat, B., Caizergues-Ferrer, M., Henry, Y.
(2004). Npa1p, a Component of Very Early Pre-60S Ribosomal Particles, Associates with a Subset of Small Nucleolar RNPs Required for Peptidyl Transferase Center Modification. Mol. Cell. Biol.
24: 6324-6337
[Abstract] [Full Text] -
Sone, T., Saeki, Y., Toh-e, A., Yokosawa, H.
(2004). Sem1p Is a Novel Subunit of the 26 S Proteasome from Saccharomyces cerevisiae. J. Biol. Chem.
279: 28807-28816
[Abstract] [Full Text] -
VANROBAYS, E., GELUGNE, J.-P., CAIZERGUES-FERRER, M., LAFONTAINE, D. L.J.
(2004). Dim2p, a KH-domain protein required for small ribosomal subunit synthesis. RNA
10: 645-656
[Abstract] [Full Text] -
Peng, W.-T., Krogan, N. J., Richards, D. P., Greenblatt, J. F., Hughes, T. R.
(2004). ESF1 is required for 18S rRNA synthesis in Saccharomyces cerevisiae. Nucleic Acids Res
32: 1993-1999
[Abstract] [Full Text] -
FATICA, A., OEFFINGER, M., TOLLERVEY, D., BOZZONI, I.
(2003). Cic1p/Nsa3p is required for synthesis and nuclear export of 60S ribosomal subunits. RNA
9: 1431-1436
[Abstract] [Full Text] -
Miyoshi, K., Shirai, C., Mizuta, K.
(2003). Transcription of genes encoding trans-acting factors required for rRNA maturation/ribosomal subunit assembly is coordinately regulated with ribosomal protein genes and involves Rap1 in Saccharomyces cerevisiae. Nucleic Acids Res
31: 1969-1973
[Abstract] [Full Text] -
Takahashi, Y., Toh-e, A., Kikuchi, Y.
(2003). Comparative Analysis of Yeast PIAS-Type SUMO Ligases In Vivo and In Vitro. J Biochem
133: 415-422
[Abstract] [Full Text] -
Chen, W., Bucaria, J., Band, D. A., Sutton, A., Sternglanz, R.
(2003). Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis. Nucleic Acids Res
31: 690-699
[Abstract] [Full Text] -
Hirata, Y., Andoh, T., Asahara, T., Kikuchi, A.
(2003). Yeast Glycogen Synthase Kinase-3 Activates Msn2p-dependent Transcription of Stress Responsive Genes. Mol. Biol. Cell
14: 302-312
[Abstract] [Full Text] -
Morita, D., Miyoshi, K., Matsui, Y., Toh-e, A., Shinkawa, H., Miyakawa, T., Mizuta, K.
(2002). Rpf2p, an Evolutionarily Conserved Protein, Interacts with Ribosomal Protein L11 and Is Essential for the Processing of 27 SB Pre-rRNA to 25 S rRNA and the 60 S Ribosomal Subunit Assembly in Saccharomyces cerevisiae. J. Biol. Chem.
277: 28780-28786
[Abstract] [Full Text] -
Uesono, Y., Toh-e, A.
(2002). Transient Inhibition of Translation Initiation by Osmotic Stress. J. Biol. Chem.
277: 13848-13855
[Abstract] [Full Text] -
Lorkovic, Z. J., Barta, A.
(2002). Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res
30: 623-635
[Abstract] [Full Text] -
Chan, H.Y. E., Brogna, S., O'Kane, C. J.
(2001). Dribble, the Drosophila KRR1p Homologue, Is Involved in rRNA Processing. Mol. Biol. Cell
12: 1409-1419
[Abstract] [Full Text] -
Takahashi, Y., Kahyo, T., Toh-e, A., Yasuda, H., Kikuchi, Y.
(2001). Yeast Ull1/Siz1 Is a Novel SUMO1/Smt3 Ligase for Septin Components and Functions as an Adaptor between Conjugating Enzyme and Substrates. J. Biol. Chem.
276: 48973-48977
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»