Previous Article | Next Article 
Molecular and Cellular Biology, November 2000, p. 8264-8282, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Elevated Levels of Hepatocyte Nuclear Factor 3
in Mouse Hepatocytes Influence Expression of Genes Involved in Bile
Acid and Glucose Homeostasis
Francisco M.
Rausa,1
Yongjun
Tan,1
Heping
Zhou,1
Kyung W.
Yoo,1
Donna Beer
Stolz,2
Simon C.
Watkins,2
Roberta R.
Franks,1
Terry G.
Unterman,1,3 and
Robert H.
Costa1,*
Departments of Molecular Genetics, Medicine,
Physiology, and Biophysics, College of Medicine, University of
Illinois at Chicago,1 and VA West Side
Medical Center,3 Chicago, Illinois 60607-7170, and Center for Biologic Imaging, University of Pittsburgh,
Pittsburgh, Pennsylvania 152612
Received 9 March 2000/Returned for modification 2 May 2000/Accepted 12 July 2000
 |
ABSTRACT |
The winged helix transcription factor, hepatocyte nuclear
factor-3
(HNF-3
), mediates the hepatocyte-specific transcription of numerous genes important for liver function. However, the in vivo
role of HNF-3
in regulating these genes remains unknown because
homozygous null HNF3
mouse embryos die in utero prior to
liver formation. In order to examine the regulatory function of
HNF-3
, we created transgenic mice in which the
3-kb transthyretin promoter functions to increase hepatocyte expression of the rat HNF-3
protein. Postnatal transgenic mice exhibit growth retardation, depletion of hepatocyte glycogen storage, and elevated levels of bile
acids in serum. The retarded growth phenotype is likely due to a
20-fold increase in hepatic expression of insulin-like growth factor
binding protein 1 (IGFBP-1), which results in elevated levels in serum
of IGFBP-1 and limits the biological availability of IGFs required for
postnatal growth. The defects in glycogen storage and serum bile acids
coincide with diminished postnatal expression of hepatocyte genes
involved in gluconeogenesis (phosphoenolpyruvate carboxykinase and
glycogen synthase) and sinusoidal bile acid uptake (Ntcp),
respectively. These changes in gene transcription may result from the
disruptive effect of HNF-3
on the hepatic expression of the
endogenous mouse HNF-3
,-3
, -3
, and -6 transcription factors.
Furthermore, adult transgenic livers lack expression of the canalicular
phospholipid transporter, mdr2, which is consistent with ultrastructure
evidence of damage to transgenic hepatocytes and bile canaliculi. These
transgenic studies represent the first in vivo demonstration that the
HNF-3
transcriptional network regulates expression of
hepatocyte-specific genes required for bile acid and glucose
homeostasis, as well as postnatal growth.
 |
INTRODUCTION |
The liver performs essential
functions in the body by uniquely expressing both
hepatocyte-specific genes encoding plasma proteins and enzymes involved
in the detoxification and in the homeostasis of glucose, cholesterol,
and bile salts (4). Functional analysis of numerous
hepatocyte-specific promoter and enhancer regions reveals that they are
composed of multiple cis-acting DNA sequences that bind
different families of hepatocyte nuclear factors (HNF) (reviewed in
reference 4). These include the HNF-1, HNF-3, HNF-4,
CCAAT/enhancer binding protein (C/EBP), HNF-6, and fetoprotein transcription factor families (4, 29, 15, 52, 53, 57). Although none of these transcriptional regulatory proteins is entirely
liver specific, the requirement for combinatorial protein interactions
among them in order to achieve abundant transcriptional activity plays
an important role in maintaining hepatocyte-specific gene expression.
The HNF-3 proteins are members of an extensive family of transcription
factors that share homology in the winged helix DNA binding domain and
use a modified helix-turn-helix motif to bind DNA as a monomer (8,
37). To date, the winged helix family consists of over 50 members, which play important roles in the differentiation of distinct
cellular lineages in C. elegans, Drosophila, rodents, and
humans (25). The rodent HNF-3
, -3
, and -3
proteins were originally identified as factors mediating liver-specific transcription of the transthyretin (TTR) (10, 27, 28) gene, encoding a serum carrier protein of thyroxine and vitamin A, and were
later shown to regulate the expression of other genes critical for
liver function. Subsets of these hepatocyte genes include the serum
carrier proteins albumin,
-fetoprotein, and apolipoprotein AI
(21, 34, 39); the cholesterol 7
-hydroxylase (Cyp7A) enzyme involved in bile acid synthesis (9, 40, 71); and the
glucose metabolism enzymes
6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFK-2) and
glucose 6-phosphatase (G6P) (31, 33, 54). HNF-3 proteins
also recognize the insulin response elements of phosphoenolpyruvate carboxykinase (PEPCK) and insulin-like growth factor binding protein 1 (IGFBP-1) genes (66, 72) and participate in growth hormone activation of insulin-like growth factor 1 (IGF-1) (43). A
hepatoma cell line which expresses a dominant-negative HNF-3 mutant
specifically extinguished transcription of HNF-3 target genes
(68). In support of HNF-3's role in regulating the
transcription of hepatocyte-specific genes during early mouse liver
development, induction of albumin expression during hepatic
specification coincides with in vivo footprinting of the HNF-3 binding
sites in the albumin enhancer region (78). Moreover, in vivo
footprinting and nucleosome assembly studies of the
10-kb albumin
enhancer region have demonstrated that the HNF-3 proteins are involved
in organizing the nucleosome architecture of the albumin enhancer
sequences (7, 38, 60).
In the mouse embryo, HNF-3
expression initiates during gastrulation
in the node, notochord mesoderm, and floorplate neuroepithelium and in
visceral and definitive endoderm (2, 41, 56, 59). Consistent
with this expression pattern, homozygous null Hnf3
embryos die in utero because of defective formation of the node, notochord, and visceral endoderm, which are required for development of
the primitive streak during gastrulation and inductive signaling for
neurotube formation (1, 73). Tetraploid rescue of the visceral endoderm defect in Hnf3
/
embryos
restored normal primitive streak morphogenesis, but the embryos failed
to undergo proper gastrulation because they were still missing the node
and notochord and did not develop foregut and midgut endoderm
(12). This Hnf3
/
embryo defect
has thereby precluded examination of the in vivo function of HNF-3
in the regulation of its hepatocyte target genes.
To assess the role of HNF-3
in hepatocyte-specific gene regulation,
we have increased hepatocyte HNF-3
levels in transgenic mice using
the
3-kb TTR promoter region (74, 76, 77). Our studies
show that postnatal transgenic mice exhibit growth retardation, diminished liver glycogen storage, and elevated levels of bile acids in
serum. These defects are coincident with diminished postnatal expression of hepatocyte genes involved in glucose and bile acid homeostasis. Furthermore, the TTR-HNF-3
transgenic mice display increased hepatic expression of IGFBP-1, which limits the biological effects of IGFs necessary for postnatal growth. Elevated HNF-3
levels also caused diminished hepatic expression of the endogenous mouse HNF-3
, -3
, -3
, and -6 transcription factors, which may contribute to the observed changes in hepatocyte-specific gene expression. Moreover, we can state with certainty that diminished transgenic levels of HNF-3 and HNF-6 were specific because we observed
normal adult hepatic expression of the HNF-1
, HNF-4
, C/EBP
, and C/EBP
transcription factors.
 |
MATERIALS AND METHODS |
Generation of TTR-HNF-3
transgenic mice.
The TTR
minigene construct (Fig. 1A) consists of
the
3-kb TTR promoter region, the first and second TTR exons fused to
the simian virus 40 (SV40) 3'-end and poly(A) sequences (74, 76, 77). The 1.6-kb rat HNF-3
cDNA was excised with
EcoRI, blunt ended with Klenow fragment of DNA polymerase I,
and ligated into a unique StuI site located in the second
exon of the pTTR-exv3 minigene vector (Fig. 1A). The 6.0-kb
HindIII fragment containing the
3-kb TTR promoter
driving the rat HNF-3
cDNA expression was purified and then used to
generate transgenic CD-1 mice as described previously (77).
Four of the 51 CD-1 mice that were born carried the TTR-HNF-3
transgene as identified by PCR analysis of genomic DNA extracted from
mouse tails using primers described previously (74, 76, 77).
The genotypes of PCR-positive mice were verified by Southern blot
analysis using BglII digestion of genomic DNA and
hybridization with a 500-nucleotide probe generated from the 5' end of
the rat HNF-3
cDNA as depicted in Fig. 1B. Two individual founder
TTR-HNF-3
transgenic mice (T-60 and T-77) were mated with CD-1
wild-type mice to generate F1 transgenic mice, which were
used for analysis of the liver phenotype. A third transgenic mouse died
shortly after weaning and a fourth transgenic founder (T-74) was a
female possessing a mosaic transgene integration, as evidenced by the
fact that 1 of her 14 offspring was transgenic (this line was not
further analyzed).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
The 3-kb TTR promoter directs hepatic HNF-3
transgene expression. (A) Representation of the mouse 3-kb TTR
promoter-HNF-3 transgene construct. Transgenic mice were created
with the 3-kb TTR promoter region (striped box) driving expression of
the rat HNF-3 cDNA (open box), which was cloned into the TTR second
exon (solid box) that contains the SV40 polyadenylation signal
(10, 74, 76, 77). (B) Southern blot analysis of wild-type
(WT) and transgenic liver DNA. Genomic DNA was prepared from P8, P17,
P24, and adult transgenic (T-60 and T-77) and wild-type mouse livers,
digested with BglII, and then analyzed by Southern blots
using the 5' BglII rat HNF-3 cDNA probe (see panel A).
Indicated are the positions of hybridizing BglII bands from
wild-type and transgenic (TG) loci and a band resulting from partial
digestion (*). (C) Analysis of HNF-3 transgene expression in mouse
liver. Total liver RNA was isolated from either P17 (lanes 1 to 4) or
adult (lanes 5 to 10) liver and used for RNase protection assays with
the TTR-SV40 transgene antisense-labeled RNA probe (see Materials and
Methods). As reported previously, RNase protection of the HNF-3
transgene produces a 310-nucleotide product (TG), whereas RNase
protection of the endogenous mouse TTR second exon yields a
90-nucleotide band (74, 76, 77). (D) Analysis of rat
HNF-3 transgene expression in mouse liver. Total liver RNA from
either P17 (lanes 1 to 3) or adult mouse (lanes 4 to 8) liver was used
for RNase protection assays of the rat HNF-3 antisense-labeled RNA
probes. Note that hepatic mRNA levels of the HNF-3 transgene in the
T-60 transgenic line displays a 50% reduction from P17 to adult mice,
whereas its expression displays a twofold increase in the T-77 line
during the same time period. (E) Increased hepatic HNF-3 protein
levels in the T-77 transgenic mouse line. HNF-3 protein expression
was analyzed in liver protein extracts from either wild-type or T-77
transgenic (5-week-old) mice by Western blot analysis using an
affinity-purified HNF-3 antibody (see Materials and Methods).
|
|
Immunohistochemical staining and PAS-glycogen staining of
paraffin-embedded liver sections.
Livers were dissected from
wild-type or transgenic embryos, postnatal mice, or adult mice, fixed
in 4% paraformaldehyde in phosphate-buffered saline (PBS) at 4°C
overnight, dehydrated, and embedded in paraffin. A microtome was used
to make serial 7-µm sections of liver, which were collected on
Superfrost Plus slides (Fisher), dried on a 40°C slide warmer
overnight, and processed for immunohistochemistry using the
microwave-based antigen retrieval method as described previously
(77, 79). The sections were blocked with 3% normal serum
and incubated with primary antibody diluted in 1% normal serum in
Tris-buffered saline (TBS) overnight at 4°C (HNF-3
monoclonal
antibody [4C7] was obtained from the University of Iowa Developmental
Studies Hybridoma Bank; 1:4 dilution). Sections were then washed in TBS
three times and incubated with secondary antibody diluted in 1% normal
serum in TBS for 1 h at room temperature. Primary antibodies were
detected using secondary anti-mouse immunoglobulin G coupled with
horseradish peroxidase staining using the appropriate substrates
(Vector Labs). Paraffin-embedded liver sections from postnatal
wild-type and transgenic (T60 and T77) mice were stained for glycogen
using the periodic acid-Schiff (PAS) reaction as described by Frederiks
et al. (14).
HNF-6 antibody, EMSA, and Western blot.
For the generation
of an HNF-6 specific antibody, HNF-6 N-terminal sequences (amino acids
1 to 289) were fused to the glutathione S-transferase (GST)
protein. Recombinant HNF-6 protein was isolated from bacterial
cultures, purified to homogeneity via glutathione affinity
chromatography (44), and used to immunize rabbits (rabbit immunization with GST-HNF-6 antigen was performed by the Biological Research Laboratory at the University of Illinois at Chicago [UIC]). Electrophoretic mobility shift assay (EMSA) with liver nuclear extracts
and a high-affinity HNF-6 DNA binding site (derived from the HNF-3
promoter) was used to assess the specificity of the HNF-6 antibody by
altering or supershifting the migration of the HNF-6 protein-DNA
complex (50, 57). The supershift assay involved a
preincubation step of liver nuclear protein extracts with either preimmune or HNF-6 rabbit antiserum (0.5 or 1 µl) for 45 min at room
temperature prior to the EMSA binding reaction with the HNF-6 DNA
binding site as described previously (50, 52, 57). We also
included a blocking control which involved the addition of the
GST-HNF-6 fusion protein (antigen) during the preincubation step.
Recombinant GST protein was used to remove GST-specific antibodies and
GST-HNF-6 fusion protein was used to affinity purify the HNF-6
antibody following protocols described previously (77). For
Western blot analysis using the HNF-6 antibody, total liver protein
extract was isolated from either wild-type or T-77 transgenic mice (5 weeks old) using a polytron homogenizer following the protocol
described by Tsutsui et al. (65). A portion (200 µg) of
total liver protein was subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and then analyzed by
Western blotting with either affinity-purified HNF-6 or HNF-3
antiserum (50, 57) using the ECL Plus Western blot detection reagents as described by the manufacturer (Amersham Pharmacia Biotech).
Serum preparation and analysis.
Mice were anesthetized with
methoxyflurane (Metofane; Schering-Plough Animal Health Corp., Union,
N.J.), and a syringe was used to draw blood from the beating mouse
heart through the atrium. Serum was generated from the blood following
coagulation at 37°C for 30 min and at 4°C overnight, and
precipitate was removed by centrifugation. The determination of the
levels in serum of all bile acids, IGF-1, glucagon, and insulin and the
levels in serum of postnatal day 8 (P8), P17, and adult wild-type,
T-60, and T-77 mice were determined by Ani Lytics, Inc., Gaithersburg,
Md. The serum measurements for eight wild-type and eight adult T-77
mice were also determined by the Biological Research Laboratory at UIC.
Western IGF-1 ligand blotting and immunoprecipitation of serum
IGF binding proteins.
Serum (2 µl) from 5-week-old T-77
transgenic or wild-type mice was loaded for nonreducing SDS-PAGE onto a
4 to 20% gradient gel and then transferred to nitrocellulose for
Western blot analysis with IGF-1 ligand. Membranes were blocked, probed
with [125I]IGF-I and IGFBPs were detected by
autoradiography, as previously reported (67). To examine
levels in serum of immunoreactive IGFBP-1, specific antibodies for
rodent IGFBP-1 (67) were adsorbed onto Pansorbin beads prior
to incubation with serum (10 µl) from T-77 and wild-type mice. Bound
proteins were eluted by heating with 1× nonreducing Laemmli sample
buffer for 10 min at 100°C and then loaded for SDS-PAGE and Western
ligand blotting as described above.
Light and transmission electron microscopy.
Mouse livers
were perfusion fixed through the heart with 2.5% glutaraldehyde in
PBS. The livers were removed and immersed in the same fixative for 2 additional days at 4°C. Several 1-mm3 cubes were removed
from the liver, washed three times in PBS, and then postfixed in
aqueous 1% OsO4-1% K3Fe(CN)6 for
1 h. Following three PBS washes, the pellet was dehydrated through
a graded series of 30 to 100% ethanol-100% propylene oxide and then
infiltrated in a 1:1 mixture of propylene oxide-Polybed 812 epoxy resin
(Polysciences, Warrington, Pa.) for 1 h. After several changes of
100% resin over 24 h, the pellet was embedded in molds and cured
at 37°C overnight, followed by additional hardening at 65°C for two
more days. Ultrathin (60-nm) sections were collected on 200-mesh copper grids and stained with 2% uranyl acetate in 50% methanol for 10 min,
followed by 1% lead citrate for 7 min. Sections were photographed using a JEOL JEM 1210 transmission electron microscope (JEOL, Peabody,
Mass.) at 80 or 60 kV onto electron microscope-film (ESTAR thick base;
Kodak, Rochester, N.Y.) and printed onto photographic paper. Thick
sections (300 nm) were heated onto glass slides and stained with
filtered 0.5% aqueous toluidine blue. Digital images of thick sections
were acquired on a Nikon Microphot-FXL microscope equipped with a Sony
3CCD color video camera. Electron micrographs were digitized on a
flatbed scanner at 400 pixels/in. (StudioStar; Agfa). Digitized images
were assembled into montages using Adobe Photoshop 5.0.
RNA extraction and RNase One protection assay.
Total RNA was
extracted from mouse liver by an acid
guanidium-thiocyanate-phenol-chloroform extraction method using
RNA-STAT-60 (Tel-Test B, Inc., Friendswood, Tex.). RNase protection
assay was performed with [
-32P]UTP-labeled antisense
RNA synthesized from plasmid templates with the appropriate RNA
polymerase as previously described (10, 77). Quantitation of
expression levels was done with scanned X-ray films using the BioMax 1D
program (Kodak).
Synthesis of antisense TTR transgene, rat HNF-3

, and rat C/EBP

probes was as described previously (
50,
74,
76,
77).
T7 RNA
polymerase was used to synthesize the mouse HNF-3

(accession
no.
X74938; bp 1354 to 1584), mouse HNF-3

(accession no.
X74937;
bp 1337 to 1668), and mouse HNF-3

(accession no.
X74936; bp
1 to 150) probes
using
EcoRI-digested pBluescript (pBS) templates.
SP6 RNA
polymerase was used to synthesize the mouse HNF-6

probe
(accession
no.
U95945; bp 1432 to 1603) using
PvuII-digested
pGEM2
template. T7 RNA polymerase was used to synthesize the mouse
HNF-1

probe (accession no.
M57966; bp 383 to 769) using
BamHI-digested
pCRII template. SP6 RNA polymerase was used
to synthesize the
rat C/EBP

probe (accession no. NM_012524) using
PvuII-digested
pGEM-1 template. T3 RNA polymerase was used
to synthesize the
Rat HNF-4

probe (accession no.
X57133; a gift from
F. Sladek)
using
XhoI-digested pBS template. T3 RNA
polymerase was used to
synthesize the sister of rat P-glycoprotein
(SPGP) probe (a gift
from R. Green) using
StyI-digested pBS
template. SP6 RNA polymerase
was used to synthesize the rat cholesterol
7

-hydroxylase (Cyp7A)
probe (a gift from J. Y. Chiang) using
EcoRI-digested pGEM-1
template.
The following RNase protection probes were isolated by reverse
transcription-PCR of adult mouse liver RNA (primer sequences
are
written in the 5'-to-3' direction) and cloned into the pBS
template,
and antisense RNA probes were synthesized with either
T7 RNA polymerase
using
NotI-digested template or T3 RNA polymerase
using
XhoI-digested template. T7 RNA polymerase was used to
synthesize
the canalicular multispecific organic anion transporter
probe
(cMoat: GACGGATAGCCTCATTCAGACG and
AACTGTGTATCTGTGCCCCTATGAC),
the organic anion-transporting
polypeptide probe (Oatp: CGCATAACTCCTCAGGATGCTC
and
TGGTAAGGATGCTTCTCAGAGACC), the Na
+-taurocholate
cotransporting polypeptide probe (Ntcp; TGGAGTTCAGCAAGATCAAGGC
and GGAGCAGGTGGTCATCACAATG), the glycogen
phosphorylase probe
(GP; CAATGTGGAGATGGCAGAGGAAG and
ATGATGTCTTTGAAGAGGTCTGGC), the
glycogen synthase probe (GS;
GGGGAAGACAGTGAGCGTTATG and
TCAAGAGTCTGGAGTGGGGTTCAG),
and the G6P probe (G6P;
TACCAAGGGAGGAAGGATGGAG and
AAGACGAGGTTGAACCAGTCTCCG).
T3 RNA polymerase was used to
synthesize the glucokinase probe
(GK; ACTTGAGGCAGCTATGTGCAGG
and GCTGTCTCCAGAATCTGTGTACTG), the
phosphoenolpyruvate
carboxykinase probe (PEPCK; GCTGTGCCAGCCAGAGTATATTCAC
and
AATGATGACCGTCTTGCTTTCG), the PFK-2 probe
(GTTGCGGTTTTTGATGCCAC
and
TCCTCATCCAAAGGTTGGTAGTTG), and the IGFBP-1 probe
(GATCGCCGACCTCAAGAAATG
and
ATGGGTAGACACACCAGCAGAGTC) using
HindIII-digested pBS template
and the IGFBP-3 probe
(CCAACCTGCTCCAGGAAACATC and
ACCGTATTCTGTCTCCCGCTTAG)
and the IGF-1 probe
(CGTCTTCACACCTCTTCTACCTGG and
ATGTGGCATTTTCTGCTCCGTGGG)
using
EcoNI-digested
pBS template. Finally, SP-6 RNA polymerase
was used to synthesize the
multidrug resistance 2P-glycoprotein
probe (mdr2;
GCGGAATTCAGGCTGTGGTTTCCCCAGG and
GCGGGATCCCCTGATGCTGCCTAGTTCAAA)
using
EcoRI-digested pGEM-1
template.
Methylation interference footprinting of the IGFBP-1 promoter
sequence with recombinant HNF-3
protein.
A double-stranded
oligonucleotide containing
85 through
122 bp upstream from the
transcription start site of the rat IGFBP-1 promoter was cloned into
the MluI site of the pGL2 polylinker by blunt-end ligation
(66). The polylinker was cut with HindIII, then treated with alkaline phosphatase, and finally cut again with
SmaI and gel purified. The probe was labeled by end labeling with either T4 polynucleotide kinase in the presence of
[
-32P]ATP or (exo-)Klenow in the presence of
[
-32P]dATP. The labeled probe was partially methylated
with DMS (57); then 25 fmol was incubated with 500 ng of
bacterially expressed GST-HNF-3
(44). Free and bound
probes were separated by nondenaturing 6% PAGE and then excised,
eluted, and purified with ELUTIPs as described by the manufacturer
(Schleicher & Schuell). Probes were ethanol precipitated in the
presence of 25 µg of tRNA per ml and redissolved in sodium
phosphate-EDTA buffer. The amounts of counts and tRNA in the free and
bound probes were equalized. G and A residues were cleaved under
alkaline conditions (probes were heated to 90°C for 15 min, cooled,
and then heated again following the addition of NaOH). Cleavage
products were precipitated with ethanol and sodium acetate and then
redissolved and loaded for electrophoresis on an 8% polyacrylamide
sequencing gel.
 |
RESULTS |
Hepatocyte expression of the HNF-3
transgene in T-60 and T-77
mouse lines.
In order to examine the role of HNF-3
in liver
function, we created transgenic CD-1 mice in which the
3-kb TTR
promoter region was used to increase hepatocyte expression of the rat
HNF-3
cDNA (74, 76, 77; Fig. 1A). Tail DNA from
potential transgenic mice was screened for the presence of the TTR
minigene by PCR analysis, and two transgenic CD-1 mouse lines (T-60 and
T-77) were established for further characterization (data not shown). A
5' HNF-3
cDNA probe was used to hybridize Southern blots containing size-fractionated BglII-digested genomic DNA prepared from
either postnatal or adult transgenic mouse liver (Fig. 1A). Transgenic mouse genomic DNA from all stages of postnatal liver development possessed two hybridizing BglII bands: one corresponded to
the endogenous mouse HNF-3
gene, and the other corresponded to an internal transgene fragment which is common to both mouse lines (Fig.
1B). To determine expression levels of the rat HNF-3
transgene during postnatal liver development, we performed RNase protection assays using total liver RNA with either the TTR transgene or the rat
HNF-3
probes (see Materials and Methods). While the T-77 livers
displayed a twofold increase in hepatic mRNA levels of the HNF-3
transgene from P17 to 6 weeks old, the T-60 line exhibited a 50%
decline in hepatic transgene expression during the same postnatal
period (Fig. 1C and D). To measure hepatic HNF-3
protein levels,
liver protein extracts were prepared from either wild-type or T-77
transgenic mice (5 weeks old) and then used for Western blot analysis
with affinity-purified polyclonal HNF-3
antibody (50).
The Western blot demonstrates that the T-77 liver protein extracts
displayed a fivefold increase in hepatic HNF-3
protein levels
compared to wild-type liver extracts (Fig. 1E).
To further determine the HNF-3

protein levels in developing
transgenic hepatocytes, an HNF-3

monoclonal antibody was used
for
immunohistochemical staining of paraffin-embedded liver sections
prepared from either wild-type or transgenic (T-60 and T-77) mice.
Embryonic day 17.5 (E17.5) and P8 transgenic mouse livers (T-60
and
T-77) exhibited similar increases in levels of HNF-3

protein
in
hepatocytes (Fig.
2B, C, E, and F)
compared to endogenous HNF-3
expression in wild-type livers (Fig.
2A
and D). However, P17 livers
from T-60 transgenic mice displayed a
reduction in the number
of hepatocytes expressing abundant levels of
HNF-3

protein (Fig.
2H), which continues in older T-60 transgenic
liver (Fig.
2K,
arrows). By contrast, T-77 hepatocytes continued to
abundantly
express the HNF-3

transgene protein (Fig.
2I and L)
compared
to wild-type liver (Fig.
2G and J). Southern blot analysis of
T-60 liver DNA from postnatal and adult transgenic mice showed
that
postnatal decline in transgene expression was not due to
genomic
rearrangement of the transgene (Fig.
1B). One possible
explanation for
the loss of T-60 transgene expression is that
it has integrated into a
chromosomal locus which is transcriptionally
repressed in postnatal
hepatocytes.

View larger version (155K):
[in this window]
[in a new window]
|
FIG. 2.
Transgenic hepatocytes display an increase in HNF-3
protein expression. To determine HNF-3 protein expression, paraffin
sections of wild-type (WT; A, D, G, and J) or transgenic (T-60 [B, E,
H, and K] and T-77 [C, F, I, and L]) mouse liver were prepared from
E17.5 embryos (A to C) or P8 (D to F), P17 (G to I), or P30 (J to L)
mice and used for immunohistochemical staining with a monoclonal
HNF-3 antibody (The University of Iowa Developmental Studies
Hybridoma Bank). Hepatocyte expression of HNF-3 protein is more
abundant in E17.5 (B and C) and P8 (E and F) transgenic liver than in
wild-type liver (A and D). Continued abundant expression of HNF-3
protein in PI7 (I) and P30 (L) hepatocytes of the T-77 transgenic mice
compared to wild-type liver (G and J) was seen. In T-60 transgenic
mice, the number of hepatocytes displaying abundant expression of
HNF-3 protein (indicated by arrows) diminishes by P17 (H) and is
greatly reduced in P30 (K) liver.
|
|
Postnatal reduction in TTR-HNF-3
transgenic mouse size
correlates with increase in hepatic IGFBP-1 expression.
We noted
that, during the breeding process, both TTR-HNF-3
transgenic mouse
lines weighed 50% less than their wild-type littermates by P10 and
that this difference in body weight was more pronounced in the P30 mice
of both transgenic lines (Fig. 3A and B).
We were able to determine that this defect in postnatal growth is not due to hypoglycemia because comparable glucose levels were observed in
the serum of postnatal transgenic and wild-type mice (Table 1). RNase protection assays were used to
determine if there was an alteration in the hepatic expression of
HNF-3
target genes that are required for postnatal growth. These
include the growth hormone-regulated IGF-1A gene (3, 43, 49)
and the gene encoding IGFBP-1, which limits the biological activity of
serum IGFs (16, 51, 66). RNase protection assays
demonstrated that postnatal T-60 and T-77 transgenic livers exhibited
significant reductions in IGF-1A mRNA levels compared to wild-type
livers (Fig. 3C). Consistent with reduced levels of the HNF-3
transgene protein in the adult T-60 liver, IGF-1A expression is normal, whereas in the adult T-77 line its hepatic mRNA levels remain diminished (Fig. 3D). Despite this reduction in the postnatal hepatic
expression of IGF-1A, T-77 mice exhibited normal IGF-1 levels in serum
compared to their P17 wild-type littermates (Table 1). This result
suggests that the dramatic reduction in transgenic mouse size is
unlikely due to diminished hepatic expression of IGF-1A. In P17
transgenic livers, we found an approximately 20-fold increase in the
hepatic expression of IGFBP-1 (Fig. 3C), and this increase became less
pronounced in adult transgenic mice (Fig. 3D). In contrast, the
transgenic mice exhibited normal hepatic mRNA levels of another IGF
carrier protein, IGFBP-3 (data not shown). Western blotting of serum
followed by ligand binding with radioactively labeled IGF-1 protein
reveals that the levels of 32-kDa IGF binding proteins are increased in
serum from 5-week-old T-77 transgenic compared to wild-type mice, while
the levels of 45- to 50-kDa and 24-kDa IGFBPs (corresponding to IGFBP-3
and -4, respectively) are similar in transgenic and wild-type mice (Fig. 3E, Neat panel). To determine whether this increase in 32-kDa IGFBPs reflects a change in the circulating levels of IGFBP-1, the
IGFBP-1 protein was immune precipitated from either T-77 or wild-type
mouse serum and then Western blots were analyzed for IGF-1 ligand
binding (see Materials and Methods). Immunoreactive IGFBP-1 is readily
detected in serum from T-77 transgenic but not wild-type mice,
demonstrating that circulating levels of IGFBP-1 are markedly increased
in the T-77 transgenic mouse line. The retarded growth of the
TTR-HNF-3
transgenic mice is thus consistent with transgenic mouse
studies demonstrating that increased hepatic expression of IGFBP-1
causes significant reductions in postnatal growth (16, 51).
Methylation interference footprinting of the IGFBP-1 insulin response
element (IRE) with recombinant HNF-3
protein demonstrates that this
promoter sequence specifically binds the HNF-3
protein (Fig. 3F).
Previous cotransfection studies demonstrated that HNF-3
protein is
capable of stimulating IGFBP-1 promoter activity and that this
transcriptional activation required retention of the HNF-3 binding
sequence (66). Taken together, these studies are consistent
with documentation regarding the ability of HNF-3
to stimulate
transcription of the IGFBP-1 gene in vivo.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 3.
Reduction in postnatal growth of TTR-HNF-3
transgenic mice coincides with increased liver expression of IGFBP-1.
(A) Transgenic mice are retarded in postnatal growth. Shown graphically
are the mean weights (n = 3, ± the standard error) of
wild-type (WT) and transgenic (T-60 and T-77) mice at the indicated
postnatal days (P2, P10, P20, and P30). (B) Photograph of P5 transgenic
mouse (T-60) and wild-type littermate showing the reduction in
transgenic mouse size. (C) Postnatal transgenic livers exhibit
increased levels of IGFBP-1 mRNA expression. Total RNA was prepared
from postnatal wild-type and transgenic mouse livers, and RNase
protection assays were used to analyze for expression of IGF-1A,
IGFBP-1, and cyclophilin. A cyclophilin RNase-protected band was used
as a normalization internal control, and representative RNase
protection assays displaying increased levels of IGFBP-1 mRNA and
diminished expression of IGF-1A in postnatal transgenic livers compared
to wild-type livers are shown. (D) Adult transgenic livers exhibit
increased levels of IGFBP-1 mRNA expression. Shown are representative
RNase protection assays from two distinct mice showing that postnatal
transgenic livers express increased IGFBP-1 mRNA levels compared to
wild-type livers. (E) Increased IGFBP-1 levels in T-77 transgenic line
serum using Western ligand blotting and immunoprecipitation of IGFBP-1.
Ligand blotting of circulating IGFBPs in 5-week-old wild-type and T-77
transgenic (Tg) mice (Neat labeled panel). IGFBPs in serum from
wild-type and transgenic mice were separated by 4 to 20% nonreducing
SDS-PAGE and then transferred to nitrocellulose and probed with
[125I]IGF-I prior to autoradiography at 70°C with
enhancing screens. Immunoprecipitation of circulating IGFBP-1
(anti-BP-1 panel). Serum from wild-type and transgenic mice was
incubated with specific anti-IGFBP-1 antibodies bound to Pansorbin
beads. Bound proteins were eluted with Laemmli sample buffer and then
loaded for SDS-PAGE and ligand blotting. Small amounts of 45-kDa
IGFBP-3 bound nonspecifically to Pansorbin beads (67) and
were detected in precipitates from both transgenic and wild-type sera.
(F) Recombinant HNF-3 protein specifically binds to the insulin
response element of the IGFBP-1 promoter. Methylation interference
experiment demonstrates that methylation of the indicated G or A
residues (arrows) of the IGFBP-1 promoter sequence at from 112 to
86 bp prevents binding of the recombinant HNF-3 protein.
|
|
T-77 line exhibits diminished hepatocyte expression of the
endogenous mouse HNF-3 isoforms and HNF-6.
We next examined the
possibility that observed changes in T-77 liver gene expression were
mediated by altered expression of other liver transcription factors. To
avoid cross-hybridization with the rat HNF-3
transgene, we used
antisense RNA probes made to the divergent untranslated portion of the
mouse HNF-3
, HNF-3
, and HNF-3
genes for RNase protection
assays (Fig. 4). To our surprise, P8
livers from both transgenic lines exhibited diminished expression of
the endogenous mouse HNF-3
, HNF-3
, HNF-3
, and HNF-6
transcription factors when normalized to cyclophilin mRNA levels (Fig.
4A). Postnatal or adult livers of the T-77 transgenic line continued to
display significant decreases in the expression of the HNF-3 and HNF-6
transcription factors and yet normal adult levels of HNF-4
,
HNF-1
, C/EBP
, and C/EBP
(Fig. 4B). We next generated a
polyclonal antibody specific to the mouse HNF-6 protein, which
allowed us to determine HNF-6 protein expression in the T-77 transgenic
liver (see Materials and Methods). The specificity of the HNF-6
antibody was confirmed by its ability to alter the migration of the
liver derived HNF-6 protein-DNA complex (supershift) in EMSA (Fig. 4C,
lanes 3 and 4, indicated by arrows); this supershifted complex is not
observed in preimmune serum (Fig. 4C, lane 2), and its formation is
inhibited by the addition of the GST-HNF-6 fusion protein (antigen;
Fig. 4C, lane 5). To measure hepatic HNF-6 protein levels, liver
protein extracts were prepared from either wild-type or T-77 transgenic
mice (5 weeks old) and used for Western blot analysis with
affinity-purified HNF-6 antibody (Fig. 4D). The Western blot
demonstrated that HNF-6 protein was not detectable in T-77 liver
extracts (Fig. 4D, lanes 3 and 4) compared to wild-type liver protein
(Fig. 4D, lanes 1 and 2), confirming reduction of hepatic HNF-6 protein
levels in transgenic liver. These results suggest that reduced
transcription of a subset of HNF-3 and HNF-6 target genes may
contribute to the T-77 liver phenotype. By P17, the T-60 line has lost
abundant hepatic expression of the HNF-3
transgene protein and
hepatic expression levels of HNF-6 and HNF-3 recover (Fig. 4E and
data not shown). These studies demonstrate that the T-77 transgenic
liver expresses primarily the HNF-3
isoform, in contrast to
normal hepatocyte expression of three HNF-3 isoforms, and exhibits
significant reductions in HNF-6 levels.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
T-77 transgenic liver exhibits reduced hepatic
expression of HNF-3 isoforms and HNF-6. Total RNA was prepared from
either P8, P17, or 6-week-old adult wild-type (WT) and transgenic mouse
livers, and RNase protection assays were used to analyze for expression
of rat HNF-3 , HNF-4 , C/EBP , and C/EBP and mouse
HNF-3 , HNF-3 , HNF-3 , HNF-6, HNF-1 , and
cyclophilin. To perform this RNase protection analysis, we used
antisense RNA probes made to the untranslated portion of the mouse
HNF-3 , HNF-3 , and HNF-3 genes which would not
cross-hybridize with the rat HNF-3 transgene. Shown are
representative RNase protection assays performed on at least two
wild-type and T-77 livers each from either P8 (A) or P17 and adult
(6-week-old) mice (B). Panel A also shows the RNase protection assay
for a single P8 liver from a T-60 mouse. The numbers below panels
reflect the fold induction of transgenic liver mRNA levels compared to
wild-type liver following normalization to the cyclophilin signal. (A
and B) T-77 transgenic liver displays reduced mRNA levels of
HNF-3 , HNF-3 , HNF-3 , and HNF-6 but normal levels
of C/EBP , C/EBP , HNF-4 , and HNF-1 . P8 liver from the T-60
line shows similar decreases in mRNA levels of the HNF-3 and HNF-6
transcription factors. (C) HNF-6 antibody alters the migration of the
HNF-6 protein-DNA complex. To examine specificity of the HNF-6
antibody, liver nuclear extracts were preincubated with buffer (lane
1), preimmune serum (lane 2), or 0.5 µl (lane 3) or 1 µl (lane 4)
of HNF-6 antiserum and used for EMSA with the high-affinity HNF-6 DNA
binding site (see Materials and Methods). The HNF-6 antibody altered or
supershifted the migration of the hepatic HNF-6 protein-DNA complex
(position indicated by arrow), and the supershifted complex formation
was competed by inclusion of the GST-HNF-6 fusion protein in the
preincubation step (lane 5). (D) HNF-6 protein expression is
significantly decreased in T-77 transgenic mouse liver. HNF-6 protein
expression was analyzed in liver protein extracts from either wild-type
(lanes 1 and 2) or T-77 transgenic (lanes 3 and 4) mice by Western blot
analysis using an affinity-purified HNF-6 antibody (see Materials and
Methods). HNF-6 protein was not detectable in T-77 liver extracts
compared to wild-type liver extracts. (Note that identical extracts
were used for the HNF-3 Western blot in panel E.) (E) Normal
hepatic levels of HNF-3 and HNF-6 in P17 and adult T-60 mice. RNase
protection assay with P17 or 6-week-old mouse liver RNA from the T-60
line displays normal endogenous mouse expression of HNF-6 and
HNF-3 transcription factors, which is consistent with diminished
levels of HNF-3 transgene protein. The TTR band is used to
normalize signals.
|
|
Diminished hepatocyte glycogen storage in TTR-HNF-3
transgenic mouse livers.
We next examined the possibility that
transgenic mice were deficient in hepatocyte glycogen storage. Livers
from postnatal wild-type and transgenic (T60 and T77) mice were stained
for glycogen using the PAS reaction (glycogen is stained magenta)
(14). Although the transgenic mouse livers possessed normal
glycogen stores immediately postpartum (Fig. 5A to
C), by P8 diminished hepatocyte glycogen levels were observed (Fig. 5D to F). By P17, however, the T-60 mice
regained their ability to store hepatic glycogen (Fig. 5G and H), which
occurs concomitant with the reduction in HNF-3
transgene protein
expression (Fig. 2H). Postnatal T-77 transgenic livers continued to
exhibit reduced hepatic glycogen levels compared to age-matched
wild-type littermates or T-60 transgenic mice (Fig. 5G to L).

View larger version (164K):
[in this window]
[in a new window]
|
FIG. 5.
Diminished hepatic glycogen storage in postnatal
TTR-HNF-3 transgenic mice. Liver sections from wild-type (WT)
and transgenic (T-60 and T-77) mice at P1 (A to C), P8 (D to F), P17 (G
to I), P30 (J to K), or P28 (L) were stained with PAS (14)
reagent to determine the hepatocyte glycogen content (stains magenta).
(A to C) Transgenic and wild-type P1 livers store normal levels of
glycogen. (D and E) Diminished hepatic glycogen storage in P8
transgenic liver. (G to I) Reduced hepatic glycogen storage in P17
transgenic liver of the T-77 but not the T-60 line, the latter of which
correlates with a decline in HNF-3 transgene protein expression
(Fig. 2). (J to L) Continued depletion of hepatic glycogen levels in
P30 transgenic livers of the T-77 line.
|
|
Because serum insulin and glucagon levels are normal in the
TTR-HNF-3

transgenic mouse lines (Table
2), we hypothesize that
hepatic glycogen
depletion is due to altered expression of genes
involved in glucose
homeostasis. Indeed, P8 mice from both transgenic
lines exhibited a
reduction in hepatic expression of the HNF-3
target gene enzyme
PEPCK (Fig.
6A) (
72). PEPCK is
the rate-limiting
enzyme involved in gluconeogenesis, and its decreased
levels are
consistent with hepatocyte glycogen depletion
(
20). Furthermore,
we observed a 50% decline in hepatic
levels of glycogen synthase
mRNA, which is also consistent with a
reduction in hepatocyte
glycogen storage. Interestingly, postnatal
livers from both transgenic
lines exhibited an increase in expression
of the glucokinase gene,
which remained elevated in P17 livers of the
T-77 line (Fig.
6A
and B). In P8 transgenic mice, we also observed a
transient decrease
in hepatic expression of the glycogen phosphorylase
gene, which
encodes the enzyme involved in glycogen mobilization.
Normal hepatic
expression of G6P was observed in all of the transgenic
lines
except in adult T-60 liver (Fig.
6). We observed elevated hepatic
expression of the HNF-3-HNF-6 target gene enzyme PFK-2 (
31,
32) in P8 and adult T-77 mice. Both P17 and adult T-77 liver
continued to express reduced levels of PEPCK and glycogen synthase
(GS)
whereas its expression was restored in adult livers of T-60
mice which
no longer expressed the
HNF-3
transgene (Fig.
6B and
C). This analysis suggests that hepatic expression of GS, PEPCK,
and
PFK-2 is altered in the T-77 line and that these changes are
likely to
contribute to the glycogen storage defects.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 6.
Hepatocyte glycogen storage defect in T-77 transgenic
livers coincides with reduced expression of the gluconeogenic enzyme
PEPCK. (A) Postnatal T-77 transgenic liver exhibits reduced expression
of glucose homeostasis genes. Total RNA was prepared from wild-type
(WT) and transgenic mouse liver (P8, P17, and 6-week-old adults), and
RNase protection assays were used to analyze the expression of the
gluconeogenic PEPCK and G6P, glucokinase (GK), PFK-2, glycogen
phosphorylase (GP), glycogen synthase (GS), and cyclophilin. A
cyclophilin RNase-protected band was used as a normalization internal
control. Indicated below each panel is the normalized fold induction of
transgenic liver expression compared to wild-type liver. Shown are
representative RNase protection assays using two distinct transgenic or
wild-type livers. (A) P8 transgenic livers from either the T-60 or T-77
transgenic line express diminished mRNA levels of GS and PEPCK and
exhibit elevated levels of glucokinase and PFK-2 mRNA. (B) Diminished
GS and PEPCK and elevated glucokinase mRNA levels continue in P17
transgenic liver from the T-77 line. (C) Diminished GS and PEPCK and
elevated PFK-2 mRNA levels continues in adult transgenic liver from the
T-77 line.
|
|
Elevated levels of bile acids and liver enzymes in serum in T-77
transgenic mice.
In order to examine whether the HNF-3
transgene is influencing other liver functions, we determined the
postnatal levels in serum of glucose, bilirubin, bile acids, and liver
aminotransferases (Tables 1 and 2, ALT
and AST) and alkaline phosphatase enzymes from the T-77 line. Serum
parameters from P8 transgenic mice were similar to those from
wild-type littermates, suggesting that postnatal transgenic
liver function was normal (Table 1, T-77). This result supports the
hypothesis that postnatal defects in hepatocyte glycogen storage were
specific to elevated HNF-3
transgene expression rather than
being caused by nonspecific effects from liver dysfunction. As early as
P17, however, the T-77 transgenic mice began to exhibit elevated levels
of bile acids and liver aminotransferase in serum, the latter of which
suggests that some hepatocyte damage has occurred (Table 1) (22,
35). P17 transgenic mice displayed levels of alkaline phosphatase
and bilirubin in serum identical to those of wild-type mice, indicating
that there was no evidence of hepatic biliary damage or liver
dysfunction. Despite hepatocyte glycogen storage defects, the postnatal
T-77 transgenic mice were not hypoglycemic (Table 1). By 6 weeks of
age, however, most of the T-77 transgenic mice were jaundiced, with
serum bilirubin levels of >1 mg/dl (T-77J, Table 2), and they
exhibited a 50-fold increase in levels of bile acids in serum compared
to either wild-type littermates or the T-60 mice (Table 2). Although
the levels of liver aminotransferase and alkaline phosphatase in serum
were elevated in adult T-77 mice (6 weeks old; T-77J, Table 2), the
observed increases in serum enzyme levels are not indicative of
extensive biliary and hepatocyte damage. For example, mouse tail vein
injection of adenovirus induces extensive liver hepatitis, and they
displayed 10 times higher liver enzyme levels than those found in the
adult T-77 mice (30). Moreover, a subset of adult T-77
transgenic mice exhibited proper liver function, as evidenced by normal
serum bilirubin levels (nonjaundiced; T-77NJ, Table 2), but they
still possessed elevated levels of liver enzymes and bile acids in serum.
Diminished hepatocyte expression of bile acid and phospholipid
transporters in T-77 mice.
One likely explanation for elevated
levels of bile acids in serum in the T-77 mouse line is diminished
hepatic expression of bile transporters which are involved in recycling
serum bile acids (reabsorbed from the intestine) back into the hepatic
biliary system (42, 64). Hepatocyte reuptake of
serum-conjugated bile salts is mediated by the basolateral (sinusoidal)
sodium-taurocholate cotransporter protein (Ntcp; Fig.
7A). Conjugated bile acids are then
transported across the apical (canalicular) hepatocyte membrane into
the bile canaliculi by the ATP-dependent bile transporter named sister
of P-glycoprotein (Spgp) (42, 64). The basolateral multispecific organic anion-cation transporting polypeptide (Oatp) is
involved in the reuptake of unconjugated bile salts, organic anion, and
lipophilic compounds from the sinusoidal circulation (42,
64). RNase protection assays with T-77 postnatal and adult liver
RNA reveal a substantial reduction in Ntcp expression, but its hepatic
levels are only slightly reduced in T-60 mice (Fig. 7B and C). These
results indicated that diminished hepatic expression of Ntcp precedes
the increase in the levels of bile acids in serum, suggesting that its
downregulation is specific to HNF-3
transgene levels. By
contrast, mRNA levels of the canalicular Spgp bile transporter were
normal in transgenic adult livers and exhibited only transient
reductions in P8 transgenic livers (Fig. 7B and D). Expression of
conjugated bilirubin canalicular multispecific organic anion
transporter (cMoat) and Oatp was not significantly reduced in either
postnatal or adult transgenic livers (Fig. 7B and D). These data
suggest that diminished expression of Ntcp in the livers of postnatal
T-77 transgenic mice is coincident with early onset of and persistence
of increased bile acid levels in serum (Tables 1 and 2).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 7.
T-77 transgenic liver exhibits reduced hepatic
expression of sinusoidal bile acid transporters and canalicular bile
phospholipid transporters. (A) Schematic representation of the
sinusoidal and canalicular bile acid, organic acid phospholipid, and
bilirubin transporter proteins. Shown is the sinusoidal (basolateral)
Ntcp, the Oatp, and the canalicular (apical) mdr2 P-glycoprotein
phospholipid transporter, Spgp ATP-dependent bile transporter (also
known as bile salt export pump), and bilirubin canalicular
multispecific organic anion transporter (cMoat; also known as cmrp2).
The double arrow indicates that Oatp can transport organic anions in
both directions. Total RNA was prepared from P8, P17, and adult
wild-type and transgenic mouse livers, and RNase protection assays were
used to analyze for expression of Ntcp, Oatp, Spgp, Mdr2, cMoat, and
cyclophilin. Indicated below each panel is the normalized fold
induction of transgenic liver expression compared to wild-type liver.
(B) Decreased Ntcp mRNA levels in postnatal T-77 transgenic livers. (C)
Adult T-77 transgenic liver (6 weeks old) exhibited diminished
expression of Ntcp and Mdr2. (D) Adult T-77 transgenic liver exhibited
normal levels of Spgp and cMoat mRNAs.
|
|
Another candidate gene involved in bile acid homeostasis is the
canalicular multidrug resistance 2 (mdr2) P-glycoprotein,
which
transports intracellular phospholipids into bile secretion
(Fig.
7A)
and mediates protection of the biliary epithelial cells
from bile
injury. Homozygous null
Mdr2 mice display extensive
damage
to the liver parenchyma and biliary system and elevated
levels of liver
enzymes in serum and die postnatally of liver
failure (
62).
Consistent with the mdr2 knockout phenotype, the
increase in T-77
biliary and hepatocyte damage observed by 6 weeks
of age is coincident
with a 93% reduction in hepatic mdr2 mRNA
levels, but its expression
levels are normal in younger P17 transgenic
livers (Fig.
7C and data
not shown). These results suggest that
reduction in the adult T-77
liver expression of mdr2 may contribute
to the damage of hepatocytes
and the biliary
tree.
Transmission electron microscopy of T-77 transgenic livers shows
bile canalicular damage and disruption of hepatocyte apical tight
junctions.
To examine the extent of abnormal hepatic architecture,
wild-type and transgenic mouse livers were examined by light microscopy and processed for examination by transmission electron microscopy (see
Materials and Methods). Light micrographs of P17 liver sections stained
with toluidine blue displayed aberrant T-77 liver morphology (Fig.
8C) compared to its
age-matched wild-type littermates (Fig. 8A). Although
most bile canaliculi are intact in P17 livers from the T-77 line,
several of them are visibly open to the basolateral domain (compare
Fig. 8B and D, between arrowheads). The T-77 transgenic hepatocytes
also contain large vacuoles, an increase in lipid-storing vesicles, and
a complete absence of glycogen (Fig. 8C and D). Transmission electron
microscopy of adult wild-type liver (Fig. 9 and 10A) shows the normal liver
ultrastructure, with a single row of hepatocytes bordered on either
basolateral side by sinusoids and on the apical side are tight
junctions with intact bile canaliculi (Fig. 9 and 10A, arrowheads). In
comparison with the wild-type adult liver, the ultrastructure of the
T-60 hepatocytes is essentially normal, but they contain large vacuoles
and the glycogen content appears increased and more dispersed
throughout the cytoplasm (Fig. 10B).
Transgenic hepatocytes from 3-month-old T-77 mice continue to display
large vacuoles that often displace the hepatocyte nuclei, increased
lipid-containing vesicles, and an absence of glycogen (Fig. 10C and D).
The endothelium lining of the T-77 hepatic sinusoids is damaged, as
evidenced by the lack of microvilli at the basolateral domain within
the space of Disse, and the transgenic liver shows disruption of the
bile canaliculi and basolateral tight junctions between hepatocytes
(Fig. 10C, between arrows, and 10D). Despite the damage to the T-77
bile canaliculi, small and large intrahepatic bile ducts remain intact
(Fig. 9, right panels and data not shown). Moreover, in a few areas of
P17 and adult transgenic liver sections there is evidence of periportal
fibrosis and an influx of immune cells (Fig. 8C and 10D). These studies
demonstrate that, at 3 months of age, the T-77 adult livers display
injury to the bile canaliculi and disruption of hepatocyte tight
junctions.

View larger version (164K):
[in this window]
[in a new window]
|
FIG. 8.
Morphology and ultrastructure of livers from P17
wild-type and T-77 transgenic mice. Livers were obtained from P17 mice
and processed for transmission electron microscopy as described in
Materials and Methods. (A) Light micrograph of toluidine blue-stained
300-µm section of P17 wild-type mouse liver shows
normal architecture with intact bile ducts (BD). (B) The
ultrastructure from these wild-type livers also displays normal
architecture with intact bile canaliculi (BC) at the apical membrane
domain, abundant glycogen (*) in the cytoplasm, and hepatic
sinusoidal (S) plate structure. (C) Light micrograph of toluidine
blue-stained 300-µm section of P17 liver from the T-77 transgenic line
shows bile ducts (BD) that appear normal and intact, but some
periportal fibrosis is evident (*). Many hepatocytes in T-77
transgenic livers display lipid accumulation (arrows), and some areas
are filled with immune cells (IC). (D) A high-magnification view of P17
transgenic liver from the T-77 line displays aberrant morphology. Many
hepatocytes display large vacuoles (V), as well as numerous smaller
vacuoles (arrows), throughout the cytoplasm. Although most bile
canaliculi (BC) are intact, and several are visibly open (between
arrowheads) to the basolateral domain. Also of note is the complete
absence of glycogen but an increase in lipid-storing vesicles (F) in
the hepatocytes. A and C, × 40 magnification; B and D, bar = 5 µm.
|
|

View larger version (176K):
[in this window]
[in a new window]
|
FIG. 9.
Comparative analysis of adult wild-type (WT),
T-60, and T-77 liver morphology and bile duct ultrastructure. Toluidine
blue-stained 300-µm sections of adult livers from 3.5-month-old mice
were examined for general morphology (left panels). Wild-type livers
display normal architecture. Hepatocytes in the T-60 transgenic livers
show many submembrane vacuoles (V) closely apposed to both the apical
and basolateral plasma membranes. Livers from T-77 transgenic mice
display distended, as well as disrupted, bile canaliculi (between
arrowheads), hepatocytes with large vacuoles (V), and some areas with
immune cells (IC) within the sinusoids (S). Representative transmission
electron micrographs of small bile ducts from each mouse strain (right
panels; wild type, T-60, and T-77) show that bile ducts are normal.
Left-panel magnifications, ×20. Right panel bars: WT and T-60, 4 µm;
T-77, 2 µm.
|
|

View larger version (156K):
[in this window]
[in a new window]
|
FIG. 10.
Ultrastructure of adult livers from
wild-type (WT) and T-60 and T-77 transgenic mice. Livers were obtained
from 3.5-month-old mice and processed for transmission electron
microscopy as described in Materials and Methods. (A) Wild-type liver
displays typical liver ultrastructure with a single row of hepatocytes
bounded on either basolateral side by sinusoids (S), and glycogen is
evident throughout the hepatocytes (arrowheads). Intact bile
canaliculus (BC) is evident between the apical membrane domains of the
hepatocytes and is surrounded by a ring of tight junctions. (B) T-60
transgenic mouse liver displays typical liver ultrastructure similar to
that observed in the wild-type liver. However, in many hepatocytes,
large vacuoles (V) are apparent just under the plasma membrane in both
the apical and the basolateral domains and exhibits an increase in
glycogen content that is more dispersed throughout the cytoplasm
compared to wild-type liver. (C) Liver from a 3-month-old adult T-77
transgenic mouse displays many striking abnormalities compared to liver
from a wild-type or T-60 transgenic mouse. The hepatocytes are filled
with large vacuoles (V) that often displace the nucleus (N) of the
hepatocyte. The bile canaliculi are often not intact and patent to the
basolateral membrane domain of the hepatocyte (between arrows),
suggesting leakage of bile into the sinusoidal blood. Additionally, a
greater number of lipid containing vesicles (L), but less glycogen
storage, are evident in this line. (D) In other areas of the adult T-77
liver lobule, infiltrating immune cells, including natural killer cells
(NK), neutrophils (N), T cells (T), and macrophages (M), are coalescing
within a sinusoid (S). Bile canaliculi (BC) are not intact and are open
to the sinusoid, and the sinusoidal endothelial cell adjacent to the
immune cells is destroyed (*). One natural killer cell is observed
migrating between two endothelial cells into the parenchymal cells
below (arrow). In panels C and D, hepatocytes in T-77 transgenics do
not possess microvilli at the basolateral domain within the space of
Disse (DS), indicating sinusoidal damage. A to C, bar = 2 µm; D, bar = 5 µm.
|
|
 |
DISCUSSION |
Homozygous null Hnf3
mice die in utero at 10 days
postcoitum, thereby precluding examination of the in vivo function
of HNF-3
in the regulation of hepatocyte-specific gene
transcription (1, 73). To perform the study reported here,
we created transgenic mice that display increased hepatocyte
HNF-3
levels and then assessed the consequences of elevated
HNF-3
on hepatocyte-specific gene regulation. The transgenic
mice are smaller than their wild-type littermates and exhibit elevated
levels of bile acids in serum and an absence of hepatic glycogen
storage. We show that these defects are coincident with diminished
expression of hepatocyte genes involved in glucose homeostasis (PEPCK
and glycogen synthase) and sinusoidal bile acid uptake (Ntcp). Retarded
postnatal growth is coincident with an increase in hepatic IGFBP-1
levels, which limits the biological effects of IGFs in the circulation
and in target tissues. The observed phenotypes may also result from
diminished expression of the HNF-3
,-3
, -3
, and -6 transcription factors, suggesting that increased HNF-3
levels
disrupted the normal hepatocyte expression of liver transcription
factors. We were able to determine that these changes in hepatocyte
gene expression are specific to the HNF-3
transgene because they
were also observed in P8 livers of the T-60 line when those hepatocytes
were still expressing the HNF-3
transgene protein. Furthermore,
transgenic liver displayed sustained, normal hepatic expression levels
of genes involved in bile acid transport (Spgp and Oatp), glucose
homeostasis (G6P and GP), and IGFBP-3, as well as the other liver
transcription factors HNF-1
, HNF-4
, C/EBP
, and C/EBP
. We
can also conclude that this altered hepatic gene expression is not due
to liver hepatitis because transgenic hepatocytes were not
proliferating (data not shown), nor did they exhibit changes in
C/EBP
, C/EBP
, and Spgp mRNA levels, which change dramatically in
regenerating and acute-phase livers (11, 48, 69).
Furthermore, the levels of liver enzymes in the serum of adult T-77
transgenic mice were 10-fold lower than those found in
adenovirus-infected mice with hepatitis (30).
The TTR-HNF-3
transgenic mouse phenotype involves
disruption of the HNF-3 isoforms and HNF-6 transcription
factors.
Our transgenic mouse analysis demonstrates that the T-77
transgenic liver expresses primarily the HNF-3
isoform, instead of the normal hepatocyte expression of all three HNF-3 isoforms. The presence of the HNF-3
protein alone in transgenic
hepatocytes may influence the transcription of a subset of genes in
which the DNA regulatory region is recognized by a distinct HNF-3
isoform, as has been observed in TTR regulatory sequences (28,
58). One potential mechanism mediating diminished expression of
the endogenous HNF-3 genes involves the direct binding of the
HNF-3
transgene protein to its autoregulatory sites in the
HNF-3
and HNF-3
promoter regions (45, 46). In
this model, the HNF-3 binding site may function to diminish
HNF-3
and HNF-3
gene transcription in response to an
excess of HNF-3
protein. The transgenic livers also display
significant reductions in HNF-3
expression, but its promoter has
not been characterized in detail, and we are therefore unable to
propose a model for its diminished hepatic expression. In postnatal
T-60 and T-77 transgenic livers, we also observed a significant
decrease in HNF-6 expression, suggesting that we have created a
hepatocyte-specific ablation of HNF-6. Although we do not know whether
HNF-3
mediates a direct or indirect downregulation of HNF-6
expression, it is likely that reduced transcription of the HNF-6 target
gene contributes to the T-77 liver phenotype. Moreover, because HNF-6
is known to transcriptionally activate the HNF-3
promoter
(29, 52, 57), another possibility is that diminished HNF-6
expression is contributing to reduced expression of the endogenous
mouse HNF-3
gene. Previous cotransfection studies demonstrated
that HNF-6 is also capable of stimulating HNF-4
promoter activity,
suggesting that HNF-6 may regulate transcription of the HNF-4
gene
in developing and adult livers (29). In spite of diminished
hepatic levels of HNF-6 in the T-77 mice, adult hepatic expression of
HNF-4
was not affected. This result suggests that the HNF-6 to
HNF-4
regulatory pathway is not essential for the maintenance of
adult hepatic HNF-4
expression in vivo.
Which of the HNF-3 target genes are involved in retarded
postnatal growth and defects in hepatocyte glycogen storage?
IGFBP-1 gene expression is activated by the winged helix transcription
factor, Fkhr, which recognizes the IRE in its promoter region (6,
19). IGFBP-1 promoter activation is negatively regulated by
insulin through Akt (protein kinase B)-mediated phosphorylation of
fkhr, which causes cytoplasmic retention of fkhr protein. In the
current study, reduction in postnatal transgenic mouse growth is
coincident with stimulated hepatic expression of the IGFBP-1 gene.
Methylation interference experiments demonstrate that HNF-3
protein specifically binds the IGFBP-1 promoter region, and previous NIH 3T3 cell cotransfection studies showed that retention of this HNF-3 binding sequence is necessary to mediate HNF-3
activation of IGFBP-1 promoter expression (66). The elevated
hepatic IGFBP-1 levels in postnatal T-60 and T-77 transgenic mice
confirm these transfection studies by demonstrating that HNF-3
is also able to activate IGFBP-1 expression in vivo. Furthermore,
we demonstrated that elevated hepatic expression of IGFBP-1 resulted in
a significant increase in levels of IGFBP-1 in transgenic mouse
serum (Fig. 3E). Although
IGFBP-3 is the predominant serum carrier protein for
IGF-1 (55), increased expression of IGFBP-1 in transgenic mice causes significant reductions in postnatal growth, confirming its
role in regulating the biological activity of IGFs (16, 51).
The increase in hepatic expression and the resulting increase in
serum IGFBP-1 levels therefore provides a plausible
explanation for the reduction in postnatal growth of the
TTR-HNF-3
transgenic mouse lines. Paradoxically, despite
reduced hepatic expression of IGF-1 in postnatal T-77 transgenic mice,
they displayed normal levels of IGF-1 protein in serum. One possible
explanation for this result resides in the ability of increased levels
of IGFBP-1 in serum to mediate the stabilization of serum IGF-1 protein
(18). Furthermore, recent conditional knockout mouse studies
demonstrated that, although hepatocyte-specific ablation of the IGF-1
gene caused a 75% reduction in serum IGF-1 levels, the mice still
exhibited normal postnatal growth (61, 75). These studies
support the hypothesis that reduced postnatal growth of the
TTR-HNF-3
transgenic mice is due to increased hepatic IGFBP-1
expression, with no reduction in serum IGF-1.
The TTR-HNF-3

transgenic mouse livers possessed normal glycogen
stores immediately postpartum, but their hepatocyte glycogen
levels
were diminished by P8. This result suggests that postnatal
transgenic
hepatocytes are unable to maintain normal glycogen
levels. The
decreased hepatocyte glycogen storage capability of
transgenic livers
is not due to liver dysfunction, because glycogen
depletion was evident
in P8 livers when the transgenic mice exhibited
normal levels in serum
of bilirubin, bile acids, and liver enzymes.
The glycogen storage
defect is coincident with diminished expression
of the PEPCK gene,
which is activated in postnatal liver and is
the rate-limiting enzyme
in the gluconeogenic pathway (
20).
Although the HNF-3

protein is known to activate expression of
the PEPCK promoter region
(
72), we observed that increased hepatocyte
HNF-3

levels mediate decreases in postnatal PEPCK mRNA levels.
A 50%
reduction in hepatic PEPCK mRNA levels was observed in homozygous
null
HNF-3

mice even though they exhibited elevated hepatic
expression
of the other two HNF-3 isoforms (
24). Our
study supports this
result in that normal expression of PEPCK requires
the HNF-3
isoform and increased HNF-3

levels are
insufficient to sustain
normal hepatic levels of PEPCK mRNA.
Furthermore, we also observed
a 50% decline in hepatic expression of
the glycogen synthase gene,
which is consistent with diminished
glycogen storage in transgenic
hepatocytes. Similar to the
TTR-HNF-3

transgenic mice, the
C/EBP
/
mice exhibit postnatal defects in
hepatic glycogen storage resulting
from reduced induction of hepatic
expression of PEPCK and glycogen
synthase (
70). We also
noted significant increases in postnatal
transgenic expression of
glucokinase, suggesting that glucokinase
transcription may be regulated
by HNF-3

protein. Consistent with
this possibility, the human
glucokinase promoter contains a consensus
HNF-3 binding site
(797/

784; AcTATTGACTgA). Postnatal and adult
transgenic
liver exhibited elevated PFK-2 mRNA levels, which confirms
its
transcriptional regulation by HNF-3 (
31). Because PFK-2
is a bifunctional enzyme whose products influence gluconeogenesis,
its
increase in transgenic hepatocytes may also contribute to
diminished
hepatic glycogen stores (
23). More recently, HNF-6
protein
has been shown to inhibit glucocorticoid hormone induction
of PFK-2
gene transcription through direct interaction with the
glucocorticoid
receptor DNA-binding domain (
47). Another possibility
is
that diminished HNF-6 protein levels in the T-77 transgenic
liver may
lead to elevated glucocorticoid induction of the PFK-2
gene and
contribute to its increased hepatic
expression.
Diminished expression of hepatic Ntcp and mdr2 in T-77 transgenic
mice leads to elevated serum bile acids and extensive liver damage,
respectively.
Hepatocytes synthesize and secrete bile acids which
are stored in the gallbladder and released into the intestine to
emulsify fat for digestion (42). Approximately 90% of the
bile acids are reabsorbed from the ileum, transported through the
hepatic vein to the sinusoidal circulation, and recycled back into the hepatic biliary system by hepatocyte bile acid transporter proteins (13, 63). The majority of hepatocyte reuptake of bile salts from the hepatic sinusoidal circulation is mediated by the basolateral Ntcp (42). Bile is then transported against a concentration gradient across the apical hepatocyte membrane into the bile canaliculi by the ATP-dependent Spgp bile transporter (17, 42). In P8 transgenic T-77 mice, we show that abrogated hepatic expression of the
sinusoidal bile acid transporter protein, Ntcp, precedes elevated
levels of bile acids in serum. This result indicates that
downregulation of hepatic Ntcp levels is likely due to the HNF-3
transgene rather than increased serum levels of bile acids (26). The T-60 line exhibited no increases in serum bile
acid levels (data not shown). A plausible explanation is found in our observation that a transient decrease in P8 hepatic expression of Ntcp
is insufficient to elicit elevated levels of bile acids in the serum of
T-60 mice. These results strongly support the hypothesis that continued
downregulation of hepatic Ntcp levels in the T-77 line diminishes bile
acid reuptake and contributes to the elevated levels of bile acids in
serum. Consistent with the role of HNF-6 in regulating Ntcp expression,
the Rat Ntcp promoter region contains a consensus HNF-6 binding
site (
758/
770; TTTATTGACTgTT) which is recognized by
recombinant HNF-6 protein and mediates its transcriptional activation
by HNF-6 (F. M. Rausa, S. Karpen, and R. H. Costa,
unpublished results). These results suggest that diminished hepatic
expression of HNF-6 may also contribute to reduced transcription of
Ntcp in the T-77 liver. Coincident with increased levels of bile acids
in the serum of T-77 mice, we observed an 80% decrease in P17 hepatic
mRNA levels of cholesterol 7
-hydroxylase (Cyp7A; data not shown),
the rate-limiting enzyme involved in the synthesis of bile acids from
cholesterol (5). Because bile acids are the endogenous
ligands for the farnesoid X receptor (26, 36), which
mediates transcriptional repression of the Cyp7A gene, we were unable
to determine whether diminished hepatic expression in T-77 mice is due
to an indirect effect of increased levels of bile acids in hepatocytes
through import by the sinusoid multispecific organic
anion-cation-transporting polypeptide. Moreover, we observed normal
hepatic expression of Spgp in the T-77 mice, allowing continued
transport of de novo hepatocyte bile into the biliary system and
preventing complete hepatic cholestasis.
The T-77 transgenic line was noted to develop liver disease by 6 weeks
of age, as evidenced by the development of jaundice
(elevated serum
bilirubin levels). Preliminary analysis of P22
transgenic mice
(T-77) indicates that the hepatic expression of
the
bilirubin-conjugating enzyme UDP-glucuronosyltransferase is
significantly diminished, suggesting that the jaundiced phenotype
is a
specific effect of the HNF-3

transgene (X. Wang, D. Hughes,
and
R. H. Costa, unpublished results). Furthermore, adult transgenic
mice display liver damage, as indicated by elevated liver enzymes
in
serum and disruption of normal liver architecture. This adult
transgenic phenotype is coincident with extinguished expression
of the
phospholipid transporter protein, mdr-2, which functions
to protect the
biliary epithelial cell lining. Homozygous
Mdr2 null mice
display extensive damage to hepatocytes and bile canaliculi,
exhibit
elevated levels of liver enzymes in serum, and die postnatally
of liver
failure (
62). The increase in bile acid levels in serum
and
diminished phospholipid transport into bile secretion may
lead to
disruption of the hepatocyte tight junctions required
to separate the
contents of the bile canaliculi from the sinusoidal
circulation.
Transmission electron microscopy of adult transgenic
liver from
3-month-old T-77 mice confirms hepatocyte and bile
canalicular damage
leading to disruption of apical tight junctions
between hepatocytes. We
believe that the combination of elevated
bile acids in serum and
diminished phospholipid transport into
the bile secretion leads to
liver damage and eventual liver failure.
Furthermore, a portion of the
elevated bilirubin and bile acid
levels in the serum of the T-77
transgenic mouse line may be the
result of leakage from damaged
hepatocytes or bile canaliculi
into the sinusoidal circulation. More
recent studies have also
demonstrated that increased bile acid levels
in mdr2-deficient
mice result in a decline in Ntcp protein levels
(
26). This result
suggests that reduced hepatic expression
of mdr2 in adult T-77
mice may also contribute to further increases in
bile acid levels
in the serum of adult transgenic
mice.
In summary, increased hepatocyte expression of HNF-3

in
transgenic mice caused postnatal growth retardation, diminished liver
glycogen storage, elevated bile acids in serum, and subsequent
damage
to the adult liver parenchyma. We show that these defects
are
coincident with diminished expression of genes involved in
gluconeogenesis, the sinusoidal reuptake of bile acids by hepatocytes,
and biliary homeostasis. Furthermore, the retarded growth phenotype
is
coincident with elevated hepatic expression of IGFBP-1, which
limits
stimulation of postnatal growth by serum IGF proteins in
target
tissues. We also show that TTR-HNF-3

transgenic livers
express
diminished levels of endogenous HNF-3 and HNF-6 transcription
factors, suggesting that changes in transcription of both HNF-3
and
HNF-6 target genes contribute to this liver
phenotype.
 |
ACKNOWLEDGMENTS |
We thank K. Wang for her expert assistance in generating the
transgenic mice, Raul Lacson for his technical assistance in performing
the methylation interference studies, and Xiaohue He for performing
Western ligand blotting and immunoprecipitation studies of IGFBPs. We
also thank T. A. Van Dyke for providing us the
3-kb TTR minigene
expression plasmid and Pradip Raychaudhuri, Ai Xuan Holterman, Richard
Green, Saul Karpen, and Xinhe Wang for critically reading the
manuscript. The HNF-3
monoclonal antibody (4C7) developed by
T. M. Jessell and S. Brenner-Morton was obtained from the
Developmental Studies Hybridoma Bank developed under the auspices of
the NICHD and maintained by the Department of Biological Sciences, The
University of Iowa, Iowa City, Iowa.
This work was supported by National Institutes of Health grants R01
GM43241-10 (R.H.C.), RO1 DK41430 (T.G.U.), and RO1 CA76541 (D.B.S.) and
by an American Liver Foundation Liver Scholar Grant (D.B.S.) and the
Department of Veterans Affairs Merit Review Program (T.G.U.).
F.M.R., Y.T., and H.Z. contributed equally to this study.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics (M/C 669), University of Illinois at Chicago,
College of Medicine, 900 S. Ashland Ave., Rm. 2220 MBRB, Chicago, IL
60607-7170. Phone: (312) 996-0474. Fax: (312) 355-4010. E-mail:
RobCosta{at}uic.edu.
 |
REFERENCES |
| 1.
|
Ang, S. L., and J. Rossant.
1994.
HNF-3 is essential for node and notochord formation in mouse development.
Cell
78:561-574[CrossRef][Medline].
|
| 2.
|
Ang, S. L.,
A. Wierda,
D. Wong,
K. A. Stevens,
S. Cascio,
J. Rossant, and K. S. Zaret.
1993.
The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/forkhead proteins.
Development
119:1301-1315[Abstract].
|
| 3.
|
Baker, J.,
J. P. Liu,
E. J. Robertson, and A. Efstratiadis.
1993.
Role of insulin-like growth factors in embryonic and postnatal growth.
Cell
75:73-82[CrossRef][Medline].
|
| 4.
|
Cereghini, S.
1996.
Liver-enriched transcription factors and hepatocyte differentiation.
FASEB J.
10:267-282[Abstract].
|
| 5.
|
Chiang, J. Y. L.
1998.
Regulation of bile acid synthesis.
Front. Biosci.
3:D176-D193.
|
| 6.
|
Cichy, S. B.,
S. Uddin,
A. Danilkovich,
S. Guo,
A. Klippel, and T. G. Unterman.
1998.
Protein kinase B/Akt mediates effects of insulin on hepatic insulin-like growth factor-binding protein-1 gene expression through a conserved insulin response sequence.
J. Biol. Chem.
273:6482-6487[Abstract/Free Full Text].
|
| 7.
|
Cirillo, L. A.,
C. E. McPherson,
P. Bossard,
K. Stevens,
S. Cherian,
E. Y. Shim,
K. L. Clark,
S. K. Burley, and K. S. Zaret.
1998.
Binding of the winged-helix transcription factor HNF3 to a linker historic site on the nucleosome.
EMBO J.
17:244-254[CrossRef][Medline].
|
| 8.
|
Clark, K. L.,
E. D. Halay,
E. Lai, and S. K. Burley.
1993.
Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5.
Nature
364:412-420[CrossRef][Medline].
|
| 9.
|
Cooper, A. D.,
J. Chen,
M. J. Botelho-Yetkinler,
Y. Cao,
T. Taniguchi, and B. Levy-Wilson.
1997.
Characterization of hepatic-specific regulatory elements in the promoter region of the human cholesterol 7 -hydroxylase gene.
J. Biol. Chem.
272:3444-3452[Abstract/Free Full Text].
|
| 10.
|
Costa, R. H.,
D. R. Grayson, and J. E. Darnell, Jr.
1989.
Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and 1-antitrypsin genes.
Mol. Cell. Biol.
9:1415-1425[Abstract/Free Full Text].
|
| 11.
|
Diehl, A. M.
1998.
Roles of CCAAT/enhancer-binding proteins in regulation of liver regenerative growth.
J. Biol. Chem.
273:30843-30846[Abstract/Free Full Text].
|
| 12.
|
Dufort, D.,
L. Schwartz,
K. Harpal, and J. Rossant.
1998.
The transcription factor HNF3 is required in visceral endoderm for normal primitive streak morphogenesis.
Development
125:3015-3025[Abstract].
|
| 13.
|
Erlinger, S.
1996.
Review article: new insights into the mechanisms of hepatic transport and bile secretion.
J. Gastroenterol. Hepatol.
11:575-579[Medline].
|
| 14.
|
Frederiks, W. M.,
F. Marx, and C. J. Van Noorden.
1987.
Quantitative histochemical assessment of the heterogeneity of glycogen phosphorylase activity in liver parenchyma of fasted rats using the semipermeable membrane technique and the PAS reaction.
Histochem. J.
19:150-156[CrossRef][Medline].
|
| 15.
|
Galarneau, L.,
J. F. Pare,
D. Allard,
D. Hamel,
L. Levesque,
J. D. Tugwood,
S. Green, and L. Belanger.
1996.
The 1-fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family.
Mol. Cell. Biol.
16:3853-3865[Abstract].
|
| 16.
|
Gay, E.,
D. Seurin,
S. Babajko,
S. Doublier,
M. Cazillis, and M. Binoux.
1997.
Liver-specific expression of human insulin-like growth factor binding protein-1 in transgenic mice: repercussions on reproduction, ante- and perinatal mortality and postnatal growth.
Endocrinology
138:2937-2947[Abstract/Free Full Text].
|
| 17.
|
Gerloff, T.,
B. Stieger,
B. Hagenbuch,
J. Madon,
L. Landmann,
J. Roth,
A. F. Hofmann, and P. J. Meier.
1998.
The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver.
J. Biol. Chem.
273:10046-10050[Abstract/Free Full Text].
|
| 18.
|
Guler, H. P.,
J. Zapf,
C. Schmid, and E. R. Froesch.
1989.
Insulin-like growth factors I and II in healthy man. Estimations of half-lives and production rates.
Acta Endocrinol.
121:753-758.
|
| 19.
|
Guo, S.,
G. Rena,
S. Cichy,
X. He,
P. Cohen, and T. Unterman.
1999.
Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence.
J. Biol. Chem.
274:17184-17192[Abstract/Free Full Text].
|
| 20.
|
Hanson, R. W., and L. Reshef.
1997.
Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression.
Annu. Rev. Biochem.
66:581-611[CrossRef][Medline].
|
| 21.
|
Harnish, D. C.,
S. Malik,
E. Kilbourne,
R. Costa, and S. K. Karathanasis.
1996.
Control of apolipoprotein AI gene expression through synergistic interactions between hepatocyte nuclear factors 3 and 4.
J. Biol. Chem.
271:13621-13628[Abstract/Free Full Text].
|
| 22.
|
Herlong, H. F.
1994.
Approach to the patient with abnormal liver enzymes.
Hosp. Pract.
29:32-38.
|
| 23.
|
Hue, L., and G. G. Rousseau.
1993.
Fructose 2,6-bisphosphate and the control of glycolysis by growth factors, tumor promoters and oncogenes.
Adv. Enzyme Regul.
33:97-110[CrossRef][Medline].
|
| 24.
|
Kaestner, K. H.,
H. Hiemisch, and G. Schutz.
1998.
Targeted disruption of the gene encoding hepatocyte nuclear factor 3 results in reduced transcription of hepatocyte-specific genes.
Mol. Cell. Biol.
18:4245-4251[Abstract/Free Full Text].
|
| 25.
|
Kaufmann, E., and W. Knochel.
1996.
Five years on the wings of fork head.
Mech. Dev.
57:3-20[CrossRef][Medline].
|
| 26.
|
Koopen, N. R.,
H. Wolters,
P. Voshol,
B. Stieger,
R. J. Vonk,
P. J. Meier,
F. Kuipers, and B. Hagenbuch.
1999.
Decreased Na+-dependent taurocholate uptake and low expression of the sinusoidal Na+-taurocholate cotransporting protein (Ntcp) in livers of mdr2 P-glycoprotein-deficient mice.
J. Hepatol.
30:14-21[CrossRef][Medline].
|
| 27.
|
Lai, E.,
V. R. Prezioso,
E. Smith,
O. Litvin,
R. H. Costa, and J. E. Darnell, Jr.
1990.
HNF-3A, a hepatocyte-enriched transcription factor of novel structure, is regulated transcriptionally.
Genes Dev.
4:1427-1436[Abstract/Free Full Text].
|
| 28.
|
Lai, E.,
V. R. Prezioso,
W. F. Tao,
W. S. Chen, and J. E. Darnell, Jr.
1991.
Hepatocyte nuclear factor 3 belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head.
Genes Dev.
5:416-427[Abstract/Free Full Text].
|
| 29.
|
Landry, C.,
F. Clotman,
T. Hioki,
H. Oda,
J. J. Picard,
F. P. Lemaigre, and G. G. Rousseau.
1997.
HNF-6 is expressed in endoderm derivatives and nervous system of the mouse embryo and participates to the cross-regulatory network of liver-enriched transcription factors.
Dev. Biol.
192:247-257[CrossRef][Medline].
|
| 30.
|
Lee, Y. H.,
B. Sauer,
P. F. Johnson, and F. J. Gonzalez.
1997.
Disruption of the c/ebp gene in adult mouse liver.
Mol. Cell. Biol.
17:6014-6022[Abstract].
|
| 31.
|
Lemaigre, F. P.,
S. M. Durviaux, and G. G. Rousseau.
1993.
Liver-specific factor binding to the liver promoter of a 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase gene.
J. Biol. Chem.
268:19896-19905[Abstract/Free Full Text].
|
| 32.
|
Lemaigre, F. P.,
S. M. Durviaux,
O. Truong,
V. J. Lannoy,
J. J. Hsuan, and G. G. Rousseau.
1996.
Hepatocyte nuclear factor 6, a transcription factor that contains a novel type of homeodomain and a single cut domain.
Proc. Natl. Acad. Sci. USA
93:9460-9464[Abstract/Free Full Text].
|
| 33.
|
Lin, B.,
D. W. Morris, and J. Y. Chou.
1997.
The role of HNF1 , HNF3 , and cyclic AMP in glucose-6-phosphatase gene activation.
Biochemistry
36:14096-14106[CrossRef][Medline].
|
| 34.
|
Liu, J. K.,
C. M. DiPersio, and K. S. Zaret.
1991.
Extracellular signals that regulate liver transcription factors during hepatic differentiation in vitro.
Mol. Cell. Biol.
11:773-784[Abstract/Free Full Text].
|
| 35.
|
Mahl, T. C.
1998.
Approach to the patient with abnormal liver tests.
Lippincotts Prim. Care Pract.
2:379-389[Medline].
|
| 36.
|
Makishima, M.,
A. Y. Okamoto,
J. J. Repa,
H. Tu,
R. M. Learned,
A. Luk,
M. V. Hull,
K. D. Lustig,
D. J. Mangelsdorf, and B. Shan.
1999.
Identification of a nuclear receptor for bile acids.
Science
284:1362-1365[Abstract/Free Full Text].
|
| 37.
|
Marsden, I.,
C. Jin, and X. Liao.
1998.
Structural changes in the region directly adjacent to the DNA-binding helix highlight a possible mechanism to explain the observed changes in the sequence-specific binding of winged helix proteins.
J. Mol. Biol.
278:293-299[CrossRef][Medline].
|
| 38.
|
McPherson, C. E.,
E. Y. Shim,
D. S. Friedman, and K. S. Zaret.
1993.
An active tissue-specific enhancer and bound transcription factors existing in a precisely positioned nucleosomal array.
Cell
75:387-398[CrossRef][Medline].
|
| 39.
|
Millonig, J. H.,
J. A. Emerson,
J. M. Levorse, and S. M. Tilghman.
1995.
Molecular analysis of the distal enhancer of the mouse -fetoprotein gene.
Mol. Cell. Biol.
15:3848-3856[Abstract].
|
| 40.
|
Molowa, D. T.,
W. S. Chen,
G. M. Cimis, and C. P. Tan.
1992.
Transcriptional regulation of the human cholesterol 7 -hydroxylase gene.
Biochemistry
31:2539-2544[CrossRef][Medline].
|
| 41.
|
Monaghan, A. P.,
K. H. Kaestner,
E. Grau, and G. Schutz.
1993.
Postimplantation expression patterns indicate a role for the mouse forkhead/HNF-3 , and genes in determination of the definitive endoderm, chordamesoderm and neuroectoderm.
Development
119:567-578[Abstract/Free Full Text].
|
| 42.
|
Muller, M., and P. L. Jansen.
1997.
Molecular aspects of hepatobiliary transport.
Am. J. Physiol.
272:G1285-G1303[Abstract/Free Full Text].
|
| 43.
|
Nolten, L. A.,
P. H. Steenbergh, and J. S. Sussenbach.
1996.
The hepatocyte nuclear factor 3 stimulates the transcription of the human insulin-like growth factor I gene in a direct and indirect manner.
J. Biol. Chem.
271:31846-31854[Abstract/Free Full Text].
|
| 44.
|
Overdier, D. G.,
A. Porcella, and R. H. Costa.
1994.
The DNA-binding specificity of the hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues adjacent to the recognition helix.
Mol. Cell. Biol.
14:2755-2766[Abstract/Free Full Text].
|
| 45.
|
Pani, L.,
X. B. Qian,
D. Clevidence, and R. H. Costa.
1992.
The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3 involves a cell-specific factor and positive autoactivation.
Mol. Cell. Biol.
12:552-562[Abstract/Free Full Text].
|
| 46.
|
Peterson, R. S.,
D. E. Clevidence,
H. Ye, and R. H. Costa.
1997.
Hepatocyte nuclear factor-3 promoter regulation involves recognition by cell-specific factors, thyroid transcription factor-1 and autoactivation.
Cell Growth Differ.
8:69-82[Abstract].
|
| 47.
|
Pierreux, C. E.,
J. Stafford,
D. Demonte,
D. K. Scott,
J. Vandenhaute,
R. M. O'Brien,
D. K. Granner,
G. G. Rousseau, and F. P. Lemaigre.
1999.
Antiglucocorticoid activity of hepatocyte nuclear factor-6.
Proc. Natl. Acad. Sci. USA
96:8961-8966[Abstract/Free Full Text].
|
| 48.
|
Poli, V.
1998.
The role of C/EBP isoforms in the control of inflammatory and native immunity functions.
J. Biol. Chem.
273:29279-29282[Free Full Text].
|
| 49.
|
Powell-Braxton, L.,
P. Hollingshead,
C. Warburton,
M. Dowd,
S. Pitts-Meek,
D. Dalton,
N. Gillett, and T. A. Stewart.
1993.
IGF-I is required for normal embryonic growth in mice.
Genes Dev.
7:2609-2617[Abstract/Free Full Text].
|
| 50.
|
Qian, X.,
U. Samadani,
A. Porcella, and R. H. Costa.
1995.
Decreased expression of hepatocyte nuclear factor 3 during the acute-phase response influences transthyretin gene transcription.
Mol. Cell. Biol.
15:1364-1376[Abstract].
|
| 51.
|
Rajkumar, K.,
D. Barron,
M. S. Lewitt, and L. J. Murphy.
1995.
Growth retardation and hyperglycemia in insulin-like growth factor binding protein-1 transgenic mice.
Endocrinology
136:4029-4034[Abstract].
|
| 52.
|
Rausa, F.,
U. Samadani,
H. Ye,
L. Lim,
C. F. Fletcher,
N. A. Jenkins,
N. G. Copeland, and R. H. Costa.
1997.
The cut-homeodomain transcriptional activator HNF-6 is coexpressed with its target gene HNF-3 in the developing murine liver and pancreas.
Dev. Biol.
192:228-246[CrossRef][Medline].
|
| 53.
|
Rausa, F. M.,
L. Galarneau,
B. I. L, and R. H. Costa.
1999.
The nuclear receptor fetoprotein transcription factor is coexpressed with its target gene HNF-3 in the developing murine liver intestine and pancreas.
Mech. Dev.
89:185-188[CrossRef][Medline].
|
| 54.
|
Raymondjean, M.,
A. L. Pichard,
C. Gregori,
F. Ginot, and A. Kahn.
1991.
Interplay of an original combination of factors: C/EBP, NFY, HNF-3 and HNF-1 in the rat aldolase B gene promoter.
Nucleic Acids Res.
19:6145-6153[Abstract/Free Full Text].
|
| 55.
|
Rechler, M. M.
1993.
Insulin-like growth factor binding proteins.
Vitam. Horm.
47:1-114[Medline].
|
| 56.
|
Ruiz i Altaba, A.,
V. R. Prezioso,
J. E. Darnell, and T. M. Jessell.
1993.
Sequential expression of HNF-3 and HNF-3 by embryonic organizing centers: the dorsal lip/node, notochord and floor plate.
Mech. Dev.
44:91-108[CrossRef][Medline].
|
| 57.
|
Samadani, U., and R. H. Costa.
1996.
The transcriptional activator hepatocyte nuclear factor six regulates liver gene expression.
Mol. Cell. Biol.
16:6273-6284[Abstract].
|
| 58.
|
Samadani, U.,
X. Qian, and R. H. Costa.
1996.
Identification of a transthyretin enhancer sequence that selectively binds the hepatocyte nuclear factor-3 isoform.
Gene Expression
6:23-33[Medline].
|
| 59.
|
Sasaki, H., and B. L. Hogan.
1993.
Differential expression of multiple fork head related genes during gastrulation and axial pattern formation in the mouse embryo.
Development
118:47-59[Abstract].
|
| 60.
|
Shim, E. Y.,
C. Woodcock, and K. S. Zaret.
1998.
Nucleosome positioning by the winged helix transcription factor HNF3.
Genes Dev.
12:5-10[Abstract/Free Full Text].
|
| 61.
|
Sjogren, K.,
J. L. Liu,
K. Blad,
S. Skrtic,
O. Vidal,
V. Wallenius,
D. LeRoith,
J. Tornell,
O. G. Isaksson,
J. O. Jansson, and C. Ohlsson.
1999.
Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice.
Proc. Natl. Acad. Sci. USA
96:7088-7092[Abstract/Free Full Text].
|
| 62.
|
Smit, J. J.,
A. H. Schinkel,
R. P. Oude Elferink,
A. K. Groen,
E. Wagenaar,
L. van Deemter,
C. A. Mol,
R. Ottenhoff,
N. M. van der Lugt,
M. A. van Roon,
M. A. van der Valk,
G. J. Offerhaus,
A. J. Berns, and P. Borst.
1993.
Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease.
Cell
75:451-462[CrossRef][Medline].
|
| 63.
|
Torchia, E. C.,
S. K. Cheema, and L. B. Agellon.
1996.
Coordinate regulation of bile acid biosynthetic and recovery pathways.
Biochem. Biophys. Res. Commun.
225:128-133[CrossRef][Medline].
|
| 64.
|
Trauner, M.,
P. J. Meier, and J. L. Boyer.
1998.
Molecular pathogenesis of cholestasis.
N. Engl. J. Med.
339:1217-1227[Free Full Text].
|
| 65.
|
Tsutsui, T.,
B. Hesabi,
D. S. Moons,
P. P. Pandolfi,
K. S. Hansel,
A. Koff, and H. Kiyokawa.
1999.
Targeted disruption of CDK4 delays cell cycle entry with enhanced p27(Kip1) activity.
Mol. Cell. Biol.
19:7011-7019[Abstract/Free Full Text]
|
| 66.
|
Unterman, T. G.,
A. Fareeduddin,
M. A. Harris,
R. G. Goswami,
A. Porcella,
R. H. Costa, and R. G. Lacson.
1994.
Hepatocyte nuclear factor-3 (HNF-3) binds to the insulin response sequence in the IGF binding protein-1 (IGFBP-1) promoter and enhances promoter function.
Biochem. Biophys. Res. Commun.
203:1835-1841[CrossRef][Medline].
|
| 67.
|
Unterman, T. G.,
D. T. Oehler,
M. B. Gotway, and P. W. Morris.
1990.
Production of the rat type 1 insulin-like growth factor binding protein (rIGFBP-1) by well-differentiated H4EIIC3 hepatoma cells: identification, purification, and N-terminal amino acid analysis.
Endocrinology
127:789-797[Abstract/Free Full Text].
|
| 68.
|
Vallet, V.,
B. Antoine,
P. Chafey,
A. Vandewalle, and A. Kahn.
1995.
Overproduction of a truncated hepatocyte nuclear factor 3 protein inhibits expression of liver-specific genes in hepatoma cells.
Mol. Cell. Biol.
15:5453-5460[Abstract].
|
| 69.
|
Vos, T. A.,
G. J. Hooiveld,
H. Koning,
S. Childs,
D. K. Meijer,
H. Moshage,
P. L. Jansen, and M. Muller.
1998.
Up-regulation of the multidrug resistance genes, Mrp1 and Mdr1b, and down-regulation of the organic anion transporter, Mrp2, and the bile salt transporter, Spgp, in endotoxemic rat liver.
Hepatology
28:1637-1644[CrossRef][Medline].
|
| 70.
|
Wang, N. D.,
M. J. Finegold,
A. Bradley,
C. N. Ou,
S. V. Abdelsayed,
M. D. Wilde,
L. R. Taylor,
D. R. Wilson, and G. J. Darlington.
1995.
Impaired energy homeostasis in C/EBP knockout mice.
Science
269:1108-1112[Abstract/Free Full Text].
|
| 71.
|
Wang, D. P.,
D. Stroup,
M. Marrapodi,
M. Crestani,
G. Galli, and J. Y. Chiang.
1996.
Transcriptional regulation of the human cholesterol 7 -hydroxylase gene (CYP7A) in HepG2 cells.
J. Lipid Res.
37:1831-1841[Abstract].
|
| 72.
|
Wang, J. C.,
P. E. Stromstedt,
T. Sugiyama, and D. K. Granner.
1999.
The phosphoenolpyruvate carboxykinase gene glucocorticoid response unit: identification of the functional domains of accessory factors HNF3 (hepatic nuclear factor-3 ) and HNF4 and the necessity of proper alignment of their cognate binding sites.
Mol. Endocrinol.
13:604-618[Abstract/Free Full Text].
|
| 73.
|
Weinstein, D. C.,
A. Ruiz i Altaba,
W. S. Chen,
P. Hoodless,
V. R. Prezioso,
T. M. Jessell, and J. Darnell, Jr.
1994.
The winged-helix transcription factor HNF-3 is required for notochord development in the mouse embryo.
Cell
78:575-588[CrossRef][Medline].
|
| 74.
|
Wu, H.,
M. Wade,
L. Krall,
J. Grisham,
Y. Xiong, and T. Van Dyke.
1996.
Targeted in vivo expression of the cyclin-dependent kinase inhibitor p21 halts hepatocyte cell-cycle progression, postnatal liver development and regeneration.
Genes Dev.
10:245-260[Abstract/Free Full Text].
|
| 75.
|
Yakar, S.,
J. L. Liu,
B. Stannard,
A. Butler,
D. Accili,
B. Sauer, and D. LeRoith.
1999.
Normal growth and development in the absence of hepatic insulin-like growth factor I.
Proc. Natl. Acad. Sci. USA
96:7324-7329[Abstract/Free Full Text].
|
| 76.
|
Yan, C.,
R. H. Costa,
J. E. Darnell, Jr.,
J. D. Chen, and T. A. Van Dyke.
1990.
Distinct positive and negative elements control the limited hepatocyte and choroid plexus expression of transthyretin in transgenic mice.
EMBO J.
9:869-878[Medline].
|
| 77.
|
Ye, H.,
A. Holterman,
K. W. Yoo,
R. R. Franks, and R. H. Costa.
1999.
Premature expression of the winged helix transcription factor HFH-11B in regenerating mouse liver accelerates hepatocyte entry into S-phase.
Mol. Cell. Biol.
19:8570-8580[Abstract/Free Full Text].
|
| 78.
|
Zaret, K.
1999.
Developmental competence of the gut endoderm: genetic potentiation by GATA and HNF3/fork head proteins.
Dev. Biol.
209:1-10[CrossRef][Medline].
|
| 79.
|
Zhou, L.,
L. Lim,
R. H. Costa, and J. A. Whitsett.
1996.
Thyroid transcription factor-1, hepatocyte nuclear factor-3 , surfactant protein B, C, and Clara cell secretory protein in developing mouse lung.
J. Histochem. Cytochem.
44:1183-1193[Abstract].
|
Molecular and Cellular Biology, November 2000, p. 8264-8282, Vol. 20, No. 21
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wederell, E. D., Bilenky, M., Cullum, R., Thiessen, N., Dagpinar, M., Delaney, A., Varhol, R., Zhao, Y., Zeng, T., Bernier, B., Ingham, M., Hirst, M., Robertson, G., Marra, M. A., Jones, S., Hoodless, P. A.
(2008). Global analysis of in vivo Foxa2-binding sites in mouse adult liver using massively parallel sequencing. Nucleic Acids Res
36: 4549-4564
[Abstract]
[Full Text]
-
Wang, M., Chen, M., Zheng, G., Dillard, B., Tallarico, M., Ortiz, Z., Holterman, A.-X.
(2008). Transcriptional activation by growth hormone of HNF-6-regulated hepatic genes, a potential mechanism for improved liver repair during biliary injury in mice. Am. J. Physiol. Gastrointest. Liver Physiol.
295: G357-G366
[Abstract]
[Full Text]
-
Petrovic, V., Costa, R. H., Lau, L. F., Raychaudhuri, P., Tyner, A. L.
(2008). FoxM1 Regulates Growth Factor-induced Expression of Kinase-interacting Stathmin (KIS) to Promote Cell Cycle Progression. J. Biol. Chem.
283: 453-460
[Abstract]
[Full Text]
-
Lamba, J., Lamba, V., Strom, S., Venkataramanan, R., Schuetz, E.
(2008). Novel Single Nucleotide Polymorphisms in the Promoter and Intron 1 of Human Pregnane X Receptor/NR1I2 and Their Association with CYP3A4 Expression. Drug Metab. Dispos.
36: 169-181
[Abstract]
[Full Text]
-
Rise, M. L, Douglas, S. E, Sakhrani, D., Williams, J., Ewart, K V., Rise, M., Davidson, W. S, Koop, B. F, Devlin, R. H
(2006). Multiple microarray platforms utilized for hepatic gene expression profiling of GH transgenic coho salmon with and without ration restriction.. J Mol Endocrinol
37: 259-282
[Abstract]
[Full Text]
-
Dai, C., Stolz, D. B., Bastacky, S. I., St.-Arnaud, R., Wu, C., Dedhar, S., Liu, Y.
(2006). Essential Role of Integrin-Linked Kinase in Podocyte Biology: Bridging the Integrin and Slit Diaphragm Signaling. J. Am. Soc. Nephrol.
17: 2164-2175
[Abstract]
[Full Text]
-
Cheng, A., Zhang, M., Crosson, S. M., Bao, Z. Q., Saltiel, A. R.
(2006). Regulation of the Mouse Protein Targeting to Glycogen (PTG) Promoter by the FoxA2 Forkhead Protein and by 3',5'-Cyclic Adenosine 5'-Monophosphate in H4IIE Hepatoma Cells. Endocrinology
147: 3606-3612
[Abstract]
[Full Text]
-
Kim, I.-M., Zhou, Y., Ramakrishna, S., Hughes, D. E., Solway, J., Costa, R. H., Kalinichenko, V. V.
(2005). Functional Characterization of Evolutionarily Conserved DNA Regions in Forkhead Box F1 Gene Locus. J. Biol. Chem.
280: 37908-37916
[Abstract]
[Full Text]
-
Besnard, V., Wert, S. E., Kaestner, K. H., Whitsett, J. A.
(2005). Stage-specific regulation of respiratory epithelial cell differentiation by Foxa1. Am. J. Physiol. Lung Cell. Mol. Physiol.
289: L750-L759
[Abstract]
[Full Text]
-
Zollner, G., Wagner, M., Fickert, P., Geier, A., Fuchsbichler, A., Silbert, D., Gumhold, J., Zatloukal, K., Kaser, A., Tilg, H., Denk, H., Trauner, M.
(2005). Role of nuclear receptors and hepatocyte-enriched transcription factors for Ntcp repression in biliary obstruction in mouse liver. Am. J. Physiol. Gastrointest. Liver Physiol.
289: G798-G805
[Abstract]
[Full Text]
-
Kim, I.-M., Ramakrishna, S., Gusarova, G. A., Yoder, H. M., Costa, R. H., Kalinichenko, V. V.
(2005). The Forkhead Box M1 Transcription Factor Is Essential for Embryonic Development of Pulmonary Vasculature. J. Biol. Chem.
280: 22278-22286
[Abstract]
[Full Text]
-
Hashimoto, T., Nakamura, T., Maegawa, H., Nishio, Y., Egawa, K., Kashiwagi, A.
(2005). Regulation of ATP-sensitive Potassium Channel Subunit Kir6.2 Expression in Rat Intestinal Insulin-producing Progenitor Cells. J. Biol. Chem.
280: 1893-1900
[Abstract]
[Full Text]
-
Scassa, M. E., Guberman, A. S., Ceruti, J. M., Canepa, E. T.
(2004). Hepatic Nuclear Factor 3 and Nuclear Factor 1 Regulate 5-Aminolevulinate Synthase Gene Expression and Are Involved in Insulin Repression. J. Biol. Chem.
279: 28082-28092
[Abstract]
[Full Text]
-
Halmos, B., Basseres, D. S., Monti, S., D'Alo, F., Dayaram, T., Ferenczi, K., Wouters, B. J., Huettner, C. S., Golub, T. R., Tenen, D. G.
(2004). A Transcriptional Profiling Study of CCAAT/Enhancer Binding Protein Targets Identifies Hepatocyte Nuclear Factor 3{beta} as a Novel Tumor Suppressor in Lung Cancer. Cancer Res.
64: 4137-4147
[Abstract]
[Full Text]
-
Jung, D., Hagenbuch, B., Fried, M., Meier, P. J., Kullak-Ublick, G. A.
(2004). Role of liver-enriched transcription factors and nuclear receptors in regulating the human, mouse, and rat NTCP gene. Am. J. Physiol. Gastrointest. Liver Physiol.
286: G752-G761
[Abstract]
[Full Text]
-
Major, M. L., Lepe, R., Costa, R. H.
(2004). Forkhead Box M1B Transcriptional Activity Requires Binding of Cdk-Cyclin Complexes for Phosphorylation-Dependent Recruitment of p300/CBP Coactivators. Mol. Cell. Biol.
24: 2649-2661
[Abstract]
[Full Text]
-
Kalinichenko, V. V., Major, M. L., Wang, X., Petrovic, V., Kuechle, J., Yoder, H. M., Dennewitz, M. B., Shin, B., Datta, A., Raychaudhuri, P., Costa, R. H.
(2004). Foxm1b transcription factor is essential for development of hepatocellular carcinomas and is negatively regulated by the p19ARF tumor suppressor. Genes Dev.
18: 830-850
[Abstract]
[Full Text]
-
Kalinichenko, V. V., Gusarova, G. A., Kim, I.-M., Shin, B., Yoder, H. M., Clark, J., Sapozhnikov, A. M., Whitsett, J. A., Costa, R. H.
(2004). Foxf1 haploinsufficiency reduces Notch-2 signaling during mouse lung development. Am. J. Physiol. Lung Cell. Mol. Physiol.
286: L521-L530
[Abstract]
[Full Text]
-
Wan, H., Kaestner, K. H., Ang, S.-L., Ikegami, M., Finkelman, F. D., Stahlman, M. T., Fulkerson, P. C., Rothenberg, M. E., Whitsett, J. A.
(2004). Foxa2 regulates alveolarization and goblet cell hyperplasia. Development
131: 953-964
[Abstract]
[Full Text]
-
Kalinichenko, V. V., Gusarova, G. A., Tan, Y., Wang, I-C., Major, M. L., Wang, X., Yoder, H. M., Costal, R. H.
(2003). Ubiquitous Expression of the Forkhead Box M1B Transgene Accelerates Proliferation of Distinct Pulmonary Cell Types following Lung Injury. J. Biol. Chem.
278: 37888-37894
[Abstract]
[Full Text]
-
Fuchs, M.
(2003). Bile Acid Regulation of Hepatic Physiology: III. Regulation of bile acid synthesis: past progress and future challenges. Am. J. Physiol. Gastrointest. Liver Physiol.
284: G551-G557
[Abstract]
[Full Text]
-
Trauner, M., Boyer, J. L.
(2003). Bile Salt Transporters: Molecular Characterization, Function, and Regulation. Physiol. Rev.
83: 633-671
[Abstract]
[Full Text]
-
Clotman, F., Lannoy, V. J., Reber, M., Cereghini, S., Cassiman, D., Jacquemin, P., Roskams, T., Rousseau, G. G., Lemaigre, F. P.
(2003). The onecut transcription factor HNF6 is required for normal development of the biliary tract. Development
129: 1819-1828
[Abstract]
[Full Text]
-
Rausa, F. M., Tan, Y., Costa, R. H.
(2003). Association between Hepatocyte Nuclear Factor 6 (HNF-6) and FoxA2 DNA Binding Domains Stimulates FoxA2 Transcriptional Activity but Inhibits HNF-6 DNA Binding. Mol. Cell. Biol.
23: 437-449
[Abstract]
[Full Text]
-
Wang, X., Kiyokawa, H., Dennewitz, M. B., Costa, R. H.
(2002). The Forkhead Box m1b transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration. Proc. Natl. Acad. Sci. USA
99: 16881-16886
[Abstract]
[Full Text]
-
Banks, K. E., Anderson, A. L., Tang, H., Hughes, D. E., Costa, R. H., McLachlan, A.
(2002). Hepatocyte Nuclear Factor 3{beta} Inhibits Hepatitis B Virus Replication In Vivo. J. Virol.
76: 12974-12980
[Abstract]
[Full Text]
-
Wang, X., Krupczak-Hollis, K., Tan, Y., Dennewitz, M. B., Adami, G. R., Costa, R. H.
(2002). Increased Hepatic Forkhead Box M1B (FoxM1B) Levels in Old-aged Mice Stimulated Liver Regeneration through Diminished p27Kip1 Protein Levels and Increased Cdc25B Expression. J. Biol. Chem.
277: 44310-44316
[Abstract]
[Full Text]
-
Foucher, I., Volovitch, M., Frain, M., Kim, J. J., Souberbielle, J.-C., Gan, L., Unterman, T. G., Prochiantz, A., Trembleau, A.
(2002). Hoxa5 overexpression correlates with IGFBP1 upregulation and postnatal dwarfism: evidence for an interaction between Hoxa5 and Forkhead box transcription factors. Development
129: 4065-4074
[Abstract]
[Full Text]
-
Su, A. I., Guidotti, L. G., Pezacki, J. P., Chisari, F. V., Schultz, P. G.
(2002). Gene expression during the priming phase of liver regeneration after partial hepatectomy in mice. Proc. Natl. Acad. Sci. USA
99: 11181-11186
[Abstract]
[Full Text]
-
Wang, H., Gauthier, B. R., Hagenfeldt-Johansson, K. A., Iezzi, M., Wollheim, C. B.
(2002). Foxa2 (HNF3beta ) Controls Multiple Genes Implicated in Metabolism-Secretion Coupling of Glucose-induced Insulin Release. J. Biol. Chem.
277: 17564-17570
[Abstract]
[Full Text]
-
Phan, J., Pesaran, T., Davis, R. C., Reue, K.
(2002). The Diet1 Locus Confers Protection against Hypercholesterolemia through Enhanced Bile Acid Metabolism. J. Biol. Chem.
277: 469-477
[Abstract]
[Full Text]
-
Matsukawa, T., Inoue, Y., Oishi, Y., Kato, H., Noguchi, T.
(2001). Up-Regulation of Upstream Stimulatory Factors by Protein Malnutrition and Its Possible Role in Regulation of the IGF-Binding Protein-1 Gene. Endocrinology
142: 4643-4651
[Abstract]
[Full Text]
-
Wang, X., Quail, E., Hung, N.-J., Tan, Y., Ye, H., Costa, R. H.
(2001). Increased levels of forkhead box M1B transcription factor in transgenic mouse hepatocytes prevent age-related proliferation defects in regenerating liver. Proc. Natl. Acad. Sci. USA
98: 11468-11473
[Abstract]
[Full Text]
-
Lim, L., Kalinichenko, V. V., Whitsett, J. A., Costa, R. H.
(2002). Fusion of lung lobes and vessels in mouse embryos heterozygous for the forkhead box f1 targeted allele. Am. J. Physiol. Lung Cell. Mol. Physiol.
282: L1012-L1022
[Abstract]
[Full Text]
-
Kalinichenko, V. V., Zhou, Y., Shin, B., Stolz, D. B., Watkins, S. C., Whitsett, J. A., Costa, R. H.
(2002). Wild-type levels of the mouse Forkhead Box f1 gene are essential for lung repair. Am. J. Physiol. Lung Cell. Mol. Physiol.
282: L1253-L1265
[Abstract]
[Full Text]