INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The basic functional unit of the thyroid is the thyroid follicle; thyrotropin (TSH) is thought to be its primary regulator of function, in concert with insulin and insulin-like growth factor 1 (IGF-1). The function of each follicle is, however, heterogeneous, despite its being exposed to the same hormonal milieu in the blood. Recently it was shown that accumulated thyroglobulin (TG) in the follicular lumen is a feedback suppressor of hormonally increased thyroid function and plays a significant role in follicular heterogeneity (52-55). Thus, follicular TG selectively suppresses RNA levels of thyroid-specific proteins; the sodium iodide symporter (NIS), thyroid peroxidase (TPO), TG, and the TSH receptor (TSHR) (52-55). Suppression is transcriptional rather than being caused by changes in RNA stability, since TG decreases the promoter activity of the NIS, TG, TPO, and TSHR genes (51-55) concordantly with decreases in their RNAs. The suppressive effect of follicular TG is not duplicated by thyroid hormones or iodide nor by bovine serum albumin (BSA) or immunoglobulin (52, 54, 55). The ability of follicular TG to suppress the thyroid-specific proteins is explained by its ability to suppress the transcription activity, RNA, and protein levels of three thyroid-restricted transcription factors regulated by TSH or insulin-IGF-1, i.e., thyroid transcription factor 1 (TTF-1), Pax-8, and TTF-2, but not ubiquitous transcription factors which can also regulate the thyroid-specific genes (52-55). Thus, negative-feedback regulation by follicular TG counteracts the action of TSH or insulin-IGF-1, and TG transcriptional activity helps maintain a dynamic balance of follicular function necessary for thyroid hormone homeostasis (53, 55).

The ability of TG to suppress thyroid-restricted transcription factors is mediated by TG binding to a receptor on the apical surface of cells surrounding the follicular lumen of the thyroid follicle (51-56). This receptor is thought to be an asialoglycoprotein receptor (ASGPR), similar in structure to the liver ASGPR and previously associated with vectorial transport of TG to the follicular lumen (9, 10, 29, 37, 48, 58; F. Pacifico, N. Montuori, L. Ulianich, B. Di Jeso, L. Nitsch, L. Kohn, S. Formisano, and E. Consiglio, submitted for publication). Thus, TG binding to the ASGPR and the repressive action of TG are coordinately attenuated by neuraminidase treatment of the cells (9, 56) and coordinately effected by different macromolecular multimers of TG (9, 10, 56). Most importantly, TG suppression is abolished by an antibody against the ASGPR (56).

Specific signaling pathways activated by TG binding to the apical receptor and potentially involved in repression are under investigation (56). In this study, however, we addressed the molecular mechanism by which follicular TG modulates gene expression. We used TTF-1 as a prototypic thyroid-restricted transcription factor, since it is a major transcriptional regulator of the TG (8, 14, 50), NIS (15, 43), TPO (16, 38), and TSHR (7, 30, 49) genes. We hoped that this study would also help clarify the mechanisms which control constitutive TTF-1 gene expression and ultimately allow us to trace the TG signaling path in the reverse direction. In this report, we show that TG decreases the expression and binding of the nuclear factor I (NFI) family of proteins to the TTF-1 5'-flanking region and that NFI is a positive regulator of TTF-1 gene expression, controlling TTF-1 constitutive expression.

NFI was initially identified as a cellular factor that stimulates in vitro replication of adenovirus DNA (20, 21, 35) but was subsequently shown to play an important role in RNA transcription (5, 22, 47). The NFI family consists of four highly conserved genes (four subtypes) whose protein products are able to homodimerize and heterodimerize (18, 33). Additionally, each gene gives rise to alternatively spliced transcripts that potentially encode a number of different isoforms (17, 33, 46). The existence of a number of structurally different NFI proteins, their differential expression, and the involvement of NFI binding sites in cell-specific gene expression (5, 17, 22, 47) suggested that individual isoforms might have distinct functions. Surprisingly, and in contrast to other reports describing the contribution of these proteins to constitutive gene expression (6, 44), we show that all NFI RNAs (NFI-A, -B, -C, and -X) are transcriptionally regulated in thyrocytes and are repressible by follicular TG, which is a tissue-specific protein.

(Part of this work was presented at the 81st Annual Meeting of The Endocrine Society, abstr. OR-8-3, 1999.)

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Materials. Bovine follicular TG was prepared by salt extraction of sliced, fresh thyroid glands, ammonium sulfate precipitation, and gel filtration chromatography on Sephacryl S-300 (Amersham Pharmacia Biotech, Uppsala, Sweden) in 0.1 M potassium phosphate (pH 7.4) (9, 10). The source of all other materials was the same as reported previously (51, 52, 54, 56).

Cells. Buffalo rat liver 3A (BRL-3A) cells (ATCC CRL 1442) were grown in Ham's F-12 medium supplemented with 5% fetal calf serum. Nonfunctioning rat FRT thyroid cells (1) and the F1 subclone of FRTL-5 thyrocytes (Interthyr Research Foundation, Baltimore, Md.) (ATCC CRL 8305), which are diploid and have all the functional properties previously detailed (12, 24, 51-56), were grown in Coon's modified Ham's F-12 medium supplemented with 5% calf serum, 2 mM glutamine, and 1 mM nonessential amino acids. FRTL-5 cell medium also includes a six-hormone mixture (6H medium) containing bovine TSH (10¹⁰ M), insulin (10 µg/ml), cortisol (0.4 ng/ml), transferrin (5 µg/ml), glycyl-L-histidyl-L-lysine acetate (10 ng/ml), and somatostatin (10 ng/ml).

RNA isolation and Northern analysis. RNA was prepared using RNeasy Mini Kits (Qiagen Inc., Valencia, Calif.) and the method described by the manufacturer. For Northern blots, 20-µg portions of different RNA samples were run on denatured agarose gels, capillary blotted onto Nytran membranes (11 by 14 cm; Schleicher & Schuell), UV cross-linked, and subjected to hybridization. Probes were prepared by reverse transcription-PCR (RT-PCR) (see below). An amplified cDNA was purified from an agarose gel by using a Jetsorb kit (Genomed Inc.) and was labeled with [-³²P]dCTP by using a Ladderman labeling kit (Takara Biochemical Inc., Berkeley, Calif.). Membranes were hybridized and washed as described previously (54).

RT-PCR. cDNA was synthesized using an Advantage RT-for-PCR Kit (Clontech Laboratories Inc., Palo Alto, Calif.). PCR was performed by "touchdown" PCR (13) using a GeneAmp 9600 PCR apparatus (Perkin-Elmer Corp., Norwalk, Conn.), Pfu DNA polymerase (Stratagene, La Jolla, Calif.), FRTL-5 cell RNA, and the following forward and reverse primer pairs (5'  3', respectively): NFI-A, GGAATTCATGTATTCTCCGCTCTGTC and GGAATTCTTTTATCCCAGGTACCAGG; NFI-B, ATGGATCCCATGATGTATTCTCCC and ATGGATCCTCAGTTGCTTGTCTCCG; NFI-C, GGAATTCATGTATTCCTCCCCGCTCTG and GGAATTCGTCCTAATCCCACAAAGGG; NFI-X, GGAATTCGATGTACTCCCCGTACTGC and GGAATTCTCAGAAAGTTGCTGTCCCG; TTF-1, ACCTTACCAGGACACCATGC and TACTTCTGCTGCTTGAAGCG; and -actin, AGCCATGTACGTAGCCATCC and TGTGGTGGTGAAGCTGTAGC. The forward and reverse primers (5'  3', respectively) used to generate a specific probe for each NFI subtype were as follows: NFI-A, GGAATTCACACAGCATCACCGAC and GGAATTCCAACACTGACGAATCGG; NFI-B, GGAATTCACTTTTCCCCAGCACCAC and GGAATTCCAGTGGATGTAGTGATGG; NFI-C, GGGAATTCACACAACACCACAGGC and GGAATTCTGTCATTGCCATTGAGC; and NFI-X, GGAATTCATCAAGTGACCCTGGGAC and GGAATTCTGCTGTGGGATGTTCAG. In each case, these sequences crossed an intron-exon boundary. Each primer used for amplification of NFI cDNA contained a restriction enzyme site in its 5' end (which is underlined), EcoRI for NFI-A, -C, and -X and BamHI for NFI-B, which was used to facilitate subcloning. All inserts were sequenced using a DNA-sequencing kit (PE Applied Biosystems, Warrington, Great Britain) and a sequencing apparatus (PE Applied Biosystems).

Plasmids. Rat TTF-1 promoter-luciferase constructs were prepared by PCR amplification of 5' untranslated sequences of the TTF-1 gene. Amplified genomic fragments using a rat genomic clone as a template (42) were ligated into pGL3-Basic vector (Promega, Madison, Wis.) and sequenced.

Transient-expression analysis. A DEAE procedure was used to transfect promoter-luciferase gene constructs and expression plasmids into FRTL-5 cells, and an electroporation procedure was used to transfect FRT and BRL-3A cells. Briefly, FRTL-5 cells were grown in six-well plastic plates to about 70% confluency, washed with 2 ml of serum-free culture medium (6H0 medium), and exposed to 800 µl of a premade plasmid-DEAE mixture. The plasmid-DEAE mixture was prepared by incubating 3 µg of plasmid DNA, unless otherwise noted in individual experiments, with 40 µl of 20× DEAE (5 Prime3 Prime, Inc., Boulder, Colo.) and 760 µl of 6H0 medium for 15 min at room temperature. FRTL-5 cells were incubated with this mixture for 2 h at 37°C in a CO₂ incubator, and then 2 ml of 6H5 medium was added.

Nuclear extracts. A previously described method (24) was modified to prepare extracts from small numbers of cells. Cells were washed, scraped into 1 ml of PBS at pH 7.4, pelleted in a microcentrifuge, and resuspended in 5 volumes of buffer A (20 mM HEPES-KOH [pH 7.9], 10 mM KCl, 2 mM MgCl₂, 0.1 mM EDTA) containing 0.3 M sucrose and 2% Tween 40. To release nuclei, cells were repetitively pipetted (100 to 200 times) using a micropipette with a yellow tip (200-µl capacity). Samples were overlaid on 1 ml of 1.5 M sucrose in buffer A and microcentrifuged for 10 min at 4°C. Pelleted nuclei were washed with 1 ml of buffer A, centrifuged for 30 s, and resuspended in 50 µl of buffer B (20 mM HEPES-KOH [pH 7.9], 420 mM NaCl, 2 mM MgCl₂, 0.2 mM EDTA, 25% glycerol). Samples were incubated on ice for 30 min with occasional vortexing and microcentrifuged for 20 min at 4°C. Buffers A and B also contained 0.5 mM dithiothreitol (DTT), 0.5 mM phenylmethylsulfonyl fluoride, 2 ng of pepstatin A per ml, and 2 ng of leupeptin per ml. The supernatant was dialyzed for use in DMSA or DNase I protection assays and frozen in small aliquots at 70°C. Nuclear extracts for redox experiments were prepared without 0.5 mM DTT.

DNase I protection analysis. Genomic fragments were synthesized by PCR and subcloned into pBluescript SKII. The plasmid was digested with either BglII or HindIII, end labeled with [-³²P]ATP and T4 polynucleotide kinase, and then recut with either HindIII or BglII. The probe was purified on an 8% native polyacrylamide gel. In DNase I protection analysis, 30 µg of nuclear extract was incubated for 15 min on ice in 20 µl of binding buffer [20 mM HEPES-KOH (pH 7.9), 50 mM KCl, 2 mM MgCl₂, 0.1 mM EDTA, 1 µg of poly(dI-dC)-poly(dI-dC)] and incubated for 20 min in the presence of 50,000 cpm of probe. The mixture was treated with 1 U of DNase I (Promega) for 5 min on ice before the addition of 80 µl of stopping solution (20 mM Tris-HCl [pH 8.0], 250 mM NaCl, 20 mM EDTA, 0.5% sodium dodecyl sulfate [SDS], 10 µg of proteinase K, 4 µg of sonicated calf thymus DNA). After incubation at 37°C for 15 min, samples were phenol-chloroform extracted, ethanol precipitated, and separated on an 8% sequencing gel.

DMSA. Oligonucleotides were labeled with [-³²P]ATP and T4 polynucleotide kinase. DMSA was performed using 3 µg of nuclear extracts or 20 ng of recombinant NFI. In some applications, a 50-fold molar excess of unlabeled oligonucleotide was added to the mixtures during a 15-min preincubation. In others, the 15-min preincubation included a polyclonal rabbit antiserum to NFI-A or its preimmune counterpart. A ³²P-labeled oligonucleotide probe (50,000 cpm) was added, and the incubation was continued for 20 min at room temperature. Mixtures were analyzed on 5% native polyacrylamide gels and autoradiographed.

Western analysis. Nuclear extracts (15 µg) were boiled in SDS sample loading buffer (2% SDS, 10% glycerol, 100 mM dithiothreitol, 50 mM Tris-HCl [pH 6.8]) for 5 min. Samples were loaded on a 10% denaturing SDS-Tris-glycine gel (Novex, San Diego, Calif.). After electrophoresis, the proteins were transferred to a nitrocellulose membrane (Novex). The filter was blocked in PBS-T buffer (PBS with 0.6% Tween 20)-10% nonfat milk-1% BSA and then incubated with a primary antibody: an anti-NFI antibody raised against the common N terminus of the NFI isoforms (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) diluted in PBS-T containing 1% nonfat milk. The filter was washed with PBS-T, probed with peroxidase-conjugated anti-rabbit immunoglobulin G (Santa Cruz), washed with PBS-T, and then developed using an enhanced chemiluminescence reagent (Amersham Pharmacia Biotech).

Oxidoreductive reactions. Chemical oxidation of the thiols in NFI was performed using diamide (Sigma), an inorganic catalyst of oxidation of thiols (-SH₂) to generate disulfides (-S-S-) (31). Oxidation was carried out on ice for 5 min in DMSA binding buffer without dithiothreitol, after which labeled probe was added. Chemical reduction of the disulfide to thiols was carried out using dithiothreitol at room temperature for 5 min.

Statistical significance. All experiments were repeated at least three times with different batches of cells. Significance between experimental values was determined by two-way analysis of variance; P < 0.05 was considered significant.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Identification of the elements on the TTF-1 promoter that are required for TG suppression of TTF-1 gene expression. Transient transfection and reporter gene analysis were used to identify the area in the TTF-1 5'-flanking region responsible for TG-mediated repression of the rat TTF-1 gene. To do this, we measured the activity of FRTL-5 cells transfected with various TTF-1 promoter-luciferase chimeras harboring 5' deletions of a construct containing 5.1 kb of 5'-flanking region and then exposed for 48 h to medium containing 10 mg of bovine TG or BSA per ml, as well as TSH (Fig. 1). The TG concentration used was previously determined to maximize suppression of TTF-1 RNA and protein levels and was within the physiologic range of TG present in the follicular lumen (51-56).

View larger version (21K): [in this window] [in a new window]   FIG. 1.   An element between bp 264 and 156 of the TTF-1 promoter is required for TG-mediated suppression. The ability of exogenous follicular TG to decrease TTF-1 promoter activity in functioning FRTL-5 thyroid cells was measured by transient-expression analysis. FRTL-5 cells cultured in 6H medium were transfected with 3 µg of TTF-1-luciferase chimeras containing different 5'-flanking region lengths as noted, and then exposed to medium with or without 10 mg of bovine TG per ml which was purified as described in Materials and Methods or to medium with 10 mg of crystalline BSA per ml. Promoter activity was measured 48 h later. (A) The activity of each promoter-chimera is presented relative to the pGL3 Basic plasmid with no TTF-1 promoter insert. (B) The ratio of the promoter activity treated with TG to that treated with an equivalent concentration of BSA is shown; there was no difference in promoter activity in the presence or absence of BSA. Data are the mean and standard deviation (SD) of four different experiments. (C) Schematic representation of the region between bp 264 and 156 of the TTF-1 promoter. The locations of putative NFI and TTF-1 or Pax-8 cis elements are noted. Additionally, oligonucleotides spanning the region, A, B, and C, defined by DNase I protection (Fig. 2) and used in DMSA experiments (Fig. 3), are noted.

View larger version (79K): [in this window] [in a new window]   FIG. 2.   TG treatment decreases the protection of two areas identified by DNase I protection assay in the proximal TTF-1 promoter. The coding (top) and noncoding (bottom) strands of the DNA fragment from bp 264 to 153 of the TTF-1 promoter were end labeled with [-32P]ATP. Footprinting analysis was performed as described in Materials and Methods in the absence (lanes 1, 5, 6, and 9) or presence (lanes 4 and 8) of 30 µg of nuclear extract (N.E.) from FRTL-5 cells treated with 10 mg of TG per ml for 48 h (lanes 4 and 8) or left untreated (lanes 2, 3, and 7). Three protected areas were identified and defined as A, B, and C sites (denoted by black bars). TG treatment results in decreased protection of the B and C sites (compare lanes 2 and 3 with lane 4 and compare lane 7 with lane 8). The extract in lane 2 was from cells with no TSH in the medium; that in lane 3 was from TSH-treated cells. TSH did not significantly alter the protected areas.

View larger version (44K): [in this window] [in a new window]   FIG. 3.   Decreased binding of one or more transcription factors to elements within the B and C sites is closely related to TG repression of TTF-1 gene expression. The 32P-labeled oligonucleotides corresponding to the three protected areas (A, B, and C) detected in footprinting assays were incubated with 3 µg of nuclear extracts from rat liver BRL-3A cells (lanes 1, 6, and 11), nonfunctioning FRT thyrocytes (lanes 2, 7, and 12), and functioning FRTL-5 thyrocytes (lanes 3 to 5, 8 to 10, and 13 to 15). The complexes formed with B and C sites and nuclear extracts from FRTL-5 cells were markedly decreased by TG treatment (compare lane 9 with lane 10 and lane 14 with lane 15). Note that these complexes were not abundant in FRT thyrocytes (lanes 7 and 12). Extracts in lanes 4, 9, and 14 were from FRTL-5 cells exposed to TSH, and those in lanes 3, 8, and 13 were from cells treated with 1010 M TSH. The medium of cells treated with TG also contained 1010 M TSH.

NFI proteins bind to specific cis elements identified in the B and C oligonucleotides. A computer-based search revealed that both the B and C sites contain a putative NFI binding site (Fig. 1B). This was evidenced when the B and C sites were compared to a consensus NFI element (19, 41) (Fig. 4A). Site B, bp 226 to 205, has an incomplete palindromic sequence of NFI consensus site (underlined), and site C, bp 187 to 153, has a complete half-site in a reverse orientation (Fig. 4A, boxed). It has been reported that NFI can bind to a single TGGC sequence (18, 44). Using the B and C site oligonucleotides as probes, we performed competition experiments using nuclear extracts from FRTL-5 cells and nonlabeled oligonucleotides with intact or mutated NFI elements to see if the complexes were with functional NFI elements (Fig. 4A).

View larger version (56K): [in this window] [in a new window]   FIG. 4.   Schematic representation of the NFI consensus sequence, the B and C oligonucleotides identified in DNase I protection assays or DMSA, and mutant or related oligonucleotides used in this study, and identification of NFI binding sites on the B and C oligonucleotides of the TTF-1 proximal promoter. (A) The NFI consensus sequences are those reported previously (18, 19, 41, 44). The TTF-1 B and C region oligonucleotides and their various mutants, which we used in subsequent experiments, are compared to the NFI consensus sites. An oligonucleotide containing NFI binding sequence found on adenovirus DNA, defined as Adeno, is presented, along with its mutations; these were used as specific competitors of NFI binding. (B) DMSA reveals that oligonucleotides with the sequence of sites B and C of the proximal TTF-1 promoter contain NFI binding sites. DMSA was performed using oligonucleotides corresponding to the TTF-1 promoter B and C oligonucleotides as probes and nuclear extracts from FRTL-5 cells. Specific or nonspecific unlabeled competitors listed in panel A were used to confirm the specificity of binding and identify NFI binding sites. Two complexes formed with the B oligonucleotide (arrows 2 and 3) and with the C oligonucleotide (arrows 5 and 6) were identified as NFI proteins at this point, as discussed in the text, based on specific competition or by inhibition and supershift of the complexes with anti-NFI-A. The anti-NFI-A was not specific for this NFI subtype but reacted with all four NFI subtypes in the FRTL-5 cells, as evidenced by Western blotting of the recombinant NFI proteins isolated from the cells.

View larger version (49K): [in this window] [in a new window]   FIG. 5.   NFI proteins in FRTL-5 cells; sequence and expression by in vitro translation. NFI subtypes were cloned by PCR using FRTL-5 cell RNA (see Materials and Methods). Each was sequenced (A) and subjected to in vitro translation (B) as described in Materials and Methods. In vitro translation was performed using 1 µg of expression vector carrying full cDNA sequences of each NFI subtype and [35S]methionine as described in Materials and Methods. All proteins had the molecular masses expected from the sizes of the open reading frames.

View larger version (33K): [in this window] [in a new window]   FIG. 6.   The NFI elements identified in the B and C regions of the TTF-1 minimal promoter bind recombinant NFI proteins, and all NFI subtypes can bind to the B or C sites and generate a specific set of complexes involving combinations of homo- and heterodimers. (A) To confirm that NFI proteins, not NFI-like proteins, bind to both sites B and C in the minimal TTF-1 promoter, DMSA was performed using bacterially expressed NFI proteins and radiolabeled oligonucleotides with the sequence of each site. The representative result shown in this panel uses recombinant NFI-A protein and radiolabeled B site oligonucleotide as a probe (lane 1). Binding is inhibited by an unlabeled self-oligonucleotide or by unlabeled C oligonucleotide with intact NFI sites (lanes 2, 3, 8, 10, and 11) but not if these unlabeled competitors had an NFI site mutation (lane 3 and 9). An unrelated oligonucleotide containing no sequence similarity other than the NFI site, Adeno, also was inhibitory (lane 5) except if there was an NFI mutation (lane 6). See Fig. 4A for sequences of these oligonucleotides and their mutations. Identical binding results were found using recombinant NFI-B, -C, and -X proteins and with all recombinant NFI proteins and the radiolabeled C site oligonucleotide as probe. Incubations and DMSA were performed as in Fig. 3. (B) The labeled B site oligonucleotide was incubated with nuclear extracts from COS-7 cells transfected with various combinations of expression plasmids for each NFI subtype and subjected to DMSA. The E arrow shows the complex generated with endogenous NFI proteins from COS-7 cells. Note that even by adding nuclear extracts transfected with all four NFI subtypes in the binding solution, the major complexes appeared to be two bands, just as seen in DMSA using nuclear extracts from FRTL-5 cells. Incubations and DMSA were performed as in Fig. 3. The results in panels A and B are representative of three separate experiments with different batches of cells and extracts.

Functional roles of the two NFI binding elements on the minimal TTF-1 promoter. To characterize the roles of the NFI binding elements, we constructed heterologous promoter-luciferase chimeric plasmids by inserting one or three copies of the B or C site oligonucleotides into a plasmid with an SV40 promoter (Fig. 7A, top). FRTL-5, FRT, and BRL-3A cells were transfected with each chimera, and the luciferase activity was measured 48 h after transfection. In FRTL-5 cells, the constructs with the B site oligonucleotide caused higher activity as a function of copy number (Fig. 7A). The increase in promoter activity caused by inserting this element 5' to the SV40 promoter was weaker in BRL-3A cells and minimal in FRT cells (Fig. 7A). The increase in promoter activity in FRTL-5 cells was abolished if the B or C site oligonucleotides had an NFI site mutation the same as that eliminating their ability to bind NFI proteins (see below). These results indicate that the B site works as an enhancer in FRTL-5 cells and in BRL-3A cells but has minimal activity in FRT cells. Taken together with the results of DMSA showing a very low level of specific NFI complexes in FRT cells (Fig. 3, lanes 7 and 12), this enhancer activity seems to be related to the abundance of the NFI complexes formed with this fragment. The same results were obtained using constructs containing one or three copies of the C oligonucleotide (data not shown).

View larger version (23K): [in this window] [in a new window]   FIG. 7.   An NFI element works as an enhancer in FRTL-5 cells; both NFI elements are important for maximal expression of the TTF-1 gene as well as TG suppression. (A) We constructed heterologous promoter-luciferase chimeric plasmids by inserting one or three copies of the B elements 5' to the SV40 promoter (top). A 1-µg portion of each chimera or the vector control was transfected into FRTL-5, FRT, and BRL-3A cells, and the luciferase activity was measured 48 h later. Data are the mean and SD of three different experiments. The B element works as an enhancer in FRTL-5 cells and in BRL-3A cells but has minimal activity in FRT cells. (B) The 224-bp TTF-1 promoter-luciferase chimeric plasmid containing two NFI binding sites was used to construct mutant plasmids containing 3-bp substitution mutations of either NFI element (mut.N1 and mut.N2 in Fig. 4A) or both (mut.N1+N2) (top). A 3-µg portion of each chimera was transfected into FRTL-5 cells, and the promoter activity was measured 48 h later in cells exposed or not exposed to 10 mg of purified 19S bovine TG per ml. Data are the mean and SD of three different experiments. Data are expressed as relative light units (R.L.U.), which are arbitrarily defined in each experiment.

All major NFI isoforms enhance TTF-1 promoter activity. Using FRT cells, we cotransfected the bp 224 TTF-1 promoter-luciferase chimera (Fig. 7B) with expression plasmids containing the full-length cDNAs encoding the major NFI proteins (NFI-A, -B, -C, and -X) that we had cloned from FRTL-5 cells (Fig. 5). As noted above, FRT cells had only low levels of NFI-A, -B, -C, and -X, as evidenced by the faint complexes seen with the B and C site oligonucleotides in DMSA (Fig. 3, lanes 7 and 12). All the major NFI isoforms increased TTF-1 promoter activity individually or in combination (Fig. 8A). Significantly, the combinations containing NFI-A had a greater transactivation activity, suggesting that heterodimers containing NFI-A play an important role in maximal TTF-1 gene expression (Fig. 8A). Cotransfection of the NFI vectors with the TTF-1 promoter-reporter plasmid increased promoter activity in a concentration-dependent manner, as illustrated for NFI-A and NFI-B (Fig. 8B). In each case, the same experiment performed side by side with either mut.N1, mut.N2, or mut.N1+N2 had no significant activity, as separately illustrated in Fig. 7B (data not shown). Thus, in the experiment in Fig. 7A, activity with each mutant was not significantly different from that of the pcDNA3 control and in the experiment in Fig. 7B, 2.0 µg of NFI-A or NFI-B had no effect on activity, compared to pcDNA3, using any of the 224 NFI site mutant promoter-luciferase chimeras.

View larger version (20K): [in this window] [in a new window]   FIG. 8.   Cotransfection of all NFI expression vectors with the 224-bp TTF-1 promoter-luciferase chimeric plasmid can increase its promoter activity in a concentration-dependent manner. (A) The 224-bp TTF-1 promoter-luciferase chimeric plasmid was cotransfected with 0.5 µg of the expression vectors for NFI-A, -B, -C, -X, or combinations thereof, into FRT cells which form only faint NFI complexes in DMSA (Fig. 3). The promoter activity was measured 48 h later and expressed as fold activation over the control, whose activity is determined by cotransfection with 0.5 µg of vacant vector. Data are the mean and SD of three different experiments. Note that the combinations containing NFI-A had a greater activity of transactivation. (B) FRT cells were cotransfected with the 224-bp TTF-1 promoter-luciferase chimeric plasmid and different amounts of the expression vectors for NFI-A or NFI-B. Activity was measured as in panel A. Activity in panel A was not significantly different from that of the pcDNA3 control when using the bp 224 TTF-1 promoter-luciferase chimera with 3-bp substitution mutations of either NFI element (mut.N1 and mut.N2 in Fig. 4A and 7B) or both (mut.N1+N2). Similarly, in panel B, 2.0 µg of NFI-A or NFI-B had no effect on activity, compared to pcDNA3, using any of the bp 224 NFI site mutant promoter-luciferase chimeras, i.e., mut.N1, mut.N2, or mut.N1+N2.

TG modulates NFI expression in FRTL-5 cells. To investigate whether all or some of the subtypes of NFI proteins are regulated by TG, we performed Northern analysis using total RNA from FRTL-5 cells maintained in complete medium containing all six hormones including TSH. We used specific probes recognizing the different NFI subtypes and measured their RNA levels as a function of time after treatment of cells with 10 mg of bovine TG per ml (Fig. 9). As early as 4 h after addition of TG to the culture medium, expression of the different NFI subtypes was repressed 50% or more by comparison to control values, except for the larger RNA of NFI-C, which was repressed almost 30% (Fig. 9A to D). At 4 h after TG treatment, the degree of decrease of the levels of the different NFI RNAs was greater than that of TTF-1 RNA, whose levels were 70% of control values (Fig. 9E).

View larger version (39K): [in this window] [in a new window]   FIG. 9.   TG can decrease NFI RNA levels in FRTL-5 cells. FRTL-5 cells cultured in complete 6H medium with TSH were washed, and the incubation was continued in 6H medium containing 10 mg of TG per ml. Before (0 h) or after (4, 12, 24, and 48 h) TG treatment, total RNA was prepared and 20 µg was subjected to Northern analysis. Blots were sequentially hybridized with probes for NFI-A, -B, -C, and -X, TTF-1, and -actin. A representative blot is presented. After quantitative analysis, the ratio of TTF-1 to -actin (E) or of each NFI subtype to -actin (A to D) was calculated. The values are expressed relative to the respective control values (0 h). Data are the mean of three independent experiments.

View larger version (16K): [in this window] [in a new window]   FIG. 10.   TG can decrease NFI protein levels in FRTL-5 cells. (A) Western analysis was performed using an NFI-specific antibody that recognizes common amino acid sequences of all NFI subtypes, an antibody to actin, and 15 µg of nuclear extracts treated with TG for 48 h or left untreated, as described in Materials and Methods and in parallel to the studies in Fig. 9. A representative blot from one experiment is presented. (B) After quantitative analysis, the ratio of total NFI protein to actin was calculated. The values were compared and expressed relative to the values from extracts from cells which were not exposed to TG. Data are the mean and SD from three independent experiments.

Decreased binding of NFI proteins by nuclear extracts from cells treated with TG is restored by higher concentrations of DTT in the binding assay mixture. Although DMSA revealed that TG treatment for 48 h caused a major decrease in the formation of NFI complexes with the NFI elements in oligonucleotides B and C of the minimal TTF-1 promoter (Fig. 3, lanes 10 and 11), NFI proteins were still detectable in FRTL-5 cell nuclear extracts by Western analysis, using NFI-specific antibody (Fig. 10). To investigate additional mechanisms that might be involved in the decreased binding of NFI proteins, we first examined the possibility of regulation by phosphorylation. Treatment of nuclear extracts with potato acid phosphatase or calf intestinal phosphatase and with various phosphatase inhibitors had no effect in DMSA (data not shown).

View larger version (59K): [in this window] [in a new window]   FIG. 11.   The binding of all NFI subtypes is regulated by their redox state; TG regulates the redox state. (A) DMSA was performed using the radiolabeled B site oligonucleotide and nuclear extracts from COS-7 cells transfected with the expression plasmids of each NFI subtype. An arrow shows the complex generated with endogenous NFI proteins from COS-7 cells. Nuclear extracts were treated with 2 mM diamide in lanes 1, 4, 7, and 10, with 2 mM DTT in lanes 3, 6, 9, and 12, and with neither diamide nor DTT in lanes 2, 5, 8, and 11. The DNA binding activity of all NFI subtypes was markedly attenuated by oxidizing reagent and considerably increased by reducing reagent. (B) Nuclear extracts from exogenously expressed NFI-A protein from COS-7 cells were incubated with 0.5 mM (lane 1), 1.0 mM (lane 2), and 2.0 mM (lanes 3 to 6) diamide, incubated with increasing amounts of DTT for 48 h (lanes 3 to 6), and subjected to DMSA. An arrow shows the complex generated with endogenous NFI proteins from COS-7 cells. To a large extent, high concentrations of DTT restored the DNA binding of NFI proteins from FRTL-5 cells treated with TG (compare lanes 4 and 5). (C and D) Nuclear extracts from FRTL-5 cells which were not treated with TG were incubated with increasing amounts of DTT (C, lanes 1 to 4) and compared to extracts from cells treated with follicular TG for 48 h and also incubated with increasing amounts of DTT (D, lanes 1 to 4).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The present report addresses two issues. First, it addresses the mechanism by which follicular TG suppresses expression of TTF-1, a critical thyroid-restricted transcription factor. Second, it presents evidence for a novel, non-thyroid-specific regulatory mechanism which controls constitutive expression of the tissue-restricted trans factor TTF-1. Although the first issue was our initial and primary question at the start of these experiments, the second became an unexpected integral part of understanding the TG results. We therefore discuss our findings on constitutive TTF-1 gene expression first.

Previous studies demonstrated that TTF-1 plays a critical role in thyroid morphogenesis (28) and in the regulation of a number of genes critically involved in thyroid function. Thus, TTF-1 regulates the gene expression of all known thyroid-specific or -restricted proteins: NIS, TPO, TG, and TSHR (7, 8, 15, 16, 30, 36, 38, 49, 52-55). TSH-cAMP and follicular TG can each down regulate TTF-1 gene expression (24, 30, 49, 51-56); however, little is known about what regulates TTF-1 constitutive expression.

TTF-1 contains major transcription start sites on the proximal 5'-flanking region (23, 36), but alternative transcription start sites located far upstream of the proximal promoter have also been reported (39). In the course of our studies to define elements on the TTF-1 5'-flanking region that are involved in the ability of follicular TG to suppress TTF-1 expression (see below), we noted that TG suppression involved the proximal 5'-flanking region, bp 257 to 156. We then showed that this region has two NFI sites within nucleotides 233 to 202 and 192 to 153 and that their deletion eliminates constitutive TTF-1 expression. The NFI elements within these regions serve as enhancers of TTF-1 gene expression and function by binding all four major NFI proteins present in functioning thyrocytes: NFI-A, NFI-B, NFI-C, and NFI-X. Consistent with this, we show that overexpression of each up regulates TTF-1 promoter activity.

The TTF-1-proximal promoter does not have a functioning TATA box. In genes without a TATA box, initiation of RNA polymerase II-directed transcription is mediated by DNA sequence-specific activator proteins that can interact with components of the transcription initiation complex. NFI is a family of constitutive and sequence-specific binding proteins which stimulate transcription in many promoters (5, 17, 22, 47) and interact with TFIIB (27), one of the important components of the transcription machinery. Although we show that both NFI binding sites are important for maximal expression of TTF-1 gene, they are not equivalent. The most proximal site lies between the major and minor transcription start sites of the proximal promoter of the TTF-1 gene, bp 198 and 125 with respect to the translation initiation codon (23, 36), and its mutation (mut.N2) can alone abolish TTF-1 promoter activity and the binding of NFI proteins to the NF-1 element. For these reasons, we suggest the NFI sites may be essential for transcription initiation of the TTF-1 gene and constitutive expression. NFI-A data are consistent with this suggestion.

Thus, it has been reported that a motif with the amino acid sequence SPTSPSY, existing in a core domain of NFI-CTF1, is important for transcriptional activation and is strongly related to the heptapeptide repeat, YSPTSPS, present in the carboxy-terminal domain of RNA polymerase II (26, 27, 57). When we cloned the NFI subtypes expressed in FRTL-5 cells, only NFI-A had a similar sequence motif, SPTSPTY. The data in this report, which show that NFI-A significantly increases NFI transactivation activity when present along with other NFI subtypes, would be consistent with a role in transcription initiation. This is under investigation.

Since NFI proteins are ubiquitous, they may regulate TTF-1 gene expression not only in thyrocytes but also in other cells where TTF-1 is expressed. Two points are notable in this respect. First, nonfunctioning FRT thyrocytes have low levels of NFI able to activate the activity of a 224-bp TTF-1 promoter construct containing two NFI binding sites. The low levels of NFI in these cells, along with low levels of TTF-1 expression, raise the possibility that negative regulation of NFI expression or a failure in NFI expression may be an important factor in determining a thyroid-specific, or perhaps even a tissue-specific, phenotype. Second, although TSH can decrease TTF-1 gene expression (24, 30, 49), the effect of TSH does not seem to be mediated by NFI proteins or elements, given their identical protection and binding by nuclear extracts from cells exposed or not exposed to TSH. The role of the TTF-1 or Pax-8 site and the SP1 site in the region between bp 257 and 153 and their role in TSH-cAMP suppression of TTF-1 are not known and are the subject of work in progress.

As pointed out above, we started this work to examine the molecular mechanism by which TG suppresses thyroid-restricted transcription factor gene expression. We used TTF-1 as a prototype thyroid-restricted transcription factor because it regulated NIS, TSHR, TG, and TPO gene expression. Suppression of thyroid-restricted or -specific transcription factors by follicular TG is thought to be an important means by which thyroid homeostasis is maintained and by which the thyroid is able to secrete thyroid hormones in a regulated manner. Follicular TG is the feedback regulator counteracting the transcriptional actions of TSH (51-55).

In this report we demonstrate that TG decreases the expression of all NFI subtypes in FRTL-5 thyroid cells. Thus, the RNAs of all NFI subtypes are decreased after 4 h of TG treatment as an early response to TG and, with one exception, the RNA levels are lower than control values 48 h after TG treatment. We show that there is an associated decrease in NFI protein levels and correlate these decreases with the decrease in TTF-1 RNA levels. Thus, 48 h after TG treatment, the molecular weights of the dominant NFI subtypes changed concomitant with changes in their RNA levels and the total NFI protein levels decreased to almost 60% of control values. We show that NFI-A has the strongest transactivation activity when present with other NFI subtypes, and we currently think that regulation of NFI-A is at the core of the mechanism by which TG suppresses TTF-1 gene expression levels. We also believe that the change in the amount of the dominant NFI subtypes, rather than a change in the NFI isoforms, is the major action of TG, since we did not detect changes in the sizes of cDNA fragments generated by RT-PCR using mRNAs treated with TG (data not shown).

The TG-induced decreases in NFI RNA and protein levels account in part for decreases in the levels of NFI complexes with NFI cis elements that we show exist on the proximal promoter and that we associate with decreased TTF-1 gene expression. This results in decreased TTF-1 gene expression because NFI elements and their binding of NFI controls constitutive expression and normally enhances TTF-1 gene expression. In short, TG acts by down regulating constitutive TTF-1 expression by its action on NFI proteins.

Although decreases in NFI complex levels were detected in DMSA using nuclear extracts from FRTL-5 cells treated with TG for 48 h, NFI proteins were still detectable in Western blots, suggesting that TG caused a potential posttranslational modification of the NFI subtypes, which contributed to decreased binding. It had been reported that the DNA binding activity of NFI is regulated by redox (3, 4, 40) and phosphorylation (11) reactions. We tested both possibilities and showed that treatment of nuclear extracts with oxidizing reagent can almost abolish the binding ability of all NFI subtypes; this decrease is reversed by DTT. While the mechanism of oxidative inactivation of DNA binding by NFI has been studied extensively in vitro (3, 4, 40), the physiological relevance of the reversible oxidation of NFI proteins is still not clear. Nevertheless, in this report, we demonstrate that excess reducing agent can restore the decreased NFI binding ability of nuclear extracts from FRTL-5 cells treated with TG toward the normal value. This suggests that the change of the redox state of NFI proteins may be another factor in TG action; i.e., TG-decreased NFI binding and TG-decreased TTF-1 gene expression might be partially caused by the ability of TG to increase the oxidized state of NFI proteins. In a separate report we show that this effect is specific for TG and is not mimicked by transforming growth factor , which can down regulate TTF-1 expression by a different effect on NFI proteins (unpublished data).

It remains to be determined how TG changes the intracellular redox status and whether this phenomenon is relevant to in vivo regulation of thyrocyte function by follicular TG. Given that TG is a substrate for oxidation in the generation of thyroid hormone, TG could be functioning to stimulate an oxidative "burst" that generates reactive oxygen species that could oxidize NFI and other transcription factors. While this mechanism is speculative, it would be a relatively simple mechanism of coupling NFI activity levels to the level of TG. Of interest, we have observed that TG-decreased binding of NFI protein is more apparent when using nuclear extracts from aged FRTL-5 cells, i.e., cells passaged more than 20 times (data not shown). The suggestion that aged FRTL-5 cells are more sensitive to oxidative stress and oxidative changes in NFI proteins may be physiologically relevant in the context of aged cells in general.

In sum, this report describes the possible mechanism to explain how follicular TG suppresses the gene expression of TTF-1, which is one of the important thyroid-restricted transcription factors controlling thyroid-specific expression of critical genes controlling thyroid function. We show that NFI sites and NFI binding control constitutive TTF-1 gene expression even in the presence of TSH-cAMP, which can independently decrease TTF-1 gene expression. We further show that the ability of TG to decrease this binding is associated with suppression of TTF-1 gene expression. We describe two mechanisms for decreased NFI binding, a decrease in the profile of dominant NFI subtypes, particularly a decrease in the NFI-A subtype, and an increase in their oxidative state. We do not know if this mechanism will be a general phenomenon for all thyroid-restricted transcription factors, nor do we know if it will be generalized to all cells that can interact with TG and have TTF-1 as an important regulatory factor. Nevertheless, we anticipate that further pursuit of these findings, i.e., understanding how TG decreases NFI gene expression transcriptionally, will generate a more complete and perhaps a general mechanism for controlling TTF-1 constitutive expression as well as regulation.