Previous Article | Next Article 
Molecular and Cellular Biology, November 2000, p. 8513-8525, Vol. 20, No. 22
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Tyrosine Phosphatase SHP-2 Is Required for Sustained
Activation of Extracellular Signal-Regulated Kinase and Epithelial
Morphogenesis Downstream from the Met Receptor Tyrosine
Kinase
Christiane R.
Maroun,1,2
Monica A.
Naujokas,1,2
Marina
Holgado-Madruga,3
Albert J.
Wong,3,4 and
Morag
Park1,2,5,6,*
Molecular Oncology Group, Royal Victoria
Hospital,1 and Departments of
Medicine,2
Oncology,5 and
Biochemistry,6 McGill University,
Montreal, Quebec, Canada H3A 1A1, and Departments of
Microbiology and Immunology3 and
Pharmacology,4 Kimmel Cancer Institute,
Philadelphia, Pennsylvania 19107
Received 6 March 2000/Returned for modification 28 April
2000/Accepted 21 August 2000
 |
ABSTRACT |
Epithelial morphogenesis is critical during development and wound
healing, and alterations in this program contribute to neoplasia. Met,
the hepatocyte growth factor (HGF) receptor, promotes a morphogenic program in epithelial cell lines in matrix cultures. Previous studies
have identified Gab1, the major phosphorylated protein following Met
activation, as important for the morphogenic response. Gab1 is a
docking protein that couples the Met receptor with multiple signaling
proteins, including phosphatidylinositol-3 kinase, phospholipase C
,
the adapter protein Crk, and the tyrosine specific phosphatase SHP-2.
HGF induces sustained phosphorylation of Gab1 and sustained activation
of extracellular signal-regulated kinase (Erk) in epithelial Madin-Darby canine kidney cells. In contrast, epidermal growth factor
fails to promote a morphogenic program and induces transient Gab1
phosphorylation and Erk activation. To elucidate the Gab1-dependent signals required for epithelial morphogenesis, we undertook a structure-function approach and demonstrate that association of Gab1
with the tyrosine phosphatase SHP-2 is required for sustained Erk
activation and for epithelial morphogenesis downstream from the Met
receptor. Epithelial cells expressing a Gab1 mutant protein unable to
recruit SHP-2 elicit a transient activation of Erk in response to HGF.
Moreover, SHP-2 catalytic activity is required, since the expression of
a catalytically inactive SHP-2 mutant, C/S, abrogates sustained
activation of Erk and epithelial morphogenesis by the Met receptor.
These data identify SHP-2 as a positive modulator of Erk activity and
epithelial morphogenesis downstream from the Met receptor.
 |
INTRODUCTION |
Epithelial morphogenesis plays an
important role during development and wound healing, and understanding
the mechanisms that regulate this function will provide insights into
how alterations in this morphogenic program lead to neoplasia.
Hepatocyte growth factor (HGF) is a mesenchymally derived factor that
has been implicated in epithelial morphogenesis in addition to multiple
other biological functions (15, 25, 30, 42, 67, 72, 80). In
vitro, HGF promotes epithelial cell growth and survival as well as
epithelial-mesenchymal transition, where it stimulates the dissociation
and dispersal of colonies of epithelial cells and the acquisition of a
fibroblastic morphology resulting in increased cellular motility and
invasiveness (25, 42, 74, 80, 82). HGF triggers a
morphogenic program in epithelial cell lines when cultured in a
collagen matrix (41, 65, 74). Increasing evidence
demonstrates an important in vivo role for HGF during the development
of the liver and placenta, as well as in the development and
innervation of skeletal muscle, the ductal growth of mammary explants,
and directing the growth of axonal cones (9, 37, 60, 70,
77). Importantly, the receptor for HGF, the Met tyrosine kinase,
is shown to be deregulated through either gene amplification,
overexpression, or activating point mutations in a number of human
cancers, suggesting that the Met receptor may play an important role in
human tumorigenesis (8, 24, 36, 57, 61).
To characterize signaling pathways downstream from the Met receptor
involved in epithelial morphogenesis, we and others have used receptor
chimeras to demonstrate that the Met receptor cytoplasmic domain is
sufficient for the biological responses attributed to HGF and that Met
tyrosine kinase activity is required for these responses (29, 74,
83). Two tyrosine residues within the carboxyl terminus of Met
(Y1349 and Y1356), which are highly conserved between the other members
of the Met receptor tyrosine kinase gene family, Sea and Ron, are
crucial for cell scatter and epithelial morphogenesis in Madin-Darby
canine kidney (MDCK) epithelial cells (29, 48, 58, 74, 83).
Y1356 forms a multisubstrate-binding site, coupling the Met receptor
with the Grb2 and Shc adapter proteins, as well as the Cbl
proto-oncogene and the Grb2-associated binder 1 (Gab1) (10-12,
44, 51, 73).
Gab1 was initially identified in a library screen as a Grb2 binding
protein and belongs to a family of docking proteins, including closely
related proteins Gab2 and Daughter of Sevenless (DOS) and the more
remotely related insulin receptor substrate 1 (IRS-1), IRS-2, IRS-3,
downstream of kinases (Dok), and fibroblast growth factor (FGF)
receptor substrate 2 (FRS2) (6, 16, 18, 21, 54, 75, 78, 81).
These proteins lack enzymatic activities. Following activation of
tyrosine kinase and cytokine receptors, they become phosphorylated on
tyrosine residues, providing binding sites for multiple proteins
involved in signal transduction. In this manner they act to potentiate
and diversify the signals downstream from receptors by virtue of their
ability to assemble multiprotein complexes. Furthermore, these proteins
contain, in the amino terminus, a domain that allows for membrane
recruitment. Many docking proteins contain a pleckstrin homology (PH)
domain, as is the case for Gab1, and their association with
phospholipids results in the targeting of proteins to membrane
subdomains (reviewed in references 17, 34, 35, 39,
and 62). Other docking proteins, like FRS2, are
targeted to the membrane via a myristoylation signal (31).
In addition, several of these proteins contain a phosphotyrosine binding (PTB) domain that promotes association with specific receptor tyrosine kinases. Gab1 lacks a known PTB domain, and instead, its
association with the Met or epidermal growth factor (EGF) receptor may
be both direct and indirect and requires a proline-rich domain defined
as the Met binding domain and the association of these receptors with
the Grb2 adapter protein (44, 55, 73).
Murine Gab1 contains 18 tyrosine residues, some of which, if
phosphorylated, provide potential binding sites for SH2 or PTB domain-containing proteins. We have previously demonstrated that Gab1
is highly phosphorylated following stimulation of epithelial cells with
HGF and couples with the p85 subunit of phosphatidylinositol-3 kinase
(PI3K) and associated kinase activity, phospholipase C
(PLC
1),
and the tyrosine phosphatase SHP-2 (38, 44). MDCK cells
expressing Met receptor mutants with decreased ability to recruit Gab1
fail to form branching tubules upon Met activation. Importantly,
overexpression of Gab1 rescues the tubulogenesis defect of these
mutants (38). To investigate the mechanism through which
Gab1 mediates this function, we undertook a structure-function analysis
of Gab1 and demonstrated that the Gab1 PH domain is essential to target
Gab1 to sites of cell-cell contact in the vicinity of the Met receptor
in epithelial cells and is also essential for the ability of Gab1 to
promote epithelial morphogenesis downstream from the Met receptor
(38).
Gab1 is phosphorylated downstream from multiple receptors, including
the EGF, insulin, and TrkA receptors, as well as members of the
cytokine family interleukin-3 (IL-3), IL-6, alpha and gamma interferon
receptors, and T- and B-cell antigen receptors (21-23, 45,
68). Insight into the mechanism through which Gab1 could modulate
distinct biological signals has revealed that Gab1 is phosphorylated
with distinct kinetics. Gab1 is phosphorylated for a prolonged period
of time (>60 min) downstream from the Met receptor, where it promotes
branching morphogenesis of MDCK epithelial cells, whereas Gab1 is
transiently phosphorylated (15 min) in response to EGF, which fails to
induce a morphogenic program (38). Furthermore, while
extracellular signal-regulated kinase (Erk) activity is sustained in
response to HGF and parallels Gab1 phosphorylation, EGF-stimulated Erk
activity is transient (28). Overexpression of Gab1
potentiates Erk activation downstream from the EGF receptor (55), suggesting that Gab1 provides a link from receptor
tyrosine kinases to Erk activation. However, it remained unclear if
Gab1 provided a link from the Met receptor tyrosine kinase to Erk
activation and if Gab1 was required for sustained Erk activity.
The tyrosine specific phosphatase SHP-2 is recruited to Gab1 following
HGF stimulation. However, its role in the regulation of Met-mediated
signaling pathways and biological activities has remained undefined.
Accumulating evidence implicates SHP-2 as a positive regulator of Erk
activity downstream from receptor tyrosine kinases (4, 5, 7, 43,
47, 69). In Drosophila, genetic studies place the
homologue of SHP-2, Corkscrew, as a positive regulator of Erk activity
in a pathway downstream from receptor tyrosine kinases (18,
54), and in Xenopus oocytes, SHP-2 activity was
required for full Erk activation in response to FGF (47).
Moreover, fibroblasts derived from SHP-2 exon 3
/
mice
have decreased ability to activate Erk in response to EGF and
platelet-derived growth factor (PDGF) (53, 63). SHP-2 contains two tandem SH2 domains followed by a phosphatase domain. Following growth factor stimulation, SHP-2 is recruited through its SH2
domain directly to the EGF or PDGF receptors or indirectly via a
docking protein, FRS2, to the FGF receptor and becomes phosphorylated on tyrosine residues (26, 31, 43, 65, 66). Both tyrosine phosphorylation of SHP-2 and binding of its SH2 domains to tyrosine phosphorylated peptides enhance its catalytic activity (32, 49,
71), possibly through the release of negative regulatory constraints on the phosphatase domain mediated by the SH2 domains of
SHP-2 (3, 20).
In this paper we describe our investigation of the contribution of
Gab1-associated SHP-2 to Met biological activity. We show that the
interaction of Gab1 with SHP-2 is necessary for epithelial morphogenesis and for the sustained activation of Erk by the Met receptor. Importantly, the expression of a catalytically inactive SHP-2
protein (C/S) abrogates both epithelial tubulogenesis and sustained Erk
activation, demonstrating that SHP-2 phosphatase activity is required
for its function downstream from the Met receptor tyrosine kinase.
 |
MATERIALS AND METHODS |
Cell culture and DNA transfections.
MDCK cells were
maintained in Dulbecco's modified Eagle's medium (DMEM) containing
10% fetal bovine serum (FBS). The generation of MDCK cell lines
expressing the wild-type colony-stimulating factor (CSF)-Met receptor
and mutants thereof by retroviral infection has been previously
described (12, 82). For the generation of stable cell lines
expressing wild-type and mutant hemagglutinin (HA)-tagged Gab1, the
Gab1 cDNA was cloned into the pCDNA1.1+ vector and was
cotransfected with a PLXSH vector, which confers resistance to
hygromycin, by the calcium phosphate method as described elsewhere
(76). Cell lines were selected in hygromycin (300 µg/ml).
For transient transfection assays, 293T cells were seeded at
106/100-mm-diameter petri dish and were transfected 24 h later with 2 µg of plasmid DNA encoding wild-type Gab1 without or
with CSF-Met cDNA following the calcium phosphate precipitation method.
Sixteen hours later, cells were washed twice in DMEM lacking FBS and
were cultured for 24 h in medium containing 10% FBS, following
which the cells were serum starved in 0.02% FBS overnight and then harvested.
Antibodies and reagents.
Antibodies raised in a rabbit
against a C-terminal peptide of human Met were used (56).
Antibodies raised in a rabbit against full-length murine Gab1 were
generated. Anti-p85 was kindly provided by T. Pawson, Mount Sinai
Hospital, University of Toronto, Toronto, Ontario, Canada.
Antiphosphotyrosine (4G10) was obtained from Upstate Biotechnology
Incorporated, Lake Placid, N.Y. Anti-HA (HA.11) was purchased from
BABCO, Richmond, Calif., and anti-SOSn, anti-Grb2, and anti-AKT
(sc-1618) were purchased from Santa Cruz Biotechnology, Inc. Anti-Shc
was kindly provided by J. Bergeron, McGill University, Montreal,
Quebec, Canada, and anti-SHP-2 was kindly provided by G.-S. Feng,
Indiana University School of Medicine, Indianapolis, Ind.
Anti-phospho-Akt and anti-phospho-Erk were purchased from New England
Biolabs, and total Erk (p44Erk1 and p42Erk2)
antibody was a gift from J. Blenis, Harvard Medical School, Boston,
Mass. prCMV vector encoding wild-type SHP-2 was kindly provided by S. Ali, McGill University, and CEP4 vector encoding the SHP-2 C/S mutant
was kindly provided by A. Saltiel, Parke Davis/Warner-Lambert Co., Ann
Arbor, Mich. (40).
Site-directed mutagenesis.
Site-directed mutagenesis within
Gab1 was performed using the Chameleon double-stranded site-directed
mutagenesis kit (Stratagene) according to the manufacturer's
instructions. The mutagenesis primers were the following: for Y637F,
ACAAACAAGTCGAATTCCTGGATTTAGAC, and for Y659F,
GGCAGACGAGAGGGTCGACTTCGTTGTGGTGGACC. The mutated sequences are underlined.
HGF stimulation of MDCK cell lines expressing wild-type and
mutant
SHP-2 Gab1.
Cells were seeded at 106 per
100-mm-diameter dish. Twenty-four hours later cells were washed once
with DMEM and then starved overnight in 10 ml of DMEM containing 0.02%
FBS. HGF or CSF was added at 100 U/ml in 2 ml for the indicated times.
Cells were immediately lysed in 1 ml of lysis buffer (50 mM HEPES [pH
7.4], 150 mM NaCl, 10% glycerol, 0.5% Triton X-100, 1 mM
phenylmethylsulfonyl fluoride, 1 µg each of leupeptin and
aprotinin/ml, 1 mM Na3VO4).
Immunoprecipitations and Western blotting.
MDCK cell lysates
(2 mg of total protein) or 293T cell lysates (50 µg) were incubated
with the indicated antibodies for 1 h at 4°C with gentle
rotation. Twenty microliters of a 50% slurry of either protein A or
protein G-Sepharose was added for an additional hour to collect immune
complexes. For the quantitative coimmunoprecipitations of Gab1 with
SHP-2, 500 µg of proteins was subjected to immunoprecipitation with
anti-HA, anti-SHP-2, or anti-Shc as indicated, followed by either
protein A or protein G-Sepharose. The supernatant from this first
immunoprecipitation was sequentially subjected to an incubation with
beads alone and then an immunoprecipitation with the same
antibodies. The resulting supernatant was then again subjected to
protein A- or G-Sepharose beads alone, followed by a final
immunoprecipitation with anti-HA and protein G-Sepharose. Following
three washes in lysis buffer, the proteins were resolved by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
transferred to a nitrocellulose membrane. The membranes were blocked
for 1 h with 3% bovine serum albumin in TBST (10 mM Tris-HCl [pH
7.4], 2.5 mM EDTA, 150 mM NaCl, 0.1% Tween 20) and then with primary
antibody (1:1,000) for an additional hour. Following five washes in
TBST, the proteins were revealed with secondary anti-mouse antibody
(Jackson ImmunoResearch Laboratories, Inc.) or protein A (Amersham)
conjugated to horseradish peroxidase. The proteins were visualized with
an ECL detection system (Amersham). For the determination of Erk and
Akt phosphorylation, 50 µg of total cellular proteins was resolved on
an SDS-10% PAGE gel, transferred to a nitrocellulose membrane, and
immunoblotted with an antibody specific for the activated form of Erk1
and Erk2 or Akt.
GST association assays.
Glutathione S-transferase
(GST) fusion proteins were immobilized on glutathione-Sepharose beads,
incubated with 500 µg of cell lysates from MDCK cells overexpressing
wild-type Gab1, and stimulated or not with 100 U of HGF/ml or 50 µg
of 293T cells transiently expressing CSF-Met and Gab1, as indicated in
the figures. After 2 h on a rotator at 4°C, bound proteins were
washed three times with lysis buffer, boiled in Laemmli buffer,
resolved by SDS-PAGE, and revealed following Western blotting as
described above.
Collagen assays.
The ability of MDCK cells to form branching
tubules was assayed as previously described (82). Briefly,
5 × 103 cells were resuspended in 500 µl of
collagen solution (Vitrogen 100 from Cohesion, Palo Alto, Calif.)
prepared following the manufacturer's instructions and were layered
over 350 µl of the collagen solution in a 24-well plate. Cells were
maintained in Liebowitz medium (GIBCO) containing 5% FBS and were
allowed to form cysts for 5 to 7 days. For stimulations, 5 U of HGF
(kindly provided by G. Vande Woude, Grand Falls, Mich.) per ml or 5 U
of rhCSF-1 (kindly provided by the Genetics Institute, Boston, Mass.)
per ml was added to the Liebowitz medium containing 5% FBS. Tubules
were apparent by light microscopy 5 to 10 days after the addition of growth factors. The medium was changed every 5 days, and photographs were taken at day 14 using Kodak TMY400 films at a magnification of
×10. For quantitation of the morphogenic response, 60 colonies in each
of six independent cultures were scored for the ability to form
branching tubules, and the results were plotted as the average number
of cysts able to undergo tubulogenesis/culture/100.
Immunofluorescence.
MDCK cells overexpressing wild-type Gab1
or the Gab1 mutants were plated on glass coverslips (Bellco Glass Inc.)
in a 24-well dish (Nunc) for the indicated times in DMEM containing
10% FBS. Cells were stimulated with 50 U of HGF per ml for 15 min
where indicated. Cells were fixed in 2% paraformaldehyde in
phosphate-buffered saline (PBS) for 30 min at room temperature, washed
twice in PBS, and incubated for 10 min in PBS containing 50 mM ammonium
chloride. Following one additional wash in PBS, cells were treated with PBS containing 0.1% Triton X-100 and 5% FBS (buffer A) for 10 min at
room temperature. Anti-HA was diluted (1:300) in buffer A, and after
three washes in the same buffer, CY3-conjugated anti-mouse antibody
(1:2,000) was added for 10 min, followed by three washes in buffer A. The glass coverslips were mounted onto slides in Immunofluore medium
(ICN) and visualized using a Nikon Labophot-2 epifluorescence
microscope at a magnification of ×60. Photographs were taken using
Kodak TMZ3200 film. Where indicated, cells were visualized by a Bio-Rad
confocal microscope at a magnification of ×63.
 |
RESULTS |
Activation of the Met receptor tyrosine kinase results in
the association of Gab1 with SHP-2 and SHP-2 tyrosine
phosphorylation.
It has been shown previously that the tyrosine
phosphatase SHP-2 can be recruited to the Met receptor tyrosine kinase
(10); however, the functional significance of this
interaction in epithelial morphogenesis had not been determined. SHP-2
is predominantly recruited to the Met receptor through the docking
protein Gab1. MDCK epithelial cells stably expressing HA epitope-tagged
Gab1 were stimulated with HGF. Lysates were subjected to
immunoprecipitation with antibodies specific for the Grb2 or Shc
adapter protein SOS or SHP-2, followed by Western blotting with
anti-HA, which revealed that Gab1 was highly associated with SHP-2
(Fig. 1A). This was further supported by
quantitative coimmunoprecipitation of Gab1 with SHP-2, where up to 50%
of Gab1 was depleted from HGF-stimulated cells, compared with
unstimulated cells (Fig. 1B). In GST pull-down experiments using
lysates from unstimulated or HGF-stimulated MDCK cells expressing
HA-Gab1, both the individual N-SH2 and C-SH2 domains of SHP-2
associated with Gab1 (Fig. 1C). Together, these results suggest that
either SHP-2 SH2 domain can associate with Gab1 and that this
interaction is phosphotyrosine dependent since both Met activation and
Gab1 phosphorylation are required.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
SHP-2 association with Gab1 is tyrosine phosphorylation
dependent. (A) MDCK cells stably transfected with vector or constructs
that express HA-Gab1 were stimulated for 15 min with 100 U of HGF/ml.
SHP-2, Grb2, SOS, and Shc were immunoprecipitated with specific
antibodies. Proteins resolved by SDS-PAGE were transferred to a
nitrocellulose membrane and immunoblotted with anti-HA. (B) Lysates
from HA-Gab1-expressing cells, stimulated or not with 100 U of HGF/ml,
were subjected to immunoprecipitation as indicated. The resulting
supernatants were subjected to a second round of immunoprecipitation
with the indicated antibodies, followed by a third round of
immunoprecipitation with anti-HA. (C) Lysates from HA-Gab1-expressing
MDCK cells, stimulated or not with 100 U of HGF/ml, were subjected to a
pull-down assay using GST-SHP-2 SH2 domain fusion proteins. Proteins
were resolved by SDS-PAGE, transferred to a nitrocellulose membrane,
and immunoblotted with anti-HA. ip, immunoprecipitate; WT, wild type.
|
|
The tyrosine phosphatase SHP-2 has been demonstrated to be recruited to
and phosphorylated by several receptor tyrosine kinases
(for a review,
see references
43 and
66). Thus,
we determined
whether SHP-2 could be phosphorylated as a consequence of
Met
activation and whether Met and/or Gab1 could act as physiological
substrates for SHP-2. Overexpression of Met in 293T cells results
in
ligand-independent Met activation (
38). In the presence of
activated Met, immunoprecipitation of cotransfected SHP-2 proteins
(Fig.
2A, lane 2) revealed an increase in
the level of tyrosine
phosphorylation of SHP-2 compared to control
cells (Fig.
2A, compare
lanes 2 and 4). Furthermore, the increase in
the tyrosine phosphorylation
of cotransfected SHP-2 was enhanced in
cells expressing a catalytically
inactive mutant SHP-2 C/S protein
(Fig.
2A, lane 3). Importantly,
in the presence of activated Met,
endogenous SHP-2 coprecipitated
with two phosphoproteins: p120 and p150
(Fig.
2A, lane 1). To
investigate whether p150 and p120 corresponded to
Met and Gab1,
respectively, SHP-2 immunoprecipitates were immunoblotted
with
either Met or Gab1 antibodies identifying these proteins as Met
and Gab1 (Fig.
2A). Notably, Gab1 is present in endogenous SHP-2
or Met
immunoprecipitates, suggesting that Gab1 may act as an
intermediate to
recruit SHP-2 to Met (Fig.
2A). HA-Gab1 was highly
phosphorylated on
tyrosine residues in cells coexpressing Met
(Fig.
2B, lane 1). However,
coexpression of SHP-2 resulted in
a prominent decrease in Gab1
phosphorylation that was restored
in cells coexpressing catalytically
inactive C/S SHP-2 (Fig.
2B,
lanes 2 and 3). The level of tyrosine
phosphorylation of Met was
also diminished in cells coexpressing
wild-type SHP-2, in contrast
to cells expressing the C/S SHP-2 mutant.
Taken together, these
results suggest that binding of SHP-2 to Gab1
provides a mechanism
through which SHP-2 can be recruited to the Met
receptor. Moreover,
both the Met receptor and Gab1 could function as
physiological
substrates for SHP-2 in cells where SHP-2 is
overexpressed.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Gab1 can function as a substrate for SHP-2 phosphatase
activity. (A) 293T cells were transiently transfected with vectors
encoding CSF-Met together with either wild-type (WT) SHP-2 or a
catalytically inactive SHP-2 C/S mutant. Lysates were subjected to
immunoprecipitation with anti-SHP-2 and Western blotting with anti-PY,
anti-Met, or anti-Gab1 as indicated. (B) 293T cells were transfected
with vectors encoding CSF-Met, together with either wild-type SHP-2 or
the catalytically inactive SHP-2 C/S mutant, and Gab1. Gab1, Met, and
SHP-2 were immunoprecipitated and immunoblotted, as indicated, with
specific antibodies. ip, immunoprecipitate.
|
|
Gab1-SHP-2 binding mutant fails to rescue branching tubulogenesis
downstream from Met receptor mutants.
Recruitment of Gab1 requires
two tyrosine residues in the C terminus of the Met receptor (Y1349 and
Y1356). Structure-function studies using chimeric CSF-Met receptor
mutants have revealed that receptor mutants impaired in their
association with Gab1 (CSF-Met Y1356F and N1358H) were unable to induce
branching tubules (12, 44, 82). Overexpression of Gab1 in
these cell lines rescued the ability of CSF-Met mutants to promote
branching tubulogenesis in response to CSF-1 (38). Since
Gab1 is highly associated with SHP-2 following Met activation, we
determined the biological function of this interaction by performing
site-directed mutagenesis and studying the biological consequence of
loss of SHP-2 association with Gab1 on epithelial tubulogenesis. Gab1
contains two tyrosine residues with a putative binding capacity for the
SHP-2 SH2 domains. Tyrosine 637 or tyrosine 659 was mutated to
phenylalanine alone or in combination, and the ability of these mutants
to associate with SHP-2 was assessed. Met was coexpressed transiently
with wild-type Gab1 or Gab1
SHP-2 mutants in 293T cells (Fig.
3A). While all Gab1 variant proteins were
expressed at similar levels and were phosphorylated when coexpressed
with Met, SHP-2 was immunoprecipitated only with wild-type Gab1 or the
Y659F Gab1 mutant but not with the Y637F or the Y637/659F mutants (Fig.
3A). These data identify Y637 as crucial for the interaction of Gab1
with SHP-2, and the Gab1-Y637F (Gab1
SHP-2) mutant protein was used
in all subsequent analyses.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 3.
Gab1 SHP-2 mutant fails to rescue branching
tubulogenesis downstream from a Met receptor mutant. (A) 293T cells
were transfected with vectors encoding Gab1 mutants at Y637F and/or
Y659F in the absence or presence of CSF-Met. Lysates were subjected to
immunoprecipitation with anti-HA followed by Western blotting with
either anti-SHP-2, anti-PY or anti-HA. (B) MDCK cells expressing the
CSF-Met receptor mutant N1358H were stably transfected with vectors
encoding wild-type (WT) the Gab1 or Gab1 SHP-2 mutant. Proteins from
cell lysates were immunoprecipitated with anti-HA and resolved by
SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with
anti-HA. (C) Cells expressing wild-type Gab1 (clone 3) and cells
expressing the Gab1 SHP-2 mutant protein (clone 5) were grown in
collagen for 5 days, during which time they formed cysts. RhCSF-1 or
HGF, both at 5 U/ml, were added, and 14 days later branching tubules
were visualized at a magnification of ×10. (D) Quantitation of the
tubulogenic response following stimulation with HGF and CSF was
performed as described in Materials and Methods. The responses are
plotted as the percentage of cysts that have undergone branching
tubulogenesis. The values were derived from three independent
experiments. ip, immunoprecipitate.
|
|
MDCK cells expressing CSF-Met mutant proteins that are unable to
support branching tubules (Y1356F and N1358H CSF-Met) were
stably
transfected with expression vectors encoding Gab1

SHP-2.
Five clones
of each cell line, with similar levels of HA-Gab1
expression, were
selected and assayed for branching tubulogenesis.
While similar results
were obtained with the two Met mutant-expressing
cell lines, data are
shown only for the N1358H cell lines. The
level of expression of Gab1

SHP-2 in the selected cell lines
was similar to that observed in
wild-type HA-Gab1-expressing cells
(Fig.
3B); the tubulogenic response
is shown for one representative
clone (Fig.
3C, clone 5), and the
quantitation of this response
is shown for two clones (Fig.
3D).
Cell lines expressing CSF-Met
mutants N1358H (Fig.
3C) or Y1356F (data
not shown) formed cysts
when grown in a collagen matrix
(
12). Stimulation of the CSF-Met
receptor with CSF did not
induce branching tubulogenesis in these
cells (Fig.
3C and reference
12). However, as previously shown,
overexpression of
wild-type Gab1 rescued the tubulogenic response
(Fig.
3 and reference
38). Importantly, although cell lines
expressing the
Gab1

SHP-2 proteins could form cysts in a collagen
matrix, in all
cell lines tested, branching tubules failed to
develop following
activation of the CSF-Met receptor (0% with
the Gab1

SHP-2 mutant
compared to 48% for cells expressing wild-type
Gab1; Fig.
3C and D).
Interestingly, the expression of Gab1

SHP-2
reduced the ability of
two of these lines (one is shown, clone
5) to form tubules in response
to stimulation of the endogenous
Met receptor with HGF. These results
suggest not only that the
SHP-2 binding site within the Gab1 C terminus
is essential for
rescue of tubulogenesis downstream from CSF-Met
mutants but also
that the expression of this mutant protein per se can
detectably
inhibit the formation of branching tubules induced through
the
wild-type endogenous Met
receptor.
To investigate this possibility, we generated MDCK cells expressing
either wild-type Gab1 or Gab1

SHP-2 mutant proteins and
compared
their abilities to form tubules in response to HGF. The
results are
shown for two cell clones expressing Gab1

SHP-2 (clone
6B and clone
8B). While the levels of expression of Gab1 in the
different
experimental groups were similar (Fig.
4A), the expression
of Gab1

SHP-2
proteins inhibited the ability of HGF to induce
the formation of
tubules to 8 and 19% (Fig.
4B and C). These results
suggest that Gab1

SHP-2 can act dominantly to interfere with
the formation of
branching tubules following Met receptor activation.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 4.
Overexpression of a Gab1 SHP-2 inhibits branching
tubulogenesis downstream from the endogenous Met receptor. (A) Proteins
from lysates of MDCK cells expressing wild-type (WT) Gab1 (clone 9) and
MDCK cells expressing Gab1 SHP-2 mutant proteins (clones 6B and 8B)
were subjected to immunoprecipitation and Western blotting with
anti-HA. (B) Quantitation of the tubulogenic response was performed as
described in Materials and Methods. The responses are plotted as the
percentage of cysts that have undergone branching tubulogenesis. The
values are derived from three independent experiments. (C) Cells were
grown in collagen for 5 days, during which they formed cysts. HGF (5 U/ml) was added, and 14 days later branching tubules were visualized at
a magnification of ×10. ip, immunoprecipitate.
|
|
Loss of SHP-2 binding does not affect Gab1 cellular localization or
interaction with the Met receptor.
We and colleagues have
previously shown that cellular localization of Gab1 to cell-cell
junctions in the vicinity of the Met receptor correlated with the
ability of Gab1 to promote branching tubulogenesis (38).
Gab1 proteins that lack the entire PH domain or have mutations in the
conserved phospholipid binding site within the PH domain fail to rescue
branching tubulogenesis and fail to localize to sites of cell-cell
contact in 10% serum (38, 39). To establish if the
inability of the Gab1
SHP-2 protein to rescue tubulogenesis
reflected an altered cellular localization, the HA-tagged Gab1
SHP-2
proteins stably expressed in MDCK epithelial cells were labeled by
indirect immunofluorescence using anti-HA followed by CY3-conjugated
anti-mouse antibody as a secondary antibody. Both wild-type Gab1 and
Gab1
SHP-2 proteins localized to sites of cell-cell contact,
indicating that the inability to bind SHP-2 did not affect Gab1
localization in colonies of MDCK cells grown in 10% FBS (Fig.
5A). Moreover, we have previously demonstrated that in single cells or small MDCK cell colonies prior to
the formation of phosphatidylinositol 3,4,5-trisphosphate-rich cell-cell junctions, Gab1 was predominantly present in the cytoplasm and, upon stimulation with HGF, relocalized to the membrane. We therefore determined whether the interaction of Gab1 with SHP-2 was a
prerequisite for the HGF-mediated recruitment of Gab1 to the membrane.
As shown in Fig. 5B, recruitment of Gab1 to the membrane was
independent of the association of Gab1 with SHP-2.

View larger version (101K):
[in this window]
[in a new window]
|
FIG. 5.
The cellular localization of Gab1 is not altered in the
absence of a Gab1-SHP-2 interaction. (A) MDCK cells (104
cells) expressing either wild-type (WT) Gab1 or Gab1 SHP-2 mutant
proteins were grown for 72 h on glass coverslips in DMEM
containing 10% FBS. Cells were fixed in 2% paraformaldehyde and were
subjected to indirect immunofluorescence using anti-HA, followed by
CY3-conjugated anti-mouse antibody. Photographs were taken at a
magnification of ×60. (B) MDCK cells (104 cells)
expressing either wild-type Gab1 or Gab1 SHP-2 mutant proteins were
grown overnight on glass coverslips in DMEM containing 10% FBS. Cells
were stimulated with 50 U of HGF/ml prior to fixation and indirect
immunofluorescence with anti-HA, followed by CY3-conjugated anti-mouse
antibody. Results were visualized by confocal microscopy at a
magnification of ×63.
|
|
Furthermore, to establish whether the failure of the Gab1

SHP-2
protein to rescue tubulogenesis in CSF-Met mutant-expressing
cells
resulted from the failure of this mutant protein to be recruited
to the Met receptor, the ability of Gab1

SHP-2 to
coimmunoprecipitate
with wild type or with N1358H or Y1356F
CSF-Met mutants was investigated.
In transient transfections,
wild-type CSF-Met coimmunoprecipitated
with the Gab1

SHP-2 mutant
proteins as efficiently as with wild-type
Gab1 (Fig.
6A). The N1358H and the Y1356F CSF-Met
receptor mutants,
as described previously (
38,
44),
associated less efficiently
with Gab1 than did the wild-type CSF-Met
receptor. Importantly,
the Gab1

SHP-2 mutant was comparable to
wild-type Gab1 in the
efficiency with which it coimmunoprecipitated
with either the
N1358H or Y1356F Met mutant (Fig.
6A). Similar levels
of the various
CSF-Met mutant proteins and similar levels of Gab1
proteins were
expressed in the different experimental groups, although
fewer
Gab1 proteins were expressed in the absence of CSF-Met
cotransfection
(Fig.
6A). Thus, neither inappropriate cellular
localization nor
defective recruitment to the various CSF-Met receptors
could account
for the inability of Gab1

SHP-2 to promote branching
tubulogenesis
downstream from the Met receptor. Interestingly, the Gab1

SHP-2
mutant had a faster electrophoretic mobility compared to
wild-type
Gab1, suggesting that the phosphorylation of Gab1

SHP-2 was decreased
(Fig.
6A).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 6.
The association of wild-type Gab1 and Gab1 SHP-2 with
Met and with p120 RasGAP and Grb2 fusion proteins. (A) 293T cells were
transfected with vectors encoding wild type (WT), N1358H, or Y1356F
CSF-Met receptors together with either wild-type Gab1 or the Gab1
SHP-2 mutant. Lysates were subjected to immunoprecipitation with
anti-HA and blotting with anti-Met, anti-PY, or anti-SHP-2 and
immunoprecipitation with anti-Met, followed by blotting with anti-PY.
Fifty micrograms of total cellular proteins (TCP) was resolved by
SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with
anti-HA or anti-Met. (B) Lysates from A were subjected to a pull-down
experiment using GST-p120 RasGAP N-SH2 and GST-Grb2 SH2 domain fusion
proteins. Associated proteins were resolved by SDS-PAGE, transferred to
a nitrocellulose membrane, and immunoblotted with anti-HA. ip,
immunoprecipitate.
|
|
Kinetics of HGF-stimulated Erk activation are altered in cells
expressing Gab1
SHP-2.
Both genetic and biochemical approaches
support a role for mammalian SHP-2, as well as the
Drosophila and Xenopus homologues, in modulating
the Erk pathway downstream from several receptor tyrosine kinases,
including the insulin, EGF, and FGF receptors (1, 63, 69).
Moreover, Erk activity is essential for branching morphogenesis
(28). We therefore analyzed whether the failure of cells
expressing the Gab1
SHP-2 mutant to undergo branching tubulogenesis
correlated with an alteration in the prolonged activation of Erk
typical of Met receptor stimulation. While similar results were
obtained for cells expressing the N1358H mutant of the CSF-Met receptor
or parental MDCK cells expressing either wild-type Gab1 or Gab1
SHP-2 (data not shown), results are shown for MDCK cells stimulated
with HGF (Fig. 7). Proteins from total
cellular extracts were resolved by SDS-PAGE, transferred to a
nitrocellulose membrane, and probed with an antibody that specifically
recognizes the activated form of Erk (phosphorylated at Thr202 and
Tyr204). Phosphorylation of Erk was observed, which was maintained for
180 min in response to HGF (Fig. 7A). Importantly, in cell lines
expressing Gab1
SHP-2, Erk activation was transient (15 min), while
the total level of Erk was equivalent to that in control cells (Fig.
7A). This occurs despite similar levels of Gab1 expression and kinetics
in the induction of tyrosine phosphorylation of the Gab1
SHP-2
mutant (Fig. 7B). Importantly, similar association of the wild type and Gab1
SHP-2 with the p85 subunit of Pl3K was observed (Fig. 7B). In addition, HGF-mediated activation of protein kinase B/Akt, a
downstream effector of Pl3K, was not altered in cells expressing Gab1
SHP-2 when compared to cells expressing wild-type Gab1 (Fig. 7C).
Hence, the specific reduction in the duration of Erk activity was
consistent with the loss of SHP-2 binding to Gab1.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 7.
Activation of Erk is altered in cells expressing Gab1
SHP-2 mutant proteins. (A) Cell lines expressing either wild-type
(WT) Gab1 (clone 9) or a Gab1 SHP-2 mutant (clone 8B) were
stimulated with 100 U of HGF/ml for the indicated times at 37°C.
Fifty micrograms of total cellular proteins was resolved by SDS-10%
PAGE, transferred to a nitrocellulose membrane, and blotted with
anti-phospho-Erk. Blots were stripped and reprobed with anti-total Erk.
(B) Lysates were subjected to immunoprecipitation with anti-HA followed
by Western blotting with anti-PY, anti-SHP-2, anti-p85 or anti-HA as
indicated. (C) Fifty micrograms of total cellular proteins was resolved
by SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with
anti-phospho-AKT. Blots were stripped and reprobed with anti-total AKT.
ip, immunoprecipitate.
|
|
The Erk pathway has been shown to be positively regulated by Grb2/SOS
and negatively regulated through recruitment of p120
Ras
GTPase-activating protein (p120 RasGAP). Importantly, the
Drosophila SHP-2 homologue, Csw, positively regulates the
Erk
pathway by dephosphorylating a tyrosine residue in the Torso
receptor
tyrosine kinase, which binds to p120 RasGAP (
7). We
therefore
determined whether the mechanism through which Gab1

SHP-2
alters
Erk activation involved modifications in the interaction of Gab1
with the regulators of Erk activity: p120 rasGAP and Grb2. The
analysis
was performed for 293T cells expressing the CSF-Met receptor
and
mutants thereof, together with either wild-type Gab1 or Gab1

SHP-2
as in Fig.
6B. Lysates from these cells were subjected
to GST pull-down
assays using either GST-Grb2-SH2 or GST-p120
RasGAP-SH2 domain fusion
protein. Associated Gab1 was revealed
following Western blotting with
anti-HA. No significant differences
in the ability of Gab1

SHP-2 to
associate with the p120 rasGAP-N-SH2
domain was detected (Fig.
6B).
However, a modest decrease in the
ability of the Grb2-SH2 domain to
associate with Gab1

SHP-2 was
consistently
observed.
Overexpression of a catalytically inactive SHP-2 C/S mutant protein
inhibits tubulogenesis and sustained Erk activation in response to
HGF.
The interaction of Gab1 with SHP-2 was essential for the
ability of Gab1 to rescue branching tubulogenesis downstream from the
Met receptor (Fig. 3). However, this interaction was also critical for
efficient induction of branching tubulogenesis through the endogenous
wild-type Met receptor (Fig. 3 and 4), suggesting that overexpression
of the Gab1
SHP-2 mutant functioned as an inhibitory protein for
tubulogenesis downstream from Met. To establish whether the mechanism
involved in this inhibitory effect was dependent on the recruitment to
Gab1 of a catalytically active SHP-2 protein, we generated five stable
lines of MDCK cells expressing the catalytically inactive SHP-2 C/S
protein and assayed HGF-mediated tubulogenesis. While the assays
performed with the five clones yielded similar results, branching
tubulogenesis and quantitation of this response are shown for two
clones (Fig. 8A and B). Cell lines
expressing the vector and the C/S SHP-2 mutants formed cysts when grown
in a three-dimensional collagen matrix. Following stimulation with HGF,
cells expressing the C/S SHP-2 mutant formed a distinct irregularly shaped cell mass and no organized branching tubules, suggesting that
the phosphatase activity of SHP-2 was critical for epithelial tubulogenesis.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 8.
Catalytic activity of SHP-2 is required for branching
tubulogenesis and sustained Erk activation induced by HGF. MDCK cells
stably expressing SHP-2 C/S were generated (clones C/S-6 and -11). (A)
Cells were grown in collagen for 5 days, during which they formed
cysts. HGF (5 U/ml) was added, and 14 days later branching tubules were
visualized at a magnification of ×10. (B) Quantitation of the
tubulogenic response following stimulation with HGF was performed as
described in Materials and Methods. The responses are plotted as the
percentage of cysts that have undergone branching tubulogenesis. The
values are derived from three independent experiments. (C) MDCK cells
expressing vector control or SHP-2 C/S mutant proteins were stimulated
with 100 U of HGF/ml for the indicated time. Fifty micrograms of total
cellular proteins was resolved on an SDS-10% PAGE gel, transferred to
a nitrocellulose membrane, and blotted for anti-phospho-Erk. Gels were
stripped and reprobed with anti-total Erk.
|
|
We determined whether the kinetics of HGF-mediated Erk activation were
altered in MDCK cells expressing the catalytically
inactive C/S SHP-2
mutant. Stimulation of cells expressing the
vector alone or wild-type
Gab1 with HGF resulted in a marked increase
in the activation of Erk
that was sustained up to 3 h following
stimulation (Fig.
8C). In
contrast, the stimulation of cells expressing
the C/S catalytically
inactive SHP-2 mutant protein showed transient
Erk activation, as did
cells expressing the Gab1

SHP-2 mutant.
Thus, both the inability of
Gab1 to bind SHP-2 and the overexpression
of an SHP-2 catalytically
inactive mutant acted to decrease the
duration of Erk activation
induced by HGF, suggesting that recruitment
of enzymatically competent
SHP-2 to the Met receptor through Gab1
was necessary for sustained Erk
activation and for efficient branching
tubulogenesis.
 |
DISCUSSION |
The Met receptor tyrosine kinase regulates the dispersal of
epithelial sheets in culture and promotes the inherent morphogenic program of epithelia when grown in a collagen matrix. However, it is
unclear how the Met receptor orchestrates the signaling pathways
leading to its pleiotropic biological activities. We and colleagues
have previously demonstrated that the multisubstrate binding protein
Gab1 is required for the initiation of the morphogenic program
(38). In the absence of any catalytic activity, Gab1 functions as a docking protein that, when phosphorylated by Met or
other receptors, recruits multiple signaling proteins (21, 38). Gab1 acts to recruit Pl3K downstream from the Met, EGF, and
TrkA receptors (21, 22, 38). This interaction has been shown
to be essential for the survival of the neuronal PC12 cell line
following stimulation of nerve growth factor (22) but is not
required for the induction of the morphogenic program by Gab1 (38). While other proteins including PLC
1, Crk, and SHP-2
also associate with Gab1, the contribution of these to the biological activities of the Met receptor is unknown (14, 38). We
therefore undertook a structure-function approach to determine the
contribution of SHP-2 in Met-mediated branching tubulogenesis. We show
in this paper that both the interaction of Gab1 with SHP-2 and SHP-2
phosphatase activity are essential for epithelial tubulogenesis
downstream from the Met receptor tyrosine kinase. Moreover, the
recruitment of SHP-2 to Gab1 is required for the sustained activation
of the Erk pathway observed following HGF stimulation of MDCK cells.
SHP-2 is one of the signaling proteins recruited to Gab1 following Met
activation, yet the role of SHP-2 biological activity in epithelial
cell morphogenesis and signaling downstream from the Met receptor has
not been addressed. To investigate the role of this interaction in
Met-mediated signaling pathways involved in epithelial tubulogenesis,
we identified the SHP-2 binding site on Gab1 (Y637) that is
phosphorylated following Met activation (Fig. 3) and show that mutation
of this site results in Gab1 proteins unable to recruit SHP-2. Although
overexpression of SHP-2 results in dephosphorylation of Gab1 (Fig. 2),
mutating the SHP-2 binding site does not enhance Gab1 phosphorylation
in stable cell lines in response to Met activations. Instead, the level
of phosphorylation of the Gab1
SHP-2 mutant protein is lower than
that observed in wild-type Gab1 (Fig. 7). This is consistent with the
observation that the SHP-2 binding site (Y637) in the Gab1 carboxy
terminus is the predominant site of phosphorylation of Gab1 in vitro by a recombinant EGF receptor kinase domain (33). Importantly, the failure to recruit SHP-2 results in the inability of Gab1 to rescue
tubulogenesis in MDCK cells that express mutant CSF-Met receptors,
implying, for the first time, a role for SHP-2 in the morphogenic
response of epithelial cells. In addition, the overexpression of the
Gab1
SHP-2 mutant abrogates tubulogenesis downstream from the
endogenous Met receptor (Fig. 3 and 4), suggesting that overexpressed Gab1
SHP-2 proteins function as dominant inhibitory proteins by
competing with endogenous Gab1 proteins. Importantly, the
overexpression of a catalytically inactive SHP-2 C/S mutant protein
inhibits tubulogenesis by the Met receptor in the presence of wild-type Gab1, implicating SHP-2 catalytic activity in the morphogenic program
(Fig. 8).
The ability of HGF to promote branching tubulogenesis correlates with
the sustained phosphorylation of Gab1 and the prolonged activation of
signaling pathways such as Erk (28, 38). The inhibition of
MEK with a pharmacological agent, PD98059, inhibits tubulogenesis
following HGF stimulation in MDCK cells (28), suggesting
that the tubulogenic response in MDCK cells requires Erk activation.
However, it remained to be determined how the Met receptor regulated
sustained Erk activity. We have shown that the interaction of Gab1 with
SHP-2 is required for the sustained Erk activity in response to HGF
(180 min), whereas epithelial cells that express Gab1 proteins which
fail to associate with SHP-2 display transient activation of Erk (15 min; Fig. 7). Importantly, we show that the kinetics of phosphorylation
of the Gab1
SHP-2 mutant protein is similar to that observed with
wild-type Gab1 (Fig. 7). Moreover, the Gab1
SHP-2 protein associated
with the p85 subunit of Pl3K to a similar extent as wild-type Gab1, and activation of Akt is observed in cells expressing Gab1
SHP-2 or
wild-type Gab1 proteins with similar kinetics (Fig. 7). Hence, mutation
of the SHP-2 binding site of Gab1 did not affect the coupling of Gab1
with the Pl3K signaling pathway, yet resulted in attenuation of the Erk
pathway downstream from Met.
While this paper was in preparation, a role for Gab1 in the activation
of Erk downstream from the EGF receptor was suggested using SHP-2 exon
3
/
fibroblasts (64). However, a Gab1
SHP2
mutant protein was not evaluated (64). Since mutation of the
SHP-2 binding site within the Gab2 multisubstrate docking protein did
not abrogate Erk activation stimulated through the IL-3 receptor
(16), this raised the possibility that Gab1-SHP-2
interactions were not required for Erk activity. Our data provide the
first direct evidence that the recruitment of SHP-2 to Gab1 is
important for Erk activation. This supports data from
Drosophila indicating that the interaction of corkscrew with
DOS, a docking protein related to Gab1, is required for positive
regulation of Erk (1). Moreover, in a manner similar to that
of Gab1, mutation of the SHP-2 binding site on FRS2 compromises activation of Erk and neurite outgrowth in PC12 cells following stimulation with FGF (16), implying an important role for
docking proteins in modulating Erk activity dependent on SHP-2.
A positive role for SHP-2 as a regulator of the Erk pathway has been
proposed based on the observation that SHP-2 is phosphorylated on
tyrosine residues in response to PDGF. This provides a binding site for
the Grb2 adapter protein and hence the ability to form a SHP-2/Grb2/SOS
complex with potential to activate the Ras pathway (5).
However, the overexpression of a SHP-2 mutant that fails to bind the
Grb2 adapter protein has not been shown to alter Erk activation
downstream from several receptor tyrosine kinases, suggesting that this
is unlikely to be a significant mechanism through which SHP-2 can
regulate Erk activity (4, 69). However, since SHP-2 is
phosphorylated following activation of the Met receptor (Fig. 2), and
reduced Grb2 is recruited to the Gab1
SHP2 mutant, we cannot exclude
the possibility that SHP-2 links Met at least in part to Grb2/SOS/Ras.
The phosphatase activity of SHP-2 is required for Erk activation both
in mammalian systems and in lower organisms, such as Drosophila and Xenopus embryos, suggesting that
the dephosphorylation of proteins by SHP-2 may be critical for the
onset of signaling pathways leading to Erk activation (1, 2, 4,
69). Consistent with these observations, we show that the
overexpression of a catalytically inactive SHP-2 mutant abrogates
sustained Erk activation downstream from the Met receptor tyrosine
kinase (Fig. 8). Importantly, the overexpression of the catalytically
inactive SHP-2 C/S mutant also inhibits branching tubulogenesis,
indicating that the phosphatase activity of SHP-2 is required for the
ability of Met-Gab1 to induce branching tubulogenesis in epithelial
cells (Fig. 8).
The Drosophila homologue of SHP-2, Csw, dephosphorylates a
tyrosine residue on the Torso receptor tyrosine kinase that binds to
p120 Ras GAP, thus uncoupling a negative regulator of Ras from the
Torso receptor (7). The dephosphorylation of the
Gab1-related docking protein DOS by Csw has also been implicated in
linking the receptor tyrosine kinase Sevenless to the Ras pathway
(18, 19). Similarly, in cells overexpressing SHP-2, Gab1 can
also act as a substrate for SHP-2 following phosphorylation by the Met
receptor (Fig. 2) and following activation of the EGF receptor (64). This supports the observation that in response to
IL-6, Gab1 is an in vitro substrate for GST fusion protein containing the SHP-2 phosphatase domain (45). Since we have shown that Gab1 can associate with the SH2 domain of p120 RasGAP, it is possible that SHP-2 dephosphorylates tyrosine residues important for the interaction of p120 RasGAP with Gab1. However, either in transient overexpression assays (Fig. 6) or in stable epithelial cell lines expressing Gab1
SHP-2 mutant proteins (not shown), the ability of
Gab1 to associate with a p120 RasGAP SH2 domain fusion protein is not
altered. Thus, under these conditions, the binding site for p120 RasGAP
on Gab1 is not dephosphorylated by SHP-2.
We have shown that either the failure to recruit the SHP-2 phosphatase
to Gab1 or the overexpression of a catalytically inactive SHP-2
phosphatase results in improper epithelial organization in response to
Met activation. This is consistent with studies of SHP-2 exon
3
/
mutant mice, where gastrulation is interrupted due
to inappropriate mesodermal cell migration and organization
(59). Moreover, expression of a dominant negative SHP-2
mutant inhibits elongation of Xenopus animal caps in
response to FGF, a process that involves the reorganization of existing
cells (69). Epithelial morphogenesis requires both cell
proliferation and the remodeling of epithelial junctions (50). MEK-Erk activity is necessary for the breakdown of
adherens junctions in response to HGF (52). Thus, the
transient activation of Erk in cells expressing the Gab1
SHP-2 or
SHP-2 C/S mutant may be insufficient for the remodeling of adherens
junctions and for the cell proliferation required for epithelial
morphogenesis. Both Gab1 and the Met receptor are localized to the
basolateral membranes of polarized epithelial cells in the vicinity of
adherens junctions, and this localization of Gab1 is important for its ability to rescue branching tubulogenesis in cells expressing Met
receptor mutants (38). In a manner similar to that of
wild-type Gab1, the Gab1
SHP-2 protein is localized to sites of
cell-cell contact (38), demonstrating that association with
SHP-2 is not essential for Gab1 subcellular localization (Fig. 5).
However, the inability of SHP-2 to be recruited to Gab1 may itself
result in the failure of SHP-2 to colocalize with Gab1 in the proximity of critical membrane-associated substrates.
Fibroblasts isolated from SHP-2 exon 3
/
mice have
increased numbers of focal adhesions and actin aggregation at the cell
periphery, suggesting that SHP-2 could also play a role in the
regulation of cell spreading and migration on extracellular matrix
(ECM) (46, 79). A class of adhesion proteins, the
signal-regulatory proteins, including SHP substrate 1 and the distantly
related PECAM and PIR-B/p91A proteins, are SHP-2 binding proteins
and may serve as substrates for SHP-2 (13, 27). A role for
SHP-2 in regulating SHP substrate 1 function and integrin signaling has
been proposed, where the catalytic activity of SHP-2 is required for
Erk activation downstream from cell-ECM interactions (46). Hence SHP-2 may modify cell-ECM-dependent Erk signals required for
branching morphogenesis. The determination of substrates
dephosphorylated by SHP-2 that modify epithelial tubulogenesis
downstream from the Met receptor will provide a better understanding of
how these processes are normally controlled and which events lead to
loss of epithelial organization during tumorigenesis.
 |
ACKNOWLEDGMENTS |
This research was supported by an operating grant from the
National Cancer Institute of Canada with funds from the Canadian Cancer
Society (to M.P.), an American Cancer Society grant, and National
Institutes of Health grants NS34514 and CA69495 (to A.J.W.), with a
fellowship from the Medical Research Council (to C.M.) and a fellowship
from the Ministerio de Educacion y Ciencia of Spain (to M.H.-M.). M.P.
is a Scientist of the Medical Research Council of Canada.
We are grateful to G. F. Vande Woude for HGF, the Genetics
Institute for recombinant CSF-1, T. Pawson for anti-p85, G. S. Feng for anti-SHP2, S. Ali for the vector encoding wild-type SHP-2, A. Saltiel for the vector encoding SHP-2 C/S, S. Sadekova for help in
confocal microscopy, and members of the Park laboratory for helpful comments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular
Oncology Group, Royal Victoria Hospital, 687 Pine Ave. West, Rm. H5.10,
Montreal, Quebec, Canada H3A 1A1. Phone: (514) 842-1231, ext. 5845. Fax: (514) 843-1478. E-mail:
morag{at}lan1.molonc.mcgill.ca.
 |
REFERENCES |
| 1.
|
Allard, J. D.,
H. C. Chang,
R. Herbst,
H. McNeill, and M. A. Simon.
1996.
The SH2-containing tyrosine phosphatase corkscrew is required during signaling by sevenless, Ras and Raf.
Development
122:1137-1146[Abstract].
|
| 2.
|
Allard, J. D.,
R. Herbst,
P. M. Carroll, and M. A. Simon.
1998.
Mutational analysis of the SRC homology 2 domain protein-tyrosine phosphatase Corkscrew.
J. Biol. Chem.
273:13129-13135[Abstract/Free Full Text].
|
| 3.
|
Barford, D., and B. G. Neel.
1998.
Revealing mechanisms for SH2 domain-mediated regulation of the protein tyrosine phosphatase SHP-2.
Structure
6:249-254[Medline].
|
| 4.
|
Bennett, A. M.,
S. F. Hausdorff,
A. M. O'Reilly,
R. M. J. Freeman, and B. G. Neel.
1996.
Multiple requirements for SHPTP2 in epidermal growth factor-mediated cell cycle progression.
Mol. Cell. Biol.
16:1189-1202[Abstract].
|
| 5.
|
Bennett, A. M.,
T. L. Tang,
S. Sugimoto,
C. T. Walsh, and B. G. Neel.
1994.
Protein tyrosine phosphatase SHPTP2 couples platelet-derived growth factor receptor to Ras.
Proc. Natl. Acad. Sci. USA
91:7335-7339[Abstract/Free Full Text].
|
| 6.
|
Carpino, N.,
D. Wisniewski,
A. Strife,
D. Marshak,
R. Kobayashi,
B. Stillman, and B. Clarkson.
1997.
p62(dok): a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells.
Cell
88:197-204[CrossRef][Medline].
|
| 7.
|
Cleghon, V.,
P. Feldmann,
C. Ghigilone,
T. D. Copeland,
N. Perrimon,
D. A. Hughes, and D. K. Morrison.
1998.
Opposing actions of CSW and RasGAP modulate the strength of Torso RTK signaling in the Drosophila terminal pathway.
Mol. Cell
2:719-727[CrossRef][Medline].
|
| 8.
|
Di Renzo, M. F.,
R. P. Narsimhan,
M. Olivero,
S. Bretti,
S. Giordano,
E. Medico,
P. Gaglia,
P. Zara, and P. M. Comoglio.
1991.
Expression of the Met/HGF receptor in normal and neoplastic human tissues.
Oncogene
6:1997-2003[Medline].
|
| 9.
|
Ebens, A.,
K. Brose,
E. D. Leonardo,
M. G. J. Hanson,
F. Bladt,
C. Birchmeier,
B. A. Barres, and M. Tessler-Lavigne.
1996.
Hepatocyte growth factor/scatter factor is an axonal chemoattractant and a neurotrophic factor for spinal motor neurons.
Neuron
17:1157-1172[CrossRef][Medline].
|
| 10.
|
Fixman, E. D.,
T. M. Fournier,
D. M. Kamikura,
M. A. Naujokas, and M. Park.
1996.
Pathways downstream of Shc and Grb2 are required for cell transformation by the Tpr-Met oncoprotein.
J. Biol. Chem.
271:13116-13122[Abstract/Free Full Text].
|
| 11.
|
Fixman, E. D.,
M. Holgado-Madruga,
L. Nguyen,
D. M. Kamikura,
T. M. Fournier,
A. J. Wong, and M. Park.
1997.
Efficient cellular transformation by the Met oncoprotein requires a functional Grb2 binding site and correlates with phosphorylation of the Grb2-associated proteins Cbl and Gab1.
J. Biol. Chem.
272:20167-20172[Abstract/Free Full Text].
|
| 12.
|
Fournier, T. M.,
D. Kamikura,
K. Teng, and M. Park.
1996.
Branching tubulogenesis, but not scatter of Madin-Darby canine kidney cells, requires a functional Grb2 binding site in the Met receptor tyrosine kinase.
J. Biol. Chem.
271:22211-22217[Abstract/Free Full Text].
|
| 13.
|
Fujioka, Y.,
T. Matozaki,
T. Noguchi,
A. Iwamatsu,
T. Yamao,
N. Takahashi,
M. Tsuda,
T. Takada, and M. Kasuga.
1996.
A novel membrane glycoprotein, SHPS-1, that binds the SH2-domain-containing protein tyrosine phosphatase SHP-2 in response to mitogens and cell adhesion.
Mol. Cell. Biol.
16:6887-6899[Abstract].
|
| 14.
|
Garcia-Guzman, M.,
F. Dolfi,
K. Zeh, and K. Vuori.
1999.
Met-induced JNK activation is mediated by the adapter protein Crk and correlates with the Gab1-Crk signaling complex formation.
Oncogene
18:7775-7786[CrossRef][Medline].
|
| 15.
|
Gherardi, E.,
J. Gray,
M. Stoker,
M. Perryman, and R. Furlong.
1989.
Purification of scatter factor, a fibroblast-derived basic protein that modulates epithelial interactions and movement.
Proc. Natl. Acad. Sci. USA
86:5844-5848[Abstract/Free Full Text].
|
| 16.
|
Gu, H.,
J. C. Pratt,
S. J. Burakoff, and B. G. Neel.
1998.
Cloning of p97/Gab2, the major SHP2-binding protein in hematopoietic cells, reveals a novel pathway for cytokine-induced gene activation.
Mol. Cell
6:729-740.
|
| 17.
|
Harlan, J. E.,
P. J. Hajduk,
H. S. Yoon, and S. W. Fesik.
1994.
Pleckstrin homology domains bind to phosphatidylinositol 4,5-bisphosphate.
Nature
371:168-170[CrossRef][Medline].
|
| 18.
|
Herbst, R.,
P. M. Caroll,
J. D. Allard,
J. Schilling,
T. Raabe, and M. A. Simon.
1996.
Daughter of sevenless is a substrate of the phosphotyrosine phosphatase Corkscrew and functions during sevenless signaling.
Cell
85:899-909[CrossRef][Medline].
|
| 19.
|
Herbst, R.,
X. Zhang,
J. Qin, and M. A. Simon.
1999.
Recruitment of the protein phosphatase CSW by DOS is an essential step during signaling by the sevenless receptor tyrosine kinase.
EMBO J.
18:6950-6961[CrossRef][Medline].
|
| 20.
|
Hof, P.,
S. Pluskey,
S. Dhe-Paganon,
M. J. Eck, and S. E. Shoelson.
1998.
Crystal structure of the SH2 domain phosphatase SHP-2.
Cell
98:441-450.
|
| 21.
|
Holgado-Madruga, M.,
D. R. Emlet,
D. K. Moscatello,
A. K. Godwin, and A. J. Wong.
1996.
A Grb2-associated docking protein in EGF- and insulin-receptor signalling.
Nature
379:560-564[CrossRef][Medline].
|
| 22.
|
Holgado-Madruga, M.,
D. K. Moscatello,
D. R. Emlet,
R. Dieterich, and A. J. Wong.
1997.
Grb2-associated binder-1 mediates phosphatidylinositol 3-kinase activation and the promotion of cell survival by nerve growth factor.
Proc. Natl. Acad. Sci. USA
94:12419-12424[Abstract/Free Full Text].
|
| 23.
|
Ingham, R. J.,
M. Holgado-Madruga,
C. Siu,
A. J. Wong, and M. R. Gold.
1998.
The Gab1 protein is a docking site for multiple proteins involved in signaling by the B cell antigen receptor.
J. Biol. Chem.
273:30630-30637[Abstract/Free Full Text].
|
| 24.
|
Jeffers, M.,
S. Koochekpour,
M. Fiscella,
B. K. Sathyanarayana, and G. F. Vande Woude.
1998.
Signaling requirements for oncogenic forms of the Met tyrosine kinase receptor.
Oncogene
17:2691-2700[CrossRef][Medline].
|
| 25.
|
Kan, M.,
G. H. Zhang,
R. Zarnegar,
G. Michalopoulos,
Y. Myoken,
W. L. McKeehan, and J. I. Stevens.
1991.
Hepatocyte growth factor/hepatopoietin A stimulates the growth of rat kidney proximal tubule epithelial cells (RPTE), rat nonparenchymal liver cells, human melanoma cells, mouse keratinocytes and stimulates anchorage-independent growth of SV-40 transformed RPTE.
Biochem. Biophys. Res. Commun.
174:331-337[CrossRef][Medline].
|
| 26.
|
Kazlauskas, A.,
G.-S. Feng,
T. Pawson, and M. Vallus.
1993.
The 64-kDa protein that associates with the platelet-derived growth factor receptor subunit via Tyr-1009 is the SH2-containing phosphotyrosine phosphatase Syp.
Proc. Natl. Acad. Sci. USA
90:6939-6942[Abstract/Free Full Text].
|
| 27.
|
Kharitonenkov, A.,
Z. Chen,
I. Sures,
H. Wang,
J. Schilling, and A. Ullrich.
1997.
A family of proteins that inhibit signaling through tyrosine kinase receptors.
Nature
386:181-186[CrossRef][Medline].
|
| 28.
|
Khwaja, A.,
K. Lehmann,
B. Marte, and J. Downward.
1998.
Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway.
J. Biol. Chem.
273:18793-18801[Abstract/Free Full Text].
|
| 29.
|
Komada, M., and N. Kitamura.
1993.
The cell dissociation and motility triggered by scatter factor/hepatocyte growth factor are mediated through the cytoplasmic domain of the c-Met receptor.
Oncogene
8:2381-2390[Medline].
|
| 30.
|
Komada, M.,
K. Miyazawa,
T. Ishii, and N. Kitamura.
1991.
Characterization of hepatocyte-growth-factor receptors on Meth A cells.
Eur. J. Biochem.
204:857-864[Medline].
|
| 31.
|
Kouhara, H.,
Y. R. Hadari,
T. Spivak-Kroizman,
J. Schilling,
D. Bar-Sagi,
I. Lax, and J. Schlessinger.
1997.
A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway.
Cell
89:693-702[CrossRef][Medline].
|
| 32.
|
Lechleider, R. J.,
S. Sugimoto,
A. M. Bennett,
A. S. Kashishian,
J. A. Cooper,
S. E. Shoelson,
C. T. Walsh, and B. G. Neel.
1993.
Activation of the SH2-containing phosphotyrosine phosphatase SH-PTP2 by its binding site, phosphotyrosine 1009, on the human platelet-derived growth factor receptor b.
J. Biol. Chem.
268:21478-21481[Abstract/Free Full Text].
|
| 33.
|
Lehr, S.,
J. Kotzka,
A. Herkner,
E. Klein,
C. Siethoff,
B. Knebel,
V. Noelle,
J. C. Brüning,
H. W. Klein,
H. E. Meyer,
W. Krone, and D. Müller-Wieland.
1999.
Identification of tyrosine phosphorylation sites in human Gab-1 protein by EGF receptor kinase in vitro.
Biochemistry
38:151-159[CrossRef][Medline].
|
| 34.
|
Lemmon, M. A.,
M. Falasca,
K. M. Ferguson, and J. Schlessinger.
1997.
Regulatory recruitment of signaling molecules to the cell membrane by pleckstrin homology domains.
Trends Cell Biol.
7:237-242.
|
| 35.
|
Lemmon, M. A.,
K. M. Ferguson, and J. Schlessinger.
1996.
PH domains: diverse sequences with a common fold recruit signaling molecules to the cell surface.
Cell
85:621-624[CrossRef][Medline].
|
| 36.
|
Liu, C.,
M. Park, and S. Tsao.
1992.
Over-expression of met protooncogene but not epidermal growth factor receptor or c-erb2 in primary human colorectal carcinomas.
Oncogene
7:181-185[Medline].
|
| 37.
|
Maina, F.,
M. C. Hilton,
C. Ponzetto,
A. M. Davies, and R. Klein.
1997.
Met receptor signaling is required for sensory nerve development and HGF promotes axonal growth and survival of sensory neurones.
Genes Dev.
11:3341-3350[Abstract/Free Full Text].
|
| 38.
|
Maroun, C. R.,
M. Holgado-Madruga,
I. Royal,
M. A. Naujokas,
T. M. Fournier,
A. J. Wong, and M. Park.
1999.
The Gab1 PH domain is required for localization of Gab1 at sites of cell-cell contact and epithelial morphogenesis downstream from the Met receptor tyrosine kinase.
Mol. Cell. Biol.
19:1784-1799[Abstract/Free Full Text].
|
| 39.
|
Maroun, C. R.,
D. K. Moscatello,
M. A. Naujokas,
M. Holgado-Madruga,
A. J. Wong, and M. Park.
1999.
A conserved inositol phospholipid binding site within the pleckstrin homology domain of the Gab1 docking protein is required for epithelial morphogenesis.
J. Biol. Chem.
274:31719-31726[Abstract/Free Full Text].
|
| 40.
|
Milarski, K. L., and A. R. Saltiel.
1994.
Expression of catalytically inactive Syp phosphatase in 3T3 cells blocks stimulation of mitogen-activated protein kinase by insulin.
J. Biol. Chem.
33:21239-21243[Abstract/Free Full Text].
|
| 41.
|
Montesano, R.,
G. Schaller, and L. Orci.
1991.
Induction of epithelial tubular morphogenesis in vitro by fibroblast-derived soluble factors.
Cell
66:697-711[CrossRef][Medline].
|
| 42.
|
Nakamura, T.
1991.
Structure and function of hepatocyte growth factor.
Prog. Growth Factor Res.
3:67-85[CrossRef][Medline].
|
| 43.
|
Neel, B. G., and N. K. Tonks.
1997.
Protein tyrosine phosphatases in signal transduction.
Curr. Opin. Cell Biol.
9:193-204[CrossRef][Medline].
|
| 44.
|
Nguyen, L.,
M. Holgado-Madruga,
C. Maroun,
E. D. Fixman,
D. Kamikura,
T. Fournier,
A. Charest,
M. L. Tremblay,
A. J. Wong, and M. Park.
1997.
Association of the multisubstrate docking protein Gab1 with the hepatocyte growth factor receptor requires a functional Grb2 binding site involving tyrosine 1356.
J. Biol. Chem.
272:20811-20819[Abstract/Free Full Text].
|
| 45.
|
Nishida, K.,
Y. Yoshida,
M. Itoh,
T. Fukada,
T. Ohtani,
T. Shirogane,
T. Atsumi,
M. Takahashi-Tezuka,
K. H. Ishihara,
M. Hibi, and T. Hirano.
1999.
Gab-family adapter proteins act downstream of cytokine and growth factor receptors and T- and B- cell antigen receptors.
Blood
93:1809-1816[Abstract/Free Full Text].
|
| 46.
|
Oh, E.-S.,
H. Gu,
T. M. Saxton,
J. F. Timms,
S. Hausdorff,
E. U. Frevert,
B. B. Kahn,
T. Pawson,
B. G. Neel, and S. M. Thomas.
1999.
Regulation of early events in integrin signaling by protein tyrosine phosphatase SHP-2.
Mol. Cell. Biol.
19:3205-3215[Abstract/Free Full Text].
|
| 47.
|
O'Reilly, A. M., and B. G. Neel.
1998.
Structural determinants of SHP-2 function and specificity in Xenopus mesoderm induction.
Mol. Cell. Biol.
18:161-177[Abstract/Free Full Text].
|
| 48.
|
Park, C. Y., and M. J. Hayman.
1999.
The tyrosines in the bidentate motif of the env-sea oncoprotein are essential for cell transformation and are binding sites for Grb2 and the tyrosine phosphatase SHP-2.
J. Biol. Chem.
274:7583-7590[Abstract/Free Full Text].
|
| 49.
|
Pluskey, S.,
T. J. Wandless,
C. T. Walsh, and S. E. Shoelson.
1995.
Potent stimulation of SH-PTP2 phosphatase activity by simultaneous occupancy of both SH2 domains.
J. Biol. Chem.
270:2897-2900[Abstract/Free Full Text].
|
| 50.
|
Pollack, A. L.,
R. B. Runyan, and K. E. Mostov.
1998.
Morphogenic mechanisms of epithelial tubulogenesis: MDCK cell polarity is transiently rearranged without loss of cell-cell contact during scatter factor/hepatocyte growth factor-induced tubulogenesis.
Dev. Biol.
204:64-79[CrossRef][Medline].
|
| 51.
|
Ponzetto, C.,
A. Bardelli,
Z. Zhen,
F. Maina,
P. dalla Zonca,
S. Giordano,
A. Graziani,
G. Panayotou, and P. M. Comoglio.
1994.
A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor/scatter factor receptor family.
Cell
77:261-271[CrossRef][Medline].
|
| 52.
|
Potempa, S., and A. J. Ridley.
1998.
Activation of both MAP kinase and phosphatidylinositide 3-kinase by Ras is required for hepatocyte growth factor/scatter factor-induced adherens junction assembly.
Mol. Biol. Cell
9:2185-2200[Abstract/Free Full Text].
|
| 53.
|
Qu, C.-K.,
W.-M. Yu,
B. Azzarelli, and G.-S. Feng.
1999.
Genetic evidence that Shp-2 tyrosine phosphatase is a signal enhancer of the epidermal growth factor receptor in mammals.
Proc. Natl. Acad. Sci. USA
96:8528-8533[Abstract/Free Full Text].
|
| 54.
|
Raabe, T.,
J. Riesgo-Escovar,
X. Liu,
B. S. Bausenwein,
P. Deak,
P. Maröy, and E. Hafen.
1996.
DOS, a novel pleckstrin homology domain-containing protein required for signal transduction between sevenless and RAS1 in Drosophila.
Cell
85:911-920[CrossRef][Medline].
|
| 55.
|
Rodrigues, G. A.,
M. Falasca,
Z. Zhang,
S. H. Ong, and J. Schlessinger.
2000.
A novel feedback loop mediated by the docking protein Gab1 and phosphatidylinositol 3-kinase in epidermal growth factor receptor signaling.
Mol. Cell. Biol.
20:1448-1459[Abstract/Free Full Text].
|
| 56.
|
Rodrigues, G. A.,
M. A. Naujokas, and M. Park.
1991.
Alternative splicing generates isoforms of the met receptor tyrosine kinase which undergo differential processing.
Mol. Cell. Biol.
11:2962-2970[Abstract/Free Full Text].
|
| 57.
|
Rong, S.,
M. Bodescot,
D. Blair,
J. Dunn,
T. Nakamura,
K. Mizuno,
M. Park,
A. Chan,
S. Aaronson, and G. F. Vande Woude.
1992.
Tumorigenicity of the met proto-oncogene and the gene for hepatocyte growth factor.
Mol. Cell. Biol.
12:5152-5158[Abstract/Free Full Text].
|
| 58.
|
Ronsin, C.,
F. Muscatelli,
M. G. Mattei, and R. Breathnach.
1993.
A novel putative receptor protein tyrosine kinase of the met family.
Oncogene
8:1195-1202[Medline].
|
| 59.
|
Saxton, T. M.,
M. Henkemeyer,
S. Gasca,
R. Shen,
D. J. Rossi,
F. Shalaby,
G.-S. Feng, and T. Pawson.
1997.
Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase SHP-2.
EMBO J.
16:2352-2364[CrossRef][Medline].
|
| 60.
|
Schmidt, C.,
F. Bladt,
S. Goedecke,
V. Brinkmann,
W. Zschiesche,
M. Sharpe,
E. Gherardi, and C. Birchmeier.
1995.
Scatter factor/hepatocyte growth factor is essential for liver development.
Nature
373:699-702[CrossRef][Medline].
|
| 61.
|
Schmidt, L.,
F. M. Duh,
F. Chen,
T. Kishida,
G. Glenn,
P. Choyke,
S. W. Scherer,
Z. P. Zhuang,
I. Lubensky,
M. Dean,
R. Allikmets,
A. Chimambaram,
U. R. Bergerheim,
J. T. Feltis,
C. Casadevall,
A. Zamarron,
M. Bernues,
S. Richard,
C. J. Lips,
M. M. Walther,
L. C. Tsui,
L. Geil,
M. L. Orcutt,
T. Stackhouse,
J. Lipan,
L. Slife,
H. Brauch,
J. Decker,
G. Niehans,
M. D. Hughson,
H. Moch,
S. Storkel,
M. I. Lerman,
W. M. Linehan, and B. Zbar.
1997.
Germline and somatic mutations in the tyrosine kinase domain of the MET proto-oncogene in papillary renal carcinomas.
Nat. Genet.
16:68-73[CrossRef][Medline].
|
| 62.
|
Shaw, G.
1996.
The pleckstrin homology domain: an intriguing multifunctional protein module.
Bioessays
18:35-46[CrossRef][Medline].
|
| 63.
|
Shi, Z.-Q.,
W. Lu, and G.-S. Feng.
1998.
The Shp-2 tyrosine phosphatase has opposite effects in mediating the activation of extracellular signal-regulated and c-Jun NH2-terminal mitogen-activated protein kinases.
J. Biol. Chem.
273:4904-4908[Abstract/Free Full Text].
|
| 64.
|
Shi, Z.-Q.,
D.-H. Yu,
M. Park,
M. Marshall, and G.-S. Feng.
2000.
Molecular mechanism for the Shp-2 tyrosine phosphatase function in promoting growth factor stimulation of Erk activity.
Mol. Cell. Biol.
20:1526-1536[Abstract/Free Full Text].
|
| 65.
|
Soriano, J. V.,
M. S. Pepper,
T. Nakamura,
L. Orci, and R. Montesano.
1995.
Hepatocyte growth factor stimulates extensive development of branching duct-like structures by cloned mammary gland epithelial cells.
J. Cell Sci.
108:413-430[Abstract].
|
| 66.
|
Stein-Gerlach, M.,
C. Wallasch, and A. Ullrich.
1998.
SHP-2, SH2-containing protein tyrosine phosphatase-2.
Int. J. Biochem. Cell Biol.
30:559-566[CrossRef][Medline].
|
| 67.
|
Stoker, M., and E. Gherardi.
1991.
Regulation of cell movement: the motogenic cytokines.
Biochim. Biophys. Acta
1072:81-102[Medline].
|
| 68.
|
Takahashi-Tezuka, M.,
Y. Yoshida,
T. Fukada,
T. Ohtani,
Y. Yamanaka,
K. Nishida,
K. Nakajima,
M. Hibi, and T. Hirano.
1998.
Gab1 acts as an adapter molecule linking the cytokine receptor gp130 to ERK mitogen-activated protein kinase.
Mol. Cell. Biol.
18:4109-4117[Abstract/Free Full Text].
|
| 69.
|
Tang, T. L.,
R. M. J. Freeman,
A. M. O'Reilly,
B. G. Neel, and S. Y. Sokol.
1995.
The SH2-containing protein-tyrosine phosphatase SH-PTP2 is required upstream of MAP kinase for early xenopus development.
Cell
80:473-483[CrossRef][Medline].
|
| 70.
|
Uehara, Y.,
O. Minowa,
C. Mori,
K. Shiota,
J. Kuno,
T. Noda, and N. Kitamura.
1995.
Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor.
Nature
373:702-705[CrossRef][Medline].
|
| 71.
|
Vogel, W., and A. Ullrich.
1996.
Multiple in vivo phosphorylated tyrosine phosphatase SHP-2 engages binding to Grb2 via tyrosine 584.
Cell Growth Differ.
7:1589-1597[Abstract].
|
| 72.
|
Weidner, K. M.,
N. Arakaki,
G. Hartmann,
J. Vandekerchkhove,
S. Weingart,
H. Rieder,
C. Fonatsch,
H. Tsubouchi,
T. Hishida,
Y. Daikuhara, and W. Birchmeier.
1991.
Evidence for the identity of human scatter factor and human hepatocyte growth factor.
Proc. Natl. Acad. Sci. USA
88:7001-7005[Abstract/Free Full Text].
|
| 73.
|
Weidner, K. M.,
S. Di Cesare,
M. Sachs,
V. Brinkman,
J. Behrens, and W. Birchmeier.
1996.
Interaction between Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial morphogenesis.
Nature
384:173-176[CrossRef][Medline].
|
| 74.
|
Weidner, K. M.,
M. Sachs, and W. Birchmeier.
1993.
The Met receptor tyrosine kinase transduces motility, proliferation, and morphogenic signals of scatter factor/hepatocyte growth factor in epithelial cells.
J. Cell Biol.
121:145-154[Abstract/Free Full Text].
|
| 75.
|
White, M. F., and L. Yenush.
1998.
The IRS-signaling system: a network of docking proteins that mediate insulin and cytokine action.
Curr. Opin. Genet. Dev.
8:112-126[CrossRef][Medline].
|
| 76.
|
Wigler, M.,
A. Pellicer,
S. Silverstein,
R. Axel,
G. Urlaub, and L. Chasin.
1979.
DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells.
Proc. Natl. Acad. Sci. USA
76:1373-1376[Abstract/Free Full Text].
|
| 77.
|
Yang, X. M., and M. Park.
1993.
Expression of the met/hepatocyte growth factor/scatter factor receptor and its ligand during differentiation of murine P19 embryonal carcinoma cells.
Dev. Biol.
157:308-320[CrossRef][Medline].
|
| 78.
|
Yenush, L., and M. F. White.
1997.
The IRS-signalling system during insulin and cytokine action.
Bioessays
19:491-500[CrossRef][Medline].
|
| 79.
|
Yu, D.-H.,
C.-K. Qu,
O. Henegariu,
X. Lu, and G.-S. Feng.
1998.
Protein-tyrosine phosphatase SHP-2 regulates cell spreading, migration and focal adhesion.
J. Biol. Chem.
273:21125-21131[Abstract/Free Full Text].
|
| 80.
|
Zarnegar, R., and G. Michalopoulos.
1989.
Purification and biological characterization of human hepatopoietin A, a polypeptide growth factor for hepatocytes.
Cancer Res.
49:3314-3320[Abstract/Free Full Text].
|
| 81.
|
Zhao, C.,
D. H. Yu,
R. Shen, and G.-S. Feng.
1999.
Gab2, a new pleckstrin homology domain-containing adaptor protein, acts to uncouple signaling from ERK to Elk-1.
J. Biol. Chem.
274:19649-19654[Abstract/Free Full Text].
|
| 82.
|
Zhu, H.,
M. A. Naujokas,
E. D. Fixman,
K. Torossian, and M. Park.
1994.
Tyrosine 1356 in the carboxyl-terminal tail of the HGF/SF receptor is essential for the transduction of signals for cell motility and morphogenesis.
J. Biol. Chem.
269:29943-29948[Abstract/Free Full Text].
|
| 83.
|
Zhu, H.,
M. A. Naujokas, and M. Park.
1994.
Receptor chimeras indicate that the Met tyrosine kinase mediates the motility and morphogenic responses of hepatocyte growth/scatter factor.
Cell Growth Differ.
5:359-366[Abstract].
|
Molecular and Cellular Biology, November 2000, p. 8513-8525, Vol. 20, No. 22
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Paliouras, G. N., Naujokas, M. A., Park, M.
(2009). Pak4, a Novel Gab1 Binding Partner, Modulates Cell Migration and Invasion by the Met Receptor. Mol. Cell. Biol.
29: 3018-3032
[Abstract]
[Full Text]
-
Abella, J. V., Park, M.
(2009). Breakdown of endocytosis in the oncogenic activation of receptor tyrosine kinases. Am. J. Physiol. Endocrinol. Metab.
296: E973-E984
[Abstract]
[Full Text]
-
Kakazu, A., Sharma, G., Bazan, H. E. P.
(2008). Association of Protein Tyrosine Phosphatases (PTPs)-1B with c-Met Receptor and Modulation of Corneal Epithelial Wound Healing. IOVS
49: 2927-2935
[Abstract]
[Full Text]
-
Hellmuth, K., Grosskopf, S., Lum, C. T., Wurtele, M., Roder, N., von Kries, J. P., Rosario, M., Rademann, J., Birchmeier, W.
(2008). Specific inhibitors of the protein tyrosine phosphatase Shp2 identified by high-throughput docking. Proc. Natl. Acad. Sci. USA
105: 7275-7280
[Abstract]
[Full Text]
-
Cavet, M. E., Smolock, E. M., Ozturk, O. H., World, C., Pang, J., Konishi, A., Berk, B. C.
(2008). Gas6-Axl Receptor Signaling Is Regulated by Glucose in Vascular Smooth Muscle Cells. Arterioscler. Thromb. Vasc. Bio.
28: 886-891
[Abstract]
[Full Text]
-
Ha, C. H., Bennett, A. M., Jin, Z.-G.
(2008). A Novel Role of Vascular Endothelial Cadherin in Modulating c-Src Activation and Downstream Signaling of Vascular Endothelial Growth Factor. J. Biol. Chem.
283: 7261-7270
[Abstract]
[Full Text]
-
Seiden-Long, I., Navab, R., Shih, W., Li, M., Chow, J., Zhu, C. Q., Radulovich, N., Saucier, C., Tsao, M.-S.
(2008). Gab1 but not Grb2 mediates tumor progression in Met overexpressing colorectal cancer cells. Carcinogenesis
29: 647-655
[Abstract]
[Full Text]
-
Kondo, A., Hirayama, N., Sugito, Y., Shono, M., Tanaka, T., Kitamura, N.
(2008). Coupling of Grb2 to Gab1 Mediates Hepatocyte Growth Factor-induced High Intensity ERK Signal Required for Inhibition of HepG2 Hepatoma Cell Proliferation. J. Biol. Chem.
283: 1428-1436
[Abstract]
[Full Text]
-
Schaeper, U., Vogel, R., Chmielowiec, J., Huelsken, J., Rosario, M., Birchmeier, W.
(2007). Distinct requirements for Gab1 in Met and EGF receptor signaling in vivo. Proc. Natl. Acad. Sci. USA
104: 15376-15381
[Abstract]
[Full Text]
-
Accornero, P., Martignani, E., Macchi, E., Baratta, M.
(2007). Hepatocyte Growth Factor Exerts Multiple Biological Functions on Bovine Mammary Epithelial Cells. J DAIRY SCI
90: 4289-4296
[Abstract]
[Full Text]
-
Bertotti, A., Comoglio, P. M., Trusolino, L.
(2006). {beta}4 integrin activates a Shp2-Src signaling pathway that sustains HGF-induced anchorage-independent growth. JCB
175: 993-1003
[Abstract]
[Full Text]
-
Mood, K., Saucier, C., Bong, Y.-S., Lee, H.-S., Park, M., Daar, I. O.
(2006). Gab1 Is Required for Cell Cycle Transition, Cell Proliferation, and Transformation Induced by an Oncogenic Met Receptor. Mol. Biol. Cell
17: 3717-3728
[Abstract]
[Full Text]
-
Dance, M., Montagner, A., Yart, A., Masri, B., Audigier, Y., Perret, B., Salles, J.-P., Raynal, P.
(2006). The Adaptor Protein Gab1 Couples the Stimulation of Vascular Endothelial Growth Factor Receptor-2 to the Activation of Phosphoinositide 3-Kinase. J. Biol. Chem.
281: 23285-23295
[Abstract]
[Full Text]
-
Chen, L., Sung, S.-S., Yip, M. L. R., Lawrence, H. R., Ren, Y., Guida, W. C., Sebti, S. M., Lawrence, N. J., Wu, J.
(2006). Discovery of a Novel Shp2 Protein Tyrosine Phosphatase Inhibitor. Mol. Pharmacol.
70: 562-570
[Abstract]
[Full Text]
-
Watanabe, T., Tsuda, M., Makino, Y., Ichihara, S., Sawa, H., Minami, A., Mochizuki, N., Nagashima, K., Tanaka, S.
(2006). Adaptor Molecule Crk Is Required for Sustained Phosphorylation of Grb2-Associated Binder 1 and Hepatocyte Growth Factor-Induced Cell Motility of Human Synovial Sarcoma Cell Lines. Mol Cancer Res
4: 499-510
[Abstract]
[Full Text]
-
Hopper, N. A.
(2006). The Adaptor Protein soc-1/Gab1 Modifies Growth Factor Receptor Output in Caenorhabditis elegans. Genetics
173: 163-175
[Abstract]
[Full Text]
-
Salmond, R. J., Huyer, G., Kotsoni, A., Clements, L., Alexander, D. R.
(2005). The src Homology 2 Domain-Containing Tyrosine Phosphatase 2 Regulates Primary T-Dependent Immune Responses and Th Cell Differentiation. J. Immunol.
175: 6498-6508
[Abstract]
[Full Text]
-
Abella, J. V., Peschard, P., Naujokas, M. A., Lin, T., Saucier, C., Urbe, S., Park, M.
(2005). Met/Hepatocyte Growth Factor Receptor Ubiquitination Suppresses Transformation and Is Required for Hrs Phosphorylation. Mol. Cell. Biol.
25: 9632-9645
[Abstract]
[Full Text]
-
Ling, Y., Maile, L. A., Lieskovska, J., Badley-Clarke, J., Clemmons, D. R.
(2005). Role of SHPS-1 in the Regulation of Insulin-like Growth Factor I-stimulated Shc and Mitogen-activated Protein Kinase Activation in Vascular Smooth Muscle Cells. Mol. Biol. Cell
16: 3353-3364
[Abstract]
[Full Text]
-
Basar, T., Shen, Y., Ireton, K.
(2005). Redundant Roles for Met Docking Site Tyrosines and the Gab1 Pleckstrin Homology Domain in InlB-Mediated Entry of Listeria monocytogenes. Infect. Immun.
73: 2061-2074
[Abstract]
[Full Text]
-
Montagner, A., Yart, A., Dance, M., Perret, B., Salles, J.-P., Raynal, P.
(2005). A Novel Role for Gab1 and SHP2 in Epidermal Growth Factor-induced Ras Activation. J. Biol. Chem.
280: 5350-5360
[Abstract]
[Full Text]
-
Schuetz, G., Rosario, M., Grimm, J., Boeckers, T. M., Gundelfinger, E. D., Birchmeier, W.
(2004). The neuronal scaffold protein Shank3 mediates signaling and biological function of the receptor tyrosine kinase Ret in epithelial cells. JCB
167: 945-952
[Abstract]
[Full Text]
-
Karihaloo, A., Kale, S., Rosenblum, N. D., Cantley, L. G.
(2004). Hepatocyte Growth Factor-Mediated Renal Epithelial Branching Morphogenesis Is Regulated by Glypican-4 Expression. Mol. Cell. Biol.
24: 8745-8752
[Abstract]
[Full Text]
-
Arnaud, M., Crouin, C., Deon, C., Loyaux, D., Bertoglio, J.
(2004). Phosphorylation of Grb2-Associated Binder 2 on Serine 623 by ERK MAPK Regulates Its Association with the Phosphatase SHP-2 and Decreases STAT5 Activation. J. Immunol.
173: 3962-3971
[Abstract]
[Full Text]
-
Higuchi, T., Orita, T., Katsuya, K., Yamasaki, Y., Akiyama, K., Li, H., Yamamoto, T., Saito, Y., Nakamura, M.
(2004). MUC20 Suppresses the Hepatocyte Growth Factor-Induced Grb2-Ras Pathway by Binding to a Multifunctional Docking Site of Met. Mol. Cell. Biol.
24: 7456-7468
[Abstract]
[Full Text]
-
Tartaglia, M., Martinelli, S., Cazzaniga, G., Cordeddu, V., Iavarone, I., Spinelli, M., Palmi, C., Carta, C., Pession, A., Arico, M., Masera, G., Basso, G., Sorcini, M., Gelb, B. D., Biondi, A.
(2004). Genetic evidence for lineage-related and differentiation stage-related contribution of somatic PTPN11 mutations to leukemogenesis in childhood acute leukemia. Blood
104: 307-313
[Abstract]
[Full Text]
-
Massa, A., Barbieri, F., Aiello, C., Arena, S., Pattarozzi, A., Pirani, P., Corsaro, A., Iuliano, R., Fusco, A., Zona, G., Spaziante, R., Florio, T., Schettini, G.
(2004). The Expression of the Phosphotyrosine Phosphatase DEP-1/PTP{eta} Dictates the Responsivity of Glioma Cells to Somatostatin Inhibition of Cell Proliferation. J. Biol. Chem.
279: 29004-29012
[Abstract]
[Full Text]
-
Lamothe, B., Yamada, M., Schaeper, U., Birchmeier, W., Lax, I., Schlessinger, J.
(2004). The Docking Protein Gab1 Is an Essential Component of an Indirect Mechanism for Fibroblast Growth Factor Stimulation of the Phosphatidylinositol 3-Kinase/Akt Antiapoptotic Pathway. Mol. Cell. Biol.
24: 5657-5666
[Abstract]
[Full Text]
-
Higashi, H., Nakaya, A., Tsutsumi, R., Yokoyama, K., Fujii, Y., Ishikawa, S., Higuchi, M., Takahashi, A., Kurashima, Y., Teishikata, Y., Tanaka, S., Azuma, T., Hatakeyama, M.
(2004). Helicobacter pylori CagA Induces Ras-independent Morphogenetic Response through SHP-2 Recruitment and Activation. J. Biol. Chem.
279: 17205-17216
[Abstract]
[Full Text]
-
Holgado-Madruga, M., Wong, A. J.
(2004). Role of the Grb2-Associated Binder 1/SHP-2 Interaction in Cell Growth and Transformation. Cancer Res.
64: 2007-2015
[Abstract]
[Full Text]
-
Ren, Y., Meng, S., Mei, L., Zhao, Z. J., Jove, R., Wu, J.
(2004). Roles of Gab1 and SHP2 in Paxillin Tyrosine Dephosphorylation and Src Activation in Response to Epidermal Growth Factor. J. Biol. Chem.
279: 8497-8505
[Abstract]
[Full Text]
-
Kapoor, G. S., Zhan, Y., Johnson, G. R., O'Rourke, D. M.
(2004). Distinct Domains in the SHP-2 Phosphatase Differentially Regulate Epidermal Growth Factor Receptor/NF-{kappa}B Activation through Gab1 in Glioblastoma Cells. Mol. Cell. Biol.
24: 823-836
[Abstract]
[Full Text]
-
Chan, P.-C., Chen, Y.-L., Cheng, C.-H., Yu, K.-C., Cary, L. A., Shu, K.-H., Ho, W. L., Chen, H.-C.
(2003). Src Phosphorylates Grb2-associated Binder 1 upon Hepatocyte Growth Factor Stimulation. J. Biol. Chem.
278: 44075-44082
[Abstract]
[Full Text]
-
Agazie, Y. M., Hayman, M. J.
(2003). Molecular Mechanism for a Role of SHP2 in Epidermal Growth Factor Receptor Signaling. Mol. Cell. Biol.
23: 7875-7886
[Abstract]
[Full Text]
-
Zhao, C., Ma, H., Bossy-Wetzel, E., Lipton, S. A., Zhang, Z., Feng, G.-S.
(2003). GC-GAP, a Rho Family GTPase-activating Protein That Interacts with Signaling Adapters Gab1 and Gab2. J. Biol. Chem.
278: 34641-34653
[Abstract]
[Full Text]
-
Ling, Y., Maile, L. A., Clemmons, D. R.
(2003). Tyrosine Phosphorylation of the {beta}3-Subunit of the {alpha}V{beta}3 Integrin Is Required for Membrane Association of the Tyrosine Phosphatase SHP-2 and Its Further Recruitment to the Insulin-Like Growth Factor I Receptor. Mol. Endocrinol.
17: 1824-1833
[Abstract]
[Full Text]
-
Kogata, N., Masuda, M., Kamioka, Y., Yamagishi, A., Endo, A., Okada, M., Mochizuki, N.
(2003). Identification of Fer Tyrosine Kinase Localized on Microtubules as a Platelet Endothelial Cell Adhesion Molecule-1 Phosphorylating Kinase in Vascular Endothelial Cells. Mol. Biol. Cell
14: 3553-3564
[Abstract]
[Full Text]
-
Lock, L. S., Frigault, M. M., Saucier, C., Park, M.
(2003). Grb2-independent Recruitment of Gab1 Requires the C-terminal Lobe and Structural Integrity of the Met Receptor Kinase Domain. J. Biol. Chem.
278: 30083-30090
[Abstract]
[Full Text]
-
Nakaoka, Y., Nishida, K., Fujio, Y., Izumi, M., Terai, K., Oshima, Y., Sugiyama, S., Matsuda, S., Koyasu, S., Yamauchi-Takihara, K., Hirano, T., Kawase, I., Hirota, H.
(2003). Activation of gp130 Transduces Hypertrophic Signal Through Interaction of Scaffolding/Docking Protein Gab1 With Tyrosine Phosphatase SHP2 in Cardiomyocytes. Circ. Res.
93: 221-229
[Abstract]
[Full Text]
-
Holgado-Madruga, M., Wong, A. J.
(2003). Gab1 Is an Integrator of Cell Death versus Cell Survival Signals in Oxidative Stress. Mol. Cell. Biol.
23: 4471-4484
[Abstract]
[Full Text]
-
Gu, H., Botelho, R. J., Yu, M., Grinstein, S., Neel, B. G.
(2003). Critical role for scaffolding adapter Gab2 in Fc{gamma}R-mediated phagocytosis. JCB
161: 1151-1161
[Abstract]
[Full Text]
-
Maroun, C. R., Naujokas, M. A., Park, M.
(2003). Membrane Targeting of Grb2-associated Binder-1 (Gab1) Scaffolding Protein through Src Myristoylation Sequence Substitutes for Gab1 Pleckstrin Homology Domain and Switches an Epidermal Growth Factor Response to an Invasive Morphogenic Program. Mol. Biol. Cell
14: 1691-1708
[Abstract]
[Full Text]
-
Long, I. S., Han, K., Li, M., Shirasawa, S., Sasazuki, T., Johnston, M., Tsao, M.-S.
(2003). Met Receptor Overexpression and Oncogenic Ki-ras Mutation Cooperate to Enhance Tumorigenicity of Colon Cancer Cells in Vivo. Mol Cancer Res
1: 393-401
[Abstract]
[Full Text]
-
Palka, H. L., Park, M., Tonks, N. K.
(2003). Hepatocyte Growth Factor Receptor Tyrosine Kinase Met Is a Substrate of the Receptor Protein-tyrosine Phosphatase DEP-1. J. Biol. Chem.
278: 5728-5735
[Abstract]
[Full Text]
-
Kong, M., Mounier, C., Dumas, V., Posner, B. I.
(2003). Epidermal Growth Factor-induced DNA Synthesis. KEY ROLE FOR Src PHOSPHORYLATION OF THE DOCKING PROTEIN Gab2. J. Biol. Chem.
278: 5837-5844
[Abstract]
[Full Text]
-
Lamorte, L., Rodrigues, S., Naujokas, M., Park, M.
(2002). Crk Synergizes with Epidermal Growth Factor for Epithelial Invasion and Morphogenesis and Is Required for the Met Morphogenic Program. J. Biol. Chem.
277: 37904-37911
[Abstract]
[Full Text]
-
Huang, Q., Lerner-Marmarosh, N., Che, W., Ohta, S., Osawa, M., Yoshizumi, M., Glassman, M., Yan, C., Berk, B. C., Abe, J.-i.
(2002). The Novel Role of the C-terminal Region of SHP-2. INVOLVEMENT OF Gab1 AND SHP-2 PHOSPHATASE ACTIVITY IN Elk-1 ACTIVATION. J. Biol. Chem.
277: 29330-29341
[Abstract]
[Full Text]
-
Saenger, P.
(2002). Noonan Syndrome--Certitude Replaces Conjecture. J. Clin. Endocrinol. Metab.
87: 3527-3528
[Full Text]
-
Saito, Y., Hojo, Y., Tanimoto, T., Abe, J.-i., Berk, B. C.
(2002). Protein Kinase C-alpha and Protein Kinase C-epsilon Are Required for Grb2-associated Binder-1 Tyrosine Phosphorylation in Response to Platelet-derived Growth Factor. J. Biol. Chem.
277: 23216-23222
[Abstract]
[Full Text]
-
Zhang, S. Q., Tsiaras, W. G., Araki, T., Wen, G., Minichiello, L., Klein, R., Neel, B. G.
(2002). Receptor-Specific Regulation of Phosphatidylinositol 3'-Kinase Activation by the Protein Tyrosine Phosphatase Shp2. Mol. Cell. Biol.
22: 4062-4072
[Abstract]
[Full Text]
-
Lock, L. S., Maroun, C. R., Naujokas, M. A., Park, M.
(2002). Distinct Recruitment and Function of Gab1 and Gab2 in Met Receptor-mediated Epithelial Morphogenesis. Mol. Biol. Cell
13: 2132-2146
[Abstract]
[Full Text]
-
Yamaguchi, H., Miki, H., Takenawa, T.
(2002). Neural Wiskott-Aldrich Syndrome Protein Is Involved in Hepatocyte Growth Factor-induced Migration, Invasion, and Tubulogenesis of Epithelial Cells. Cancer Res.
62: 2503-2509
[Abstract]
[Full Text]
-
Dorsey, J. F., Cunnick, J. M., Mane, S. M., Wu, J.
(2002). Regulation of the Erk2-Elk1 signaling pathway and megakaryocytic differentiation of Bcr-Abl+ K562 leukemic cells by Gab2. Blood
99: 1388-1397
[Abstract]
[Full Text]
-
Liang, C.-C., Chen, H.-C.
(2001). Sustained Activation of Extracellular Signal-regulated Kinase Stimulated by Hepatocyte Growth Factor Leads to Integrin alpha 2 Expression That Is Involved in Cell Scattering. J. Biol. Chem.
276: 21146-21152
[Abstract]
[Full Text]
-
Ong, S. H., Hadari, Y. R., Gotoh, N., Guy, G. R., Schlessinger, J., Lax, I.
(2001). Stimulation of phosphatidylinositol 3-kinase by fibroblast growth factor receptors is mediated by coordinated recruitment of multiple docking proteins. Proc. Natl. Acad. Sci. USA
98: 6074-6079
[Abstract]
[Full Text]