INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Fragile X syndrome is the most common form of hereditary mental retardation whose effects are traced to the loss of function of a single gene, named FMR1. This syndrome affects approximately 1 in 5,000 male births and is globally distributed throughout the human population (19, 42, 61). In most cases, the disease results from the repression of FMR1 gene expression that is due to an expansion of a CGG trinucleotide repeat in the 5' untranslated region of the gene (25, 28, 36, 45, 65, 66, 73). Subsequent methylation of this expanded repeat results in transcriptional silencing of the FMR1 gene (7, 43). A few fragile X patients with partial or complete deletions of the FMR1 gene have been identified, and these patients have phenotypes similar to those affected by the trinucleotide repeat expansion (26, 68). One patient who has a single point mutation in the FMR1 gene that replaces an isoleucine residue at amino acid 304 with asparagine (I304N) exhibits a particularly severe fragile X phenotype (17). The severity of the phenotype observed in this patient has prompted the suggestion that the I304N substitution results in a dominant-negative form of FMR1 protein (22, 53).

The FMR1 protein binds RNA in vitro and contains two types of RNA-binding motifs, KH domains and an RGG box (10, 35, 55). The RNA-binding activity of FMR1 appears to be selective. It has been estimated that FMR1 interacts with about 4% of human fetal brain mRNAs, including its own mRNA (4). The importance of the RNA-binding activity to the function of the FMR1 protein is underscored by the observation that the I304N substitution alters a highly conserved residue in the second KH domain and that this substitution impairs the ability of FMR1 to bind RNA in vitro (53) and affects its association with polyribosomes in vivo (22).

Searches for other vertebrate homologs of FMR1 and screens for proteins that interact with FMR1 led to the identification of two closely related genes, FXR1 and FXR2 (56, 74). All three proteins share extensive amino acid sequence identity or similarity over their entireties except for the carboxy-terminal end (74). They are capable of forming both heteromers and homomers via an FMR1/FXR interaction domain located near the amino termini of the proteins (57, 74) (Fig. 1). Additionally, all three proteins associate with ribosomes (22, 34, 57, 62) via a ribosome interaction domain located carboxy terminal to the second KH domain (Fig. 1). All three proteins also contain a sequence that resembles the leucine-rich nuclear export signal (NES) of the human immunodeficiency virus (HIV) Rev protein, and mutation of this putative NES in FMR1 results in mislocalization of the protein from the cytoplasm to the cell nucleus (21, 24, 58). Therefore, it has been suggested that FMR1 may shuttle between the nucleus and cytoplasm and thus may play a role in the nuclear export of as yet unidentified RNA substrates. Taken together, these results demonstrate that FMR1, FXR1, and FXR2 constitute a family of structurally related proteins that are likely to function in the transport or metabolism of specific RNA molecules. However, little is known about the potential RNA targets to which these proteins may bind and how FMR1/FXR proteins may influence the activities of such RNAs. Thus, the molecular functions of the FMR1/FXR proteins remain unknown.

View larger version (128K): [in this window] [in a new window]   FIG. 1.   Amino acid sequence alignment of hFMR1, hFXR1, hFXR2, and dFMR1 (GenBank accession no. AF305881). Identical and similar amino acid residues among all four proteins are highlighted in gray, and gaps are introduced for optimal alignment. Previously delineated functional domains of FMR1/FXR proteins are marked and include two KH domains, an FMR1/FXR interaction domain, a 60S ribosomal subunit interaction domain, and an RGG box. Highly conserved isoleucine residues that are essential for normal KH domain function are indicated with asterisks. The putative HIV Rev-like leucine-rich NES is also indicated.

Here, we report the isolation and characterization of the first invertebrate member of the FMR1/FXR gene family from Drosophila melanogaster (dfmr1). The dfmr1 gene product has considerable amino acid sequence identity/similarity with the vertebrate FMR1/FXR protein family members and, like these proteins, contains two KH domains and an RGG box, as well as a high degree of conservation in the ribosomal association and oligomerization domains. It possesses similar RNA-binding activity and displays a capacity to interact with human FMR1. Using a monoclonal antibody to dFMR1, we show that it is localized to the cytoplasm. The expression pattern of dfmr1 during Drosophila embryogenesis reflects a combination of the tissue distributions of FMR1 and the FXR proteins observed in the mouse and human embryos. We further show that overexpression of dFMR1 leads to apoptosis, indicating that the cellular dFMR1 levels must be tightly regulated. We produced dFMR1 mutants bearing point mutations analogous to the I304N substitution in each of the two KH domains and show that these mutations result in a loss of function for dFMR1 both in vitro and in vivo. The identification of FMR1 in Drosophila, along with the ability to induce a phenotype by overexpression of the protein, provides an opportunity to utilize genetic approaches in Drosophila to uncover the in vivo function(s) of the FMR1/FXR protein family.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Isolation of cDNA clones and DNA sequencing. Using the degenerate primers with sequences of CAG(C/T)TGGC(A/C)TC(A/C)(A/C)GATT(C/T)CA(C/T) and CTC(A/G/C/T)CCATAAAT(A/G)TG(A/G)AA(A/G/C/T)GT, PCR was performed on zebra fish genomic DNA to obtain a 180-bp DNA fragment covering the first KH domain. This fragment was then used as a probe to screen 10⁶ plaques of a ZAP zebra fish cDNA library (generously provided by E. Weinberg), and a partial zebra fish FMR1 (zFMR1) cDNA lacking the 5' end was isolated. The 5' end was obtained by PCR on the zebra fish cDNA library using the T3 promoter primer which anneals to the library vector and a primer with the sequences TCCACAACCTCTTGAATCAG which anneals to the extreme 5' end of the partial cDNA. To obtain a D. melanogaster fmr1 cDNA, the 600-bp cDNA fragment encoding amino acids 173 to 371 of zFMR1 was used as a probe to screen 10⁶ plaques of a ZAP D. melanogaster ovarian cDNA library. The inserts of all clones were sequenced and analyzed by MacVector (Oxford Molecular Group). The full-length dFMR1 sequence was assembled from two overlapping clones.

RNA binding assay. Binding of in vitro-translated proteins to ribohomopolymers was carried out as previously described (55) in binding buffer (10 mM Tris-HCl, 2.5 mM MgCl₂, 0.5% Triton X-100, 1 µg of pepstatin A/ml, 1 µg of leupeptin/ml, 0.5% aprotinin) containing 100 or 400 mM NaCl. After binding at 4°C for 30 min, the beads bound with proteins were once washed with binding buffer containing heparin (2 mg/ml) and then four times with binding buffer. Bound proteins were eluted from the beads in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer, separated by SDS-PAGE on a 12.5% gel, and visualized by fluorography.

In vitro protein binding assays. All the [³⁵S]methionine-labeled proteins were produced using the TnT T7 coupled rabbit reticulocyte lysate system (Promega Biotech) in the presence of [³⁵S]methionine (Amersham) according to the manufacturer's protocol. The dFMR1 cDNA was subcloned into the EcoRI-cleaved pGEX-5X-1 bacterial expression vector. Glutathione S-transferase (GST)- dFMR1 fusion protein was induced and purified as recommended by the manufacturer (Pharmacia). In vitro protein interaction assays were carried out as previously described (74). Briefly, GST or GST-dFMR1 (2 µg) bound to 30 µl of glutathione-Sepharose 4B resin (Pharmacia) was incubated with 5 µl of the in vitro-translated proteins in 500 µl of binding buffer (50 mM Tris-HCl [pH 7.5], 200 mM NaCl, 2 mM EDTA, 0.1% NP-40, 1 µg of leupeptin/ml, 1 µg of pepstatin A/ml, 0.5% aprotinin). Following incubation at 4°C for 1 h, the resin was washed with 1 ml of binding buffer five times. Bound proteins were eluted in SDS-PAGE sample buffer, separated by SDS-PAGE on a 12.5% gel, and visualized by fluorography.

Antibody production and immunoprecipitation. The cDNA fragment encoding the amino-terminal 580 amino acids of dFMR1 was cloned into the His tag-containing pET28(a) vector (Novagen) to create the expression plasmid pET-dFMR1(N). His-dFMR1(N) fusion protein was induced and purified using a His-binding resin column as described by the manufacturer (Novagen). The purified protein was dialyzed against phosphate-buffered saline (PBS) and used to immunize mice. Hybridoma production and screening were performed essentially as previously described (13) except that the hybridomas were screened by Western blot analysis using Drosophila Schneider 2 (S2) tissue culture cell extract. Antibody specificity was determined by immunoprecipitation of in vitro-translated dFMR1 in the presence of the detergent Empigen BB. Briefly, 5 µl of in vitro-translated, [³⁵S]methionine-labeled proteins was mixed with 2 µl of antibodies from mouse ascites fluid and incubated with 50 µl of protein A-Sepharose beads (Pharmacia) in 450 µl of PBS containing 1% Empigen BB, 1 mM EDTA, and 0.1 mM dithiothreitol at 4°C for 1 h. Unbound proteins were removed by washing the beads in binding buffer several times. Bound proteins were eluted with SDS-PAGE sample buffer, separated by SDS-PAGE, and visualized by fluorography.

Immunofluorescence microscopy on S2 cells. S2 cells were fixed onto polylysine-treated slides, fixed in PBS containing 2% formaldehyde for 30 min at room temperature, and permeabilized with acetone for 3 min at 20°C as previously described (13). Mouse ascites fluid of hybridoma 6A15 at 1:1,000 dilution was used, followed by fluorescein isothiocyanate-conjugated goat anti-mouse F(ab')₂.

Northern blot analysis. Total RNA isolated from D. melanogaster ovaries and poly(A)⁺ RNA isolated from flies of different embryonic stages were separated by electrophoresis in a formaldehyde-1.2% agarose gel in MOPS (morpholinepropanesulfonic acid) buffer at 2 µg per lane. RNA was transferred to nitrocellulose membrane and probed with the ³²P-labeled AatII/NcoI dfmr1 restriction fragment.

Western blot analysis. S2 cell extract and protein extract from D. melanogaster embryos were prepared in SDS-PAGE sample buffer and separated by SDS-PAGE on a 12.5% gel. The amount of total protein in each lane was normalized by quantitative Coomassie blue staining. Immunoblotting and antibody probing were carried out essentially as described elsewhere (46), using 6A15 ascites fluid at a 1:1,000 dilution. Imaginal disc tissue from Drosophila larvae was lysed in a hypotonic buffer as described by Pan and Rubin (44). Proteins were separated by SDS-PAGE on a 10% gel, transferred to a nitrocellulose membrane, and detected with a 1:2,000 dilution of 6A15 ascites fluid and a 1:10,000 dilution of the mouse anti--tubulin antibody E7 (14).

Drosophila manipulations. Fly stocks were maintained on cornmeal-molasses medium at 25°C. Targeted overexpression of dfmr1 was achieved by cloning the wild-type or mutant dfmr1 open reading frame into the pUAST vector (9) or downstream of sevenless promoter and enhancer regions described elsewhere (8) and generating transformed flies through germ line transformation (9, 51, 59). Transformed stocks with UAS-dfmr1 alleles were crossed to GAL4 driver stocks as described in Results, and progeny were monitored for phenotypes.

Drosophila tissue processing. Wings were dissected from flies of interest, mounted in DPX (Fluka), and photographed using a Leica DMR microscope and a Hamamatsu C5810 charge-coupled device camera. To examine eye phenotypes by scanning electron microscopy, adult flies of appropriate genotypes went through a graded series of ethanol dehydration (70, 80, 90, 95, and 100% ethanol, at least 12 h per grade) and were dried using hexamethyldisilazane (Sigma). Flies were coated with gold-platinum and examined on a JEOL 6300 or JEOL T33A scanning electron microscope. Adult retinal morphology was examined as described by Carthew and Rubin (11). Briefly, adult eyes were dissected, fixed in glutaraldehyde and osmium tetroxide, dehydrated in ethanol, and then embedded in Durcapan resin (Fluka). Sections (1 µm) were cut on a Sorval MT-1 Porter-Blum ultramicrotome, stained with toluidine blue, and examined as described above for wing tissue. Eye-antennal imaginal discs were stained with acridine orange as described by Ye and Fortini (72). Eye-antennal discs from third-instar larvae were dissected in Ringer's solution and placed in acridine orange (0.2 mg/ml) in Ringer's solution for 4 min. Tissue was then placed into fresh Ringer's solution, immediately examined by fluorescence microscopy, and photographed.

Nucleotide sequence accession number. The dfmr1 and zFMR1 cDNA sequences have been deposited in GenBank (accession no. AF305881 and AF305882, respectively).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Cloning of a Drosophila FMR1/FXR homolog. To screen for potential Drosophila homologs of FMR1/FXR, we first isolated a lower-vertebrate homolog to use as a probe. Amino acid sequence comparison of FMR1/FXR homologs cloned from mammalian species revealed that the amino-terminal half, containing two KH domains, is highly conserved. Therefore, we designed degenerate oligonucleotide primers within the first KH domain and performed PCR on zebra fish genomic DNA. PCR using these primers yielded a product of the expected size (ca. 180 bp), and its sequences revealed that it indeed corresponded to a zebra fish homolog of mammalian FMR1 (data not shown). The entire zFMR1 coding region was obtained by hybridization screens and by assembling sequences from two overlapping clones from a cDNA library. Sequence comparison between zFMR1 and human FMR1 (hFMR1) showed a high degree of amino acid conservation, particularly in a 200-amino-acid region containing the two KH domains (not shown).

dFMR1 has RNA-binding and protein-protein interaction properties similar to those of the hFMR1 and hFXR proteins. Previous studies demonstrated that FMR1 has RNA-binding activity which is conferred by the two KH domains and the RGG box (4, 53, 55). In an RNA homopolymer binding assay, in vitro-translated, ³⁵S-labeled hFMR1 protein showed strong binding to poly(G), weaker but significant binding to poly(U), and no detectable binding to poly(C) and poly(A). Under the same binding conditions, the same RNA homopolymer binding profile was observed for dFMR1 (Fig. 2A). The conservation of the RNA-binding activity between dFMR1 and hFMR1 lends further support to the conclusion that dFMR1 is functionally related to the vertebrate FMR1/FXR proteins. To assess whether the KH domains of dFMR1 confer its RNA-binding capability, point mutations predicted to inactivate the function of either KH domain were engineered into the dfmr1 cDNA by site-directed mutagenesis. A codon for a highly conserved isoleucine residue within each of the KH domains was mutated to a codon for asparagine (I244N or I307N). These KH domain mutations are analogous to a mutation identified in the FMR1 protein of a fragile X patient (17), and such analogous mutations in human FMR1 have been shown to impair RNA binding in vitro (53). Furthermore, solution structure data of these KH domains predict that these substitutions will disrupt an alpha-helix structure within the KH domain (41). RNA homopolymer binding assays with these mutant forms of dFMR1 show that either mutation impairs the ability of dFMR1 to bind poly(U) in vitro as is observed for the analogous hFMR1 mutants (Fig. 2B).

View larger version (30K): [in this window] [in a new window]   FIG. 2.   dFMR1 and hFMR1 have similar biochemical properties. (A) Binding of dFMR1 and hFMR1 to ribonucleotide homopolymers at 100 mM NaCl. dFMR1 and hFMR1 were in vitro translated and labeled with [35S]methionine; 5 µl of each was loaded onto 30 µl of poly(A), poly(C), poly(U), or poly(G) beads for binding. After washing, retained proteins were boiled in SDS-PAGE sample buffer and analyzed by SDS-PAGE followed by fluorography. Translation lanes show 20% of the proteins used in each binding. (B) Binding profile of wild-type (wt) and mutant forms of dFMR1 (I244N and I307N) and hFMR1 (I241N and I304N) to poly(U) at 400 mM NaCl. Translation lanes show 10% of the proteins used in each binding. (C) In vitro interaction between dFMR1 and human FMR1/FXR proteins. The indicated in vitro [35S]methionine-labeled proteins were incubated with GST-dFMR1 or GST (2 µg) alone. The bound proteins were analyzed by SDS-PAGE followed by fluorography. Translation lanes show 20% of each protein used in the binding assay. Sizes are indicated in kilodaltons.

Production of monoclonal antibodies to dFMR1. To facilitate characterization of the dFMR1 protein, we produced a monoclonal antibody to it, designated 6A15. By Western blotting, 6A15 recognizes a single major protein of approximately 85 kDa in extracts of Drosophila S2 tissue culture cells, which comigrates with the translation product of the dfmr1 cDNA. 6A15 does not cross-react with human FMR1 or FXR proteins, because no bands were detected from HeLa cell extract (Fig. 3A). The specificity of this monoclonal antibody was further demonstrated by immunoprecipitation of dFMR1 produced by in vitro transcription and translation (Fig. 3B). hnRNP K, another KH domain-containing protein (54), was not immunoprecipitated by 6A15. Since 6A15 specifically recognized dFMR1, we used this antibody further to determine the subcellular distribution of the protein in S2 cells. Like its human homologs, dFMR1 is localized predominantly to the cytoplasm at steady state (Fig. 3C).

View larger version (55K): [in this window] [in a new window]   FIG. 3.   Characterization of dFMR1 monoclonal antibody 6A15. (A) On a Western blot, 6A15 specifically recognizes dFMR1. The indicated cell extracts and in vitro-translated proteins were immunoblotted with 6A15. (B) 6A15 specifically immunoprecipitates dFMR1. Each antibody (2 µl of ascites fluid) was immobilized on protein A-Sepharose beads and incubated with in vitro-produced, [35S]methionine-labeled dFMR1 or hnRNP K. Translation lanes show 20% of each protein used in the immunoprecipitation experiment. Sizes are indicated in kilodaltons. (C) Cytoplasmic localization of dFMR1 in S2 cells by immunofluorescence microscopy using 6A15. Left, detection by 6A15 of dFMR1 largely in the cytoplasm of S2 cells; right, phase image of the same field of cells.

dFMR1 is ubiquitously expressed throughout Drosophila embryogenesis. To determine the timing of expression and transcript complexity of dfmr1, we performed developmental Northern analysis using a probe derived from the dfmr1 cDNA (see Materials and Methods). A prominent 2.8-kb transcript was detected in total RNAs prepared from ovaries and in poly(A)⁺ RNAs prepared from 0- to 3-h embryos. At later times, from 3 to 6 h and beyond, the major transcript detected was about 4.0 kb, and its level peaked between 9 to 12 h (Fig. 4A). Although two different-sized dfmr1 transcripts are produced during development, they appear to encode proteins of the same size because a developmental Western blot probed with 6A15 detected a single protein of the expected size of 85 kDa, whose expression level remains unchanged throughout development (Fig. 4B). This suggests that the difference in the transcript sizes is most likely due to variation in the untranslated regions of the mRNAs. Indeed, fragments of the same size were amplified from RNAs from all different stages of embryogenesis by reverse transcription-PCR using three sets of primers which span the entire dfmr1 coding region (data not shown).

View larger version (39K): [in this window] [in a new window]   FIG. 4.   Expression of dfmr1 RNA and protein during embryogenesis. (A) Northern blot analysis of dfmr1 transcripts from D. melanogaster ovaries and 0- to 16-h embryos. Total RNA (2 µg) from ovaries and poly(A)+ RNA (2 µg) from embryos were resolved by electrophoresis on a formaldehyde-agarose gel, transferred to a nitrocellulose membrane, and hybridized with a 32P-labeled fragment of dfmr1 cDNA. (B) Western blot analysis of proteins expressed throughout Drosophila embryonic development from 0 to 18 h. Extracts from S2 cells and total cellular proteins from different-stage embryos were normalized by quantitative Coomassie blue staining. Equal amounts of protein were loaded in all lanes, separated by SDS-PAGE, transferred to a nitrocellulose membrane, and probed with 6A15 at a 1:1,000 dilution. Sizes are indicated in kilodaltons.

View larger version (68K): [in this window] [in a new window]   FIG. 5.   In vivo expression of dfmr1. The dfmr1 transcript and its protein product are widely distributed throughout the developing Drosophila embryo. (A) Blastoderm (stage 5) embryo with ubiquitous distribution of dFMR1 protein. (B) Stage 11 embryo with elevated concentrations of dFMR1 in the mesoderm. (C and D) Protein (C) and transcript (D) localization in stage 14 embryos. Increased levels of expression in both RNA and protein are seen in the brain and ventral nerve cord. (E and F) At stage 16, dFMR1 expression is still high in the brain, and expression in muscles can be detected. All embryos are oriented so that anterior is left. Panels A to D are lateral views; panels E and F are ventral views.

Overexpression of dFMR1 leads to apoptosis. Given that there are no known loss-of-function alleles of dfmr1 and that a majority of genes in Drosophila do not mutate to a readily detectable phenotype (40), we tested the effect of overexpressing dFMR1 protein. Overexpression of a gene can lead to phenotypes that are often relevant to the function of the expressed gene product (48-50). To overexpress dFMR1 in developing tissues, we used the GAL4-UAS system (9) or sevenless promoter/enhancer sequences (8) that direct expression of dFMR1 in a subset of cell types in the larval eye-antennal imaginal disc. Transgenic flies containing a copy of UAS-dfmr1 (see Materials and Methods) were crossed to a variety of promoters that direct GAL4 expression in easily visualized tissues. Overexpression of dfmr1 under the control of vestigial (vg) or decapentaplegic (dpp) promoters, which direct expression in developing wing tissue, caused transgenic wings to suffer a loss of cells in the region of the wing where the promoters for these genes function. Expression of UAS-dfmr1 through dpp-GAL4, which is strongly expressed at the anterior/posterior margin of the developing wing blade, led to a decrease in cells between longitudinal veins 3 and 4, as well as loss of the anterior crossvein (Fig. 6C). A loss of cells at the margin of the wings was observed with 100% penetrance when UAS-dfmr1 was expressed under the control of vg-GAL4 (Fig. 6D). Finally, UAS-dfmr1 expression was directed by sevenless-GAL4 (sev-GAL4), which drives expression in a subset of the photoreceptor cells, the mystery cells, and the cone cells behind the morphogenetic furrow during eye development (6, 8, 64). Overexpression of dFMR1 in the eye leads to a severe rough eye phenotype (compare Fig. 6F and E).

View larger version (122K): [in this window] [in a new window]   FIG. 6.   Overexpression of dFMR1 induces apoptosis. (A to D) Overexpression of dfmr1 in wing tissue leads to cell loss. (A and B) UAS-dfmr1 or vg-GAL4 wings by themselves have no obvious defects. No other GAL4 driver stocks used in this study have any visible phenotypes. The arrow in panel A denotes the anterior crossvein; L3 and L4 refer to longitudinal veins 3 and 4. (C) Expression of UAS-dfmr1 under dpp-GAL4 control leads to wings with missing anterior crossveins and with fewer cells between the L3 and L4 veins. (D) vg-GAL4-driven expression of UAS-dfmr1 leads to a loss of cells at wing margins. (E and F) Overexpression of dfmr1 in the eye leads to a severe rough eye phenotype. Scanning electron micrographs show adult eyes from control sevenless-GAL4/+ (sev-GAL4) (E) and sev-GAL4/UAS-dfmr1 (F). (G and H) Eye-antennal imaginal discs from sev-GAL4/+ (G) and sev-GAL4/UAS-dfmr1 (H) larvae stained with acridine orange, a marker for apoptotic activity. Relatively few acridine orange-stained cells are seen in a sev-GAL4/+ disc, while significantly more cells stained with acridine orange are present (outlined by bracket) when UAS-dfmr1 is expressed by sev-GAL4. (I to K) The rough eye phenotype induced by sevenless overexpression of dfmr1 is partially suppressed by coexpression of DIAP1/THREAD an inhibitor of apoptotic activity. (I) Eye from a GMR-diap1/+ fly, which is wild type in appearance. (J) Eye from a sev-dfmr1 fly, showing disorganized ommatidia over the eye surface. (K) Eye from a GMR-diap/sev-dfmr1 fly shows a partial rescue over the phenotype seen in panel J, with more organized ommatidia present.

The effects of overexpressing dFMR1 are dependent on the function of the KH domains. One potential problem with an analysis dependent on overexpression is nonspecific effects caused by the overabundance of a protein. To assess whether the overexpression phenotype is specific to a normal function of the dFMR1 protein, dfmr1 alleles containing isoleucine-to-asparagine changes (I244N and I307N) in either or both KH domains were expressed behind UAS (Fig. 7A). Using sev-GAL4 as a driver, transgenic stocks were selected for lines that exogenously expressed wild-type and mutant forms of dFMR1 at approximately equal levels to allow for quantitative comparisons of the phenotypic effect (Fig. 7B).

View larger version (88K): [in this window] [in a new window]   FIG. 7.   The phenotype elicited by overexpressing dFMR1 is dependent on the functions of its KH domains. (A) Schematic of UAS-dfmr1 alleles used for this study. Highly conserved isoleucine residues known to be essential for RNA-binding function were mutated to asparagine to inactivate either one or both of the KH domains. (B) Western blot analysis of extracts prepared from eye-antennal imaginal discs of w1118 or flies expressing the transgenes described in panel A under sev-GAL4 control. An antibody that recognizes -tubulin was used as a loading control. (C to G) Scanning electron micrographs of adult eyes expressing dfmr1. (C) Oregon-R; (D) sev-GAL4 expression of UAS-dfmr1; (E) sev-GAL4 expression of UAS-dfmr1I244N allele; (F) sev-GAL4 expression of UAS-dfmr1I307N allele; (G) sev-GAL4 expression of UAS-dfmr1I244N, I307N double mutant. (H to L) Cross sections of ommatidia from eyes of the above-mentioned genotypes. Sections (1 µm) from fixed eyes were stained with toluidine blue and examined by microscopy. (H) Oregon-R; (I) sev-GAL4 expression of UAS-dfmr1; (J) sev-GAL4 expression of UAS-dfmr1I244N allele; (K) sev-GAL4 expression of UAS-dfmr1I307N allele; (L) sev-GAL4 expression of UAS-dfmr1I244N, I307N double mutant.

Dominant-negative functions for the I244N and I307N substitutions in dFMR1 protein? A severe case of fragile X has been described in which there is a single missense mutation in the second KH domain of the FMR1 gene that substitutes an asparagine residue for the normal isoleucine residue (I304N). The extreme phenotype of this patient, as well as observations that the I304N mutation causes abnormally sized RNP particles to form (22) and that mutations mapping to the KH domains of some genes elicit stronger phenotypes than null alleles of the same gene (31, 38), has suggested that the effects of the I304N mutation in hFMR1 may be due to a dominant-negative rather than a loss-of-function effect. To determine whether the phenotype elicited by the dFMR1 I307N substitution was due to a dominant-negative or a loss-of-function effect, we generated Drosophila stocks that in addition to overexpressing dFMR1 I307N had a deficiency in a wild-type copy of dfmr1. The deficiency Df(3R)by62 (85D11-85F16) removes one copy of dfmr1 as assessed by quantitative Southern hybridization (data not shown). If the I307N mutation of dFMR1 acts as a dominant negative, removal of one wild-type copy of the gene would be predicted to increase the severity of the rough eye phenotype. In contrast, if the I307N mutation represented a partial loss of function, removal of one wild-type copy of dfmr1 would be expected to have no effect on the eye or perhaps even lessen the rough phenotype. The comparison of UASdfmr1^I307N/+; sev-GAL4/+, and UASdfmr1^I307N/+; sev-GAL4/Df(3R)by62 flies indicates no obvious enhancement of eye roughness (compare Fig. 8B and C) and perhaps shows a lessening of the defect in flies with the dfmr1 deficiency. Identical results were observed for the mutation in the first KH domain of dFMR1 (I244N [data not shown]). These results indicate that the isoleucine-to-asparagine changes in the KH domains of dFMR1 act as loss-of-function mutations in the genetic background used for these experiments.

View larger version (91K): [in this window] [in a new window]   FIG. 8.   The I307N mutation of dFMR1 acts as a loss-of-function mutation. Scanning electron micrographs show adult eyes from Oregon-R (A), UAS-dfmr1I307N/+; sev-GAL4/+ (B), and UAS-dfmr1I307N/+; sev-GAL4/Df(3R)by62 (C) flies.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

An invertebrate homolog of the FMR1/FXR gene family. dFMR1 represents the first invertebrate homolog of the FMR1/FXR gene family. Like the vertebrate members of the FMR1/FXR gene family, dFMR1 contains two KH domains that are 85% similar in amino acid sequence to those of hFMR1, as well as an RGG box. Indeed, dFMR1 binds homopolymeric RNAs with a profile similar to that of hFMR1. Previously defined domains that mediate the interaction of FMR1/FXR proteins with the 60S ribosomal subunit and mediate protein-protein interaction among FMR1/FXR family members are also highly conserved in dFMR1. Also like its vertebrate counterparts, dFMR1 is mostly localized to the cytoplasm. We have also shown that the two KH domains in dFMR1 have activity in vivo. The high degree of conservation of the functional domains between dFMR1 and vertebrate FMR1/FXR proteins strongly suggests that these proteins all have similar biological functions.

The KH domains of dFMR1 are essential for its function. Our results from analyzing mutations in the KH domains of dFMR1 indicate that each KH domain is required for in vivo function, as judged by the rough eye phenotypes elicited upon overexpression of the mutant dFMR1 bearing a single point mutation in either of the two KH domains. The importance of RNA-binding activity to dFMR1 function is underscored by the observation that mutation of either KH domain of dFMR1 affects its homopolymeric RNA-binding activity and that overexpression of a dfmr1 allele where both KH domains have been inactivated leads to no obvious phenotype.

Drosophila as a model system to study the in vivo functions of FMR1/FXR proteins. The RNA-binding activity of the FMR1/FXR proteins is one biochemical property of these proteins that has been experimentally demonstrated. Human FMR1 has been reported to bind approximately 4% of human fetal brain mRNAs, thus displaying a degree of selectivity for RNA substrates (4), but other than the FMR1 mRNA, RNA substrates to which the FMR1/FXR proteins may bind have not been identified. Loss of function of FMR1 in mice leads to abnormalities in dendritic spine processing and maturation, and FMR1 mRNA is rapidly translated in response to neurotransmitter at synapses (15, 67). Thus, it has been proposed that vertebrate FMR1 protein is essential for some aspects of neural development. Specific functions for FXR1 and FXR2 are unknown. Given the considerable overlap in the expression patterns between the three vertebrate members of the FMR1/FXR family and that all three proteins can be isolated as RNPs, it has been speculated that these proteins may be functionally redundant to some degree (3). This makes it more difficult to genetically dissect the function of these proteins in mammals.