Previous Article | Next Article 
Molecular and Cellular Biology, December 2000, p. 8783-8792, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Runx2 Is a Common Target of Transforming Growth Factor
1 and
Bone Morphogenetic Protein 2, and Cooperation between Runx2 and
Smad5 Induces Osteoblast-Specific Gene Expression in the
Pluripotent Mesenchymal Precursor Cell Line C2C12
Kyeong-Sook
Lee,1
Hyun-Jung
Kim,2
Qing-Lin
Li,1
Xin-Zi
Chi,1
Chisato
Ueta,3
Toshihisa
Komori,3
John M.
Wozney,4
Eung-Gook
Kim,1
Je-Young
Choi,2
Hyun-Mo
Ryoo,2 and
Suk-Chul
Bae1,*
Department of Biochemistry, School of
Medicine, and Medical Research Institute, Chungbuk National University,
Cheongju 361-763,1 Department of
Biochemistry, School of Dentistry, and Medical Research Institute,
Kyungpook National University, Taegu,2
Korea; Department of Medicine III, Osaka University Medical
School, Osaka 565, Japan3; and Genetics
Institute, Inc., Cambridge, Massachusetts4
Received 27 June 2000/Returned for modification 22 August
2000/Accepted 8 September 2000
 |
ABSTRACT |
When C2C12 pluripotent mesenchymal precursor cells are treated with
transforming growth factor
1 (TGF-
1), terminal differentiation into myotubes is blocked. Treatment with bone morphogenetic protein 2 (BMP-2) not only blocks myogenic differentiation of C2C12 cells but
also induces osteoblast differentiation. The molecular mechanisms governing the ability of TGF-
1 and BMP-2 to both induce
ligand-specific responses and inhibit myogenic differentiation are
not known. We identified Runx2/PEBP2
A/Cbfa1, a global regulator of
osteogenesis, as a major TGF-
1-responsive element binding protein
induced by TGF-
1 and BMP-2 in C2C12 cells. Consistent with the
observation that Runx2 can be induced by either TGF-
1 or BMP-2, the
exogenous expression of Runx2 mediated some of the effects of TGF-
1
and BMP-2 but not osteoblast-specific gene expression. Runx2 mimicked common effects of TGF-
1 and BMP-2 by inducing expression of matrix gene products (for example, collagen and fibronectin), suppressing MyoD
expression, and inhibiting myotube formation of C2C12 cells. For
osteoblast differentiation, an additional effector, BMP-specific Smad
protein, was required. Our results indicate that Runx2 is a
major target gene shared by TGF-
and BMP signaling pathways and that
the coordinated action of Runx2 and BMP-activated Smads leads to the
induction of osteoblast-specific gene expression in C2C12 cells.
 |
INTRODUCTION |
Transforming growth factor
(TGF-
) is a potent multifunctional regulator of cell growth
and differentiation. Although nearly all cells synthesize and
respond to TGF-
, bone and cartilage are particularly rich in this
growth factor (6, 46). TGF-
1, the prototypic member of
the TGF-
superfamily, elicits diverse cellular responses,
including (i) inhibition of adipogenesis and myogenesis and (ii)
stimulation of chondrogenesis and osteogenesis (31).
TGF-
1 stimulates the synthesis of matrix proteins and their
receptors (for example, fibronectin, fibronectin receptor, collagen,
osteonectin, osteopontin, and integrins) and inhibits matrix
degradation by increasing the production of protease inhibitors and
decreasing the production of proteases (42). Members of the
TGF-
superfamily with important effects on bone cell differentiation are bone morphogenetic proteins (BMPs) (17, 41), which were first identified as factors that induce bone formation in vivo when
implanted into muscular tissues (54). Unlike TGF-
, which induces new bone formation only when injected near bone, BMPs produce
bone formation even when injected into ectopic sites. TGF-
and BMPs
bind to distinct receptors, TGF-
type I and II receptors for TGF-
and BMP type I and II receptors for BMPs. Following ligand binding, the
receptor-associated kinase is activated and phosphorylates Smads, which
move into the nucleus to stimulate the transcription of a set of target
genes. Smad2 and -3 are activated by TGF-
receptors and mediate
TGF-
responses, whereas Smad1, -5, and -8 are activated by BMP
receptors and transduce BMP signals (15, 32, 57).
The pluripotent mesenchymal precursor cell line C2C12 provides a model
system to study the early stage of osteoblast differentiation during
bone formation in muscular tissues. In this model, TGF-
1 inhibits
the differentiation of C2C12 cells into multinucleated myotubes without
inducing osteoblast phenotypes. BMP-2 not only inhibits the terminal
differentiation of C2C12 cells but also induces osteoblast phenotypes
(20). Therefore, the C2C12 model is useful for analyzing
both the common and specific signaling mechanisms of TGF-
and BMPs.
In C2C12 cells, overexpression of Smad1 and Smad5 induced alkaline
phosphatase (ALP) activity, a typical osteoblast-specific marker, and
inhibited muscle-specific gene expression (11, 36, 56).
These results suggested that BMP functions via either Smad1 or Smad5
and that the induction of the osteoblast phenotype and the inhibition
of myogenic differentiation are regulated at the transcriptional level.
However, the molecular mechanisms through which Smads block myogenic
differentiation and induce osteogenic differentiation are not known.
Runx/PEBP2/Cbf (hereafter referred to as Runx) is a sequence-specific
DNA binding protein that recognizes a specific DNA sequence originally
identified as the binding site for polyomavirus enhancer binding
protein (PEBP) (2, 38). Runx/PEBP2/Cbf was also
identified as the Moloney murine leukemia virus enhancer core
binding protein (53). The consensus sequence
recognized by Runx was determined to be 5'-(Pu/T)ACCPuCPu-3' or
5'-PyGPyGGT(Py/A)-3' (3, 19, 33, 38). Each member of
the Runx family is composed of two subunits,
and
.
The
subunit is encoded by three distinct genes,
Runx1 (PEBP2
/Cbfa2/AML1), Runx2 (PEBP2
A/Cbfa1/AML3), and
Runx3 (PEBP2
C/Cbfa3/AML2). So far, only one
gene encoding the
subunit, PEBP2
/Cbfb, has been
described (4, 39, 53). The DNA binding activity of the
subunit, which binds DNA very weakly, is strongly stimulated by the
subunit. The recent identification of Runx2 as a transcription factor
required for bone formation was a significant milestone in osteoblast
biology. Both intramembranous and endochondral ossification were
blocked owing to the maturational arrest of osteoblasts in Runx2
knockout mice (21, 40). The Runx2 gene is also
involved in the human disease cleidocranial dysplasia (CCD), an
autosomal dominant bone disorder. In Runx2+/
heterozygous
mice, Otto et al. noticed abnormalities, the most prominent of which
were hypoplasia of the clavicle and delayed development of membranous
bones (40). These phenotypes are typical features of CCD.
Together with these observations, deletions, insertions, or mutations
that inactivated one allele of the Runx2 gene were
shown to be the cause of the CCD syndrome in humans (24,
34). These results proved that Runx2 is an essential transcription factor required for bone formation. However, the underlying molecular mechanisms by which Runx2 expression is regulated and Runx2 controls osteoblast gene expression are still poorly understood.
In this study, we investigated the molecular mechanisms that block
myoblast differentiation and induce osteoblast differentiation in C2C12
cells. Exogenous expression of Runx2 mimicked the common activities of
TGF-
1 and BMP-2, inducing matrix gene expression, suppressing MyoD
expression, and inhibiting myotube formation of C2C12 cells.
However, Runx2 alone was not sufficient for osteoblast-specific gene
expression. For this, the coordinate actions of Runx2 and BMP-activated
Smads were required.
 |
MATERIALS AND METHODS |
Materials.
Bioactive recombinant human BMP-2 was produced
and purified from the conditioned medium of CHO cells, and purity and
bioactivity were checked as described previously (52).
Recombinant human TGF-
1 was purchased from Sigma. Anti-Runx and
anti-PEBP2
/Cbf
polyclonal antibodies and anti-Runx2 monoclonal
antibody were kind gifts from Y. Ito (Kyoto University, Kyoto, Japan).
Reagents were purchased from the following vendors: restriction enzymes from Takara (Tokyo, Japan) or New England Biolabs; cell culture reagents, G418, and Lipofectamine from Gibco/BRL; human recombinant TGF-
1 from Sigma; mouse monoclonal anti-FLAG M2 antibody from IBI;
enhanced chemiluminescence (ECL) Western blotting kit including goat
anti-mouse horseradish peroxidase-conjugated antibody, Hybond-N+ nylon
membrane, and Rediprime DNA labeling kit from Amersham; luciferase
assay kit from Promega; hygromycin from Clontech; Immobilon from
Millipore; poly(dI-dC) from Pharmacia; all oligonucleotides from
Bioneer (Cheongiu, Korea); type I collagen gel (Cellmatrix type I-A)
from Nitta Gelatin Co. (Tokyo, Japan); and collagenase from Wako
(Osaka, Japan). All other chemicals of the purest grade available were
obtained from commercial sources. Sense-strand sequences of the
double-stranded oligonucleotides used in electrophoretic mobility shift
assays (EMSAs) are as follows: T
RE (TGF-
1-responsive element),
5'-gaTCCACCACAGCCAGACCACAGGCAGACATGAgga-3'; M1, 5'-gaTCCAGGACAGCCAGACCACAGGCAGACATGAgga-3'; M2,
5'-gaTCCACCACAGCCAGAGGACAGGCAGACATGAgga-3'; and
M3, 5'-gaTCCACCACAGCCAGACCACAGGCATCCATGAgga-3'.
Lowercase letters indicate nucleotides not present in the
immunoglobulin (Ig) C
promoter that were added for cloning and end
labeling; underlined nucleotides indicate mutations; the perfect match
of the Runx binding site in T
RE is indicated in boldface.
Plasmids.
The mouse Runx2-
A1 cDNA cloned into
pBluescript II-KS (38) and pcDNA3.1 (Invitrogen) was used
for generating the Runx2 expression construct, pcDNA3.1-Runx2-
A1.
The entire coding region of mouse Runx2-
A1 cDNA was
amplified by PCR with the primers 5'GGCTGGGATCCGGTATGCGTATTCCT (sense) and
5'-GGTTGAAGATCTTCAATATGGCCGCCA (antisense). Translation initiation and stop codons in the
primers are underlined. The PCR product was digested with
BamHI and XbaI, whose sites were
provided by the primers used, and the resulting DNA fragment
was ligated into pcDNA3.1/HisC treated with BamHI and
XbaI. The nucleotide sequence of the entire region amplified by PCR was verified by nucleotide sequencing of both strands. The
luciferase reporter plasmid, pGL3-T
RE, was constructed by inserting
two copies of the T
RE (originally identified in the Ig C
promoter
[29]), separated by 72 nucleotides of DNA derived from
pBluescript II-KS (Stratagene), into the BglII site of the pGL3-promoter plasmid (Promega). pGL3-M2 was constructed by the same
method except that the mutant T
RE M2 was used. pcDNA3-FLAG-Smad5 expressing human Smad5 tagged with FLAG was a gift from K. Miyazono (Cancer Institute of the Japanese Foundation for Cancer Research, Tokyo, Japan).
Cell lines and culture.
The mouse pluripotent mesenchymal
precursor cell line C2C12 was purchased from the American Type
Culture Collection C2C12 and MC3T3-E1 cells were maintained
in Dulbecco modified Eagle medium (DMEM) containing 15% fetal bovine
serum (FBS), and penicillin G (100 U/ml), and streptomycin (100 µg/ml) at 37°C in a humidified atmosphere of 5% CO2 in
air. The Runx2
/
calvaria cell line H1-127-30 was
established as follows. Runx2+/
mice were mated
with p53+/
mice, and Runx2+/
p53+/
mice were generated. Mating of these
littermates produced Runx2+/
p53
/
mice. Runx2
/
p53
/
embryos were
obtained at embryonic day 18.5 from the mating of these littermates.
Small fragments dissected from parietal bone of Runx2
/
p53
/
embryos at embryonic day 18.5 were cultured in
type I collagen gel in alpha-minimal essential medium overlaid by
alpha-minimal essential medium containing 10% FBS, penicillin G (100 U/ml), and streptomycin (100 µg/ml). After 10 days of culture, the
cells migrating from the explants were harvested by treatment with
0.2% collagenase. The cells were diluted on 10-cm-diameter dishes, and
each colony was picked up using cloning rings. One colony, named
H1-127-30, was expanded and used for further analysis.
Stable transfection.
To obtain Runx2-overexpressing C2C12
(C2C12-Rx2) cells, stable transfection of pcDNA3.1-Runx2-
A1 into
C2C12 cells was done via the Lipofectamine method as specified by the
manufacturer (Gibco/BRL). G418-resistant colonies were selected by
adding G418 (600 µg/ml) to the medium for 2 weeks. Viable colonies
were subcultured, and Runx2-overexpressing clones were screened
by Western blotting. C2C12 cells stably expressing Smad5 (C2C12-Sm5
cells) were obtained by the same method except that
pcDNA3-FLAG-Smad5 was used for transfection. To obtain C2C12
cells stably expressing both Smad5 and Runx2 (C2C12-Sm5-Rx2 cells),
C2C12-Rx2 was subjected to a second round of stable transfection with
pcDNA3-FLAG-Smad5 and pTK-Hyg vectors (Clontech). The stably
transfected cells were screened for 2 weeks in selection medium
containing G418 (600 µg/ml) and hygromycin B (300 µg/ml). Viable
colonies were further screened by Western blotting.
Transient transfection and luciferase assays.
For the
luciferase assay, cells were transfected with Lipofectamine according
to the manufacturer's instructions. Briefly, 2 × 105
cells were plated in each well of a six-well plate. The next day, cells
were transfected by the Lipofectamine method (Gibco/BRL). Each
transfection assay was performed with various combinations of 1 µg of
the luciferase construct, 1 µg of the Runx2 expression plasmid
(pcDNA3.1-Runx2-
A1), and 1 µg of the constitutive active form of
the TGF-
receptor I. The total amount of exogenous DNA was
maintained at 5 µg/plate by adding the appropriate amount of salmon
sperm DNA. All plasmid DNA was prepared using a Qiagen Midi kit.
After 6 h, the medium was changed and cultured for an additional
42 h. Cells were then lysed, and luciferase activity was
determined using a Dual Luciferase Reporter Assay kit as instructed by
the manufacturer (Promega). Results were obtained from at least two
independent experiments with triplicate samples for each experiment.
EMSA.
Nuclear protein extracts were prepared from cells
stimulated with TGF-
1 or BMP-2 as described previously
(45). Protein concentrations of the extracts were
determined using the Bradford assay (Bio-Rad). A double-stranded
DNA probe, T
RE (see above), was prepared and used for EMSA as
described previously (19). All binding assays were performed
at 30°C for 30 min in 20 µl of binding buffer [20 mM HEPES (pH
7.6), 4% (wt/vol) Ficoll type 400, 50 mM KCl, 2 mM EDTA, 2 µg of
poly(dI-dC)] containing 1 nM 32P-end-labeled probe (20,000 to 30,000 cpm) and about 5 µg of nuclear protein extract. The
competition assay contained 50 times more unlabeled double-stranded
synthetic competitor DNA. For supershift experiments, monoclonal
antibody (or antiserum; 0.5 µl) was added to the entire mixture. Half
of each reaction mixture was loaded onto a 0.25× Tris-borate-EDTA-5%
nondenaturing polyacrylamide gel, electrophoresed at 250 V for 1 h
and autoradiographed for 16 h at
70°C, using two sheets of
intensifying screens.
Northern blot analysis.
Total cellular RNA was prepared as
described previously (44). Then 5 µg of RNA was resolved
in a 1.2% formaldehyde-agarose gel and transferred to a Hybond-N+
nylon membrane using 10× SSPE buffer (0.18 M NaCl, 0.01 M
NaH2PO4, 0.001 M Na2EDTA [pH
7.7]). RNA was cross-linked to the filter by UV irradiation for 1 min and stored until use. The DNA probes were either the PCR product or
cloned cDNA of mouse Runx2 (38), rat ALP (37),
human collagen type I (8), human fibronectin
(22), rat osteocalcin (27), or mouse MyoD
(9) and were all labeled with [
-32P]dCTP
(3,000 Ci/mmol; NEN) using a Rediprime DNA labeling kit. The blot was
prehybridized in 5× SSPE-5× Denhardt's solution-0.5% sodium
dodecyl sulfate (SDS)-100 µg of salmon sperm DNA/ml at 65°C for
1 h. For hybridization, heat-denatured radioactive DNA probe
(106 cpm/ml) was added, and the mixture was incubated at
65°C overnight. After hybridization, the blots were washed in 2×
SSPE-0.1% SDS at room temperature for 15 min and twice in 0.1×
SSPE-0.1% SDS at 65°C for 15 min for the rat and mouse probes. For
the human probes, the membrane was washed in 0.5× SSPE-0.1% SDS at
42°C instead of 0.1× SSPE-0.1% SDS. The blots were exposed to
Kodak XAR-5 film at
70°C with two sheets of intensifying screens.
Western blot analysis.
Proteins from cell lysates were
resolved by SDS-8 to 10% polyacrylamide gel electrophoresis and
transferred to Immobilon (Millipore). The blots were blocked in BP
solution (50 mM Tris [pH 7.5], 150 mM NaCl, 0.1% Tween 20)
containing 2% nonfat dry milk. Primary antibody (FLAG or Runx2) was
added to the BP solution at a 1:2,000 dilution for 1 h at room
temperature. The blots were washed three times with the BP solution and
incubated with the goat anti-mouse antibody for 1 h at room
temperature. After three washes with BP solution, the blots were
developed by ECL and exposed on Kodak XAR-5 film.
 |
RESULTS |
The major T
RE binding protein induced by TGF-
1 and BMP-2 is
Runx2.
C2C12 cells differentiate into multinucleated myotubes when
the serum concentration is reduced from 15% to 5%. Treatment with TGF-
1 (5 ng/ml) or BMP-2 (300 ng/ml) completely inhibits myotube formation. We studied the molecular mechanism of this inhibition of
terminal differentiation. Using the T
RE present in the Ig C
promoter (Fig. 1A)
(29), the DNA binding activity of the T
RE binding protein
was examined by EMSA. As shown in Fig. 1B, T
RE binding activity was
detected in C2C12 cells, and the activity was significantly increased
by TGF-
1 and BMP-2 (compare lanes 1, 6, and 11). The two elements
present in the T
RE have been shown to be Runx and Smad binding sites
(13, 47). Therefore, we tested which of these sites actually
mediates the binding of the T
RE binding protein induced by TGF-
1.
For this purpose, we prepared three mutant forms of the T
RE (M1, M2,
and M3 [Fig. 1A]) with a base substitution in the first (M1) or
second (M2) putative Runx binding site or in the putative Smad binding
site (M3). Addition of M1 or M3 effectively competed out the entire T
RE-protein interaction (Fig. 1B, lanes 3, 5, 8, 10, 13, and 15),
whereas M2 did not (lanes 4, 9, and 14), suggesting that the induced
protein bound to the second Runx consensus sequence but not to the
first (M1 site), which is imperfect (Fig. 1A). To examine whether the
TGF-
1 or BMP-2-induced T
RE binding protein is actually
Runx, EMSA supershift assays were performed using Runx2 or
PEBP2
/Cbf
-specific antibodies. As shown in Fig. 1C, the
T
RE binding protein-DNA complex was supershifted by a polyclonal antibody that recognizes Runx1, -2, and -3 (lanes 2 and 5) and by a
monoclonal antibody that recognizes only Runx2 (lanes 8, 10, and 12) as
well as by PEBP2
/Cbf
-specific antiserum (lanes 3 and 6), while no
supershifted band was observed using preimmune serum (lanes 1 and
4). Since the T
RE binding protein was effectively supershifted by
the Runx2-specific monoclonal antibody (lanes 8, 10, and 12), the
T
RE binding protein must contain mainly Runx2. Furthermore, these
results indicate that TGF-
1 or BMP-2 induces primarily the Runx2
isoform in C2C12 cells. It is worth mentioning that addition of
PEBP2
/Cbf
protein did not change the mobility or the intensity of
the shifted band (Fig. 1B, lane 2, 7, and 12). However, the
T
RE-bound complex was supershifted by anti-PEBP2
antibody (Fig.
1C, lanes 3 and 6). The results suggest that Runx2 bound to the T
RE
was already complexed with the
subunit, as has already been
suggested for all family members of the
subunit family (4,
5). A time course study showed that the induction of the T
RE
binding protein (Runx2) reached a maximum as early as 4 h after
TGF-
1 stimulation (about 20-fold over control at maximal level) and
gradually decreased thereafter, even though the cells were continually
stimulated by TGF-
1 (Fig. 1D).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of the T RE binding protein by EMSA.
(A) Oligonucleotide sequences of the T RE identified in the Ig C
promoter (29) and three mutant DNAs, M1 (one mismatch in the
putative Runx binding site [CACCACA]), M2 (a perfect match
[GACCACA]), and M3 (putative Smad binding site
[CAGACA]). Putative Runx2 and Smad binding sites are
indicated by solid and dotted underlining, respectively, and mutated
nucleotides are marked by asterisks. (B) EMSA was performed by using
the T RE probe and nuclear lysates obtained from C2C12 cells
untreated or treated with TGF- 1 or BMP-2 for 24 h. The
reactions were performed in the presence or absence of PEBP2 /Cbf
protein. A 50-fold molar excess of unlabeled mutant oligonucleotide was
incubated with the nuclear lysates as competitor DNA (Ct). The arrow
and arrowhead indicate the T RE binding complex and free probe,
respectively. (C) EMSA was performed by using the same nuclear lysates
and T RE probes in the presence or absence of a polyclonal antibody
which recognized all members of the Runx subunit (anti- ; lane 2 and 5) or subunit (anti- ; lane 3 and 6) or a monoclonal antibody
which specifically recognized Runx2 (anti-Runx2; lanes 8, 10, and 12).
The arrowheads and arrows indicate the positions of Runx2 and Runx-antibody complexes, respectively. (D) Time course
induction of Runx2 was analyzed by EMSA using nuclear lysates prepared
from cells treated with TGF- 1 for 0, 4, 12, 18, 24, 72, and 120 h. A nuclear extract prepared from cells cultured for 72 h in the
absence of TGF- 1 was used as a control. EMSA was performed with the
T RE probe in the presence or absence of a 50-fold molar excess of
unlabeled M3 as competitor. The arrow indicates the T RE binding
complex. Ct, competitor.
|
|
We analyzed whether the induction of Runx2 is regulated at the mRNA
level. Total cellular RNA was isolated from the C2C12
cells treated
with TGF-

1 or BMP-2 for the indicated time, and
the level of Runx2
expression was analyzed by Northern blot hybridization.
As shown
in Fig.
2A,
Runx2 mRNA was
induced by TGF-

1 and BMP-2
stimulation. The
Runx2 mRNA
level reached a maximum 2 h after
stimulation and decreased
thereafter, even though the cells were
continually stimulated with
TGF-

1 or BMP-2. At least two isoforms
of Runx2, which are identical
except for their N-terminal regions,
are known to exist. PEBP2

A1
(
38), which we will call Runx2-

A1
hereafter, is a
prototype of Runx2. The other (Runx2-Til-1) is
known as Til-1
(
48) or OSF2 (
10).
til-1 and
OSF2 have been
found to encode the same protein
(
49). We examined to see which
form was induced by TGF-

1
and BMP-2 stimulation. Northern blot
experiments using a cDNA probe
covering the common region of both
isoforms (Rx2-Ct) detected two bands
(Fig.
2B). Rehybridization
of the blot with the
Runx2-
A1-specific or
Runx2-til-1-specific
probe revealed that the upper and lower bands corresponded to
Runx2-

A1 and Runx2-Til-1, respectively. These results indicate
that TGF-

1 and BMP-2 can induce both isoforms (Fig.
2B).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Induction of Runx2 mRNA by TGF- 1 and
BMP2. (A) C2C12 cells were treated with TGF- 1 (5 ng/ml) or BMP-2
(300 ng/ml) for the indicated times, and total RNA was prepared.
Northern blotting was performed using PEBP2 A cDNA
(38), which contains the common region of
Runx2- A1 and Runx2-til-1, as a probe for
Runx2 (Rx2-Ct). (B) Total RNAs were prepared from C2C12
cells treated with BMP-2 (300 ng/ml) for 6 h and analyzed by
Northern blot hybridization using the Rx2-Ct probe. The same blot was
stripped and rehybridized with Runx2- A1 (38)-
or Runx2-til-1 (48)-specific probes. A probe
prepared from the GAPDH coding sequence was used as a
loading control.
|
|
Binding of Runx2 to T
RE is required for the response to
TGF-
1.
To examine the role of Runx2, we inserted two tandemly
repeated T
REs or a mutant version (M2) of the Ig C
promoter into the pGL3-promoter plasmid (Promega) (Fig.
3A) and measured
cis-acting activity by the luciferase assay. In agreement
with Runx2 being the major T
RE binding protein induced by TGF-
1,
we observed an approximately threefold increase in the transcriptional
activity of the T
RE-luciferase reporter after transfection of a
constitutively active form of the TGF-
receptor I and Runx2 into
C2C12 cells (Fig. 3B). A complete loss of response was observed with
the M2 mutant, indicating that Runx2 is essential for transcriptional activation of target genes in response to TGF-
1. To rigorously establish the requirement for Runx2 in T
RE function, we used the
cell line H1-127-30 (see Materials and Methods). When
Runx2+/+ (MC3T3-E1) calvaria cells were transfected with
the T
RE reporter, a two- to threefold induction was observed
after TGF-
1 treatment. This TGF-
1-dependent induction was
also completely abrogated by the mutation in the Runx binding site
(Fig. 3C). When H1-127-30 cells were transfected with the T
RE
reporter, the T
RE did not respond to TGF-
1 at all. Expression of
Runx2 in H1-127-30 cells, however, strongly induced T
RE reporter
activity, and treatment with TGF-
1 further induced reporter activity
(Fig. 3D). It is worth noting that the expression of Runx2 by itself
induced gene expression through the T
RE in the absence of TGF-
1,
while TGF-
1 by itself had no effect. This result firmly establishes
that Runx2 is essential for the TGF-
1 responsiveness of the T
RE.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of Runx2 to the Runx binding site is essential
for the TGF- 1 responsiveness of the T RE. (A) Diagrams of
luciferase reporter constructs. Two reporters for the T RE of the Ig
C promoter were constructed using the pGL3-promoter plasmid
(Promega) containing the simian virus 40 promoter (SV40 Pr) as a
backbone, i.e., one with the wild-type (WT) T RE (pGL3-T RE) DNA
and the other with the T RE mutated at the Runx binding site (pGL3-M2). Two copies of the element were inserted for
each plasmid construct. (B) pGL3, pGL3-M2, and pGL3-T RE reporters
were transfected into C2C12 cells with the Runx2 expression plasmid
(Runx2) or the constitutively active TGF- receptor I expression
plasmid (T R-I) or with both. Cells were harvested 48 h after
transfection, and luciferase activities were assayed. (C and D) The
same reporters were transfected into MC3T3-E1 and H1-127-30 cells with
or without the Runx2 expression plasmid (Runx2) and cultured in the
presence or absence of TGF- 1 for 24 h. Luciferase activities
were measured, and relative activities are shown.
|
|
Runx2 mediates the common activities of TGF-
1 and BMP-2.
Since both TGF-
1 and BMP-2 induce Runx2, we asked whether Runx2
could mediate the common function of TGF-
1 and BMP-2. Therefore, we
examined whether exogenous expression of Runx2 could block myogenic
differentiation. For this purpose, C2C12-Rx2 cells were used (Fig.
4A). When control C2C12 cells, which bear
only the empty vector, were cultured for 10 days in medium containing
5% serum, extensive formation of multinucleated myotubes was observed. Myotube formation was completely blocked in cells stably expressing Runx2 as well as in the TGF-
1- or BMP-2-treated cells, indicating that Runx2 by itself is sufficient to block myogenic differentiation (Fig. 4B). To confirm this result, molecular markers for TGF-
1 and
BMP-2 stimulation were analyzed. Both TGF-
1 and BMP-2 are known to
suppress MyoD (20) and induce collagen
1(I) and
fibronectin expression (25). Up- or down-regulation of these
marker genes by TGF-
1 and BMP-2 was confirmed in control C2C12 cells
(Fig. 5, lanes 1 to 3); constitutively
expressed Runx2 also suppressed MyoD and induced collagen
1(I) and
fibronectin expression in C2C12 cells (lane 4). It is worth noting that
MyoD, which is critically important for myogenic differentiation, was
suppressed by exogenous expression of Runx2. Given that Runx2 blocks
myogenic differentiation, it can be assumed that Runx2 expression must
be suppressed for the induction of myogenic differentiation. As shown
in Fig. 6, Runx2 expression was
significantly suppressed during myogenic differentiation whereas MyoD
expression was slightly enhanced. These results suggest that
Runx2 is an essential and common target of TGF-
1 and
BMP-2 signaling and that the induction of Runx2 is a key event in
the inhibition of myogenic differentiation.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 4.
Morphological changes of C2C12 cells stably expressing
Runx2. (A) Western blotting showing overexpression of Runx2 in
C2C12-Rx2 cells. Cytoplasmic (C) and nuclear (N) protein extracts were
prepared from C2C12 and C2C12-Rx2 cells, and Runx2 protein was detected
by Western blotting. An arrow indicates Runx2 protein. (B) C2C12 cells
containing the empty vector were cultured for 10 days in
differentiation medium (5% FBS in DMEM) in the presence or absence of
TGF- 1 (5 ng/ml) or BMP-2 (300 ng/ml). C2C12-Rx2 cells were cultured
under the same conditions in the absence of TGF- 1 and BMP-2. After
incubation, morphological changes were compared.
|
|

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 5.
Pattern of gene expression following BMP-2 and TGF- 1
treatment of C2C12 and C2C12-Rx2 cells. Control C2C12 (lane 1 to 3) and
C2C12-Rx2 (lane 4 to 6) cells were treated with TGF- 1 (5 ng/ml) or
BMP-2 (300 ng/ml) for 3 days. Total RNA was extracted and analyzed by
Northern blotting with probes homologous to osteocalcin (OC), collagen
type I (Col-I), fibronectin (FN), or MyoD.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6.
Suppression of Runx2 expression during myogenic
differentiation. C2C12 cells were cultured in DMEM containing 5% FBS
for 1 day (lane 1) or 7 days (lane 2). Total RNA was prepared, and the
levels of myoD and Runx2 mRNA were analyzed
by Northern blotting.
|
|
Conversely, the osteocalcin gene, a mineralized tissue-specific gene
(
28) induced by BMP-2 but not by TGF-

1, was not
up-regulated
by Runx2 expression alone (Fig.
5, lane 4). However, in
the presence
of BMP-2, overexpression of Runx2 led to significant
induction
of osteocalcin over the level of osteocalcin in the control
of
BMP-2-treated cells (compare lanes 3 and 6). Although this result
suggests that Runx2 also plays an important role in osteoblast
differentiation, other factors in addition to Runx2 would appear
to be
required.
Cooperation between Runx2- and BMP-activated Smad5 induces
osteoblast-specific gene expression.
Induction of ALP activity
following BMP treatment is considered to be an indicator of an early
stage of osteoblast differentiation (20). TGF-
1, which
can block myogenic differentiation of C2C12 cells but cannot induce
osteoblast differentiation, does not induce ALP activity. Consistent
with the differential effect of BMP and TGF-
, BMP-specific Smads,
but not TGF-
-specific Smads, have been shown to be responsible for
the induction of ALP activity in C2C12 cells (1, 36). It has
been also reported that exogenous expression of Runx2 can induce ALP
activity in C3H10T1/2 cells (14). We confirmed the induction
of ALP activity by overexpressing Runx2 in C2C12 cells (Fig.
7B, lanes 1 and 2; Fig. 7C). However, the
level of ALP activity induced by Runx2 in the absence of exogenous BMP-2 was much lower than in C2C12 cells treated with BMP-2 (300 ng/ml)
alone (Fig. 7C). These observations together with the result shown in
Fig. 5 (osteocalcin) indicate that Runx2 alone is not sufficient for
the induction of osteoblast-specific gene expression and that an
additional BMP-2-specific signal is required. Since signal-specific
Smad proteins physically interact with Runx2 (13), we
surmised that BMP-specific Smad proteins might be additionally required
for the induction of osteoblast-specific gene expression. To prove
this, we examined by Northern blot analysis the level of ALP mRNA
in C2C12-Sm5 and C2C12-Sm5-Rx2 cells (Fig. 7A and B). We confirmed the
low level of ALP mRNA in C2C12-Sm5 and C2C12-Rx2 cells in the
absence of BMP-2 stimulation (Fig. 7B, lanes 2 and 3). Remarkably, ALP
expression was strongly enhanced in C2C12-Sm5-Rx2 cells even in the
absence of BMP-2 (Fig. 7B, lane 4). We further analyzed ALP expression
in these cells by treating them with various concentrations of BMP-2
and measuring ALP enzyme activity. C2C12-Sm5-Rx2 cells showed quite
strong ALP activity even in the absence of BMP-2 (Fig. 7C). The
activity was higher than that of cells overexpressing either Smad5 or
Runx2 alone. To observe ALP activity as high as that of the control
cells treated with 300 ng of BMP-2/ml, C2C12-Sm5-Rx2 and C2C12-Sm5
cells required 2 and 10 ng of BMP-2/ml, respectively (Fig. 7C).
Therefore, C2C12-Sm5-Rx2 cells were about 150 times more sensitive to
BMP-2 than control cells and about five times more sensitive than
C2C12-Sm5 cells. These results demonstrate synergistic cooperation
between the functions of Smad5 and Runx2 for the induction of ALP
expression.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 7.
Induction of ALP by cooperation between Runx2 and Smad5.
(A) Western blot showing exogenous expression of Smad5 in C2C12-Sm5 and
C2C12-Sm5-Rx2 cells. The arrow indicates Smad5 protein. (B) C2C12
(control), C2C12-Rx2, C2C12-Sm5, and C2C12-Sm5-Rx2 cells were cultured
in the absence of BMP-2. Total RNA was prepared, and the levels of ALP
mRNA were analyzed by Northern blot hybridization. (C) The same
cells were treated with the indicated concentration of BMP-2 for 3 days, and ALP enzyme activities were assayed as described by Katagiri
et al. (20).
|
|
Involvement of Smad in Runx2 induction.
For the induction of
ALP activity, C2C12-Sm5 cells appeared to be more sensitive to BMP-2
than C2C12-Rx2 cells. C2C12-Rx2 cells still required 300 ng of BMP-2/ml
to obtain the same level of ALP activity as that of control C2C12 cells
treated with 300 ng/ml, while C2C12-Sm5 cells required only 10 ng of
BMP-2/ml (Fig. 7C). This result suggested that BMP-activated Smad5 is
more rate limiting than Runx2 for the induction of ALP expression.
Therefore, we examined whether Runx2 expression is under the control of
Smad5. We treated C2C12-Sm5 cells with serially diluted concentrations of BMP-2 for 6 h and measured Runx2 mRNA levels by
Northern blot analysis. As shown in Fig.
8A, overexpression of Smad5 by itself induced Runx2 expression even in the absence of BMP-2 (lane 5). Western
blot analysis also confirmed the induced level of Runx2 protein in
C2C12-Sm5 cells (Fig. 8B). Treatment of C2C12-Sm5 cells with 60 ng of
BMP-2/ml induced Runx2 expression to the maximal level, while control
C2C12 cells required 300 ng/ml to induce Runx2 expression (Fig. 8A).
These results indicate that BMP-specific Smad proteins play an
important role in the induction of Runx2 by BMP-2 stimulation.

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 8.
Involvement of Smads in the induction of Runx2
expression. (A) Control C2C12 cells and C2C12-Sm5 cells were treated
with the indicated concentration of BMP-2 for 6 h. Total RNA was
prepared from the cells, and the Runx2 mRNA level was
analyzed by Northern blotting using Rx2-Ct as a probe. (B) Protein
lysates were obtained from control C2C12 (lane 1) and C2C12-Sm5 (lane
2) cells, and the level of Runx2 protein was analyzed by Western
blotting. (C) C2C12 cells were cultured in the absence or presence of
BMP-2 (300 ng/ml) and cycloheximide (CHX; 5 µg/ml) as indicated for
6 h. Total RNAs were prepared, and the Runx2 mRNA
level was analyzed by Northern blot hybridization using the Rx2-Ct
probe.
|
|
We further examined whether the receptor-activated Smads stimulate
Runx2 expression directly or indirectly. C2C12 cells were
treated with
BMP-2 for 6 h in the presence or absence of the protein
synthesis
inhibitor cycloheximide (5 µg/ml), and the level of
Runx2 mRNA
was analyzed by Northern blotting. As shown in Fig.
8C, induction of
Runx2 mRNA by BMP-2 was significantly inhibited
by cycloheximide.
This result indicates that Runx2 is not a direct
target of
receptor-activated Smads but rather an indirect target
of some other
factor that must be synthesized de
novo.
 |
DISCUSSION |
Inactivation of the Runx2 gene in mice has been shown
to result in a complete block to osteoblast differentiation (21,
40), and haploinsufficiency of Runx2 causes the CCD syndrome
in humans (24, 34). In contrast to the wealth of
information stressing the importance of Runx2 in osteogenesis,
little is known about the molecular controls of Runx2 expression or
about the mechanism through which Runx2 controls osteoblast-specific
gene expression. In this study, we have shown that Runx2 acts as a
common and major target of TGF-
1 and BMP-2 signaling and that there
exists a functional relationship between Runx2 and Smad5 for
ligand-specific transcriptional regulation.
Runx2 is the major T
RE binding protein induced by
TGF-
1 and BMP-2.
To elucidate the molecular mechanism that
blocks C2C12 cell differentiation after TGF-
1 and BMP-2
stimulation, we examined for T
RE binding proteins in C2C12
cells. We observed that TGF-
1 at 5 ng/ml or BMP-2 at 300 ng/ml
significantly increased T
RE binding activity and that the major
protein binding to the T
RE was Runx2 complexed to PEBP2
/Cbf
.
Induction of Runx2 by TGF-
1, BMP-2, BMP-7, and BMP4/7 heterodimer
has been reported (10, 25, 51). However, the results have
been controversial, as some showed that BMP-2 does not significantly
alter Runx2 mRNA levels (51). Our analysis, which
directly searched for T
RE binding protein activity, firmly
establishes that Runx2 is the major and common target of TGF-
1 and
BMP-2 signaling. The time course study revealed that the Runx2 mRNA
level reached a maximum 2 h after stimulation and gradually
decreased thereafter (Fig. 2A). This rapid and transient induction of
Runx2 could be the reason why some groups failed to detect the
induction of Runx2 after BMP-2 stimulation. Our analysis further
establishes that Runx2 is essential for TGF-
1 and BMP-2 signaling.
TGF-
1 is unable to induce transcription through T
RE in
Runx2
/
calvaria cells. Interestingly, expression of
Runx2 successfully activated reporter expression in the absence of
TGF-
1 (Fig. 3D). This reporter assay revealed that binding of Runx2
to the Runx binding site is essential for TGF-
1 activity through the
T
RE.
At least two species of
Runx2 mRNA are synthesized as a
result of differential promoter usage (
10,
38,
48,
49). PEBP2

A1,
referred to here as Runx2-

A1, is the
Runx2 prototype, originally
identified in
ras-activated NIH
3T3 cells. The
til-1 isoform gene,
referred to here as
Runx2-til-1, was originally identified as
a frequent
retrovirus integration site in virus-accelerated lymphomas
of
CD2-
myc transgenic mice.
Runx2-til-1 RNA is
transcribed from
a promoter located at least 20 kb upstream from the
Runx2-
A1 promoter (
48). OSF2 was identified as
an osteoblast-specific
transcription factor and as a regulator of
osteoblast differentiation
(
10). Further analysis revealed
that
Runx2-til-1 and
OSF2 encode
identical
proteins (
49). Our Northern blot analysis revealed
that TGF-

1 and BMP-2 induce both isoforms of
Runx2
(Fig.
2B).
Although it is still not clear if each isoform has a
distinct
function, a recent analysis failed to detect any marked
differences
between the two isoforms in the C3H10T1/2 fibroblast cell
line
(
14).
Runx2 is essential for the common responses to TGF-
1
and BMP-2.
TGF-
and BMP-2 block the myogenic differentiation of
C2C12 cells by suppressing the expression of master control genes,
including that of MyoD (20, 35). Our data show that
overexpression of Runx2 suppresses MyoD expression and stops the
myogenic differentiation of C2C12 cells (Fig. 4B and 5). Osteoblasts,
chondroblasts, adipoblasts, myoblasts, and fibroblasts differentiate
from mesenchymal precursor cells (12). The critically
important regulators of osteoblast, myocyte, and adipocyte
differentiation are known to be Runx2 (10), MyoD
(9), and peroxisome proliferator-activated receptor
2 (PPAR
2) (30, 50), respectively. It is worth
noting that PPAR
2 suppresses Runx2 expression during the promotion
of adipocyte differentiation and inhibits osteoblast
differentiation (23). Thus, exclusive expression of
Runx2, MyoD, and PPAR
2 might be essential for the lineage
determination of mesenchymal precursor cells. In accord with this
suggestion, Runx2 expression was significantly suppressed during the
myogenic differentiation of C2C12 cells (Fig. 6). These results suggest
that induction of Runx2 is the key event responsible for the block of
myogenic differentiation by TGF-
and BMP-2.
In addition, Runx2 induces the expression of at least two matrix
proteins, type I collagen and fibronectin, whose synthesis
is
up-regulated by both TGF-

1 and BMP-2 (Fig.
5). Type I collagen
is
the most abundant extracellular matrix protein of bone tissue
and is
essential for bone strength (
43). Fibronectin, another
major
component of the extracellular matrix, plays an important
role during
development and wound healing by promoting cell adhesion,
cell
migration, and cytoskeletal organization (
22). The induction
of these major components of the extracellular matrix and the
suppression of MyoD expression by Runx2 suggests that Runx2 mediates
the common activities of TGF-

1 and BMP-2. It is worth noting
that
the induction patterns of type I collagen and fibronectin
by Runx2 were
different. Type I collagen gene expression was fully
induced by the
exogenous expression of Runx2 without any additional
effect of TGF-

1
and BMP-2 stimulation (Fig.
5). The induction
of type I collagen by
TGF-

1 and BMP-2, therefore, appears to
rely entirely on increased
Runx2 expression. On the other hand,
fibronectin gene expression,
induced by exogenous Runx2, was further
induced by TGF-

1 but not by
BMP-2 (Fig.
5). These results suggest
that TGF-

1 and BMP-2 induce
fibronectin expression through Runx2
but that TGF-

1 also activates
fibronectin expression through
additional mechanisms that work
synergistically with Runx2. It
has been reported that TGF-

1-mediated
fibronectin induction requires
the activation of Jun N-terminal kinase
(JNK) (
16). Thus, the
JNK pathway might be a likely
candidate for the TGF-

1 synergistic
effect on fibronectin gene
expression that operates through
Runx2.
Cooperation between Runx2 and BMP-activated Smad5 induces
osteoblast-specific gene expression.
Runx2 alone did not induce
osteocalcin, a mineralized tissue-specific protein, but increased the
level of osteocalcin induction by BMP-2 (Fig. 5). Likewise, Runx2
induced only weakly the expression of a major phenotypic marker of the
osteoblast lineage, ALP, but increased the level of ALP induced by
BMP-2 (Fig. 7C). This result suggests that although Runx2 is involved
in the induction of osteoblast differentiation, it is not sufficient
for this process. Recently, all three Runx
subunits and
receptor-activated Smad proteins (Smad1, -2, -3, and -5) were shown to
interact in vitro, and synergic effects of Runx3 and Smad3 on a T
RE
reporter gene were reported (13). Smad1 and Smad5 were shown
to be involved in the intracellular BMP signals that inhibit myogenic
differentiation and induce osteogenic differentiation in C2C12 cells
(36, 56). It is worth noting that overexpression of Runx2
could also inhibit myogenic differentiation, although it was not
sufficient for the further induction of osteoblast differentiation
(Fig. 4 and 5). These results all point to the intriguing possibility
that Runx2 can mediate TGF-
1 and BMP-2 signals for the block of
myogenic differentiation but not ligand-specific responses unless
signal specific signal transducers are concomitantly present in C2C12
cells. Our results provide good evidence to support this
hypothesis. We showed that exogenous expression of Runx2 alone mediated
the common activities of TGF-
1 and BMP-2 but failed to fully induce
osteoblast-specific gene expression (Fig. 5). As an additional
requirement for osteoblast-specific gene expression, we identified the
BMP-specific signal transducer, Smad5 (Fig. 7).
It is worth mentioning that the time course assay showed that the
induction of Runx2 expression in response to BMP-2 occurred
within the
2-h period following stimulation (Fig.
2A). BMP receptor
IA-dependent
Smad phosphorylation and nuclear translocation begin
10 to 20 min after
BMP-2 stimulation and remain elevated for up
to 2 h
(
18). These results indicate that the receptor-activated
Smad and the BMP-induced Runx2 could function together in vivo,
since
they shared overlapping periods of expression. These observations
also
explain why only BMP-2 was able to provoke the differentiation
of C2C12
cells to the osteoblastic lineage, even though both TGF-

1
and BMP-2
were able to induce Runx2 and inhibit the myogenic differentiation
of
this cell
line.
Osteocalcin gene expression is initiated late during osteoblast
differentiation at the onset of extracellular matrix mineralization
(
28). Unlike expression of ALP, an early marker of
osteoblast
differentiation, osteocalcin gene expression was not induced
by
the coexpression of Smad5 and Runx2 (data not shown). Our results
suggest that the coordinate function of Smad5 and Runx2 is still
insufficient for osteogenic terminal differentiation, although
both are
implicated in the commitment to osteogenic
differentiation.
Involvement of Smads in Runx2 induction.
Overexpression of
Smad5 resulted in the induction of Runx2 even in the absence of BMP-2
stimulation (Fig. 8). This result indicates that Smad5 functions as an
upstream regulator of Runx2. The molecular mechanism of Smad5
activation under these conditions remains unclear. Recent observations
have suggested that the subcellular localization of Smads prior to
activation is important. Treatment of the cells with reagents that
disrupt microtubules induced the phosphorylation of Smad2 in the
absence of TGF-
and enhanced TGF-
-dependent phosphorylation of
Smad2 (55). The mislocalization or promiscuous activation of
Smad5 might be responsible for the induction of Runx2. However, Smad5
did not directly induce Runx2 expression; an additional step of protein
de novo synthesis was required (Fig. 8C). One of the factors mediating
the induction of Runx2 by Smad5 could be AP1. junB is an
immediate-early gene induced by TGF-
and BMP-2 (7). JunB
expression reaches a maximum 90 min after BMP-2 stimulation and then
gradually decreases. Like Runx2, overexpression of JunB inhibits
expression of myoblast differentiation markers in C2C12 cells
(7). Analysis of the Runx2 promoter region
reveals a perfect AP1 binding site situated close to the putative Smad
sites (X.-Z. Zi and S.-C. Bae, unpublished observation). Thus, it will
be interesting to examine whether induction of AP1 is required for the
induction of Runx2 in response to TGF-
1 and BMP-2.
Since not only Smad5 but also Smad2 and -3 physically interact with
Runx2 (
13), interaction of Runx2 with TGF-

-specific
Smads
might also be important for TGF-

-specific responses. So
far, the
Smads that induce Runx2 after TGF-

stimulation and function
together
with Runx2 have not been identified. In the ROS17/2.8
osteoblast-like
cell line and primary rat calvaria cells, Runx2
expression was
suppressed by about 50% after overexpression of
Smad2 (
26),
implying that distinct relationships may exist between
each Smad
protein and Runx2. Further study will be required for
a thorough
understanding of the molecular mechanisms governing
ligand-specific
responses of TGF-

and BMP-2 and the relationship
between Runx2 and
ligand-specific Smad
proteins.
In this study, we identified Runx2 as the common and major target of
TGF-

1 and BMP-2 in C2C12 cells. Runx2 was found to be
responsible
for suppression of the expression of the myogenic
master gene,
myoD, and for the induction of components of the
extracellular matrix but insufficient for osteoblast-specific
gene
expression, which depended on the additional factor, Smad5,
an upstream
regulator of Runx2. These results provide important
insights into how
the downstream components of the TGF-

1 and
BMP-2 signaling pathways,
which we have identified as Runx2 and
receptor-activated Smads (Fig.
9), mediate the block to myogenic
differentiation and induce osteoblast differentiation in C2C12
cells.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9.
A model for the common and distinct activities of
TGF- and BMP in C2C12 cells. Runx2 is an indirect target of the Smad
signaling pathway. Induction of Runx2 is essential for the common
activities of TGF- and BMP. Ligand-specific gene expression,
however, requires cooperation between Runx2 and receptor-activated
Smads (R-Smad).
|
|
 |
ACKNOWLEDGMENTS |
We are grateful to Y. Ito (Kyoto University, Kyoto, Japan) for
valuable discussions. We also thank K. Miyazono (Cancer Institute, Tokyo, Japan) for providing Smad expression plasmids.
We acknowledge financial support from the Korea Research Foundation for
the program year 1998 to S.-C. Bae and H.-M. Ryoo. This work was also
supported by Korea Research Foundation grant KRF-99-042-F00014 F0210.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, School of Medicine, and Medical Research Institute,
Chungbuk National University, Cheongju 361-763, South Korea. Phone:
82-43-261-2842. Fax: 82-43-274-8705. E-mail:
scbae{at}med.chungbuk.ac.kr.
 |
REFERENCES |
| 1.
|
Akiyama, S.,
T. Katagiri,
M. Namiki,
N. Yamaji,
N. Yamamoto,
K. Miyama,
H. Shibuya,
N. Ueno,
J. M. Wozney, and T. Suda.
1997.
Constitutively active BMP type I receptors transduce BMP-2 signals without the ligand in C2C12 myoblasts.
Exp. Cell Res.
235:362-369[CrossRef][Medline].
|
| 2.
|
Bae, S. C.,
Y. Yamaguchi-Iwai,
E. Ogawa,
M. Maruyama,
M. Inuzuka,
H. Kagoshima,
K. Shigesada,
M. Satake, and Y. Ito.
1993.
Isolation of PEBP2 B cDNA representing the mouse homolog of human acute myeloid leukemia gene, AML1.
Oncogene
8:809-814[Medline].
|
| 3.
|
Bae, S. C.,
E. Ogawa,
M. Maruyama,
H. Oka,
M. Satake,
K. Shigesada,
N. A. Jenkins,
D. J. Gilbert,
N. G. Copeland, and Y. Ito.
1994.
PEBP2 B/mouse AML1 consists of multiple isoforms that possess differential transactivation potentials.
Mol. Cell. Biol.
14:3242-3252[Abstract/Free Full Text].
|
| 4.
|
Bae, S. C., and Y. Ito.
1999.
Regulation mechanisms for the heterodimeric transcription factor, PEBP2/CBF.
Histol. Histopathol.
14:1213-1221[Medline].
|
| 5.
|
Banerjee, C.,
L. R. McCabe,
J. Y. Choi,
S. W. Hiebert,
J. L. Stein,
G. S. Stein, and J. B. Lian.
1997.
Runt homology domain proteins in osteoblast differentiation: AML3/CBFA1 is a major component of a bone specific complex.
J. Cell. Biochem.
66:1-8[CrossRef][Medline].
|
| 6.
|
Bonewald, L. F., and G. R. Mundy.
1990.
Role of transforming growth factor-beta in bone remodeling.
Clin. Orthop.
January:261-276.
|
| 7.
|
Chalaux, E.,
T. Lopez-Rovira,
J. L. Rosa,
R. Bartrons, and F. Ventura.
1998.
JunB is involved in the inhibition of myogenic differentiation by bone morphogenetic protein-2.
J. Biol. Chem.
273:537-543[Abstract/Free Full Text].
|
| 8.
|
Chu, M. L.,
J. C. Myers,
M. P. Bernard,
J. F. Ding, and F. Ramirez.
1982.
Cloning and characterization of five overlapping cDNAs specific for the human pro alpha 1(I) collagen chain.
Nucleic Acids Res.
10:5925-5934[Abstract/Free Full Text].
|
| 9.
|
Davis, R. L.,
H. Weintraub, and A. B. Lassar.
1987.
Expression of a single transfected cDNA converts fibroblasts to myoblasts.
Cell
51:987-1000[CrossRef][Medline].
|
| 10.
|
Ducy, P.,
R. Zhang,
V. Geoffroy,
A. L. Ridall, and G. Karsenty.
1997.
Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation.
Cell
89:747-754[CrossRef][Medline].
|
| 11.
|
Fujii, M.,
K. Takeda,
T. Imamura,
H. Aoki,
T. K. Sampath,
S. Enomoto,
M. Kawabata,
M. Kato,
H. Ichijo, and K. Miyazono.
1999.
Roles of bone morphogenetic protein type I receptors and Smad proteins in osteoblast and chondroblast differentiation.
Mol. Biol. Cell
10:3801-3813[Abstract/Free Full Text].
|
| 12.
|
Grigoriadis, A. E.,
J. N. Heersche, and J. E. Aubin.
1990.
Continuously growing bipotential and monopotential myogenic, adipogenic, and chondrogenic subclones isolated from the multipotential RCJ 3.1 clonal cell line.
Dev. Biol.
142:313-318[CrossRef][Medline].
|
| 13.
|
Hanai, J.,
L. F. Chen,
T. Kanno,
N. Ohtani-Fujita,
W. Y. Kim,
W. H. Guo,
T. Imamura,
Y. Ishidou,
M. Fukuchi,
M. J. Shi,
J. Stavnezer,
M. Kawabata,
K. Miyazono, and Y. Ito.
1999.
Interaction and functional cooperation of PEBP2/CBF with Smads. Synergistic induction of the immunoglobulin germline Calpha promoter.
J. Biol. Chem.
274:31577-31582[Abstract/Free Full Text].
|
| 14.
|
Harada, H.,
S. Tagashira,
M. Fujiwara,
S. Ogawa,
T. Katsumata,
A. Yamaguchi,
T. Komori, and M. Nakatsuka.
1999.
Cbfa1 isoforms exert functional differences in osteoblast differentiation.
J. Biol. Chem.
274:6972-6978[Abstract/Free Full Text].
|
| 15.
|
Heldin, C. H.,
K. Miyazono, and P. ten Dijke.
1997.
TGF-beta signalling from cell membrane to nucleus through SMAD proteins.
Nature
390:465-471[CrossRef][Medline].
|
| 16.
|
Hocevar, B. A.,
T. L. Brown, and P. H. Howe.
1999.
TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4-independent pathway.
EMBO J.
18:1345-1356[CrossRef][Medline].
|
| 17.
|
Hogan, B. L.
1996.
Bone morphogenetic proteins: multifunctional regulators of vertebrate development.
Genes Dev.
10:1580-1594[Free Full Text].
|
| 18.
|
Hoodless, P. A.,
T. Haerry,
S. Abdollah,
M. Stapleton,
M. B. O'Connor,
L. Attisano, and J. L. Wrana.
1996.
MADR1, a MAD-related protein that functions in BMP2 signaling pathways.
Cell
85:489-500[CrossRef][Medline].
|
| 19.
|
Kamachi, Y.,
E. Ogawa,
M. Asano,
S. Ishida,
Y. Murakami,
M. Satake,
Y. Ito, and K. Shigesada.
1990.
Purification of a mouse nuclear factor that binds to both the A and B cores of the polyomavirus enhancer.
J. Virol.
64:4808-4819[Abstract/Free Full Text].
|
| 20.
|
Katagiri, T.,
A. Yamaguchi,
M. Komaki,
E. Abe,
N. Takahashi,
T. Ikeda,
V. Rosen,
J. M. Wozney,
A. Fujisawa-Sehara, and T. Suda.
1994.
Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage.
J. Cell Biol.
127:1755-1766[Abstract/Free Full Text].
|
| 21.
|
Komori, T.,
H. Yagi,
S. Nomura,
A. Yamaguchi,
K. Sasaki,
K. Deguchi,
Y. Shimizu,
R. T. Bronson,
Y. H. Gao,
M. Inada,
M. Sato,
R. Okamoto,
Y. Kitamura,
S. Yoshiki, and T. Kishimoto.
1997.
Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts.
Cell
89:755-764[CrossRef][Medline].
|
| 22.
|
Kornblihtt, A. R.,
C. G. Pesce,
C. R. Alonso,
P. Cramer,
A. Srebrow,
S. Werbajh, and A. F. Muro.
1996.
The fibronectin gene as a model for splicing and transcription studies.
FASEB J.
10:248-257[Abstract].
|
| 23.
|
Lecka-Czernik, B.,
I. Gubrij,
E. J. Moerman,
O. Kajkenova,
D. A. Lipschitz,
S. C. Manolagas, and R. L. Jilka.
1999.
Inhibition of Osf2/Cbfa1 expression and terminal osteoblast differentiation by PPARgamma2.
J. Cell. Biochem.
74:357-371[CrossRef][Medline].
|
| 24.
|
Lee, B.,
K. Thirunavukkarasu,
L. Zhou,
L. Pastore,
A. Baldini,
J. Hecht,
V. Geoffroy,
P. Ducy, and G. Karsenty.
1997.
Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia.
Nat. Genet.
16:307-310[CrossRef][Medline].
|
| 25.
|
Lee, M. H.,
A. Javed,
H. J. Kim,
H. I. Shin,
S. Gutierrez,
J. Y. Choi,
V. Rosen,
J. L. Stein,
A. J. van Wijnen,
G. S. Stein,
J. B. Lian, and H. M. Ryoo.
1999.
Transient upregulation of CBFA1 in response to bone morphogenetic protein-2 and transforming growth factor beta 1 in C2C12 myogenic cells coincides with suppression of the myogenic phenotype but is not sufficient for osteoblast differentiation.
J. Cell. Biochem.
73:114-125[CrossRef][Medline].
|
| 26.
|
Li, J.,
K. Tsuji,
T. Komori,
K. Miyazono,
J. L. Wrana,
Y. Ito,
A. Nifuji, and M. Noda.
1998.
Smad2 overexpression enhances Smad4 gene expression and suppresses CBFA1 gene expression in osteoblastic osteosarcoma ROS17/2.8 cells and primary rat calvaria cells.
J. Biol. Chem.
273:31009-31015[Abstract/Free Full Text].
|
| 27.
|
Lian, J.,
C. Stewart,
E. Puchacz,
S. Mackowiak,
V. Shalhoub,
D. Collart,
G. Zambetti, and G. Stein.
1989.
Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression.
Proc. Natl. Acad. Sci. USA
86:1143-1147[Abstract/Free Full Text].
|
| 28.
|
Lian, J. B.,
G. S. Stein,
J. L. Stein, and A. J. van Wijnen.
1998.
Osteocalcin gene promoter: unlocking the secrets for regulation of osteoblast growth and differentiation.
J. Cell. Biochem. Suppl.
30-31:62-72.
|
| 29.
|
Lin, Y. C., and J. Stavnezer.
1992.
Regulation of transcription of the germ-line Ig alpha constant region gene by an ATF element and by novel transforming growth factor-beta 1-responsive elements.
J. Immunol.
149:2914-2925[Abstract].
|
| 30.
|
Lowell, B. B.
1999.
PPAR : an essential regulator of adipogenesis and modulator of fat cell function.
Cell
99:239-242[CrossRef][Medline].
|
| 31.
|
Massague, J.
1990.
The transforming growth factor-beta family.
Annu. Rev. Cell Biol.
6:597-641[CrossRef].
|
| 32.
|
Massague, J.
1998.
TGF-beta signal transduction.
Annu. Rev. Biochem.
67:753-791[CrossRef][Medline].
|
| 33.
|
Melnikova, I. N.,
B. E. Crute,
S. Wang, and N. A. Speck.
1993.
Sequence specificity of the core-binding factor.
J. Virol.
67:2408-2411[Abstract/Free Full Text].
|
| 34.
|
Mundlos, S.,
F. Otto,
C. Mundlos,
J. B. Mulliken,
A. S. Aylsworth,
S. Albright,
D. Lindhout,
W. G. Cole,
W. Henn,
J. H. Knoll,
M. J. Owen,
R. Mertelsmann,
B. U. Zabel, and B. R. Olsen.
1997.
Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia.
Cell
89:773-779[CrossRef][Medline].
|
| 35.
|
Namiki, M.,
S. Akiyama,
T. Katagiri,
A. Suzuki,
N. Ueno,
N. Yamaji,
V. Rosen,
J. M. Wozney, and T. Suda.
1997.
A kinase domain-truncated type I receptor blocks bone morphogenetic protein-2-induced signal transduction in C2C12 myoblasts.
J. Biol. Chem.
272:22046-22052[Abstract/Free Full Text].
|
| 36.
|
Nishimura, R.,
Y. Kato,
D. Chen,
S. E. Harris,
G. R. Mundy, and T. Yoneda.
1998.
Smad5 and DPC4 are key molecules in mediating BMP-2-induced osteoblastic differentiation of the pluripotent mesenchymal precursor cell line C2C12.
J. Biol. Chem.
273:1872-1879[Abstract/Free Full Text].
|
| 37.
|
Noda, M., and G. A. Rodan.
1986.
Type-beta transforming growth factor inhibits proliferation and expression of alkaline phosphatase in murine osteoblast-like cells.
Biochem. Biophys. Res. Commun.
140:56-65[CrossRef][Medline].
|
| 38.
|
Ogawa, E.,
M. Maruyama,
H. Kagoshima,
M. Inuzuka,
J. Lu,
M. Satake,
K. Shigesada, and Y. Ito.
1993.
PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene.
Proc. Natl. Acad. Sci. USA
90:6859-6863[Abstract/Free Full Text].
|
| 39.
|
Ogawa, E.,
M. Inuzuka,
M. Maruyama,
M. Satake,
M. Naito-Fujimoto,
Y. Ito, and K. Shigesada.
1993.
Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha.
Virology
194:314-331[CrossRef][Medline].
|
| 40.
|
Otto, F.,
A. P. Thornell,
T. Crompton,
A. Denzel,
K. C. Gilmour,
I. R. Rosewell,
G. W. Stamp,
R. S. Beddington,
S. Mundlos,
B. R. Olsen,
P. B. Selby, and M. J. Owen.
1997.
Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development.
Cell
89:765-771[CrossRef][Medline].
|
| 41.
|
Reddi, A. H.
1994.
Bone and cartilage differentiation.
Curr. Opin. Genet. Dev.
4:737-744[CrossRef][Medline].
|
| 42.
|
Roberts, A. B.,
K. C. Flanders,
P. Kondaiah,
N. L. Thompson,
E. Obberghen-Schilling,
L. Wakefield,
P. Rossi,
B. de Crombrugghe,
U. Heine, and M. B. Sporn.
1988.
Transforming growth factor beta: biochemistry and roles in embryogenesis, tissue repair and remodeling, and carcinogenesis.
Recent Prog. Horm. Res.
44:157-197.
|
| 43.
|
Rossert, J., and B. Crombrugghe.
1996.
Principles of bone biology, p. 127-142.
Academic Press, San Diego, Calif.
|
| 44.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1988.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 45.
|
Schreiber, E.,
P. Matthias,
M. M. Muller, and W. Schaffner.
1989.
Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells.
Nucleic Acids Res.
17:6419[Free Full Text].
|
| 46.
|
Seyedin, S. M.,
A. Y. Thompson,
H. Bentz,
D. M. Rosen,
J. M. McPherson,
A. Conti,
N. R. Siegel,
G. R. Galluppi, and K. A. Piez.
1986.
Cartilage-inducing factor-A. Apparent identity to transforming growth factor-beta.
J. Biol. Chem.
261:5693-5695[Abstract/Free Full Text].
|
| 47.
|
Shi, M. J., and J. Stavnezer.
1998.
CBF alpha3 (AML2) is induced by TGF-beta1 to bind and activate the mouse germline Ig alpha promoter.
J. Immunol.
161:6751-6760[Abstract/Free Full Text].
|
| 48.
|
Stewart, M.,
A. Terry,
M. Hu,
M. O'Hara,
K. Blyth,
E. Baxter,
E. Cameron,
D. E. Onions, and J. C. Neil.
1997.
Proviral insertions induce the expression of bone-specific isoforms of PEBP2alphaA (CBFA1): evidence for a new myc collaborating oncogene.
Proc. Natl. Acad. Sci. USA
94:8646-8651[Abstract/Free Full Text].
|
| 49.
|
Thirunavukkarasu, K.,
M. Mahajan,
K. W. McLarren,
S. Stifani, and G. Karsenty.
1998.
Two domains unique to osteoblast-specific transcription factor Osf2/Cbfa1 contribute to its transactivation function and its inability to heterodimerize with Cbf .
Mol. Cell. Biol.
18:4197-4208[Abstract/Free Full Text].
|
| 50.
|
Tontonoz, P.,
E. Hu, and B. M. Spiegelman.
1994.
Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor.
Cell
79:1147-1156[CrossRef][Medline].
|
| 51.
|
Tsuji, K.,
Y. Ito, and M. Noda.
1998.
Expression of the PEBP2alphaA/AML3/CBFA1 gene is regulated by BMP4/7 heterodimer and its overexpression suppresses type I collagen and osteocalcin gene expression in osteoblastic and nonosteoblastic mesenchymal cells.
Bone
22:87-92[Medline].
|
| 52.
|
Wang, E. A.,
V. Rosen,
P. Cordes,
R. M. Hewick,
M. J. Kriz,
D. P. Luxenberg,
B. S. Sibley, and J. M. Wozney.
1988.
Purification and characterization of other distinct bone-inducing factors.
Proc. Natl. Acad. Sci. USA
85:9484-9488[Abstract/Free Full Text].
|
| 53.
|
Wang, S.,
Q. Wang,
B. E. Crute,
I. N. Melnikova,
S. R. Keller, and N. A. Speck.
1993.
Cloning and characterization of subunits of the T-cell receptor and murine leukemia virus enhancer core-binding factor.
Mol. Cell. Biol.
13:3324-3339[Abstract/Free Full Text].
|
| 54.
|
Wozney, J. M.,
V. Rosen,
A. J. Celeste,
L. M. Mitsock,
M. J. Whitters,
R. W. Kriz,
R. M. Hewick, and E. A. Wang.
1988.
Novel regulators of bone formation: molecular clones and activities.
Science
242:1528-1534[Abstract/Free Full Text].
|
| 55.
|
Wrana, J. L.
2000.
Regulation of Smad activity.
Cell
100:189-192[CrossRef][Medline].
|
| 56.
|
Yamamoto, N.,
S. Akiyama,
T. Katagiri,
M. Namiki,
T. Kurokawa, and T. Suda.
1997.
Smad1 and smad5 act downstream of intracellular signalings of BMP-2 that inhibits myogenic differentiation and induces osteoblast differentiation in C2C12 myoblasts.
Biochem. Biophys. Res. Commun.
238:574-580[CrossRef][Medline].
|
| 57.
|
Zhang, Y., and R. Derynck.
1999.
Regulation of Smad signalling by protein associations and signalling crosstalk.
Trends Cell Biol.
9:274-279[CrossRef][Medline].
|
Molecular and Cellular Biology, December 2000, p. 8783-8792, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hoshiba, T., Kawazoe, N., Tateishi, T., Chen, G.
(2009). Development of Stepwise Osteogenesis-mimicking Matrices for the Regulation of Mesenchymal Stem Cell Functions. J. Biol. Chem.
284: 31164-31173
[Abstract]
[Full Text]
-
Jonason, J.H., Xiao, G., Zhang, M., Xing, L., Chen, D.
(2009). Post-translational Regulation of Runx2 in Bone and Cartilage. JDR
88: 693-703
[Abstract]
[Full Text]
-
Jeong, B.-C., Lee, Y.-S., Park, Y.-Y., Bae, I.-H., Kim, D.-K., Koo, S.-H., Choi, H.-R., Kim, S.-H., Franceschi, R. T., Koh, J.-T., Choi, H.-S.
(2009). The Orphan Nuclear Receptor Estrogen Receptor-related Receptor {gamma} Negatively Regulates BMP2-induced Osteoblast Differentiation and Bone Formation. J. Biol. Chem.
284: 14211-14218
[Abstract]
[Full Text]
-
Jensen, E. D., Gopalakrishnan, R., Westendorf, J. J.
(2009). Bone Morphogenic Protein 2 Activates Protein Kinase D to Regulate Histone Deacetylase 7 Localization and Repression of Runx2. J. Biol. Chem.
284: 2225-2234
[Abstract]
[Full Text]
-
Sharff, K. A., Song, W.-X., Luo, X., Tang, N., Luo, J., Chen, J., Bi, Y., He, B.-C., Huang, J., Li, X., Jiang, W., Zhu, G.-H., Su, Y., He, Y., Shen, J., Wang, Y., Chen, L., Zuo, G.-W., Liu, B., Pan, X., Reid, R. R., Luu, H. H., Haydon, R. C., He, T.-C.
(2009). Hey1 Basic Helix-Loop-Helix Protein Plays an Important Role in Mediating BMP9-induced Osteogenic Differentiation of Mesenchymal Progenitor Cells. J. Biol. Chem.
284: 649-659
[Abstract]
[Full Text]
-
Matsubara, T., Kida, K., Yamaguchi, A., Hata, K., Ichida, F., Meguro, H., Aburatani, H., Nishimura, R., Yoneda, T.
(2008). BMP2 Regulates Osterix through Msx2 and Runx2 during Osteoblast Differentiation. J. Biol. Chem.
283: 29119-29125
[Abstract]
[Full Text]
-
Li, Z., Hassan, M. Q., Volinia, S., van Wijnen, A. J., Stein, J. L., Croce, C. M., Lian, J. B., Stein, G. S.
(2008). A microRNA signature for a BMP2-induced osteoblast lineage commitment program. Proc. Natl. Acad. Sci. USA
105: 13906-13911
[Abstract]
[Full Text]
-
Chen, S., Gluhak-Heinrich, J., Martinez, M., Li, T., Wu, Y., Chuang, H.-H., Chen, L., Dong, J., Gay, I., MacDougall, M.
(2008). Bone Morphogenetic Protein 2 Mediates Dentin Sialophosphoprotein Expression and Odontoblast Differentiation via NF-Y Signaling. J. Biol. Chem.
283: 19359-19370
[Abstract]
[Full Text]
-
Bouvet, C., Moreau, S., Blanchette, J., de Blois, D., Moreau, P.
(2008). Sequential Activation of Matrix Metalloproteinase 9 and Transforming Growth Factor {beta} in Arterial Elastocalcinosis. Arterioscler. Thromb. Vasc. Bio.
28: 856-862
[Abstract]
[Full Text]
-
Luan, Y., Yu, X.-P., Yang, N., Frenkel, S., Chen, L., Liu, C.-j.
(2008). p204 Protein Overcomes the Inhibition of Core Binding Factor {alpha}-1-mediated Osteogenic Differentiation by Id Helix-Loop-Helix Proteins. Mol. Biol. Cell
19: 2113-2126
[Abstract]
[Full Text]
-
Merrill, A. E., Eames, B. F., Weston, S. J., Heath, T., Schneider, R. A.
(2008). Mesenchyme-dependent BMP signaling directs the timing of mandibular osteogenesis. Development
135: 1223-1234
[Abstract]
[Full Text]
-
Javed, A., Bae, J.-S., Afzal, F., Gutierrez, S., Pratap, J., Zaidi, S. K., Lou, Y., van Wijnen, A. J., Stein, J. L., Stein, G. S., Lian, J. B.
(2008). Structural Coupling of Smad and Runx2 for Execution of the BMP2 Osteogenic Signal. J. Biol. Chem.
283: 8412-8422
[Abstract]
[Full Text]
-
Tanaka, T., Sato, H., Doi, H., Yoshida, C. A., Shimizu, T., Matsui, H., Yamazaki, M., Akiyama, H., Kawai-Kowase, K., Iso, T., Komori, T., Arai, M., Kurabayashi, M.
(2008). Runx2 Represses Myocardin-Mediated Differentiation and Facilitates Osteogenic Conversion of Vascular Smooth Muscle Cells. Mol. Cell. Biol.
28: 1147-1160
[Abstract]
[Full Text]
-
Tan, X., Weng, T., Zhang, J., Wang, J., Li, W., Wan, H., Lan, Y., Cheng, X., Hou, N., Liu, H., Ding, J., Lin, F., Yang, R., Gao, X., Chen, D., Yang, X.
(2007). Smad4 is required for maintaining normal murine postnatal bone homeostasis. J. Cell Sci.
120: 2162-2170
[Abstract]
[Full Text]
-
Singh, N. K., Chae, H. S., Hwang, I. H., Yoo, Y. M., Ahn, C. N., Lee, S. H., Lee, H. J., Park, H. J., Chung, H. Y.
(2007). Transdifferentiation of porcine satellite cells to adipoblasts with ciglitizone. J ANIM SCI
85: 1126-1135
[Abstract]
[Full Text]
-
Hayashi, M., Nimura, K., Kashiwagi, K., Harada, T., Takaoka, K., Kato, H., Tamai, K., Kaneda, Y.
(2007). Comparative roles of Twist-1 and Id1 in transcriptional regulation by BMP signaling. J. Cell Sci.
120: 1350-1357
[Abstract]
[Full Text]
-
Ganti, R., Hunt, R. C., Parapuram, S. K., Hunt, D. M.
(2007). Vitreous Modulation of Gene Expression in Low-Passage Human Retinal Pigment Epithelial Cells. IOVS
48: 1853-1863
[Abstract]
[Full Text]
-
Peng, Z., Wei, D., Wang, L., Tang, H., Zhang, J., Le, X., Jia, Z., Li, Q., Xie, K.
(2006). RUNX3 Inhibits the Expression of Vascular Endothelial Growth Factor and Reduces the Angiogenesis, Growth, and Metastasis of Human Gastric Cancer.. Clin. Cancer Res.
12: 6386-6394
[Abstract]
[Full Text]
-
Kollias, H. D., Perry, R. L. S., Miyake, T., Aziz, A., McDermott, J. C.
(2006). Smad7 promotes and enhances skeletal muscle differentiation.. Mol. Cell. Biol.
26: 6248-6260
[Abstract]
[Full Text]
-
Jeon, E.-J., Lee, K.-Y., Choi, N.-S., Lee, M.-H., Kim, H.-N., Jin, Y.-H., Ryoo, H.-M., Choi, J.-Y., Yoshida, M., Nishino, N., Oh, B.-C., Lee, K.-S., Lee, Y. H., Bae, S.-C.
(2006). Bone Morphogenetic Protein-2 Stimulates Runx2 Acetylation. J. Biol. Chem.
281: 16502-16511
[Abstract]
[Full Text]
-
Qiao, M., Shapiro, P., Fosbrink, M., Rus, H., Kumar, R., Passaniti, A.
(2006). Cell Cycle-dependent Phosphorylation of the RUNX2 Transcription Factor by cdc2 Regulates Endothelial Cell Proliferation. J. Biol. Chem.
281: 7118-7128
[Abstract]
[Full Text]
-
Franceschi, R.T.
(2005). Biological Approaches to Bone Regeneration by Gene Therapy. JDR
84: 1093-1103
[Abstract]
[Full Text]
-
Lee, M.-H., Kim, Y.-J., Yoon, W.-J., Kim, J.-I., Kim, B.-G., Hwang, Y.-S., Wozney, J. M., Chi, X.-Z., Bae, S.-C., Choi, K.-Y., Cho, J.-Y., Choi, J.-Y., Ryoo, H.-M.
(2005). Dlx5 Specifically Regulates Runx2 Type II Expression by Binding to Homeodomain-response Elements in the Runx2 Distal Promoter. J. Biol. Chem.
280: 35579-35587
[Abstract]
[Full Text]
-
Janssens, K., ten Dijke, P., Janssens, S., Van Hul, W.
(2005). Transforming Growth Factor-{beta}1 to the Bone. Endocr. Rev.
26: 743-774
[Abstract]
[Full Text]
-
Xiao, G., Jiang, D., Ge, C., Zhao, Z., Lai, Y., Boules, H., Phimphilai, M., Yang, X., Karsenty, G., Franceschi, R. T.
(2005). Cooperative Interactions between Activating Transcription Factor 4 and Runx2/Cbfa1 Stimulate Osteoblast-specific Osteocalcin Gene Expression. J. Biol. Chem.
280: 30689-30696
[Abstract]
[Full Text]
-
Chen, S., Rani, S., Wu, Y., Unterbrink, A., Gu, T. T., Gluhak-Heinrich, J., Chuang, H.-H., MacDougall, M.
(2005). Differential Regulation of Dentin Sialophosphoprotein Expression by Runx2 during Odontoblast Cytodifferentiation. J. Biol. Chem.
280: 29717-29727
[Abstract]
[Full Text]
-
Wei, D., Gong, W., Oh, S. C., Li, Q., Kim, W. D., Wang, L., Le, X., Yao, J., Wu, T. T., Huang, S., Xie, K.
(2005). Loss of RUNX3 Expression Significantly Affects the Clinical Outcome of Gastric Cancer Patients and Its Restoration Causes Drastic Suppression of Tumor Growth and Metastasis. Cancer Res.
65: 4809-4816
[Abstract]
[Full Text]
-
Galindo, M., Pratap, J., Young, D. W., Hovhannisyan, H., Im, H.-J., Choi, J.-Y., Lian, J. B., Stein, J. L., Stein, G. S., van Wijnen, A. J.
(2005). The Bone-specific Expression of Runx2 Oscillates during the Cell Cycle to Support a G1-related Antiproliferative Function in Osteoblasts. J. Biol. Chem.
280: 20274-20285
[Abstract]
[Full Text]
-
Lengner, C. J., Hassan, M. Q., Serra, R. W., Lepper, C., van Wijnen, A. J., Stein, J. L., Lian, J. B., Stein, G. S.
(2005). Nkx3.2-mediated Repression of Runx2 Promotes Chondrogenic Differentiation. J. Biol. Chem.
280: 15872-15879
[Abstract]
[Full Text]
-
Ikeda, R., Yoshida, K., Tsukahara, S., Sakamoto, Y., Tanaka, H., Furukawa, K.-I., Inoue, I.
(2005). The Promyelotic Leukemia Zinc Finger Promotes Osteoblastic Differentiation of Human Mesenchymal Stem Cells as an Upstream Regulator of CBFA1. J. Biol. Chem.
280: 8523-8530
[Abstract]
[Full Text]
-
Le, N., Nagarajan, R., Wang, J. Y. T., Araki, T., Schmidt, R. E., Milbrandt, J.
(2005). Analysis of congenital hypomyelinating Egr2Lo/Lo nerves identifies Sox2 as an inhibitor of Schwann cell differentiation and myelination. Proc. Natl. Acad. Sci. USA
102: 2596-2601
[Abstract]
[Full Text]
-
Kim, Y.-J., Lee, M.-H., Wozney, J. M., Cho, J.-Y., Ryoo, H.-M.
(2004). Bone Morphogenetic Protein-2-induced Alkaline Phosphatase Expression Is Stimulated by Dlx5 and Repressed by Msx2. J. Biol. Chem.
279: 50773-50780
[Abstract]
[Full Text]
-
Vinals, F., Ventura, F.
(2004). Myogenin Protein Stability Is Decreased by BMP-2 through a Mechanism Implicating Id1. J. Biol. Chem.
279: 45766-45772
[Abstract]
[Full Text]
-
Sowa, H., Kaji, H., Hendy, G. N., Canaff, L., Komori, T., Sugimoto, T., Chihara, K.
(2004). Menin Is Required for Bone Morphogenetic Protein 2- and Transforming Growth Factor {beta}-regulated Osteoblastic Differentiation through Interaction with Smads and Runx2. J. Biol. Chem.
279: 40267-40275
[Abstract]
[Full Text]
-
Doherty, T. M., Fitzpatrick, L. A., Inoue, D., Qiao, J.-H., Fishbein, M. C., Detrano, R. C., Shah, P. K., Rajavashisth, T. B.
(2004). Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification. Endocr. Rev.
25: 629-672
[Abstract]
[Full Text]
-
Ogasawara, T., Kawaguchi, H., Jinno, S., Hoshi, K., Itaka, K., Takato, T., Nakamura, K., Okayama, H.
(2004). Bone Morphogenetic Protein 2-Induced Osteoblast Differentiation Requires Smad-Mediated Down-Regulation of Cdk6. Mol. Cell. Biol.
24: 6560-6568
[Abstract]
[Full Text]
-
Jin, Y.-H., Jeon, E.-J., Li, Q.-L., Lee, Y. H., Choi, J.-K., Kim, W.-J., Lee, K.-Y., Bae, S.-C.
(2004). Transforming Growth Factor-{beta} Stimulates p300-dependent RUNX3 Acetylation, Which Inhibits Ubiquitination-mediated Degradation. J. Biol. Chem.
279: 29409-29417
[Abstract]
[Full Text]
-
Yoshizawa, T., Takizawa, F., Iizawa, F., Ishibashi, O., Kawashima, H., Matsuda, A., Endo, N., Kawashima, H.
(2004). Homeobox Protein Msx2 Acts as a Molecular Defense Mechanism for Preventing Ossification in Ligament Fibroblasts. Mol. Cell. Biol.
24: 3460-3472
[Abstract]
[Full Text]
-
Sevetson, B., Taylor, S., Pan, Y.
(2004). Cbfa1/RUNX2 Directs Specific Expression of the Sclerosteosis Gene (SOST). J. Biol. Chem.
279: 13849-13858
[Abstract]
[Full Text]
-
Zhu, S., Goldschmidt-Clermont, P. J., Dong, C.
(2004). Transforming Growth Factor-{beta}-Induced Inhibition of Myogenesis Is Mediated Through Smad Pathway and Is Modulated by Microtubule Dynamic Stability. Circ. Res.
94: 617-625
[Abstract]
[Full Text]
-
Komaki, M., Asakura, A., Rudnicki, M. A., Sodek, J., Cheifetz, S.
(2004). MyoD enhances BMP7-induced osteogenic differentiation of myogenic cell cultures. J. Cell Sci.
117: 1457-1468
[Abstract]
[Full Text]
-
Luppen, C. A., Leclerc, N., Noh, T., Barski, A., Khokhar, A., Boskey, A. L., Smith, E., Frenkel, B.
(2003). Brief Bone Morphogenetic Protein 2 Treatment of Glucocorticoid-inhibited MC3T3-E1 Osteoblasts Rescues Commitment-associated Cell Cycle and Mineralization without Alteration of Runx2. J. Biol. Chem.
278: 44995-45003
[Abstract]
[Full Text]
-
Ying, S.-X., Hussain, Z. J., Zhang, Y. E.
(2003). Smurf1 Facilitates Myogenic Differentiation and Antagonizes the Bone Morphogenetic Protein-2-induced Osteoblast Conversion by Targeting Smad5 for Degradation. J. Biol. Chem.
278: 39029-39036
[Abstract]
[Full Text]
-
Lee, M.-H., Kim, Y.-J., Kim, H.-J., Park, H.-D., Kang, A.-R., Kyung, H.-M., Sung, J.-H., Wozney, J. M., Kim, H.-J., Ryoo, H.-M.
(2003). BMP-2-induced Runx2 Expression Is Mediated by Dlx5, and TGF-{beta}1 Opposes the BMP-2-induced Osteoblast Differentiation by Suppression of Dlx5 Expression. J. Biol. Chem.
278: 34387-34394
[Abstract]
[Full Text]
-
Pratap, J., Galindo, M., Zaidi, S. K., Vradii, D., Bhat, B. M., Robinson, J. A., Choi, J.-Y., Komori, T., Stein, J. L., Lian, J. B., Stein, G. S., van Wijnen, A. J.
(2003). Cell Growth Regulatory Role of Runx2 during Proliferative Expansion of Preosteoblasts. Cancer Res.
63: 5357-5362
[Abstract]
[Full Text]
-
Kim, S., Koga, T., Isobe, M., Kern, B. E., Yokochi, T., Chin, Y. E., Karsenty, G., Taniguchi, T., Takayanagi, H.
(2003). Stat1 functions as a cytoplasmic attenuator of Runx2 in the transcriptional program of osteoblast differentiation. Genes Dev.
17: 1979-1991
[Abstract]
[Full Text]
-
Luo, K.
(2003). Negative Regulation of BMP Signaling by the Ski Oncoprotein. JBJS
85: 39-43
[Abstract]
[Full Text]
-
Enomoto, H., Shiojiri, S., Hoshi, K., Furuichi, T., Fukuyama, R., Yoshida, C. A., Kanatani, N., Nakamura, R., Mizuno, A., Zanma, A., Yano, K., Yasuda, H., Higashio, K., Takada, K., Komori, T.
(2003). Induction of Osteoclast Differentiation by Runx2 through Receptor Activator of Nuclear Factor-{kappa}B Ligand (RANKL) and Osteoprotegerin Regulation and Partial Rescue of Osteoclastogenesis in Runx2-/- Mice by RANKL Transgene. J. Biol. Chem.
278: 23971-23977
[Abstract]
[Full Text]
-
Sowa, H., Kaji, H., Canaff, L., Hendy, G. N., Tsukamoto, T., Yamaguchi, T., Miyazono, K., Sugimoto, T., Chihara, K.
(2003). Inactivation of Menin, the Product of the Multiple Endocrine Neoplasia Type 1 Gene, Inhibits the Commitment of Multipotential Mesenchymal Stem Cells into the Osteoblast Lineage. J. Biol. Chem.
278: 21058-21069
[Abstract]
[Full Text]
-
Canalis, E., Economides, A. N., Gazzerro, E.
(2003). Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton. Endocr. Rev.
24: 218-235
[Abstract]
[Full Text]
-
Shen, J., Hovhannisyan, H., Lian, J. B., Montecino, M. A., Stein, G. S., Stein, J. L., van Wijnen, A. J.
(2003). Transcriptional Induction of the Osteocalcin Gene During Osteoblast Differentiation Involves Acetylation of Histones H3 and H4. Mol. Endocrinol.
17: 743-756
[Abstract]
[Full Text]
-
Wada, M. R., Inagawa-Ogashiwa, M., Shimizu, S., Yasumoto, S., Hashimoto, N.
(2003). Generation of different fates from multipotent muscle stem cells. Development
129: 2987-2995
[Abstract]
[Full Text]
-
Tyson, K. L., Reynolds, J. L., McNair, R., Zhang, Q., Weissberg, P. L., Shanahan, C. M.
(2003). Osteo/Chondrocytic Transcription Factors and Their Target Genes Exhibit Distinct Patterns of Expression in Human Arterial Calcification. Arterioscler. Thromb. Vasc. Bio.
23: 489-494
[Abstract]
[Full Text]
-
Kim, H.-J., Kim, J.-H., Bae, S.-C., Choi, J.-Y., Kim, H.-J., Ryoo, H.-M.
(2003). The Protein Kinase C Pathway Plays a Central Role in the Fibroblast Growth Factor-stimulated Expression and Transactivation Activity of Runx2. J. Biol. Chem.
278: 319-326
[Abstract]
[Full Text]
-
Kloen, P., Doty, S. B., Gordon, E., Rubel, I. F., Goumans, M.-J., Helfet, D. L.
(2002). Expression and Activation of the BMP-Signaling Components in Human Fracture Nonunions. JBJS
84: 1909-1918
[Abstract]
[Full Text]
-
Vaillant, F., Blyth, K., Andrew, L., Neil, J. C., Cameron, E. R.
(2002). Enforced Expression of Runx2 Perturbs T Cell Development at a Stage Coincident with {beta}-Selection. J. Immunol.
169: 2866-2874
[Abstract]
[Full Text]
-
Shiroki, K., Ohsawa, C., Sugi, N., Wakiyama, M., Miura, K.-i., Watanabe, M., Suzuki, Y., Sugano, S.
(2002). Internal ribosome entry site-mediated translation of Smad5 in vivo: requirement for a nuclear event. Nucleic Acids Res
30: 2851-2861
[Abstract]
[Full Text]
-
Ziros, P. G., Gil, A.-P. R., Georgakopoulos, T., Habeos, I., Kletsas, D., Basdra, E. K., Papavassiliou, A. G.
(2002). The Bone-specific Transcriptional Regulator Cbfa1 Is a Target of Mechanical Signals in Osteoblastic Cells. J. Biol. Chem.
277: 23934-23941
[Abstract]
[Full Text]
-
Zaidi, S. K., Sullivan, A. J., van Wijnen, A. J., Stein, J. L., Stein, G. S., Lian, J. B.
(2002). Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites. Proc. Natl. Acad. Sci. USA
99: 8048-8053
[Abstract]
[Full Text]
-
Chen, H.-L., Demiralp, B., Schneider, A., Koh, A. J., Silve, C., Wang, C.-Y., McCauley, L. K.
(2002). Parathyroid Hormone and Parathyroid Hormone-related Protein Exert Both Pro- and Anti-apoptotic Effects in Mesenchymal Cells. J. Biol. Chem.
277: 19374-19381
[Abstract]
[Full Text]
-
Lai, C.-F., Cheng, S.-L.
(2002). Signal Transductions Induced by Bone Morphogenetic Protein-2 and Transforming Growth Factor-beta in Normal Human Osteoblastic Cells. J. Biol. Chem.
277: 15514-15522
[Abstract]
[Full Text]
-
Mariani, T. J., Reed, J. J., Shapiro, S. D.
(2002). Expression Profiling of the Developing Mouse Lung . Insights into the Establishment of the Extracellular Matrix. Am. J. Respir. Cell Mol. Bio.
26: 541-548
[Abstract]
[Full Text]
-
Korchynskyi, O., ten Dijke, P.
(2002). Identification and Functional Characterization of Distinct Critically Important Bone Morphogenetic Protein-specific Response Elements in the Id1 Promoter. J. Biol. Chem.
277: 4883-4891
[Abstract]
[Full Text]
-
Nam, S., Jin, Y.-H., Li, Q.-L., Lee, K.-Y., Jeong, G.-B., Ito, Y., Lee, J., Bae, S.-C.
(2002). Expression Pattern, Regulation, and Biological Role of Runt Domain Transcription Factor, run, in Caenorhabditis elegans. Mol. Cell. Biol.
22: 547-554
[Abstract]
[Full Text]
-
Brindle, N. P.J
(2001). A transcriptional regulator of osteogenesis expressed in calcifying atherosclerotic plaques. Cardiovasc Res
52: 178-180
[Full Text]
-
Liu, W., Toyosawa, S., Furuichi, T., Kanatani, N., Yoshida, C., Liu, Y., Himeno, M., Narai, S., Yamaguchi, A., Komori, T.
(2001). Overexpression of Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia with multiple fractures. JCB
155: 157-166
[Abstract]
[Full Text]
-
Banerjee, C., Javed, A., Choi, J.-Y., Green, J., Rosen, V., van Wijnen, A. J., Stein, J. L., Lian, J. B., Stein, G. S.
(2001). Differential Regulation of the Two Principal Runx2/Cbfa1 N-Terminal Isoforms in Response to Bone Morphogenetic Protein-2 during Development of the Osteoblast Phenotype. Endocrinology
142: 4026-4039
[Abstract]
[Full Text]
-
Thirunavukkarasu, K., Miles, R. R., Halladay, D. L., Yang, X., Galvin, R. J. S., Chandrasekhar, S., Martin, T. J., Onyia, J. E.
(2001). Stimulation of Osteoprotegerin (OPG) Gene Expression by Transforming Growth Factor-beta (TGF-beta ). MAPPING OF THE OPG PROMOTER REGION THAT MEDIATES TGF-beta EFFECTS. J. Biol. Chem.
276: 36241-36250
[Abstract]
[Full Text]
-
Gilbert, L., He, X., Farmer, P., Rubin, J., Drissi, H., van Wijnen, A. J., Lian, J. B., Stein, G. S., Nanes, M. S.
(2002). Expression of the Osteoblast Differentiation Factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) Is Inhibited by Tumor Necrosis Factor-alpha. J. Biol. Chem.
277: 2695-2701
[Abstract]
[Full Text]