Previous Article | Next Article 
Molecular and Cellular Biology, December 2000, p. 8826-8835, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Localization and Signaling of G
Subunit Ste4p Are Controlled by a-Factor Receptor and the
a-Specific Protein Asg7p
Jinah
Kim,1
Eric
Bortz,1
Hualin
Zhong,2,
Thomas
Leeuw,3,
Ekkehard
Leberer,3,
Andrew K.
Vershon,2 and
Jeanne
P.
Hirsch1,*
Department of Cell Biology and Anatomy, Mount
Sinai School of Medicine, New York, New York
100291; Waksman Institute and
Department of Molecular Biology and Biochemistry, Rutgers University,
Piscataway, New Jersey 088542; and
Eukaryotic Genetics Group, Biotechnology Research
Institute, National Research Council of Canada, Montreal, Quebec
H4P 2R2, Canada3
Received 29 June 2000/Returned for modification 22 August
2000/Accepted 15 September 2000
 |
ABSTRACT |
Haploid yeast cells initiate pheromone signaling upon the binding
of pheromone to its receptor and activation of the coupled G protein. A
regulatory process termed receptor inhibition blocks pheromone
signaling when the a-factor receptor is inappropriately expressed in
MATa cells. Receptor inhibition blocks signaling by
inhibiting the activity of the G protein
subunit, Ste4p. To
investigate how Ste4p activity is inhibited, its subcellular location
was examined. In wild-type cells,
-factor treatment resulted in
localization of Ste4p to the plasma membrane of mating projections. In
cells expressing the a-factor receptor,
-factor treatment resulted
in localization of Ste4p away from the plasma membrane to an internal
compartment. An altered version of Ste4p that is largely insensitive to
receptor inhibition retained its association with the membrane in cells
expressing the a-factor receptor. The inhibitory function of the
a-factor receptor required ASG7, an a-specific gene of
previously unknown function. ASG7 RNA was induced by
pheromone, consistent with increased inhibition as the pheromone
response progresses. The a-factor receptor inhibited signaling in its
liganded state, demonstrating that the receptor can block the signal
that it initiates. ASG7 was required for the altered
localization of Ste4p that occurs during receptor inhibition, and the
subcellular location of Asg7p was consistent with its having a direct
effect on Ste4p localization. These results demonstrate that Asg7p
mediates a regulatory process that blocks signaling from a G protein
subunit and causes its relocalization within the cell.
 |
INTRODUCTION |
The pheromone response of the yeast
Saccharomyces cerevisiae is initiated by the binding of a
peptide pheromone to its specific receptor on a responding cell.
Haploid yeast cells containing the MATa allele secrete
a-factor and express receptors for
-factor; cells
containing the MAT
allele secrete
-factor and express
receptors for a-factor (19, 33, 36). The
a- and
-factor receptors are G protein-coupled receptors, and they activate a heterotrimeric G protein that is common to both
cell types. Activation of the G protein by occupied receptors results
in guanine nucleotide exchange on the G protein
subunit, which
causes the
and
subunits to be released from the
subunit. The free 
complex interacts with downstream components of the pathway, resulting in activation of a mitogen-activated protein (MAP)
kinase cascade. Signaling through this pathway produces a number of
changes in cellular physiology, including arrest in the G1
phase of the cell cycle, induction of gene expression, redistribution
of cell surface proteins, and formation of cellular projections.
In addition to the classical G protein activation process described
above, the pheromone response pathway is subject to a process that
inhibits G protein signaling. This process, termed receptor inhibition,
was uncovered by a mutation that causes the a-factor
receptor to be inappropriately expressed in MATa cells. The STE3DAF mutation was isolated in a
screen for dominant mutations that conferred resistance to
pheromone-induced cell cycle arrest (4). STE3DAF, which is an allele of the
a-factor receptor gene STE3, contains a
rearranged 5' regulatory region that causes it to be expressed in
MATa cells (13). Expression of
STE3 in MATa cells confers resistance to
pheromone-induced cell cycle arrest by blocking signaling through the
pheromone response pathway. Although MATa haploid
cells do not normally express the
-specific gene STE3,
a- and
-specific gene products do come into contact with
each other immediately after the fusion of a MATa cell
and a MAT
cell during the process of mating. Therefore, a
potential physiological function of receptor inhibition is to inhibit
signaling in mating cells that have recently undergone cell fusion.
This process may function to promote recovery from mating and allow
cell cycle progression to resume.
Cells that contain a STE3DAF allele display a
characteristic pattern of signaling. In STE3DAF
cells treated with pheromone, activation of the MAP kinase is normal
early in the response but is gradually inhibited at later time points
(3). This pattern suggests that prior activation of the
signaling pathway must occur before the inhibitory process can
function. Another characteristic of receptor inhibition is that it is
independent of the G protein
subunit (4, 13). In the
pheromone response pathway, the
subunit plays a negative role by
sequestering the 
complex and keeping it inactive. Deletion of
GPA1, the G protein
subunit gene, causes constitutive
signaling due to release of the 
complex. The constitutive
signaling phenotype of cells with a GPA1 deletion is
suppressed by the STE3DAF mutation, indicating
that receptor inhibition of signaling can occur in the absence of
Gpa1p. This result demonstrates that the target of receptor inhibition
is a signaling component that is downstream of the G protein
subunit.
Two types of evidence suggest that the G protein
subunit, Ste4p, is
the signaling component that is targeted by receptor inhibition.
Initial results supporting this idea involve the phenotypes of double
mutants that carry both STE3DAF and a
constitutive signaling mutation. The STE3DAF
allele blocks signaling in cells that contain constitutive or overexpression alleles of STE4 (3, 13). However,
STE3DAF does not block signaling in cells
that overexpress STE20 or that contain a constitutive allele
of STE5 (3). STE20 encodes a kinase
that activates the MAP kinase cascade, and STE5 encodes a
scaffolding protein for the MAP kinase cascade, so both of these signaling components act downstream of Ste4p. These studies are therefore consistent with the idea that receptor inhibition acts at the
level of Ste4p, the G protein
subunit. This conclusion was further
supported by the isolation of altered versions of Ste4p that can signal
normally but that are insensitive to receptor inhibition
(17). The altered residues in Ste4p are not in the regions
that contact the
subunit, suggesting that they constitute part of a
binding site for another protein that interacts with Ste4p. Such a
protein could be a negative regulator that prevents Ste4p from
interacting with its downstream targets. One potential explanation for
the phenotype of the STE3DAF allele is that a
negative regulator of Ste4p is expressed only in MATa cells.
Receptor inhibition appears to require an a-specific
component based on the following observation. Deletion of
GPA1 causes constitutive signaling in both
MATa and MAT
cells due to release of the

complex. Expression of STE3 inhibits the constitutive
signaling conferred by a GPA1 deletion in
MATa cells but has no effect in MAT
cells (17). One important difference between
MATa and MAT
cells is that Ste2p, the
-factor receptor, is expressed only in MATa cells.
However, receptor inhibition does not require the presence of Ste2p
because the ability of STE3DAF to block
signaling in MATa gpa1
cells is unaffected by a ste2
mutation (17). These findings indicate
that an a-specific component other than Ste2p is required
for inhibition of
-subunit activity by the a-factor receptor.
Here we investigate further the process by which Ste4p signaling is
blocked by receptor inhibition. Examination of the subcellular location
of Ste4p indicates that it undergoes altered localization during
receptor inhibition. In addition, we show that altered localization of
Ste4p and inhibition of signaling require an a-specific gene
called ASG7.
 |
MATERIALS AND METHODS |
Plasmid construction.
Plasmid YCp
36 was constructed by
replacing the 392-bp HpaI-XhoI fragment in
plasmid YCpSTE4 (17) with a 284-bp
HpaI-XhoI fragment from a plasmid containing the
STE4 gene in which the 108 bp encoding amino acids 310 to
346 of Ste4p had been deleted by site-directed mutagenesis.
The fusion of STE4 with the gene encoding green fluorescent
protein (GFP) was constructed as follows. STE4 was amplified
by PCR using oligodeoxynucleotides
5'-CCACTAGTGCATGCATGGCAGCACATCAGATG-3' and
5'-AGGAGCTCCTACCCGGGTTGATAACCTGGAGAC-3'
(the newly created SpeI and SacI sites are
underlined; the newly created SphI and SmaI sites
are in boldface) as primers and pL38 (18) as the template
and cloned into the SpeI and SacI sites of
pRS316-GAL (20). The GFPS65T mutant
(11) was amplified by PCR using oligodeoxynucleotides 5'-CGGGATCCGCTAGCATGAGTAAAGGAGAAGAAC-3'
and
5'-GCTCTAGATTAGCATGCACTAGTTTTGTATAGT-3' (the newly created BamHI and XbaI sites are
underlined; the newly created NheI and SphI sites
are in boldface) as primers and pRSET-B-GFPS65T (obtained
from R. Tsien) as the template and cloned into the XbaI and
BamHI sites of pRS316-GAL to yield plasmid pBTL32. Plasmid pBTL34 carrying STE4 fused to the carboxyl terminus of
GFPS65T was created by cloning the
SphI-to-SacI fragment of pBTL29 into pBTL32. The
promoter region of STE4 was amplified by PCR using oligodeoxynucleotides 5'-CGGAATTCAATGTTTCAGGAAGAGAT-3'
and 5'-GCGGATCCCGTAATGTGTACCTGATT-3' (the
newly created EcoRI and BamHI sites are
underlined) as primers and pL38 as the template and cloned into the
EcoRI and BamHI sites of pRS313, creating plasmid
pBTL42. Plasmid pBTL60 carrying a fusion of STE4 with the
carboxyl terminus of GFPS65T under the control
of the STE4 promoter was then constructed by cloning the
BamHI-to-SacI fragment from plasmid pBTL34 into
plasmid pBTL42, and pBTL49 was constructed by transferring the
promoter-GFP fusion construct contained within the
PvuI fragment to plasmid pRS316. Plasmid YCpGFP-SD10 was
constructed by replacing the 2.1-kb BamHI-SacI
fragment in pBTL49, which contains STE4, with a 2.1-kb BamHI-SacI fragment that contains the
STE4SD10 allele (17).
The fragment used for construction of
asg7::
URA3 null alleles was synthesized
by two-step PCR (
35). In the first step, oligonucleotides
W1517 (5'-CCGCATTAGTGGGCTATCAGTAGCAC) and W1519
(5'-TATCAGTTATTACCCTATGCGGTGTGCCAAGGGTTCTCATCGTTCTCGAGGGCGC)
were used as the primers and yeast genomic DNA was used as the
template to generate a 427-bp fragment in which the first 401-bp
region
is homologous to the 5' untranslated region of
ASG7 and
the
last 26-bp region is homologous to the 5' region of the
URA3 gene. Oligonucleotides W1520
(5'-CCTTCTGTTCGGAGATTACCGAATCAGTAGATCTAAAGACAGAAAATGATATCAGCC)
and W1518 (5'-CGACTGAGGTCCACTGGCAGCGACTG) were used as
the primers
to generate a 353-bp fragment in which the first 26 bp is
homologous
to the 3' region of the
URA3 gene and the last
327 bp is homologous
to the 3' untranslated region of the
ASG7 gene. In the second
step, the 427- and 353-bp fragments
from the first PCRs served
as the primers and plasmid pRS426, which
contains the
URA3 gene,
was used as the template in the PCR.
The product of this reaction
was used to transform yeast
strains.
A plasmid containing the wild-type
ASG7 gene was isolated by
complementation of the
asg7::
URA3
mutation. DNA from yeast genomic
library 2J351 (
8) was
transformed into a
MATa STE3DAF
asg7::
URA3 strain (H67-6C.a7), and
transformants were screened
for their ability to grow in the presence
of

-factor. Plasmid
pASG7-351.1, which contains the
ASG7
gene, conferred resistance
to

-factor-induced cell cycle arrest.
Plasmid pASG7-351.2 was
constructed by subcloning the 1.6-kb
HindIII-
BglII fragment from
pASG7-351.1 into
the
HindIII-
BamHI sites of vector YEp351. The
ASG7-GFP fusion gene was constructed using a 1.8-kb
HindIII fragment
of genomic DNA from pASG7-351.1 that
contains
ASG7. A 0.7-kb fragment
containing
GFP
flanked by
NotI sites was subcloned into a
NotI
site that was inserted immediately before the stop codon in
ASG7 by site-directed mutagenesis. The 2.5-kb
HindIII fragment containing
the
ASG7-GFP
fusion gene was subcloned into the
HindIII site of
YCplac111 (
10) to create plasmid pASG7-111.GFP.
Strains and media.
Strains used in this study are listed in
Table 1. The
asg7::URA3 null allele was made by
transformation of strains with a 1.8-kb fragment generated by two-step
PCR, as described above. The gpa1::TRP1
allele was created by transformation of a strain containing the
gpa1::URA3 allele (7) with a
3.2-kb EcoRI-XhoI fragment from plasmid pTU10
(5). The far1::LEU2 allele
was created by transformation of a strain containing the
far1::URA3 allele (3) with a
4.6-kb SmaI fragment from plasmid pUL9 (5). The
asg7::HIS3 allele was created by
transformation of a strain containing the
asg7::URA3 allele with a 3.6-kb
XbaI fragment from plasmid pUH7 (5).
Strains were grown on yeast extract-peptone-dextrose (2% glucose) or
yeast extract-peptone-Gal (3% galactose), and strains
under selection
were grown on synthetic dropout media, as described
previously
(
32).
Yeast methods.
Yeast transformations were performed by the
lithium acetate method (15) modified as described previously
(13). Yeast RNA was extracted from cells as described
previously (6).
Halo assays were performed by plating a lawn of cells to be tested and
placing a filter paper disk containing 5 µl of 1 mM

-factor onto
the plate. Plates were then incubated at 30°C for
1 to 2
days.
Northern blots.
Cells were treated with 0.1 µM
-factor
(Sigma), 60 nM a-factor, or 300 nM a-factor
(generously provided by Fred Naider) for various periods of time, and
RNA was isolated. RNA was transferred to a nitrocellulose membrane
after formaldehyde-agarose gel electrophoresis as described previously
(31). The membranes were UV cross-linked using a
Stratalinker UV box. Prehybridization and hybridization were done at
65°C in a buffer containing 0.9 M NaCl, 0.09 M sodium citrate, 0.1%
Ficoll, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin, 33 mM
sodium pyrophosphate, and 50 mM sodium phosphate monobasic. The probes
used were gel-purified DNA restriction fragments 32P
labeled by random primer labeling using a Prime-It kit (Stratagene). The fragments used were FUS1, a 1.4-kb
EcoRI-HindIII fragment from plasmid pSL589
(25), phosphoglycerate kinase gene PGK1, a 0.5-kb
BamHI-XbaI fragment from pPGK1, and
ASG7, a 0.75-kb HpaI-SacI fragment
from pASG7-351.2.
Immunoblots.
For immunoblots, cells were treated with 0.1 µM
-factor (Sigma) for various periods of time, and 10-ml aliquots
of cells were pelleted and washed once with 10 mM Tris-HCl (pH 7.8)-1
mM EDTA. The washed cells were resuspended in 350 µl of lysis buffer (50 mM Tris-HCl [pH 8.0], 1% sodium dodecyl sulfate [SDS], 1 mM phenylmethylsulfonyl fluoride, and 1 µg each of leupeptin, aprotinin, chymostatin, and pepstatin/ml). The cell suspension was lysed by adding
approximately 0.25 ml of acid-washed glass beads (0.5 mm; Biospec
Products) and vortexing at high speed for 10 min at 4°C. The lysate
was cleared by centrifuging for 2 min at 4°C. The protein
concentrations of the samples were determined using a bicinchoninic
protein assay kit (Pierce), and equal amounts of protein were loaded
onto SDS-polyacrylamide gels (10% acrylamide). Separated proteins were
transferred to nitrocellulose, and the blot was probed with anti-Ste4p
rabbit antiserum (14) at a dilution of 1:1,000. Donkey
anti-rabbit immunoglobulin conjugated to horseradish peroxidase
(Amersham) was used at a dilution of 1:10,000, and immune complexes
were detected with an enhanced chemiluminescence kit (Amersham).
Microscopy.
For fluorescence microscopy, cells containing
GFP-Ste4p or Asg7p-GFP fusion proteins were observed on a Zeiss
Axioskop microscope with a ×100 (1.3-numerical-aperture) objective and
a fluorescein isothiocyanate (FITC) filter set (Chroma Technology).
Digital images were captured with a Photometrics SenSys 1400-C1.cCCD
camera using IPLab Spectrum image acquisition software (Scanalytics).
 |
RESULTS |
Expression of the a-factor receptor in
MATa cells inhibits signal transduction through the
pheromone response pathway by a process called receptor inhibition. In
cells undergoing receptor inhibition, the signaling pathway is blocked
at the level of Ste4p, the G protein
subunit (3, 17). To
investigate the mechanism responsible for the signaling block, the
effect of receptor inhibition on properties of Ste4p that are required for signaling was examined.
Expression of the a-factor receptor in a cells affects Ste4p
localization.
Previous studies have shown that association of the

complex with the plasma membrane is required for activation of
the signaling pathway (29). Therefore, one mechanism to
account for signaling inhibition in the presence of the
a-factor receptor is that the Ste4p
subunit is not
properly localized to the plasma membrane. To investigate this
possibility, the localization pattern of a GFP-Ste4p fusion protein was
observed in wild-type MATa cells and
STE3DAF MATa cells that were treated with
pheromone for various amounts of time. STE3 encodes the
a-factor receptor, and the STE3DAF
allele causes expression of STE3 in MATa
cells due to an insertion in its promoter region (13). To
eliminate any effects of autocrine signaling through the
a-factor receptor, both the wild-type and
STE3DAF strains used in these experiments have
deletions of the genes encoding a-factor (13).
Both wild-type and
STE3DAF untreated cells
displayed a signal that appeared to be partially localized at the
membrane and partially
localized to an internal compartment (Fig.
1). This result is
in agreement with cell
fractionation studies done by others, which
have shown that Ste4p
partitions 40% with the plasma membrane,
30% with internal membranes,
and 30% with nonmembrane fractions
(
14). After 1 h of

-factor treatment, GFP-Ste4p was concentrated
at the sites of
incipient mating projection formation in both
strains. At this time
point, the similar localization patterns
of GFP-Ste4p in the two
strains are expected, given the previous
finding that
STE3DAF cells undergo a detectable level of
signaling after 1 h of pheromone
treatment (
3). After
2 h of

-factor treatment of wild-type
cells, GFP-Ste4p was
localized predominantly at the membrane in
regions where mating
projections had formed (Fig.
1, 2 h). In
contrast,
STE3DAF cells treated with

-factor for 2 h showed a dramatic reduction
in the amount of GFP-Ste4p that was
membrane associated and an
increase in the amount that localized in an
internal particulate
pattern. This effect was observed even in cells
that still contained
mating projections. After 3 h of

-factor
treatment, GFP-Ste4p
remained at the sites of mating projections in
wild-type cells
but was predominantly localized to an internal
compartment in
STE3DAF cells. At this time
point, the
STE3DAF cells had recovered from cell
cycle arrest and displayed a high
percentage of budded cells.
Significant inhibition of signaling
occurs in
STE3DAF cells at about 2 h after pheromone
treatment (
3). Thus, localization
of GFP-Ste4p away from the
membrane correlates with the period
of signaling inhibition.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 1.
Localization of GFP-Ste4p in wild-type and
STE3DAF cells. The following strains were
treated with -factor (0.1 µM) for the indicated periods of time:
AC17-7B, a MATa STE3
ste4::HIS3 strain (STE3), and
AC17-2B, a MATa STE3DAF
ste4::HIS3 strain
(STE3DAF). Both strains contained the
low-copy-number GFP-STE4 plasmid BTL49. The live cells were
viewed by fluorescence microscopy using an FITC filter set.
|
|
Expression of the a-factor receptor in a cells does not affect
Ste4p abundance.
In cells undergoing receptor inhibition, the
localization pattern of Ste4p resembled that of an endocytic
compartment (Fig. 1, STE3DAF, 2 h). If
receptor inhibition causes Ste4p to undergo endocytosis, it is possible
that the level of Ste4p would decrease under these conditions. To
determine the effect of receptor inhibition on Ste4p abundance, the
levels of Ste4p in wild-type MATa cells and
STE3DAF MATa cells were investigated.
Cell extracts were prepared from wild-type and
STE3DAF strains that had been treated with

-factor for various amounts of time,
and immunoblots prepared from
these extracts were probed with
a polyclonal anti-Ste4p antibody
(
14). In wild-type cells treated
with

-factor for 1 to
4 h, Ste4p displayed a mobility shift characteristic
of the
phosphorylated form (Fig.
2A, lanes 1 to
4), as described
previously (
2). In
STE3DAF cells, Ste4p was present in both the
unmodified and phosphorylated
forms after 1 h of exposure to

-factor and the unmodified form
increased in abundance at later time
points (Fig.
2A, lanes 5
to 8). These results are consistent with
previous observations
showing that
STE3DAF cells
undergo an initial response to pheromone that is gradually
inhibited at
later times after pheromone treatment (
3). There
did not
appear to be a significant difference between the abundance
of Ste4p in
wild-type cells and that in
STE3DAF cells at the
2- and 4-h time points, when signaling is inhibited
in
STE3DAF cells. However, the presence of multiple
forms of Ste4p made
it difficult to compare its abundances in the two
different strains.
To eliminate this complication, the effect of the
STE3DAF allele on Ste4p abundance was
investigated in a strain containing
a form of Ste4p that does not
undergo phosphorylation in response
to pheromone (
2). This
form of Ste4p, which lacks residues
310 to 346, is fully capable of
signal transmission because phosphorylation
is not required for the
Ste4p signaling function (
22). Moreover,
the signaling
activity of Ste4p
310-346 is capable of being inhibited
by expression of
STE3 in
MATa cells,
indicating that phosphorylation does not play a role in
receptor
inhibition (J. Kim and J. P. Hirsch, unpublished data).
Immunoblots of samples from wild-type and
STE3DAF strains were probed with anti-Ste4p
antibody to detect the level
of Ste4p
310-346 at various
times after pheromone treatment. At all time points,
wild-type cells
contained slightly higher levels of Ste4p
310-346 than
STE3DAF cells (Fig.
2B, lanes 1 to 8). However,
the level of Ste4p
310-346 did not change significantly
in
STE3DAF cells after treatment with pheromone.
These results demonstrate
that receptor inhibition does not cause a
major change in the
steady-state level of the Ste4p

subunit.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Abundances of Ste4p and Ste4p 310-346 in
wild-type and STE3DAF cells. (A) The following
strains were treated with -factor (0.1 µM) for the indicated
periods of time: H67-9D.Ba, a MATa STE3 strain
(lanes 1 to 4), H67-6C.Ba, a MATa
STE3DAF strain (lanes 5 to 8), and AC17-7B, a
MATa STE3 ste4::HIS3 strain
(lane 9). Cell extracts were prepared, and immunoblots containing these
extracts were probed with anti-Ste4p polyclonal antibody. (B) The
following strains were treated with -factor (0.1 µM) for the
indicated periods of time: AC17-7B, a MATa STE3
ste4::HIS3 strain carrying plasmid YCp 36,
which contains the STE4 310-346 allele (lanes
1 to 4), and AC17-2B, a MATa STE3DAF
ste4::HIS3 strain carrying plasmid YCp 36
(lanes 5 to 8). Cell extracts were prepared, and immunoblots containing
these extracts were probed with an anti-Ste4p polyclonal antibody.
|
|
An altered version of Ste4p localizes normally in cells expressing
the a-factor receptor.
STE4SD alleles are
mutated versions of the STE4 gene that produce Ste4p
variants that are largely insensitive to inhibition by the
a-factor receptor (17). In wild-type
MATa cells, the Ste4pSD10 variant signals
in a manner indistinguishable from that of wild-type Ste4p. In
STE3DAF MATa cells, Ste4pSD10
produces a much greater signal than wild-type Ste4p at late time points
after
-factor treatment. To test whether signaling correlates with
localization of Ste4p at the plasma membrane, the localization pattern
of Ste4pSD10 was investigated in MATa
cells expressing the a-factor receptor. In
STE3DAF cells treated with
-factor for 2 or
3 h, GFP-Ste4p was localized in an internal particulate pattern
(Fig. 3, Ste4p). In contrast, a large
proportion of the GFP-Ste4pSD10 signal was localized at the
membrane at regions of mating projections (Fig. 3,
Ste4pSD). Therefore, the increased signaling conferred by
the Ste4pSD10 variant correlates with increased membrane
localization. These results suggest that inhibition of signaling by the
a-factor receptor is effected by localization of Ste4p away
from the plasma membrane.

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of GFP-Ste4p and GFP-Ste4pSD10
in STE3DAF cells. Strain AC17-2B
(MATa STE3DAF
ste4::HIS3) containing a GFP-STE4
plasmid (pBTL49) or a GFP-STE4SD10 plasmid
(YCpGFP-SD10) was treated with -factor (0.1 µM) for the indicated
periods of time. The live cells were viewed by fluorescence microscopy
using an FITC filter set.
|
|
ASG7 is required for inhibition of signaling by the
a-factor receptor.
Previous results indicate that receptor
inhibition requires a component that is only present in
MATa cells. However, it has been shown that inhibition
of signaling does not require any of the known a-specific
genes that might be expected to be involved in this process, including
STE2 (a-factor receptor gene), MFA1
and MFA2 (a-factor genes), SST1
(
-factor protease gene), and STE6 (a-factor
transporter gene) (13; A. Couve and J. P. Hirsch, unpublished data). A comprehensive approach to identify
a-specific genes was recently performed by screening the
Saccharomyces Genome Database for Mat
2p-Mcm1p binding
sites in the 5' flanking regions of open reading frames (38). The Mat
2p-Mcm1p complex functions to repress
transcription in MAT
cells, and thus these binding sites
identify genes that are only expressed in MATa cells.
A previously uncharacterized a-specific gene,
ASG7, was identified by the screen. The requirement for
ASG7 in receptor inhibition was tested by deleting the
ASG7 gene in MATa cells containing a
STE3DAF allele.
As described previously,
MATa cells containing a
STE3DAF allele did not undergo cell cycle arrest
in response to pheromone
as measured by a halo assay (Fig.
4A). However, deletion of
ASG7 in
STE3DAF cells completely eliminated the
inhibition of cell cycle arrest
seen in the
STE3DAF strain. Deletion of
ASG7 had
no effect on pheromone-induced cell
cycle arrest in wild-type
MATa cells. These results demonstrate
that a
functional
ASG7 gene is required for inhibition of the
cell
cycle arrest response by
STE3DAF.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of ASG7 on signaling in
STE3DAF cells. (A) Halo assays were performed
with 5 µl of 1 mM -factor using the following strains (from left
to right): H67-9D.Ba, a MATa STE3 ASG7 strain,
H67.9D.a7, a MATa STE3
asg7::URA3 strain, H67-6C.Ba, a
MATa STE3DAF ASG7 strain, and
H67-6C.a7, a MATa STE3DAF
asg7::URA3 strain. (B) The following strains
were treated with -factor (0.1 µM) for the indicated periods of
time: H67-9D.Ba, a MATa STE3 ASG7 strain (lanes
1 to 4), H67-9D.a7, a MATa STE3
asg7::URA3 strain (lanes 5 to 8), H67-6C.Ba,
a MATa STE3DAF ASG7 strain (lanes 9 to 12), and H67-6C.a7, a MATa STE3DAF
asg7::URA3 strain (lanes 13 to 16). RNA was
isolated, transferred to nitrocellulose, hybridized with a
FUS1 probe, and rehybridized with a PGK1 probe.
(C) MATa STE3DAF
gpa1::TRP1 ASG7 (H125-7D) and
MATa STE3DAF
gpa1::TRP1 asg7::HIS3
(H125-7D.aH) strains containing a plasmid with GPA1 under
the control of the GAL promoter were streaked onto
galactose- or glucose-containing plates and grown at 30°C for 2 to 3 days.
|
|
The
STE3DAF allele causes inhibition of
pheromone-inducible transcription at late times after pheromone
treatment (
3). To
determine the effect of
ASG7 on
transcriptional induction, a time
course of
FUS1 RNA
expression was performed in cells containing
wild-type or null alleles
of
ASG7. Deletion of
ASG7 had no effect
on the
level of
FUS1 RNA induced in wild-type cells (Fig.
4B,
lanes
1 to 8). As described previously,
STE3DAF cells
displayed a decrease in
FUS1 RNA induction that was most
pronounced at the 2- and 3-h time points (Fig.
4B, lanes 9 to
12). In
STE3DAF cells containing an
asg7
mutation, the levels of
FUS1 RNA were
the same as those seen
in wild-type cells (Fig.
4B, lanes 1 to
4 and 13 to 16). Therefore, the
asg7
mutation completely eliminated
the inhibitory effect
of expressing
STE3 in
MATa cells.
One of the characteristics of receptor inhibition is that it blocks the
constitutive signaling conferred by deletion of
GPA1,
the G
protein

-subunit gene, in an
a-specific manner (
4,
13,
17). In a wild-type background, a
gpa1
mutation
causes
permanent cell cycle arrest due to constitutive activation of
the pheromone response pathway by the


complex. In
MATa cells, the
STE3DAF allele
suppresses the cell cycle arrest phenotype of a
gpa1
strain. If
ASG7 is required for receptor inhibition, then
deletion
of the
ASG7 gene would be expected to result in
cell cycle arrest
in
STE3DAF MATa cells
that contain a
gpa1
mutation. The effect of
deleting
ASG7 in
MATa STE3DAF
gpa1
cells was tested using a strain that contains
GPA1 under
the control of the
GAL promoter. When
this strain was grown in
galactose, expression of
GPA1
complemented the
gpa1
mutation
and both the
ASG7 and
asg7
strains formed colonies (Fig.
4C).
In glucose, the cell cycle arrest phenotype was suppressed by
the
STE3DAF allele in the
ASG7 strain. In
the
STE3DAF strain that contains an
asg7
mutation, cell cycle arrest occurred
in the absence
of
GPA1 expression. These findings demonstrate
that
ASG7 is required for the inhibitory effect of the
STE3DAF allele that occurs in cells lacking the
G protein
subunit.
All of the results presented above show that
ASG7 is
required for the inhibition of signaling conferred by expression of
STE3 in
MATa cells. Although these results
do not prove that
ASG7 is the only
a-specific
gene that mediates receptor
inhibition, there is at present no evidence
to indicate that other
a-specific genes are required for
this
process.
Expression of ASG7 is a specific and pheromone
inducible.
Previous results have shown that expression of
ASG7 RNA is a specific (38). To
investigate further the regulation of ASG7, a time course of
RNA expression was performed in both MATa cells
treated with
-factor and MAT
cells treated with
a-factor. In these experiments, ASG7 RNA was not
detectable in untreated MATa or MAT
cells (Fig. 5, lanes 1 and 5). Treatment
of MATa cells with
-factor for 1 h caused a large increase in the abundance of ASG7 RNA, and this
increase was maintained for 3 h (Fig. 5, lanes 2 to 4). Treatment
of MAT
cells with a-factor had no effect on
the expression of ASG7 RNA, although FUS1 RNA was
induced normally (Fig. 5, lanes 6 to 8). These results demonstrate that
ASG7 RNA expression is completely a specific and
that it is pheromone inducible to a large degree.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 5.
Abundance of ASG7 RNA in
MATa and MAT cells treated with
pheromone. Strain W3031A.Ba was treated with -factor (0.1 µM) for
the indicated periods of time (lanes 1 to 4); strain W3031B was treated
with a-factor (60 nM) for the indicated periods of time
(lanes 5 to 8). RNA was isolated, transferred to nitrocellulose,
hybridized with an ASG7 or FUS1 probe, and
rehybridized with a PGK1 probe.
|
|
The a-factor receptor inhibits signaling in its liganded
state.
In the experiments described above, the a-factor
receptor is not occupied by a ligand because the strains used have deletions of the genes encoding a-factor. Therefore, it was
not known whether the a-factor receptor could function in
receptor inhibition in its liganded state. To test this idea, the
effect of the ASG7 gene on signaling that originates from the liganded a-factor receptor was investigated. Thus, this experiment tests whether the a-factor receptor can carry out its two independent functions, signal transduction and receptor inhibition, in the same cell.
To determine the effect of
ASG7 on signaling through the
a-factor receptor, a time course of
FUS1 RNA
expression was
performed in
MATa
STE3DAF cells containing wild-type or null
alleles of
ASG7. The cells
were treated with
a-factor at a concentration of 300 nM,
which is
approximately 10,000-fold higher than the lowest concentration
required
to induce a transcriptional response in
MAT
cells
(
24).
Because
STE3 is expressed at comparable
levels in
MATa STE3DAF cells and
wild-type
MAT
cells (
13), it is expected that
the
majority of cell surface receptors on
STE3DAF cells would be occupied by
a-factor at this concentration.
In the strain containing
wild-type
ASG7, there was only a slight
induction of
FUS1 RNA in response to treatment with
a-factor
(Fig.
6, lanes 1 to 4). In the strain
containing an
asg7
mutation,
there was a large increase
in the induction of
FUS1 RNA in response
to treatment with
a-factor (Fig.
6, lanes 5 to 8). The
simplest interpretation
of these results is that the
a-factor
receptor can block the
signal that it initiates. In the strain
that contains wild-type
ASG7, the low level of
FUS1 RNA induction
was due
to the presence of both the
a-factor receptor and
Asg7p in
the same cell. These results imply that the
a-factor
receptor can function in the process of receptor inhibition while
it is
bound to the ligand.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of ASG7 on signaling in
STE3DAF cells treated with a-factor.
The following strains were treated with a-factor (300 nM)
for the indicated periods of time: H67-6C.Ba, a MATa
STE3DAF ASG7 strain (lanes 1 to 4), and
H67-6C.a7, a MATa STE3DAF
asg7::URA3 strain (lanes 5 to 8). RNA was
isolated, transferred to nitrocellulose, hybridized with a
FUS1 probe, and rehybridized with a PGK1 probe.
|
|
ASG7 affects Ste4p localization.
The results
described above show that receptor inhibition results in altered
localization of the Ste4p
subunit. In addition, they show that
ASG7 is required for inhibition of signaling by the
a-factor receptor. It was therefore of interest to determine
whether deletion of the ASG7 gene would have an effect on
the subcellular location of Ste4p. To investigate this possibility, the
localization pattern of a GFP-Ste4p fusion protein in MATa STE3DAF cells that contained the wild-type
ASG7 gene or an asg7
mutation was observed.
The cells were treated with
-factor for 2 h to maximize the
difference between signaling and nonsignaling cells (Fig. 2). GFP-Ste4p
was localized in an internal particulate pattern in
STE3DAF cells that contained the wild-type
ASG7 gene (Fig. 7). In
contrast, GFP-Ste4p was localized predominantly at the cell membrane in STE3DAF cells that contained the
asg7
mutation. These results demonstrate that, in
addition to its effect on signaling, ASG7 has an effect on
Ste4p localization in cells that express the a-factor receptor. Moreover, localization of Ste4p to the cell membrane correlated with activation of the signaling pathway in all experiments, as would be expected for a protein that transmits a signal to membrane-associated target proteins.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of ASG7 on localization of GFP-Ste4p
in STE3DAF cells. The following strains were
treated with -factor (0.1 µM) for 2 h: AC17-2B, a
MATa STE3DAF
ste4::HIS3 ASG7 strain (ASG7), and
AC17-2B.aL, a MATa STE3DAF
ste4::HIS3 asg7::LEU2
strain (asg7 ). Both strains contained the low-copy-number
STE4-GFP plasmid pBTL49. The live cells were viewed by
fluorescence microscopy using an FITC filter set.
|
|
Asg7p localization is consistent with a direct effect of Asg7p on
Ste4p.
The effect of Asg7p on Ste4p localization could occur
through an indirect mechanism, such as transcriptional activation of other genes, or through a more direct mechanism, such as binding of
Ste4p to a complex containing Asg7p. To determine whether the location
of Asg7p in the cell is consistent with a direct effect on Ste4p, a
fully functional ASG7-GFP fusion construct was expressed in
STE3DAF cells containing an asg7
mutation. In cells treated with
-factor for 2 or 3 h, Asg7p-GFP
was localized in an internal particulate pattern (Fig.
8). Asg7p-GFP was observed in this
pattern as soon as the signal became visible, at about 1 h after
-factor treatment, and the pattern was the same in both
STE3DAF and wild-type cells (E. Bortz and
J. P. Hirsch, unpublished data). The subcellular location of Asg7p
is similar to that of Ste4p during receptor inhibition. Therefore,
these results are consistent with Asg7p having a direct effect on Ste4p
localization.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 8.
Localization of Asg7p in STE3DAF
cells. Strain H67-6C.a7 (MATa STE3DAF
asg7::URA3) containing an ASG7-GFP
plasmid (pASG7-111.GFP) was treated with -factor (0.1 µM) for the
indicated periods of time. The live cells were viewed by fluorescence
microscopy using an FITC filter set.
|
|
 |
DISCUSSION |
Localization and signaling function of Ste4p.
Expression of
the a-factor receptor in MATa cells
inhibits signaling through the pheromone response pathway at the level
of Ste4p, the G protein
subunit (3, 17). To investigate
the way in which signaling is inhibited, the normal localization
pattern of Ste4p during pheromone signaling was examined. Biochemical
fractionation of cell membranes had indicated that the fraction of
Ste4p that is associated with the plasma membrane does not change after
pheromone stimulation (14). We used microscopic examination
of live cells to show that treatment of cells with pheromone causes a
redistribution of Ste4p to regions of mating projection formation.
These studies were therefore able to detect a change in the location of
Ste4p that had not been seen previously. Other signaling components of
the pheromone response pathway, such as the pheromone receptors, the
kinase Ste20p, and the scaffolding protein Ste5p, have also been shown
to localize to the membranes of mating projections (16, 20, 23,
26, 29). These results are consistent with a model in which Ste5p
is recruited to the plasma membrane by the released Ste4p
subunit
upon activation of the G protein (29). Recruitment of Ste5p
to the membrane would bring Ste11p, which is bound to Ste5p, into close
proximity with the membrane-associated kinase Ste20p. Phosphorylation
of the MAP kinase kinase kinase Ste11p by Ste20p would then activate the MAP kinase cascade. This model is also consistent with our observation that localization of Ste4p away from the cell membrane to
an internal compartment correlates with inhibition of signaling. In
this case, Ste4p would not be able to recruit Ste5p to the plasma
membrane and phosphorylation of Ste11p would not occur. Therefore,
sequestration of the G protein
subunit away from the plasma
membrane provides an efficient posttranslational mechanism for
inhibition of signal transduction.
In cells undergoing receptor inhibition, Ste4p was localized to a
region of the cell that resembles an endocytic compartment.
However, it
should be noted that the yeast


complex does not
undergo
endocytosis during pheromone signaling in wild-type cells
(
14) and that the steady-state level of Ste4p does not
change
under conditions of receptor inhibition. Therefore, although
Ste4p
appears to be associated with vesicles or other subcellular
structures,
this association probably does not result in its
degradation in
the
lysosome.
G
subunit binding partners and regulation of
localization.
ASG7 was identified as an
a-specific gene that is required for the inhibitory effect
of the a-factor receptor on pheromone signaling. In
addition, it was shown that the subcellular location of Asg7p and Ste4p
is consistent with Asg7p having a direct effect on localization of the
Ste4p
subunit. Several proteins that bind directly to 
subunits and inhibit their signaling activity have been identified. One
such protein is phosducin, which undergoes regulated phosphorylation
and which binds to 
in its unphosphorylated form. The crystal
structure of the phosducin-
complex reveals that 
would not
be able to bind to a G protein
subunit when it is bound to
phosducin (9). The binding of phosducin to 
is also
predicted to disrupt the orientation of 
relative to the membrane
(9). This idea is in agreement with experimental evidence
demonstrating that the binding of phosducin to 
causes it to
shift from a membrane subcellular fraction to a soluble fraction
(21, 37). The ability of phosducin to cause the
translocation of 
to a different subcellular compartment and to
inhibit its signaling activity appears analogous to the action of Asg7p
on the yeast 
complex during receptor inhibition. However, unlike
the phosducin-
complex, the yeast 
complex remains in the
pellet fraction after it has translocated away from the plasma membrane
(J. Kim and J. P. Hirsch, unpublished data). Therefore, the
process of receptor inhibition does not cause complete solubilization
of the 
complex.
Another example of a protein that binds to


subunits is the
mammalian

-adrenergic receptor kinase (

ARK). In this case,
the


complex targets

ARK to the membrane and facilitates
phosphorylation
of the receptor by the kinase (
28). The
direct binding of

subunits to a protein involved in
down-regulating the response
suggests a parallel with the process of
receptor inhibition in
yeast. However, the complex of


and

ARK
localizes to a membrane
where


is thought to be active, unlike
the altered subcellular
location of


under conditions of receptor
inhibition.


subunits also bind to the mammalian protein KSR-1, a kinase that
was originally identified as a regulator of the Ras signaling
pathway
(
1). The binding of KSR-1 to


inhibits the ability
of


to activate the MAP kinase ERK1. In contrast to the change
in
subcellular location that is associated with inhibition of
the yeast


, the inactive complex of KSR-1 and


remains associated
with the plasma membrane. Thus, although receptor inhibition has
features in common with other systems in which


forms complexes
with known proteins, it is not strictly analogous to any previously
described
process.
Models for Asg7p function.
The a-specific gene
ASG7 was shown to be required for receptor inhibition by
demonstrating that deletion of ASG7 eliminated the
inhibitory effects of STE3 expression on signal
transduction. Moreover, MATa cells expressing
STE3 but lacking ASG7 displayed normal
localization of Ste4p at the cell membrane. These results are
consistent with several different models for the way in which Asg7p
functions with the a-factor receptor to inhibit signaling by
Ste4p. One potential model for receptor inhibition involves a direct
interaction between Asg7p and the a-factor receptor that
takes place within an intracellular membrane (Fig.
9A). The Asg7p protein is predicted to
contain two hydrophobic regions that could function as transmembrane
domains. In this model, the alpha-helical bundle of the receptor
transmembrane domains would interact with the transmembrane domains of
Asg7p. This interaction is not expected to take place in the plasma
membrane because Asg7p is not observed on the cell surface. However,
the pheromone receptors are associated with several different
intracellular membranes during their life cycle. This model assumes
that the cytoplasmic domains of the a-factor receptor
directly associate with the 
subunits. The interaction of the
receptor with Asg7p would produce a high-affinity binding site for

, which would result in the association of 
with a specific
internal compartment. This model is consistent with several studies of
mammalian systems, which have indicated that 
subunits may bind
directly to their associated receptors in the absence of an
subunit
(12, 27, 34). Moreover, Roth and colleagues have also
identified the role of ASG7 in receptor inhibition using a
genomics approach and have shown that Asg7p inhibits delivery of the
Ste3p receptor to the cell surface by a process that is independent of

(30). This finding provides support for the idea that
Asg7p and the a-factor receptor directly interact with each
other.
The other potential model for receptor inhibition involves a direct
interaction between Asg7p and the Ste4p

subunit (Fig.
9B). In this
model, the presence of the
a-factor receptor
would promote
loading of Asg7p into a complex that contains Ste4p.
Targeting signals
on Asg7p would then localize the complex to
an internal compartment.
This model is consistent with the observation
that Ste4p and Asg7p
display similar subcellular localization
patterns in cells undergoing
receptor inhibition. Activation of
a downstream component by an
unliganded G protein-coupled receptor
would represent a novel function
for this class of
receptors.
Altered versions of Ste4p that are resistant to receptor inhibition and
thus are capable of signaling in
MATa cells
in which
the
a-factor receptor is expressed have been identified
(
17). The effect of these changes in Ste4p can be
interpreted
in different ways when considering the two models presented
above.
If the first model is correct (Fig.
9A), then these changes in
Ste4p are expected to affect its ability to bind to the cytoplasmic
domains of the
a-factor receptor. If the second model is
correct (Fig.
9B), then these changes in Ste4p are expected to
affect
its ability to bind to a protein interaction domain of
Asg7p. It is
also possible that additional components that have
not yet been
identified could transmit a signal between the receptor,
Asg7p, and
Ste4p.
Analysis of the kinetics of signaling in
MATa cells
expressing the
a-factor receptor has shown that normal
initiation
of signaling is followed by a gradual inhibition of the
response
(
3). The finding that
ASG7 is a
pheromone-inducible gene provides
an explanation for this pattern of
signaling. When cells are first
exposed to pheromone, the
ASG7 gene product is present at a low
level that does not
affect activation of the signal transduction
pathway. As the response
proceeds, the accumulation of Asg7p results
in gradual inhibition of
signaling activity. Induction of
ASG7 RNA by pheromone in a
wild-type
MATa cell, where Asg7p
does not affect
signaling, could function to prepare the cell
for signaling inhibition
after the fusion of two mating partners,
as described
below.
Physiological role of receptor inhibition.
The results
presented here document inhibition of signaling by the 
complex
when Asg7p and the a-factor receptor are present in the same
cell. Although this situation was generated by a mutant allele in these
experiments, it occurs naturally during several transient phases of the
yeast life cycle. For example, homothallic strains of yeast undergo
mating type switching during haploid growth. During the transition from
one mating type to another, a single cell could produce both a
particular pheromone receptor and the pheromone that binds to that
receptor. This situation could activate the pheromone response pathway
and induce the expression of ASG7, resulting in the presence
of Asg7p and the a-factor receptor in the same cell.
Activation of the process of receptor inhibition would then turn off
the pheromone response pathway and allow the cell to resume cycling.
Another example of such a situation occurs immediately after fusion of
two haploid cells during the mating process. The long-term mechanism
for eliminating pheromone signaling in diploids is the establishment of
transcriptional inhibition of genes encoding components of the
pheromone response pathway. However, it is also possible that a
short-term mechanism acts to inhibit signaling in zygotes. The fusion
of two mating partners could bring Asg7p from the MATa
mating partner into contact with a-factor receptor from the
MAT
mating partner. In the newly fused zygote, both
pheromone receptors are expected to be occupied. The finding that the
occupied a-factor receptor can participate in receptor
inhibition indicates that signaling could be blocked under these
conditions. The function of receptor inhibition in this case would be
to prevent multiple rounds of mating or to allow the zygote to recover
rapidly from cell cycle arrest. In support of this idea, Roth and
colleagues have demonstrated that there is a delay in the emergence of
the first mitotic bud from zygotes in which the MATa
mating partner has a deletion of ASG7 (30).
Identification of ASG7 as an a-specific component
required for receptor inhibition provides an opportunity to test
multiple physiological conditions for their ability to be affected by
this unique process.
 |
ACKNOWLEDGMENTS |
This project was supported by Research Project Grant
RPG-96-119-03/4-MBC from the American Cancer Society (to J.P.H.) and grant GM49265 from the National Institutes of Health (to A.K.V.).
We thank J. Kurjan and I. Karpichev for providing plasmids used in this
work, J. Hirschman and D. Jenness for providing anti-Ste4p antibody, R. Tsien for providing the GFP plasmid, and F. Naider for providing
synthetic a-factor. We also thank N. Davis for communicating
results prior to publication.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Box 1007, Mount
Sinai School of Medicine, 1 Gustave Levy Place, New York, NY 10029. Phone: (212) 241-0224. Fax: (212) 860-1174. E-mail:
Jeanne.Hirsch{at}.mssm.edu.
Present address: Laboratory of Cell Biology, Howard Hughes Medical
Institute, The Rockefeller University, New York, NY 10021.
Present address: Aventis Biotechnologie, D-82152 Martinsried, Germany.
 |
REFERENCES |
| 1.
|
Bell, B.,
H. Xing,
K. Yan,
N. Gautam, and A. J. Muslin.
1999.
KSR-1 binds to G-protein  subunits and inhibits  -induced mitogen-activated protein kinase activation.
J. Biol. Chem.
274:7982-7986[Abstract/Free Full Text].
|
| 2.
|
Cole, G. M., and S. I. Reed.
1991.
Pheromone-induced phosphorylation of a G protein subunit in S. cerevisiae is associated with an adaptive response to mating pheromone.
Cell
64:703-716[CrossRef][Medline].
|
| 3.
|
Couve, A., and J. P. Hirsch.
1996.
Loss of sustained Fus3p kinase activity and the G1 arrest response in cells expressing an inappropriate pheromone receptor.
Mol. Cell. Biol.
16:4478-4485[Abstract].
|
| 4.
|
Cross, F. R.
1990.
The DAF2-2 mutation, a dominant inhibitor of the STE4 step in the -factor signalling pathway of Saccharomyces cerevisiae MATa cells.
Genetics
126:301-308[Abstract].
|
| 5.
|
Cross, F. R.
1997.
`Marker swap' plasmids: convenient tools for budding yeast molecular genetics.
Yeast
13:647-653[CrossRef][Medline].
|
| 6.
|
Cross, F. R., and A. H. Tinkelenberg.
1991.
A potential positive feedback loop controlling CLN1 and CLN2 gene expression at the start of the yeast cell cycle.
Cell
65:875-883[CrossRef][Medline].
|
| 7.
|
Dietzel, C., and J. Kurjan.
1987.
The yeast SCG1 gene: a G -like protein implicated in the a- and -factor response pathway.
Cell
50:1001-1010[CrossRef][Medline].
|
| 8.
|
Engebrecht, J.,
J. Hirsch, and G. S. Roeder.
1990.
Meiotic gene conversion and crossing over: their relationship to each other and to chromosome synapsis and segregation.
Cell
62:927-937[CrossRef][Medline].
|
| 9.
|
Gaudet, R.,
A. Bohm, and P. B. Sigler.
1996.
Crystal structure at 2.4 Å resolution of the complex of transducin  and its regulator, phosducin.
Cell
87:577-588[CrossRef][Medline].
|
| 10.
|
Gietz, R. D., and A. Sugino.
1988.
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene
74:527-534[CrossRef][Medline].
|
| 11.
|
Heim, R., and R. Y. Tsien.
1996.
Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer.
Curr. Biol.
6:178-182[CrossRef][Medline].
|
| 12.
|
Heithier, H.,
M. Fröhlich,
C. Dees,
M. Baumann,
M. Häring,
P. Gierschik,
E. Schiltz,
W. L. C. Vaz,
M. Hekman, and E. J. M. Helmreich.
1992.
Subunit interactions of GTP-binding proteins.
Eur. J. Biochem.
204:1169-1181[Medline].
|
| 13.
|
Hirsch, J. P., and F. R. Cross.
1993.
The pheromone receptors inhibit the pheromone response pathway in Saccharomyces cerevisiae by a process that is independent of their associated G protein.
Genetics
135:943-953[Abstract].
|
| 14.
|
Hirschman, J. E.,
G. S. De Zutter,
W. F. Simonds, and D. D. Jenness.
1997.
The G complex of the yeast pheromone response pathway: subcellular fractionation and protein-protein interactions.
J. Biol. Chem.
272:240-248[Abstract/Free Full Text].
|
| 15.
|
Ito, H.,
Y. Fukuda,
K. Murata, and A. Kimura.
1983.
Transformation of intact yeast cells with alkali cations.
J. Bacteriol.
153:163-168[Abstract/Free Full Text].
|
| 16.
|
Jackson, C. L.,
J. B. Konopka, and L. H. Hartwell.
1991.
S. cerevisiae pheromone receptors activate a novel signal transduction pathway for mating partner discrimination.
Cell
67:389-402[CrossRef][Medline].
|
| 17.
|
Kim, J.,
A. Couve, and J. P. Hirsch.
1999.
Receptor inhibition of pheromone signaling is mediated by the Ste4p G subunit.
Mol. Cell. Biol.
19:441-449[Abstract/Free Full Text].
|
| 18.
|
Leberer, E.,
D. Dignard,
L. Hougan,
D. Y. Thomas, and M. Whiteway.
1992.
Dominant-negative mutants of a yeast G-protein subunit identify two functional regions involved in pheromone signalling.
EMBO J.
11:4805-4813[Medline].
|
| 19.
|
Leberer, E.,
D. Y. Thomas, and M. Whiteway.
1997.
Pheromone signalling and polarized morphogenesis in yeast.
Curr. Opin. Genet. Dev.
7:59-66[CrossRef][Medline].
|
| 20.
|
Leberer, E.,
C. Wu,
T. Leeuw,
A. Fourest-Lieuvin,
J. E. Segall, and D. Y. Thomas.
1997.
Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase.
EMBO J.
16:83-97[CrossRef][Medline].
|
| 21.
|
Lee, R. H.,
J. P. Whelan,
R. N. Lolley, and J. F. McGinnis.
1988.
The photoreceptor-specific 33 kDa phosphoprotein of mammalian retina: generation of monospecific antibodies and localization by immunocytochemistry.
Exp. Eye Res.
46:829-840[CrossRef][Medline].
|
| 22.
|
Li, E.,
M. J. Cismowski, and D. E. Stone.
1998.
Phosphorylation of the pheromone-responsive G protein of Saccharomyces cerevisiae does not affect its mating-specific signaling function.
Mol. Gen. Genet.
258:608-618[CrossRef][Medline].
|
| 23.
|
Mahanty, S. K.,
Y. Wang,
F. W. Farley, and E. A. Elion.
1999.
Nuclear shuttling of yeast scaffold Ste5 is required for its recruitment to the plasma membrane and activation of the mating MAPK cascade.
Cell
98:501-512[CrossRef][Medline].
|
| 24.
|
Marcus, S.,
G. A. Caldwell,
D. Miller,
C.-B. Xue,
R. Naider, and J. M. Becker.
1991.
Significance of C-terminal cysteine modifications to the biological activity of the Saccharomyces cerevisiae a-factor mating pheromone.
Mol. Cell. Biol.
11:3603-3612[Abstract/Free Full Text].
|
| 25.
|
McCaffrey, G.,
F. J. Clay,
K. Kelsay, and G. F. Sprague, Jr.
1987.
Identification and regulation of a gene required for cell fusion during mating of the yeast Saccharomyces cerevisiae.
Mol. Cell. Biol.
7:2680-2690[Abstract/Free Full Text].
|
| 26.
|
Peter, M.,
A. M. Neiman,
H.-O. Park,
M. van Lohuizen, and I. Herskowitz.
1996.
Functional analysis of the interaction between the small GTP binding protein Cdc42 and the Ste20 protein kinase in yeast.
EMBO J.
15:7046-7059[Medline].
|
| 27.
|
Phillips, W. J., and R. A. Cerione.
1992.
Rhodopsin/transducin interactions. I. Characterization of the binding of the transducin- subunit complex to rhodopsin using fluorescence spectroscopy.
J. Biol. Chem.
267:17032-17039[Abstract/Free Full Text].
|
| 28.
|
Pitcher, J. A.,
J. Inglese,
J. B. Higgins,
J. L. Arriza,
P. J. Casey,
C. Kim,
J. L. Benovic,
M. M. Kwatra,
M. G. Caron, and R. J. Lefkowitz.
1992.
Role of  subunits of G proteins in targeting the -adrenergic receptor kinase to membrane-bound receptors.
Science
257:1264-1267[Abstract/Free Full Text].
|
| 29.
|
Pryciak, P. M., and F. A. Huntress.
1998.
Membrane recruitment of the kinase cascade scaffold protein Ste5 by the G complex underlies activation of the yeast pheromone response pathway.
Genes Dev.
12:2684-2697[Abstract/Free Full Text].
|
| 30.
|
Roth, A.,
B. Nelson,
C. Boone, and N. G. Davis.
2000.
Asg7p-Ste3p repression of pheromone signaling: regulation of the zygotic transition to vegetative growth.
Mol. Cell. Biol.
20:8815-8825[Abstract/Free Full Text].
|
| 31.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 32.
|
Sherman, F.,
G. R. Fink, and J. B. Hicks.
1989.
Laboratory course manual for methods in yeast genetics.
Cold Spring Harbor Laboratory, Plainview, N.Y.
|
| 33.
|
Sprague, G. F., Jr., and J. W. Thorner.
1992.
Pheromone response and signal transduction during the mating process of Saccharomyces cerevisiae, p. 657-744.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces: gene expression. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 34.
|
Taylor, J. M.,
G. G. Jacob-Mosier,
R. G. Lawton,
M. VanDort, and R. R. Neubig.
1996.
Receptor and membrane interaction sites on G .
J. Biol. Chem.
271:3336-3339[Abstract/Free Full Text].
|
| 35.
|
Wach, A.
1996.
PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae.
Yeast
12:259-265[CrossRef][Medline].
|
| 36.
|
Wittenberg, C., and S. I. Reed.
1996.
Plugging it in: signaling circuits and the yeast cell cycle.
Curr. Opin. Cell Biol.
8:223-230[CrossRef][Medline].
|
| 37.
|
Yoshida, T.,
B. M. Willardson,
J. F. Wilkins,
G. J. Jensen,
B. D. Thornton, and M. W. Bitensky.
1994.
The phosphorylation state of phosducin determines its ability to block transducin subunit interactions and inhibit transducin binding to activated rhodopsin.
J. Biol. Chem.
269:24050-24057[Abstract/Free Full Text].
|
| 38.
|
Zhong, H.,
R. McCord, and A. K. Vershon.
1999.
Identification of target sites of the 2-Mcm1 repressor complex in the yeast genome.
Genome Res.
9:1040-1047[Abstract/Free Full Text].
|
Molecular and Cellular Biology, December 2000, p. 8826-8835, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Arkowitz, R. A.
(2009). Chemical Gradients and Chemotropism in Yeast. Cold Spring Harb. Perspect. Biol.
1: a001958-a001958
[Abstract]
[Full Text]
-
Pizarro, F. J., Jewett, M. C., Nielsen, J., Agosin, E.
(2008). Growth Temperature Exerts Differential Physiological and Transcriptional Responses in Laboratory and Wine Strains of Saccharomyces cerevisiae. Appl. Environ. Microbiol.
74: 6358-6368
[Abstract]
[Full Text]
-
Wang, Y., Chen, W., Simpson, D. M., Elion, E. A.
(2005). Cdc24 Regulates Nuclear Shuttling and Recruitment of the Ste5 Scaffold to a Heterotrimeric G Protein in Saccharomyces cerevisiae. J. Biol. Chem.
280: 13084-13096
[Abstract]
[Full Text]
-
Laney, J. D., Hochstrasser, M.
(2003). Ubiquitin-dependent degradation of the yeast Mat{alpha}2 repressor enables a switch in developmental state. Genes Dev.
17: 2259-2270
[Abstract]
[Full Text]
-
Bar, E. E., Ellicott, A. T., Stone, D. E.
(2003). G{beta}{gamma} Recruits Rho1 to the Site of Polarized Growth during Mating in Budding Yeast. J. Biol. Chem.
278: 21798-21804
[Abstract]
[Full Text]
-
Roth, A. F., Nelson, B., Boone, C., Davis, N. G.
(2000). Asg7p-Ste3p Inhibition of Pheromone Signaling: Regulation of the Zygotic Transition to Vegetative Growth. Mol. Cell. Biol.
20: 8815-8825
[Abstract]
[Full Text]