Previous Article | Next Article 
Molecular and Cellular Biology, December 2000, p. 8845-8854, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
MondoA, a Novel Basic Helix-Loop-Helix-Leucine
Zipper Transcriptional Activator That Constitutes a Positive Branch
of a Max-Like Network
Andrew N.
Billin,1
Alanna L.
Eilers,1
Kathryn L.
Coulter,2
Jennifer S.
Logan,1 and
Donald E.
Ayer1,*
Huntsman Cancer
Institute1 and Department of Human
Genetics,2 University of Utah, Salt Lake
City, Utah 84112-5550
Received 10 July 2000/Returned for modification 29 August
2000/Accepted 12 September 2000
 |
ABSTRACT |
Max is a common dimerization partner for a family of transcription
factors (Myc, Mad [or Mxi]), and Mnt [or Rox] proteins) that
regulate cell growth, proliferation, and apoptosis. We recently characterized a novel Max-like protein, Mlx, which interacts with Mad1
and Mad4. Here we describe the cloning and functional characterization of a new family of basic helix-loop-helix-leucine zipper heterodimeric partners for Mlx termed the Mondo family. MondoA forms homodimers weakly and does not interact with Max or members of the Myc or Mad
families. MondoA and Mlx associate in vivo, and surprisingly, they are
localized primarily to the cytoplasm of cultured mammalian cells.
Treatment of cells with the nuclear export inhibitor leptomycin B
results in the nuclear accumulation of MondoA and Mlx, demonstrating that they shuttle between the cytoplasmic and nuclear
compartments rather than having exclusively cytoplasmic localization.
MondoA preferentially forms heterodimers with Mlx, and this
heterocomplex can bind to, and activate transcription from, CACGTG
E-boxes when targeted to the nucleus via a heterologous nuclear
localization signal. The amino termini of the Mondo proteins are highly
conserved among family members and contain separable and autonomous
cytoplasmic localization and transcription activation domains.
Therefore, Mlx can mediate transcriptional repression in conjunction
with the Mad family and can mediate transcriptional activation via the
Mondo family. We propose that Mlx, like Max, functions as the center of
a transcription factor network.
 |
INTRODUCTION |
The precise regulation of gene
expression during cell growth and differentiation requires active
repression and transactivation mechanisms. The Max network of basic
helix-loop-helix-leucine zipper (BHLHZip) transcription factors
clearly illustrates this point (27). Max is a dimerization
partner for the Myc family of transcriptional activators (c-Myc, N-Myc,
and L-Myc) and the Mad family of transcriptional repressors
(Mad1, Mxi1, Mad3, Mad4, and Mnt [also called Rox]) (20, 27, 29,
38). Consistent with a role in regulating proliferation and
growth, Myc-Max heterocomplexes drive cell growth and division and Myc
expression is down-regulated during cellular differentiation. By
contrast, Mad-Max complexes inhibit proliferation and are upregulated
during cellular differentiation (1, 2, 9, 23, 37).
Therefore, via the relative activities of the Myc-Max and Mad-Max
heterodimers, the Max transcription factor network is thought to
regulate growth and differentiation.
Considerable evidence supports the positive effects of the Myc family
and the negative effects of the Mad family on cell growth and
proliferation. Overexpression of Myc proteins can transform primary rat
embryo fibroblasts in cooperation with a number of oncogenes, most
notably activated Ras (27). Expression of Mad family genes
or Mnt blocks transformation by Myc plus activated Ras (14, 16,
29, 30, 34, 52). The opposing functions of the Myc and Mad
families are also observed in mice null for members of the
myc or mad family and in transgenic mice
overexpressing c-Myc or Mad1. Mouse embryos null for c-myc
arrest development at day 9.5 postcoitum (18), and N-Myc
null mice fail to fully develop the heart, lungs, and nervous system
(15, 40). By contrast, mad1 null animals have
defects in the differentiation capacity of granulocyte cluster-forming
cells (24), and mxi1 null mice show increased
proliferation in precursor cell populations of the prostatic epithelium
(48). The phenotypes generated by overexpression of
myc and mad family genes are reciprocal to those seen in the genetic null animals; c-myc overexpression in
murine B cells results in cells that are larger than normal
(31), and transgenic mice overexpressing mad1 are
smaller than normal (45). Therefore, these phenotypes are
entirely consistent with the proposed positive effects of the
myc family and the negative effects of the mad
family in regulating cell growth and differentiation. These opposing
effects of the Myc and Mad families are likely also active in
Drosophila melanogaster because flies homozygous for
hypomorphic alleles of dmyc are smaller than normal
(25) and overexpression of dmyc in wing imaginal
discs yields cells that are larger than normal (32).
Myc-Max and Mad-Max heterocomplexes both recognize the CACGTG
subclass of E-box elements; however, Myc-Max heterocomplexes activate transcription while Mad-Max complexes repress transcription (5, 9, 47). The opposing effects of Myc and Mad may manifest themselves by reciprocally regulating the expression of genes involved
in cell growth and proliferation. Consistent with this hypothesis, Myc
transcriptional targets include genes involved in metabolism (CAD,
ornithine decarboxylase, lactate dehydrogenase A, and dihydrofolate
reductase genes) and cell cycle progression (cyclin A, cyclin D2,
cyclin E, and telomerase genes) (13, 17, 26, 44).
Furthermore, Mxi1 can downregulate ornithine decarboxylase expression
(55), and cyclin D2-associated kinase activity is dramatically reduced in fibroblasts that overexpress Mad1
(45).
Several experiments suggest that Myc and Mad family proteins utilize
Max to activate or repress transcription. Yeast two-hybrid, DNA
binding, and coprecipitation assays all demonstrate that Myc and Mad
proteins form homodimers poorly but readily form heterodimers with Max.
Mutations that prevent the formation of Myc-Max or Mad-Max heterodimers
block the ability of Myc or Mad proteins to activate or repress
transcription, respectively. Max proteins with mutations in the basic
region function in a dominant-negative manner to block the
transcriptional activities of both Myc and Mad proteins (for examples
and review, see references 7, 11, 12, 27, 42, and
53). Therefore, Max is a cofactor utilized by the Myc and Mad proteins to bind DNA and produce changes in gene expression.
We recently characterized a new Max-like BHLHZip protein called Mlx
(Max-like protein X) that also forms functional heterodimers with Mad1
(10). Database searches revealed that the Mlx BHLHZip domain
is most similar to that of Max. In addition, Mlx shares many
biochemical properties with Max. Like Max, Mlx forms homodimers poorly
and has no intrinsic transcriptional activity. Mlx and Mad1 readily
form heterodimers that bind the CACGTG subclass of E-boxes.
Like Mad1-Max heterocomplexes, Mad1-Mlx heterocomplexes repress
transcription by a mechanism that depends on the recruitment of the
mSin3A-histone deacetylase corepressor complex. These findings, and the
sequence similarity of Mlx and Max, suggest that Mlx also functions as
the center of a transcription factor network. Similar to the Max
network, the Mad family constitutes the negative side of the proposed
Mlx network. However, Mlx does not interact with members of the Myc
family (10). Therefore, we proposed that the Mlx network
might have a positive side composed of new transcriptional activators.
In this study, we describe the cloning of a novel BHLHZip
heterodimerization partner for Mlx that constitutes the positive side
of the Mlx network. Because of the large size of the mRNA and the
protein product, we have called this new protein MondoA. We find that
Mlx and MondoA localize to the cytoplasm in cultured mammalian cells
but shuttle through the nucleus. Despite their cytoplasmic
localization, MondoA-Mlx heterocomplexes activate transcription
from CACGTG-dependent reporters when targeted
to the nucleus. Structure-function analysis of a Mondo family member, MondoA, identified a conserved region in the amino terminus that contains separable transcriptional activation and subcellular localization domains. Therefore, like Max, Mlx can mediate the transcriptional activities of at least two families of transcriptional regulators and as such is likely to function as the center of a
transcription factor network.
 |
MATERIALS AND METHODS |
Two-hybrid screening.
The entire open reading frame of human
Mlx (10) was cloned into pBTM116 to generate a LexA-Mlx
fusion. LexA-Mlx was introduced into the L40 yeast strain and was used
to screen a cDNA library constructed from 9.5 and 10.5 embryos
(28) as previously described (8, 10).
Cloning human mondoA and invertebrate
mondo homologues.
The open reading frame of human
mondoA contains a GC-rich region that is not efficiently
reverse transcribed. In order to obtain clones for this region, cDNA
libraries were constructed with double-selected mRNA prepared from K562
cells with oligo(dT) or random hexamers as primers, and the
double-stranded cDNA was size selected for molecules larger than 1 kb.
The cDNA was ligated into pCDNA3 (Invitrogen), and primary clones were
arrayed in 96-well plates with an average density of 100 per well. The
pools were spotted in duplicate onto nylon membranes at high density
and then screened using conventional 32P-labeled DNA
probes. In addition, three minilibraries were constructed using
gene-specific primers. A total of 6 million clones were screened to
obtain three overlapping cDNAs used to reconstruct the open reading
frame. The full-length MondoA cDNA was cloned into both pcDNA3
(Invitrogen) and pcDNA3.1/V5 (Invitrogen) in frame with the V5 epitope.
P1 clones for mondoA and mondoB were obtained by
screening a human P1 library (Genome Systems) with random-primed
32P-labeled fragments of the respective cDNAs. The
chromosomal localization of the human mondo genes was
determined by in situ hybridization using the P1 clones as probes and
was performed by Genome Systems. The chromosomal localization of
mondoB was confirmed by the recent completion of the draft
sequence of the human genome (GenBank accession no. AC073846).
The Caenorhabditis elegans mondo homologue is located on
cosmid T20B12. The predicted open reading frame obtained from A
Caenorhabditis elegans Data Base, or ACeDB, differs from the
open reading frame deduced by sequencing cDNAs (kindly provided by Y. Kohara). The dmondo gene was identified by BLAST searches
(using mondoA as the query) of the Berkeley
Drosophila Genome Project expressed sequence tag (EST) and
genomic sequence database. The open reading frame was deduced by
sequencing the ESTs LD31826 (which contains the initiating ATG and
stops in all three upstream reading frames) and LD27794 (which is a
partial cDNA). All cDNAs were obtained from the Berkeley
Drosophila Genome Project.
Expression analysis.
Northern blot analysis was performed by
probing adult tissue blots (Clontech) with random-primed
32P-labeled mondoA and mondoB probes
at high stringency. There was no cross-reactivity between the
mondoA and mondoB probes.
Transcription assays.
Luciferase reporter assays and cell
transfections were performed in triplicate, with the error given as the
standard error of the mean as previously reported (10).
Transfection efficiency was normalized by cotransfection of a LacZ
expression plasmid. Mutant derivatives of mlx and
mondoA were made using PCR with TurboPFU (Stratagene) and
were verified by sequencing. Gal4 DNA binding domain (Gal4DBD) fusions
were made in the vector pFA (Stratagene). The sequence of the
simian virus (SV40) large T antigen is MAPKKKRKV.
Antibodies and protein interaction assays.
Antibodies
against Mlx were directed against the carboxy terminus of the protein
(10). Antibodies against a glutathione S-transferase (GST) fusion of the BHLHZip domain of murine
MondoA were raised in rabbits. The specificity of the antiserum was
tested by immunoprecipitating in vitro-translated
[35S]Met-labeled MondoA with or without blocking antigen.
Bleeds were also tested for their ability to immunoprecipitate MondoA from [35S]Met-labeled P19 cells. Indirect
immunofluorescence was performed using standard procedures
(4). Anti-FLAG (Sigma), -V5 (Invitrogen), and -Gal4 (Santa
Cruz) monoclonal antibodies were used at 1:500. Rabbit polyclonal
anti-MondoA and anti-Mlx antibodies were used at 1:500. Fluorescein
isothiocyanate-conjugated sheep anti-mouse (Jackson ImmunoResearch
Laboratories) and Alexa 594 goat anti-rabbit (Molecular Probes)
antibodies were used at 1:500 to detect the primary antibodies. Cells
were analyzed 24 h after transfection. To quantify staining
patterns, each transfection was performed at least twice in duplicate
and scored blind. The cells were counterstained with Hoechst 33342 (5 µg/ml) to discriminate nuclei, and only cells expressing both
proteins were counted. A minimum of 50 cells were counted for each
transfection. The cells were treated with 10 ng of leptomycin B (kindly
provided by M. Yoshida)/ml for 10 h.
Immunoprecipitations and Western blotting were carried out as
previously described with the following modifications (6, 36). Cytoplasmic fractions were prepared by resuspending cell pellets in buffer H (10 mM Tris-HCl [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 1 mM dithiothreitol, 0.1% NP-40, and "complete"
protease inhibitor) (Boehringer Mannheim/Roche), vortexing them
briefly, and incubating them for 10 min on ice. Nuclei were pelleted
for 7 min at 2,000 × g and 4°C in a Sorvall tabletop
centrifuge. Following a second wash in buffer H, the supernatants were
pooled and centrifuged for 10 min at 10,000 × g and
4°C. The protein concentrations of the supernatants were determined
by Bradford assay. Anti-Mlx immunoprecipitation was carried out on 3 mg
of total cytoplasmic protein in buffer H plus 175 mM KCl. Western blots
of precipitations were probed with anti-Mlx amino terminus (1:1,000) or
anti-MondoA (1:500) antiserum.
Far-Western blots were performed by first transferring proteins
separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to polyvinylidene difluoride (PVDF) membranes and incubating the membranes in a blocking solution (1× phosphate-buffered saline, 1 mM dithiothreitol, 5% nonfat dry milk, 0.2% NP-40, 10% glycerol) for
1 h at room temperature. Next, the membranes were incubated in the
same solution with 1% nonfat dry milk mixed with a single 50-µl TNT
(Promega) in vitro translation reaction programmed to produce
[35S]Met-labeled Mlx protein. The blot was incubated for
4 h at 4°C and then washed extensively (six times over an hour)
with block solution without nonfat dry milk. The blot was dried and
autoradiographed from overnight to 4 days with a Low Energy Biomax
Transcreen (Kodak). Gel shift assays were performed as described
previously (7) with a 32P-labeled CACGTG
oligonucleotide and in vitro-translated Mlx or
LZMlx used in
combination with a purified GST fusion protein containing the BHLHZip
domain of MondoA.
DNA pulldown reactions were carried out in buffer H plus 175 mM KCl.
Three milligrams of total cytoplasmic protein was incubated with
biotinylated double-stranded oligonucleotide DNA (25 nM in a total
volume of 500 µl) for 20 min at room temperature. DNA-protein complexes were precipitated by incubation with UltraLink Neutravidin beads (25 µl of a 50% slurry) (Pierce) for 30 min at 4°C with rocking. Following incubation, the beads were washed four times in 1 ml
of buffer H plus 175 mM KCl and then resuspended in SDS-PAGE sample
buffer. The oligonucleotide pair sequences were wild-type CM1 and
Biotin (GATCCCCCCACCACGTGGTGCCTG and
GATCCAGGCACCACGTGGTGGGGG), and mutant CM1 and
Biotin (GATCCCCCCACCACCTGGTGCCTG and
GATCCAGGCACCAGGTGGTGGGGG) (underlining marks the
E-box core sequence).
Nucleotide sequence accession numbers.
GenBank accession
numbers for H. sapiens MondoA, C. elegans Mondo,
and D. melanogaster Mondo are AF312918, AAA19059, and
AAF53988, respectively. H. sapiens MondoB is identical to
the recently described putative hepatic transcription factor WBSCR14
(19). The accession number for WBSCR14 is AAF68174.
 |
RESULTS |
Cloning and characterization of a novel Mlx-binding protein.
Like Max, Mlx may function as a dimerization partner for many
transcription factors. To determine if we could identify additional Mlx-interacting proteins, Mlx was immunoprecipitated from P19 cells
under nondenaturing conditions and the immunoprecipitates were resolved
by SDS-PAGE and transferred to PVDF membranes. The membranes were
probed with [35S]methionine-labeled Mlx protein
(far-Western blotting). A prominent and specific polypeptide of
approximately 130 kDa was detected (Fig.
1A). Further, this protein was not
detected in immunoprecipitates incubated with the cognate Mlx antigen
(Fig. 1A, Block), demonstrating that it associated specifically with
Mlx. Thus, Mlx appears to directly associate with at least one protein
in P19 cells.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 1.
Identification and cloning of an Mlx-binding protein.
(A) Mlx and associated proteins were immunoprecipitated from whole-cell
extract with Mlx antibodies and probed in a far-Western blot with
[35S]Met-labeled Mlx. The arrow indicates an ~130-kDa
Mlx-binding protein. Block, incubation (+) of the antibody with cognate
antigen as a control for the specificity of the immunoprecipitation
reaction. (B) Alignment of the BHLHZip domain of MondoA with Mlx and
members of the Max network. Conserved residues in the basic region
predicted to dictate binding to CACGTG are marked by dots,
as are the hydrophobic amino acids that make up the leucine zipper. The
dashes indicate gaps in the aligned sequences. (C) Expression of
mondoA in adult human tissues as determined by Northern blot
analysis (Sk. muscle, skeletal muscle; PBL, peripheral blood
lymphocytes). (D) Domain diagram of the MondoA protein. The percentages
of amino acid identity between MondoA and D. melanogaster
Mondo (dMondo), C. elegans Mondo (cMondo), and H. sapiens Mlx are shown. The serine-threonine-proline (STP) rich
domain is shaded. The TAD is within the STP domain.
|
|
In order to clone Mlx-binding proteins, we carried out a yeast
two-hybrid screen using full-length Mlx as bait. Approximately 107 primary transformants were obtained from a day 9.5 and
10.5 mouse embryo random-primed VP16 fusion cDNA library. Of these
transformants, 40 colonies scored positive in the interaction assay.
One of the colonies contained a VP16-Mad4 fusion clone, a previously
known Mlx-binding partner (10). The remaining 39 clones
harbored a novel BHLHZip domain. This BHLHZip domain is homologous
to members of the Max family, and it is most similar to the BHLHZip
domain of Mlx (Fig. 1B). The 13-amino-acid basic region contains the conserved residues required for high-affinity binding to CACGTG E-boxes (His5, Glu9, and Arg13) and is therefore predicted to bind to this DNA sequence (3, 21, 22). To determine whether this new BHLHZip domain could interact with members of the Max network,
we tested it for interaction with Max, c-Myc, L-Myc, N-Myc, Mad1, Mxi,
Mad3, and Mad4 in a directed two-hybrid assay. None of these Max
network proteins interacted significantly with the new BHLHZip domain
(data not shown), suggesting that it dimerizes specifically with Mlx
but not with members of the Max network.
Northern blot analysis demonstrated that the transcript encoding this
BHLHZip protein is approximately 9 kb in length, with a minor
transcript of approximately 5.5 kb (Fig. 1C and data not shown). We
termed this new gene mondoA. Expression of mondoA
is highest in skeletal muscle, but it is expressed in most adult tissues (Fig. 1C). Subsequent database searches uncovered an EST encoding a portion of another mondo family member,
mondoB. Northern blot analysis of mondoB
expression revealed a broadly expressed transcript of approximately 4 kb (data not shown). Therefore, the 5.5-kb transcript detected with the
mondoA probe is unlikely to be mondoB. In situ
hybridization of mouse embryos with mondoA showed that the
transcript is broadly expressed from day 9.5 to at least day 15 postcoitum, with slightly elevated levels in the developing central
nervous system (data not shown). The chromosomal localizations of human
mondoA (mondoA) and human mondoB
(mondoB) were determined by in situ hybridization.
The mondoA and mondoB genes are located at
12q21.31 and 7q11.23, respectively. Williams syndrome, which has
complex clinical features, including supravalvular aortic stenosis,
impaired visual-spatial constructive cognition, mental retardation, and
infantile hypercalcemias, is caused by a contiguous-genome deletion of
greater than 1 Mb at 7q11.23 (50). This deletion results in
the loss of one allele of the mondoB locus (19),
suggesting that haploinsufficiency of mondoB may contribute
to the disease.
We cloned and sequenced the complete open reading frame of
mondoA. To facilitate the identification of functional
domains, we also cloned mondo homologues from D. melanogaster and C. elegans. MondoA is approximately
23% identical and 35% similar over its entire length to its homologs
from D. melanogaster and C. elegans (data not
shown). A domain map of MondoA is shown in Fig. 1D. The open reading
frame codes for a 919-amino-acid protein. The amino terminus is
conserved among all members of the mondo family but has no
sequence homology to other known proteins (Fig. 1D). We have termed
this region the mondo-specific region, or MSR. A
serine-threonine-proline-rich region (12% serine, 12% threonine, and
19% proline) follows the MSR in MondoA (Fig. 1D). The BHLHZip region is located in the carboxy-terminal third of the protein. The
BHLHZip region is followed by a region in the carboxy terminus that has
homology to the carboxy-terminal region of Mlx (10). The
function of this region is not yet known, but its conservation suggests
that mlx and mondo genes may have a common
evolutionary ancestry. The analysis described in this report focuses on
the human MondoA protein.
To determine whether MondoA associates with Mlx at normal physiological
concentrations, whole-cell extracts from P19 cells were
immunoprecipitated with Mlx antibodies and analyzed by far-Western blotting as shown in Fig. 1. Consistent with the previous result, a
single specific band was detected (Fig. 2A, left
gel). To determine whether this
Mlx-binding protein was MondoA, the same membrane was reprobed with
antibodies specific for the BHLHZip domain of MondoA. A band that
migrated similarly to that of the Mlx-binding protein was detected by
anti-MondoA antibodies (Fig. 2A, right gel), demonstrating that the
Mlx-binding protein is MondoA. Together, these data demonstrate that
under physiological conditions, MondoA-Mlx heterodimers exist in P19
cells.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 2.
Mlx and MondoA associate in the cytoplasm. (A) Mlx
immunoprecipitates were resolved on SDS gels and transferred to a PVDF
membrane, and the blot was sequentially probed with
35S-labeled Mlx (left) or anti-MondoA (right) antiserum.
Block, incubation of the antibody (+) with cognate antigen as a control
for the specificity of the immunoprecipitation reaction. (B) Nuclear
(N) and cytoplasmic (C) compartments were prepared by hypotonic lysis,
immunoprecipitated with Mlx antibodies, and probed in a far-Western
blot with [35S]Met-labeled Mlx (left) or anti-MondoA
(right) antiserum. An ~130-kDa band is detected in the cytoplasmic
fraction (arrow). (C and D) Nuclear and cytoplasmic fractions were
immunoprecipitated with Mlx (C) or mSin3 (D) antibodies, and the
immunoprecipitates were examined by Western blotting with Mlx or mSin3A
antibodies.
|
|
We also determined the subcellular localization of MondoA in P19 cells
by far-Western blotting. Nuclear and cytoplasmic fractions were
prepared and immunoprecipitated with Mlx antibody. Surprisingly, the
Mlx-binding activity of MondoA was found in the cytoplasm (Fig. 2B).
This result suggested that Mlx might also be localized to the
cytoplasm. To test this idea, Mlx was immunoprecipitated from
cytoplasmic or nuclear extracts and detected by Western blotting. The
majority of Mlx protein was also in the cytoplasmic fraction, with
small amounts present in the nuclear fraction (Fig. 2C). In contrast,
mSin3A, a known nuclear protein, was found primarily in the nuclear
fraction, with only small amounts localized in the cytoplasmic fraction
(Fig. 2D). A similar analysis demonstrated that Mlx is primarily
restricted to the cytoplasm of HL60, K562, and PC12 cells (data not shown).
MondoA binds CACGTG E-boxes and activates
transcription.
MondoA and Mlx heterodimerize and are predicted,
based on primary amino acid sequence, to bind CACGTG E-box
sequences. To determine whether P19 cells contained E-box-binding
activity associated with MondoA-Mlx heterodimers, P19 cytoplasmic
extracts were incubated with double-stranded CACGTG
oligonucleotides immobilized on beads and, following extensive
washing, retention of MondoA-Mlx heterodimers on the DNA beads was
determined by Western blotting. Both Mlx and MondoA were retained on
the wild-type oligonucleotide beads (Fig. 3A, lanes 2 and
6) but not on the mutant control
oligonucleotide beads (Fig. 3A, lanes 3 and 7). In addition, a positive
control immunoprecipitation of cytoplasmic extracts with Mlx antibody also coimmunoprecipitated Mlx and MondoA (Fig. 3A, lanes 1 and 5).
Therefore, MondoA-Mlx heterodimers can be isolated by
immunoprecipitation, and both MondoA and Mlx can be isolated by using
immobilized CACGTG binding sites. These results suggest that
the DNA binding activity is a heterocomplex of Mlx and MondoA;
however, it is possible that Mlx and MondoA homodimers are also
present in the cytoplasm and the observed DNA binding resulted from
homodimer rather than heterodimer binding.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Mlx and MondoA interact in vivo and bind CACGTG
sequences as heterodimers. (A) Cytoplasmic extracts of P19 cells
were incubated with either CACGTG E-box (W.T. CM1) or mutant
E-box CACCTG (Mut CM1) oligonucleotides immobilized on
agarose beads. As a control, cell extracts were also precipitated with
-Mlx (IP Mlx). The arrow indicates MondoA (left) or Mlx (right). (B)
EMSA was used to show specific dimerization and DNA binding by MondoA
and Mlx. Proteins in the indicated combinations were bound to a
32P-labeled oligonucleotide containing a single CACGTG
binding site. LZMlx lacks the leucine zipper and cannot
heterodimerize with Mondo. RL, reticulocyte lysate alone. On the right,
MondoA-Mlx heterocomplexes were incubated with either preimmune or
antiMlx/GST serum. The asterisk indicates the supershifted
heterocomplex. +, present.
|
|
To test whether MondoA-Mlx heterodimers are favored over homodimers of
either protein, an electrophoretic mobility shift assay (EMSA) was
performed using a recombinant GST fusion protein containing the BHLHZip
domain of MondoA and in vitro-translated Mlx. Previous results have
demonstrated that Mlx homodimerizes poorly (10), and we
obtained similar results (Fig. 3B, lane 2). Under the conditions used,
MondoA formed homodimers weakly on the CACGTG probe (Fig. 3B, lane 4). However, Mlx and MondoA formed a specific complex that
migrated with lower mobility than MondoA homodimers, indicating the
formation of heterodimers (Fig. 3B, lane 5). Antibodies against Mlx and
GST, which recognize the GST portion of the GST-Mondo fusion protein,
completely supershift the heterodimer, confirming the presence of both
proteins in the complex (Fig. 3B, right, and data not shown). A mutant
Mlx protein lacking its leucine zipper (
LZMlx) could not
heterodimerize with MondoA (Fig. 3B, lane 6). Thus, Mlx and MondoA bind
DNA as heterodimers, and heterodimerization requires the leucine zipper
of Mlx. Furthermore, the EMSA data suggest that MondoA-Mlx heterodimers
are preferred over homodimers of either protein. Together, these
experiments suggest that the cytoplasmic DNA binding activity is
composed primarily of MondoA-Mlx heterodimers as opposed to homodimers
of either MondoA or Mlx.
Our biochemical fractionation (Fig. 2B and data not shown) suggests
that Mlx and MondoA are localized primarily to the cytoplasm. The high
degree of evolutionary conservation in the BHLHZip domains of both
MondoA and Mlx, however, strongly suggests that they function in the
nucleus to regulate gene expression. It is possible that MondoA-Mlx
heterodimers are retained in the cytoplasm and only translocate to the
nucleus in response to extracellular signaling or that they enter the
nucleus but are rapidly exported. If the latter is true, it would be
expected that the heterodimer would not accumulate to high levels in
the nucleus at steady state. To test whether MondoA-Mlx heterodimers
are actively exported from the nucleus, we transfected NIH 3T3 cells,
which do not express significant amounts of MondoA or Mlx (data not
shown), with expression vectors encoding FLAG-tagged Mlx and MondoA and
treated them with the nuclear export inhibitor leptomycin B (35,
54). MondoA and Mlx subcellular localization was monitored by
indirect immunofluorescence, and we quantified the effect of leptomycin
B by determining the percentage of cells that displayed exclusively
cytoplasmic, nuclear, or equivalent cytoplasmic and nuclear staining.
As expected, MondoA and Mlx were localized almost exclusively to the
cytoplasm in untreated cells (Fig. 4). By
contrast, leptomycin B treatment resulted in a dramatic relocalization
of MondoA and Mlx to the nucleus (Fig. 4C). Therefore, consistent with
a role for MondoA-Mlx heterodimers in transcriptional regulation, they
are not exclusively cytoplasmic proteins but rather are present
transiently in the nucleus.

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 4.
Mlx and Mondo shuttle between the cytoplasmic and
nuclear compartments. Expression vectors encoding FLAG-tagged Mlx and
MondoA were transfected into NIH 3T3 cells. Their subcellular
localization was determined by indirect immunofluorescence using
anti-FLAG and anti-MondoA antibodies. (A and B) Two representative
cells coexpressing Mlx and Mondo, respectively. (C) The subcellular
distribution of Mlx and MondoA was quantified in the absence or
presence (+) of leptomycin B. Nuc, nuclear; Cyto, cytoplasmic. The
error bars indicate standard deviations.
|
|
To test the transcriptional activity of MondoA-Mlx heterodimers, we
sought to artificially target them to the nucleus. To do so, we fused
the strong nuclear localization signal (NLS) of SV40 large T antigen to
the amino terminus of Mlx (NLSMlx). We initially determined the
subcellular localization of MondoA and NLSMlx by immunofluorescence as
described above. In contrast to wild-type MondoA and Mlx (Fig. 4),
NLSMlx and coexpressed MondoA localized almost exclusively to the
nucleus (Fig. 5A). The nuclear colocalization of MondoA and NLSMlx provides further evidence for their
in vivo interaction. To determine the transcriptional activity of
MondoA-Mlx heterodimers, we transfected NIH 3T3 cells with MondoA, Mlx,
or NLSMlx expression vectors along with a luciferase reporter gene
containing four CACGTG binding sites. Expression of Mlx,
NLSMlx, MondoA alone, or the combination of Mlx and MondoA did not
appreciably affect reporter gene expression. However, coexpression of
MondoA with NLSMlx resulted in a fourfold increase in reporter gene
expression (Fig. 5B). Mlx does not possess intrinsic transcriptional
activity (10); hence, the transcriptional activation domain
(TAD) must be supplied by MondoA. Transcriptional activation depended
on the presence of E-box sites in the reporter, the DNA binding
activity of Mlx, and the leucine zipper of Mlx (data not shown).
Therefore, even though MondoA-Mlx heterodimers are predominantly cytoplasmic, they activate transcription when redistributed to the
nucleus.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
Nuclear-targeted MondoA-Mlx is a transcriptional
activator. (A) V5 epitope-tagged Mondo and NLSMlx were transfected into
NIH 3T3 cells, and their subcellular localization was determined and
quantified by immunofluorescence. MondoA and Mlx were detected using
anti-V5 and anti-Mlx, respectively, as the primary antibodies. (B)
Transient-transfection assays were performed to determine the
transcriptional activities of NLSMlx and MondoA on CACGTG
E-boxes in NIH 3T3 cells. The cells were transfected with 0.5 µg of Mlx, NLSMlx, or MondoA in the combinations shown, along with a
luciferase reporter containing four CACGTG binding sites.
The results are shown as fold activation, and the error is expressed as
the standard error of the mean. +, present; Nuc, nuclear; Cyto,
cytoplasmic.
|
|
Identification of a CLD in MondoA.
To investigate the
subcellular localization of MondoA-Mlx heterodimers, we sought to
identify domains in MondoA that regulate their cytoplasmic
localization. Mondo proteins contain a unique and highly conserved
amino terminus (MSR [Fig. 1D]); therefore, we thought it might be
involved in regulating subcellular localization. A series of MondoA
amino-terminal truncation mutants,
N224,
N322, and
N445
(diagramed in Fig. 6A), were each
coexpressed with Mlx in NIH 3T3 cells, and the subcellular localization
of both proteins was quantified by immunofluorescence as described
above. Data from a minimum of 100 cells were obtained from
two independent transfections. As before, both Mlx and
MondoA localized to the cytoplasm of coexpressing cells (Table
1 and Figure 4). However, when Mlx
was coexpressed with either
N445MondoA or
N322MondoA, Mlx
and each MondoA protein localized to the nucleus (Table 1). Therefore, the sequences in MondoA that regulate localization of
MondoA-Mlx heterocomplexes are located amino terminal to residue 322. By contrast, coexpression of Mlx and
N224MondoA resulted in their
equivalent distribution to both the nucleus and cytoplasm (Table 1).
Thus, the
N224MondoA mutant partially restores cytoplasmic localization. Therefore, these data suggest that amino acids 224 to 322 of MondoA function as a cytoplasmic localization domain (CLD), although
additional sequences upstream of amino acid 224 are required for full
cytoplasmic localization.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 6.
The amino terminus of MondoA contains an autonomous
transcriptional domain. (A) Diagram illustrating the amino-terminal
MondoA deletions. hMondoA, human MondoA. (B) The amino-terminal
deletion series of MondoA was tested for transcriptional activation
when coexpressed with Mlx. The subcellular localization of coexpressed
Mlx and MondoA is indicated. (C) Amino acids 322 to 445 of MondoA were
fused to the Gal4DBD and tested for activity in NIH 3T3 cells using a
luciferase reporter gene containing the thymidine kinase promoter and
four Gal4 binding sites. Gal4DBD (450 ng), Gal4-c-Jun (450 ng), or
increasing amounts (50, 150, and 450 ng) of Gal4DBD(332-445)MondoA were
transfected. The results are shown as fold activation, and the error is
expressed as the standard error of the mean. +, present; , absent.
|
|
To determine if the amino terminus of MondoA could function as a CLD in
the context of a heterologous protein, different regions of the amino
terminus were fused to the Gal4DBD. Consistent with the finding that
the Gal4DBD has an NLS, it localized to the nucleus in approximately
85% of cells (Table 2). By contrast, a
fusion of the Gal4DBD to amino acids 82 to 445 of MondoA
[Gal4DBD(82-445)MondoA] localized to the cytoplasm in 100% of the
expressing cells. Therefore, amino acids 82 to 445 can completely
override the activity of the Gal4 NLS, demonstrating that the CLD of
MondoA is portable. Furthermore, fusion of the SV40 large-T-antigen NLS
to Gal4DBD(82-445)MondoA did not result in a predominant nuclear
localization of the chimera. Therefore, even multiple NLSs cannot
completely overcome the activity of the CLD. A fusion between amino
acids 125 to 321 of MondoA and Gal4DBD was almost completely
cytoplasmic, further delineating the CLD. Amino acids 125 and 321 are
in the evolutionarily conserved MSR (Fig. 1D), suggesting that
cytoplasmic localization of the Mondo family is a conserved aspect of
their function.
Identification of an autonomous activation domain in
MondoA.
MondoA-Mlx heterodimers activated transcription
when targeted to the nucleus (Fig. 5B). In order to map the
transactivation domain, we tested the MondoA amino-terminal
deletions, which, when coexpressed with Mlx, localized to the
nucleus, for their ability to regulate a CACGTG E-box
reporter gene. Expression of each of these proteins alone did not
significantly affect expression of the reporter gene (Fig. 6B).
Similarly, expression of either MondoA or
N445MondoA with Mlx did
not alter the expression of the reporter gene (Fig. 6B). As before
(Fig. 5), Mlx and full-length MondoA localized to the cytoplasm and did
not activate transcription. By contrast, Mlx and
N445MondoA
localized to the nucleus (Table 1), suggesting that the first 445 amino
acids of MondoA contain both a transactivation domain and the CLD.
Strikingly, nuclear localization of Mlx and
N322MondoA (Table 1)
resulted in an approximately sevenfold increase in reporter
gene expression (Fig. 6B), demonstrating the presence of an
activation domain between amino acids 322 and 445. Coexpression
of Mlx and
N224MondoA resulted in approximately threefold activation
of the reporter gene, lower than that of
N322MondoA (Fig. 6B).
Coexpressed Mlx and
N224MondoA localized to the nucleus and
cytoplasm (Table 1), suggesting that the reduction in transactivation
seen for
N224MondoA results from a decrease in nuclear localization.
Therefore, the amino terminus of MondoA contains a transactivation
domain between amino acids 322 and 445.
To test whether amino acids 322 to 445 of MondoA could function as an
autonomous activation domain, they were fused to the Gal4DBD and this
chimera was tested for its ability to activate a herpes simplex virus
thymidine kinase promoter that contains four Gal4 binding sites.
Expression of the Gal4DBD alone resulted in little transcriptional
activation, while Gal4-c-Jun, a control transcriptional activator,
activated transcription approximately 50-fold. Gal4DBD(322-445)MondoA
activated transcription 200- to 700-fold, depending on the amount
of expression plasmid transfected (Fig. 6C). This
Gal4- MondoA fusion also activated transcription to a
similar extent from a minimal promoter under the control of four Gal4
binding sites (data not shown). Therefore, the amino-terminal region of
MondoA contains an autonomous activation domain between amino acids 322 and 445.
 |
DISCUSSION |
Previously, we identified the novel Max-like protein Mlx. Here we
describe the novel partner protein for Mlx, termed Mondo. The predicted
primary amino acid sequence of the MondoA protein reveals a large
BHLHZip protein with two regions of sequence similarity at the amino-
and carboxy-terminal regions that are conserved among Homo
sapiens, D. melanogaster, and C. elegans
mondo homologues. The carboxy-terminal conserved domain is
striking because it is conserved among all of the mondo and
mlx family members. This suggests that mlx and
mondo genes may have a common evolutionary ancestor and that
this region may be crucial for aspects of Mlx and Mondo function. The
amino terminus of the MondoA protein has at least two functional
domains, one that regulates cytoplasmic localization of MondoA-Mlx
heterocomplexes and another involved in transactivation (see below).
Thus, the mlx and mondo genes form a new family
of cytoplasmically localized BHLHZip transcription factors.
Several lines of evidence support the physiological relevance of the
interaction between MondoA and Mlx. First, 39 of 40 positive clones in
our two-hybrid screen to detect Mlx-interacting proteins included the
BHLHZip domain of murine MondoA. Second, murine MondoA did not interact
with other members of the Max network in a directed two-hybrid screen.
Third, MondoA-Mlx heterodimers bound specifically to CACGTC
sites and activated transcription from
CACGTG-dependent reporters in a manner that required
dimerization and DNA binding. Fourth, MondoA and Mlx localize to the
cytoplasm and redistribute to the nucleus together. Finally, we have
detected association between MondoA and Mlx in cytoplasmic extracts of
P19 cells by coimmunoprecipitation and DNA pulldown assays. Together,
these experiments provide compelling evidence that MondoA-Mlx
heterocomplexes exist in vivo.
Regulated nuclear import of many transcription factors is a
well-established biological control mechanism (51).
MondoA-Mlx heterodimers localize predominantly to the cytoplasm;
however, we propose that these proteins function in the nucleus. Our
strongest experimental support for this proposal comes from
targeting the heterocomplex to the nucleus with a strong NLS grafted
onto the amino terminus of Mlx. The targeted heterocomplex activated
transcription from CACGTG-driven reporter genes. We
have not yet identified the conditions or cell types in which wild-type
MondoA-Mlx heterocomplexes accumulate in the nucleus, and therefore it
is possible that the transcriptional activation attributed to
MondoA resulted from artificial nuclear targeting. However, as we
observed both nuclear localization and transcriptional activation with
wild-type Mlx and a MondoA mutant that lacks the CLD (
322MondoA), it
is unlikely that the 9-amino-acid NLS supplies an artificial activation
domain to Mlx. Furthermore, additional evidence supports a nuclear
function for MondoA-Mlx heterodimers: (i) MondoA-Mlx heterodimers
shuttle through the nucleus and therefore are not constitutively
cytoplasmic proteins, (ii) the DBDs of both MondoA and Mlx are highly
conserved across species and are capable of specific CACGTG
binding, and (iii) the amino terminus of MondoA has a potent
autonomous TAD. Therefore, we propose that MondoA-Mlx heterocomplexes
function as transcriptional activators whose nuclear activity is under tight control via their cytoplasmic localization. A signal(s), as yet
unidentified, may be required to redistribute the heterocomplex from
the cytoplasm to the nucleus. Alternatively, MondoA-Mlx
heterodimers may shuttle rapidly through the nucleus and not reach
high levels at steady state. We are attempting to distinguish
between these two mechanisms.
While we propose a nuclear function for Mondo-Mlx heterodimers, we
cannot rule out the possibility that the heterocomplex has additional
activities in the cytoplasm. A cytoplasmic function for MondoA might
include the sequestration of Mlx, which would limit the access of Mlx
to other nuclear dimerization partners, such as Mad1 and Mad4. When
expressed on its own, however, Mlx localized to the cytoplasm (A. L. Eilers, unpublished data), suggesting that cytoplasmic localization
of Mlx is an intrinsic property and is independent of Mondo. However,
at this time we cannot rule out a dominant-negative role for MondoA in
regulating the access of Mlx to as-yet-unidentified transcription
factors. Mondo-Mlx heterodimers may have cytoplasmic functions, but as
our evidence points strongly to a nuclear function for the
heterocomplex, it seems unlikely that it has exclusively cytoplasmic functions.
Other members of the Max network BHLHZip superfamily are primarily
nuclear but can also be regulated by subcellular localization, and thus
this type of regulation is not unique to Mlx and Mondo. For example,
though c-Myc is usually nuclear, it is sequestered in the cytoplasm of
Purkinje cells via an interaction with the CDR-2 protein. This
interaction is thought to block c-Myc-induced cell death in Purkinje
cells (43).
To decipher the regulation of cytoplasmic localization by Mondo-Mlx
heterodimers, we identified a CLD in MondoA. The CLD (amino acids 125 to 321) provides a strong cytoplasmic localization signal that is
capable of overriding the activity of both Gal4 and the SV40
large-T-antigen NLS. Treatment of cells with leptomycin B resulted in
the nuclear accumulation of Mlx and MondoA. Leptomycin B is an
inhibitor of CRM-dependent nuclear export (54),
suggesting that the CLD of MondoA functions via a known export pathway
to maintain MondoA-Mlx heterocomplexes in the cytoplasm. The CLD does not show obvious sequence similarity to known export signals (39, 41) and likely constitutes a novel regulatory domain.
Wild-type MondoA, N-terminal deletions of MondoA lacking the CLD, and
Mlx all localize to the cytoplasm when expressed individually (data not shown), suggesting that additional sequences in both MondoA
and Mlx regulate their subcellular localization. When coexpressed, wild-type Mlx and MondoA also localize to the cytoplasm. However, when
Mlx is coexpressed with any of the MondoA deletions lacking the CLD,
they localize predominantly to the nucleus. Therefore, in the absence
of the CLD, heterodimerization of MondoA and Mlx results in their
nuclear localization. It is possible that heterodimerization blocks the
cytoplasmic localization functions of monomeric MondoA and Mlx, or
heterodimerization may unmask a dominant NLS(s) in either MondoA, Mlx,
or both proteins. It is also possible that monomers of MondoA and Mlx
are rapidly degraded in the nucleus. However, as we can detect NLSMlx
in the nucleus when it is expressed alone (data not shown), we consider
this possibility less likely. Therefore, our data suggest that in order
for MondoA and Mlx to accumulate in the nucleus multiple negative
regulatory steps must be overcome; the function of the CLD of MondoA
must be inactivated, perhaps by extracellular signaling, and the two
proteins must heterodimerize. Interestingly, a similar dependence on
heterodimerization for nuclear accumulation has been observed for the
Drosophila clock proteins PER and TIM (46).
The amino terminus of MondoA also contains a TAD between amino acids
322 and 445 which is extremely active when fused to the Gal4DBD. This
activity is much greater than that seen with the wild-type MondoA
protein, possibly due to the high affinity of the Gal4 homodimer for
DNA. The MondoA TAD is rich in serine, threonine, and proline, a
characteristic shared with TADs of the PAX family (49). In
spite of the other functional similarities between Myc and Mondo, their
TADs have little specific sequence similarity. However, a segment of
c-Myc's activation domain, amino acids 41 to 103, is proline rich
(33), suggesting that there may be functional similarities
shared by Myc and Mondo transactivation.
We have described a new transcription factor network whose center is
Mlx. Like Max, Mlx is a common partner for both transcriptional activators, the Mondo proteins, and repressors, the Mad proteins. Given
the similarities between the Max network and the Mlx network, it is
likely that the Mlx network will also function in the regulation of
cell proliferation and differentiation. Our preliminary data suggest
that transcriptional cross talk between the Max network and the Mlx
network regulates their activity. For example, in Mad1 null mice, Mlx
is upregulated in the granulosa cells of the ovary, and
Drosophila Myc appears to regulate Drosophila
Mondo mRNA levels (data not shown). Thus, it is likely that a web of regulatory interactions between the Max and Mlx networks regulates the
functions of these two transcription factor families. Future experiments will be directed at understanding the complicated interplay
of these two networks.
 |
ACKNOWLEDGMENTS |
We thank Jennifer Phillips for technical assistance, Barbara
Graves for suggestions on the manuscript, M. Yoshida for the gift of
leptomycin B, and Jim Reamey, of the Department of Human Genetics
Robotics Core Facility, for taming the robot.
A.N.B. was supported by Cancer Center Training grant 3P30CA42014,
K.L.C. was supported by NRSA 5F32HL09548, and D.E.A. is supported
by NIH grant GM55668-04 and is a Scholar of The Leukemia and Lymphoma Society.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Huntsman Cancer
Institute, University of Utah, 2000 Circle of Hope Room 4365, Salt Lake
City, Utah 84112-5550. Phone: (801) 581-5597. Fax: (801) 585-1980. E-mail: don.ayer{at}hci.utah.edu.
 |
REFERENCES |
| 1.
|
Amati, B.,
K. Alevizopoulos, and J. Vlach.
1998.
Myc and the cell cycle.
Front. Biosci.
3:D250-D268.
|
| 2.
|
Amati, B., and H. Land.
1994.
Myc-Max-Mad: a transcription factor network controlling cell cycle progression, differentiation and death.
Curr. Opin. Genet. Dev.
4:102-108[CrossRef][Medline].
|
| 3.
|
Atchley, W. R., and W. M. Fitch.
1997.
A natural classification of the basic helix-loop-helix class of transcription factors.
Proc. Natl. Acad. Sci. USA
94:5172-5176[Abstract/Free Full Text].
|
| 4.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1995.
Current protocols in molecular biology.
John Wiley and Sons, Inc., New York, N.Y.
|
| 5.
|
Ayer, D. E.
1999.
Histone deacetylases: transcriptional repression with SINers and NuRDs.
Trends Cell Biol.
9:193-198[CrossRef][Medline].
|
| 6.
|
Ayer, D. E., and R. N. Eisenman.
1993.
A switch from Myc:Max to Mad:Max heterocomplexes accompanies monocyte/macrophage differentiation.
Genes Dev.
7:2110-2119[Abstract/Free Full Text].
|
| 7.
|
Ayer, D. E.,
L. Kretzner, and R. N. Eisenman.
1993.
Mad: a heterodimeric partner for Max that antagonizes Myc transcriptional activity.
Cell
72:211-222[CrossRef][Medline].
|
| 8.
|
Ayer, D. E.,
Q. A. Lawrence, and R. N. Eisenman.
1995.
Mad-Max transcriptional repression is mediated by ternary complex formation with mammalian homologs of yeast repressor Sin3.
Cell
80:767-776[CrossRef][Medline].
|
| 9.
|
Bernards, R.
1995.
Transcriptional regulation. Flipping the Myc switch.
Curr. Biol.
5:859-861[CrossRef][Medline].
|
| 10.
|
Billin, A. N.,
A. L. Eilers,
C. Queva, and D. E. Ayer.
1999.
Mlx, a novel max-like BHLHZip protein that interacts with the max network of transcription factors.
J. Biol. Chem.
274:36344-36350[Abstract/Free Full Text].
|
| 11.
|
Blackwood, E. M., and R. N. Eisenman.
1991.
Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc.
Science
251:1211-1217[Abstract/Free Full Text].
|
| 12.
|
Blackwood, E. M.,
B. Luscher, and R. N. Eisenman.
1992.
Myc and Max associate in vivo.
Genes Dev.
6:71-80[Abstract/Free Full Text].
|
| 13.
|
Bouchard, C.,
K. Thieke,
A. Maier,
R. Saffrich,
J. Hanley-Hyde,
W. Ansorge,
S. Reed,
P. Sicinski,
J. Bartek, and M. Eilers.
1999.
Direct induction of cyclin D2 by Myc contributes to cell cycle progression and sequestration of p27.
EMBO J.
18:5321-5333[CrossRef][Medline].
|
| 14.
|
Cerni, C.,
K. Bousset,
C. Seelos,
H. Burkhardt,
M. Henriksson, and B. Luscher.
1995.
Differential effects by Mad and Max on transformation by cellular and viral oncoproteins.
Oncogene
11:587-596[Medline].
|
| 15.
|
Charron, J.,
B. A. Malynn,
P. Fisher,
V. Stewart,
L. Jeannotte,
S. P. Goff,
E. J. Robertson, and F. W. Alt.
1992.
Embryonic lethality in mice homozygous for a targeted disruption of the N-myc gene.
Genes Dev.
6:2248-2257[Abstract/Free Full Text].
|
| 16.
|
Chin, L.,
N. Schreiber-Agus,
I. Pellicer,
K. Chen,
H. W. Lee,
M. Dudast,
C. Cordon-Cardo, and R. A. DePinho.
1995.
Contrasting roles for Myc and Mad proteins in cellular growth and differentiation.
Proc. Natl. Acad. Sci. USA
92:8488-8492[Abstract/Free Full Text].
|
| 17.
|
Dang, C. V.
1999.
c-Myc target genes involved in cell growth, apoptosis, and metabolism.
Mol. Cell. Biol.
19:1-11[Free Full Text].
|
| 18.
|
Davis, A. C.,
M. Wims,
G. D. Spotts,
S. R. Hann, and A. Bradley.
1993.
A null c-myc mutation causes lethality before 10.5 days of gestation in homozygotes and reduced fertility in heterozygous female mice.
Genes Dev.
7:671-682[Abstract/Free Full Text].
|
| 19.
|
de Luis, O.,
M. C. Valero, and L. A. Jurado.
2000.
WBSCR14, a putative transcription factor gene deleted in Williams-Beuren syndrome: complete characterisation of the human gene and the mouse ortholog.
Eur. J. Hum. Genet.
8:215-222[CrossRef][Medline].
|
| 20.
|
Facchini, L. M., and L. Z. Penn.
1998.
The molecular role of Myc in growth and transformation: recent discoveries lead to new insights.
FASEB J.
12:633-651[Abstract/Free Full Text].
|
| 21.
|
Ferre, D. A. A. R.,
G. C. Prendergast,
E. B. Ziff, and S. K. Burley.
1993.
Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain.
Nature
363:38-45[CrossRef][Medline].
|
| 22.
|
Fisher, F., and C. R. Goding.
1992.
Single amino acid substitutions alter helix-loop-helix protein specificity for bases flanking the core CANNTG motif.
EMBO J.
11:4103-4109[Medline].
|
| 23.
|
Foley, K. P., and R. N. Eisenman.
1999.
Two MAD tails: what the recent knockouts of Mad1 and Mxi1 tell us about the MYC/MAX/MAD network.
Biochim. Biophys. Acta
1423:M37-M47[Medline].
|
| 24.
|
Foley, K. P.,
G. A. McArthur,
C. Queva,
P. J. Hurlin,
P. Soriano, and R. N. Eisenman.
1998.
Targeted disruption of the MYC antagonist MAD1 inhibits cell cycle exit during granulocyte differentiation.
EMBO J.
17:774-785[CrossRef][Medline].
|
| 25.
|
Gallant, P.,
Y. Shiio,
P. F. Cheng,
S. M. Parkhurst, and R. N. Eisenman.
1996.
Myc and Max homologs in Drosophila.
Science
274:1523-1527[Abstract/Free Full Text].
|
| 26.
|
Grandori, C., and R. N. Eisenman.
1997.
Myc target genes.
Trends Biochem. Sci.
22:177-181[CrossRef][Medline].
|
| 27.
|
Henriksson, M., and B. Lüscher.
1996.
Proteins of the Myc network: essential regulators of cell growth and differentiation.
Adv. Cancer Res.
68:109-182[Medline].
|
| 28.
|
Hollenberg, S. M.,
R. Sternglanz,
P. F. Cheng, and H. Weintraub.
1995.
Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.
Mol. Cell. Biol.
15:3813-3822[Abstract].
|
| 29.
|
Hurlin, P. J.,
C. Queva, and R. N. Eisenman.
1997.
Mnt, a novel Max interacting protein is coexpressed with Myc in proliferating cells and mediates repression at Myc binding sites.
Genes Dev.
11:44-58[Abstract/Free Full Text].
|
| 30.
|
Hurlin, P. J.,
C. Queva,
P. J. Koskinen,
E. Steingrimsson,
D. E. Ayer,
N. G. Copeland,
N. A. Jenkins, and R. N. Eisenman.
1995.
Mad3 and Mad4: novel Max-interacting transcriptional repressors that suppress c-Myc-dependent transformation and are expressed during neural and epidermal differentiation.
EMBO J.
14:5646-5659[Medline].
|
| 31.
|
Iritani, B. M., and R. N. Eisenman.
1999.
c-Myc enhances protein synthesis and cell size during B lymphocyte development.
Proc. Natl. Acad. Sci. USA
96:13180-13185[Abstract/Free Full Text].
|
| 32.
|
Johnston, L. A.,
D. A. Prober,
B. A. Edgar,
R. N. Eisenman, and P. Gallant.
1999.
Drosophila myc regulates cellular growth during development.
Cell
98:779-790[CrossRef][Medline].
|
| 33.
|
Kato, G. J.,
J. Barrett,
M. Villa-Garcia, and C. V. Dang.
1990.
An amino-terminal c-myc domain required for neoplastic transformation activates transcription.
Mol. Cell. Biol.
10:5914-5920[Abstract/Free Full Text].
|
| 34.
|
Koskinen, P. J.,
D. E. Ayer, and R. N. Eisenman.
1995.
Repression of Myc-Ras cotransformation by Mad is mediated by multiple protein-protein interactions.
Cell Growth Differ.
6:623-629[Abstract].
|
| 35.
|
Kudo, N.,
S. Khochbin,
K. Nishi,
K. Kitano,
M. Yanagida,
M. Yoshida, and S. Horinouchi.
1997.
Molecular cloning and cell cycle-dependent expression of mammalian CRM1, a protein involved in nuclear export of proteins.
J. Biol. Chem.
272:29742-29751[Abstract/Free Full Text].
|
| 36.
|
Laherty, C. D.,
W. M. Yang,
J. M. Sun,
J. R. Davie,
E. Seto, and R. N. Eisenman.
1997.
Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression.
Cell
89:349-356[CrossRef][Medline].
|
| 37.
|
McArthur, G. A.,
C. D. Laherty,
C. Queva,
P. J. Hurlin,
L. Loo,
L. James,
C. Grandori,
P. Gallant,
Y. Shiio,
W. C. Hokanson,
A. C. Bush,
P. F. Cheng,
Q. A. Lawrence,
B. Pulverer,
P. J. Koskinen,
K. P. Foley,
D. E. Ayer, and R. N. Eisenman.
1998.
The Mad protein family links transcriptional repression to cell differentiation.
Cold Spring Harbor Symp. Quant. Biol.
63:423-433[CrossRef][Medline].
|
| 38.
|
Meroni, G.,
A. Reymond,
M. Alcalay,
G. Borsani,
A. Tanigami,
R. Tonlorenzi,
C. L. Nigro,
S. Messali,
M. Zollo,
D. H. Ledbetter,
R. Brent,
A. Ballabio, and R. Carrozzo.
1997.
Rox, a novel bHLHZip protein expressed in quiescent cells that heterodimerizes with Max, binds a non-canonical E box and acts as a transcriptional repressor.
EMBO J.
16:2892-2906[CrossRef][Medline].
|
| 39.
|
Michael, W. M.
2000.
Nucleocytoplasmic shuttling signals: two for the price of one.
Trends Cell Biol.
10:46-50[CrossRef][Medline].
|
| 40.
|
Moens, C. B.,
B. R. Stanton,
L. F. Parada, and J. Rossant.
1993.
Defects in heart and lung development in compound heterozygotes for two different targeted mutations at the N-myc locus.
Development
119:485-499[Abstract].
|
| 41.
|
Moroianu, J.
1999.
Nuclear import and export pathways.
J. Cell. Biochem.
(Suppl. 32-33):76-83.
|
| 42.
|
Mukherjee, B.,
S. D. Morgenbesser, and R. A. DePinho.
1992.
Myc family oncoproteins function through a common pathway to transform normal cells in culture: cross-interference by Max and trans-acting dominant mutants.
Genes Dev.
6:1480-1492[Abstract/Free Full Text].
|
| 43.
|
Okano, H. J.,
W. Y. Park,
J. P. Corradi, and R. B. Darnell.
1999.
The cytoplasmic Purkinje onconeural antigen cdr2 down-regulates c-Myc function: implications for neuronal and tumor cell survival.
Genes Dev.
13:2087-2097[Abstract/Free Full Text].
|
| 44.
|
Perez-Roger, I.,
S. H. Kim,
B. Griffiths,
A. Sewing, and H. Land.
1999.
Cyclins D1 and D2 mediate Myc-induced proliferation via sequestration of p27(Kip1) and p21(Cip1).
EMBO J.
18:5310-5320[CrossRef][Medline].
|
| 45.
|
Queva, C.,
G. A. McArthur,
L. S. Ramos, and R. N. Eisenman.
1999.
Dwarfism and dysregulated proliferation in mice overexpressing the MYC antagonist MAD1.
Cell Growth Differ.
10:785-796[Abstract/Free Full Text].
|
| 46.
|
Saez, L., and M. W. Young.
1996.
Regulation of nuclear entry of the Drosophila clock proteins period and timeless.
Neuron
17:911-920[CrossRef][Medline].
|
| 47.
|
Schreiber-Agus, N., and R. A. DePinho.
1998.
Repression by the Mad(Mxi1)-Sin3 complex.
Bioessays
20:808-818[CrossRef][Medline].
|
| 48.
|
Schreiber-Agus, N.,
Y. Meng,
T. Hoang,
H. Hou, Jr.,
K. Chen,
R. Greenberg,
C. Cordon-Cardo,
H. W. Lee, and R. A. DePinho.
1998.
Role of Mxi1 in ageing organ systems and the regulation of normal and neoplastic growth.
Nature
393:483-487[CrossRef][Medline].
|
| 49.
|
Tang, H. K.,
S. Singh, and G. F. Saunders.
1998.
Dissection of the transactivation function of the transcription factor encoded by the eye developmental gene PAX6.
J. Biol. Chem.
273:7210-7221[Abstract/Free Full Text].
|
| 50.
|
Towbin, J. A.,
B. Casey, and J. Belmont.
1999.
The molecular basis of vascular disorders.
Am. J. Hum. Genet.
64:678-684[CrossRef][Medline].
|
| 51.
|
Turpin, P.,
B. Ossareh-Nazari, and C. Dargemont.
1999.
Nuclear transport and transcriptional regulation.
FEBS Lett.
452:82-86[CrossRef][Medline].
|
| 52.
|
Vastrik, I.,
A. Kaipainen,
T. L. Penttila,
A. Lymboussakis,
R. Alitalo,
M. Parvinen, and K. Alitalo.
1995.
Expression of the mad gene during cell differentiation in vivo and its inhibition of cell growth in vitro.
J. Cell Biol.
128:1197-1208[Abstract/Free Full Text].
|
| 53.
|
Wenzel, A.,
C. Cziepluch,
U. Hamann,
J. Schurmann, and M. Schwab.
1991.
The N-Myc oncoprotein is associated in vivo with the phosphoprotein Max(p20/22) in human neuroblastoma cells.
EMBO J.
10:3703-3712[Medline].
|
| 54.
|
Wolff, B.,
J. J. Sanglier, and Y. Wang.
1997.
Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA.
Chem. Biol.
4:139-147[CrossRef][Medline].
|
| 55.
|
Wu, S.,
A. Pena,
A. Korcz,
D. R. Soprano, and K. J. Soprano.
1996.
Overexpression of Mxi1 inhibits the induction of the human ornithine decarboxylase gene by the Myc/Max protein complex.
Oncogene
12:621-629[Medline].
|
Molecular and Cellular Biology, December 2000, p. 8845-8854, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Davies, M. N., O'Callaghan, B. L., Towle, H. C.
(2008). Glucose Activates ChREBP by Increasing Its Rate of Nuclear Entry and Relieving Repression of Its Transcriptional Activity. J. Biol. Chem.
283: 24029-24038
[Abstract]
[Full Text]
-
Li, M. V., Chen, W., Poungvarin, N., Imamura, M., Chan, L.
(2008). Glucose-Mediated Transactivation of Carbohydrate Response Element-Binding Protein Requires Cooperative Actions from Mondo Conserved Regions and Essential Trans-Acting Factor 14-3-3. Mol. Endocrinol.
22: 1658-1672
[Abstract]
[Full Text]
-
Stoltzman, C. A., Peterson, C. W., Breen, K. T., Muoio, D. M., Billin, A. N., Ayer, D. E.
(2008). Glucose sensing by MondoA:Mlx complexes: A role for hexokinases and direct regulation of thioredoxin-interacting protein expression. Proc. Natl. Acad. Sci. USA
105: 6912-6917
[Abstract]
[Full Text]
-
Ma, L., Sham, Y. Y., Walters, K. J., Towle, H. C.
(2007). A critical role for the loop region of the basic helix-loop-helix/leucine zipper protein Mlx in DNA binding and glucose-regulated transcription. Nucleic Acids Res
35: 35-44
[Abstract]
[Full Text]
-
Ma, L., Robinson, L. N., Towle, H. C.
(2006). ChREBP*Mlx Is the Principal Mediator of Glucose-induced Gene Expression in the Liver. J. Biol. Chem.
281: 28721-28730
[Abstract]
[Full Text]
-
Sans, C. L., Satterwhite, D. J., Stoltzman, C. A., Breen, K. T., Ayer, D. E.
(2006). MondoA-Mlx Heterodimers Are Candidate Sensors of Cellular Energy Status: Mitochondrial Localization and Direct Regulation of Glycolysis.. Mol. Cell. Biol.
26: 4863-4871
[Abstract]
[Full Text]
-
Li, M. V., Chang, B., Imamura, M., Poungvarin, N., Chan, L.
(2006). Glucose-dependent transcriptional regulation by an evolutionarily conserved glucose-sensing module.. Diabetes
55: 1179-1189
[Abstract]
[Full Text]
-
Ma, L., Tsatsos, N. G., Towle, H. C.
(2005). Direct Role of ChREBP{middle dot}Mlx in Regulating Hepatic Glucose-responsive Genes. J. Biol. Chem.
280: 12019-12027
[Abstract]
[Full Text]
-
Merla, G., Howald, C., Antonarakis, S. E., Reymond, A.
(2004). The subcellular localization of the ChoRE-binding protein, encoded by the Williams-Beuren syndrome critical region gene 14, is regulated by 14-3-3. Hum Mol Genet
13: 1505-1514
[Abstract]
[Full Text]
-
Grinberg, A. V., Hu, C.-D., Kerppola, T. K.
(2004). Visualization of Myc/Max/Mad Family Dimers and the Competition for Dimerization in Living Cells. Mol. Cell. Biol.
24: 4294-4308
[Abstract]
[Full Text]
-
Tassabehji, M.
(2003). Williams-Beuren syndrome: a challenge for genotype-phenotype correlations. Hum Mol Genet
12: R229-237
[Abstract]
[Full Text]
-
Kim, S., Shi, H., Lee, D.-k., Lis, J. T.
(2003). Specific SR protein-dependent splicing substrates identified through genomic SELEX. Nucleic Acids Res
31: 1955-1961
[Abstract]
[Full Text]
-
Eilers, A. L., Sundwall, E., Lin, M., Sullivan, A. A., Ayer, D. E.
(2002). A Novel Heterodimerization Domain, CRM1, and 14-3-3