Previous Article | Next Article 
Molecular and Cellular Biology, December 2000, p. 8916-8922, Vol. 20, No. 23
0270-7306/00/$04.00+0
[URE3] Prion Propagation in Saccharomyces
cerevisiae: Requirement for Chaperone Hsp104 and Curing by
Overexpressed Chaperone Ydj1p
Hiromitsu
Moriyama,
Herman K.
Edskes, and
Reed B.
Wickner*
Laboratory of Biochemistry and Genetics,
National Institute of Diabetes, Digestive and Kidney Diseases,
National Institutes of Health, Bethesda, Maryland 20892-0830
Received 3 July 2000/Returned for modification 29 August
2000/Accepted 11 September 2000
 |
ABSTRACT |
The [URE3] nonchromosomal genetic element is an infectious form
(prion) of the Ure2 protein, apparently a self-propagating amyloidosis.
We find that an insertion mutation or deletion of HSP104
results in inability to propagate the [URE3] prion. Our results
indicate that Hsp104 is a common factor in the maintenance of two
independent yeast prions. However, overproduction of Hsp104 does not
affect the stability of [URE3], in contrast to what is found for the
[PSI+] prion, which is known to be cured by either
overproduction or deficiency of Hsp104. Like Hsp104, the Hsp40 class
chaperone Ydj1p, with the Hsp70 class Ssa1p, can renature proteins. We
find that overproduction of Ydj1p results in a gradual complete loss of [URE3]. The involvement of protein chaperones in the propagation of
[URE3] indicates a role for protein conformation in inheritance.
 |
INTRODUCTION |
An infectious protein (prion) can,
in principle, arise by many mechanisms, including production of a
self-modifying protein or a protein that positively regulates its own
production (1, 26, 44). However, the known and suspected
cases of prions all appear to involve self-propagating protein
aggregation (reviewed in references 33, 45, 55, and
57 to 59).
Like yeast viruses, an infectious protein in yeast is expected to be
transmitted as a nonchromosomal genetic element. The nonchromosomal
genetic elements of Saccharomyces cerevisiae, [URE3] and [PSI+], were identified about 30 years ago (15,
31), but their molecular basis was long obscure. Three
unusual genetic properties, each expected of a prion but not of a
nucleic acid replicon, were used to identify [URE3] and
[PSI+] as prions of the Ure2 and Sup35 proteins,
respectively (56). First, if a prion can be cured, it should
arise again in the cured strain at some low frequency because the
normal form of the protein is still present. Second, overproduction of
the normal form of the protein should increase the frequency with which
the prion form arises, simply because there is more of the protein
present to undergo the prion change. Third, mutants in the gene for the protein should be unable to propagate the prion but the phenotype of
these mutants and that produced by the presence of the prion should be
the same, because each of these conditions results in a deficiency of
the normal form of the protein. [URE3] and [PSI+] have
each of these properties as prions of Ure2p and Sup35p, respectively
(56). Confirming these assignments are experiments showing
that [URE3] truly arises de novo (37), that it is the Sup35 or Ure2 protein (and not the mRNA or the gene) whose
overproduction gives rise to [PSI+] or [URE3] (18,
37), and that a regulatory loop is not the basis of the [URE3]
phenomenon (37).
Ure2p is a regulator of nitrogen catabolism involved in allowing yeast
to use the best nitrogen source available and to turn off the genes
involved in the assimilation of poor nitrogen sources (13, 19,
36). A cascade of regulatory factors has been found, with ammonia
(a good nitrogen source) inhibiting Mks1p, which in turn inhibits
Ure2p, which blocks positive transcription factor Gln3p (14,
21). Gln3p activates transcription of (among others) the
allanoate permease gene, DAL5 (47). Because of
the chemical resemblance of ureidosuccinate (USA), an intermediate in
uracil biosynthesis, to allantoate, a poor nitrogen source, Dal5p can take up USA (54). Thus, the inability of cells blocked in
uracil biosynthesis before USA to utilize USA in place of uracil can be
used as a measure of Ure2p activity. Schematically, the pathway is
NH3
Mks1p
Ure2p
Gln3p
DAL5
USA uptake. Either ure2 mutants or cells
carrying the [URE3] prion can use USA in place of uracil in spite of
the presence of ammonia in the medium (31).
Sup35p and Sup45p are the subunits of the translation termination
factor (52, 60). sup35 mutants allow weak
nonsense suppressor tRNAs to be more efficient because they have
weakened competition by the normal translation termination factors. The
presence of the [PSI+] prion confers a phenotype similar
to that produced by many recessive sup35 mutations.
Biochemical and cell biological studies indicate that the prion
mechanism for [URE3] and [PSI] is amyloid formation (20, 24,
28, 38, 41-43, 53). Ure2p is protease resistant in extracts of
[URE3] strains but not in wild-type cells (38), and Ure2p
is aggregated specifically in [URE3] cells (20). The Ure2p
prion domain readily forms amyloid in vitro and promotes amyloid
formation by the native soluble full-length molecule under conditions
in which the latter would otherwise be stable (53). Moreover, the pattern of protease-resistant fragments of the in vitro
amyloid form of Ure2p closely matches that found for Ure2p in extracts
of [URE3] strains (53). Fragments of Ure2p that are unable
to assume the prion form in vivo do not form amyloid in vitro
(53).
Amyloid is a linear filamentous protein form which is high in
-sheet
structure, shows yellow-green birefringence on staining with Congo red,
and has a characteristic protease resistance. Over 20 proteins have
been shown capable of forming amyloid, and amyloid formation is a key
feature of a variety of common diseases, including type II diabetes
mellitus (amylin), multiple myeloma (immunoglobulin light chains),
Alzheimer's disease (A
peptide), Parkinson's disease
(
-synuclein), and the transmissible spongiform encephalopathies
(PrP). Although determination of the structure of amyloid has been
slowed by its irregular form, it is clearly a kind of linear crystal,
with some regular features revealed by X-ray fiber diffraction studies,
solid-state nuclear magnetic resonance, and cryoelectron microscopy
(reviewed in reference 29).
The propagation of [PSI+] requires Hsp104, and
[PSI+] is cured by excess Hsp104 (9, 10). This
result at once provided key support for the prion model for
[PSI+] and indicated that the mechanism of
[PSI+] formation involves a conformational change of
Sup35p, not a covalent change. Hsp104 is unusual among chaperones in
that it does not prevent denaturation but rather promotes renaturation of previously denatured or aggregated proteins (40). It
cooperates with Hsp40 (Ydj1p) and Hsp70s in this process
(25). The Ssa group of Hsp70 proteins are also
essential for [PSI+] propagation (27). Ydj1p
is an Hsp40 that is involved in multiple functions, including
import of proteins into mitochondria, secretion of mating pheromones,
and regulation of the activity of the cytoplasmic Hsp70s (2, 4, 7,
34, 39). In cooperation with the Hsp70 protein Ssa1p, Ydj1p can
induce the refolding of denatured protein in vitro even without Hsp104
(34).
Mks1p, a component of the signal transduction cascade regulating
nitrogen catabolism (21), is necessary for the de novo generation of [URE3] but not for its propagation (22). We
now find that [URE3] requires Hsp104 for its propagation but that, unlike what is found for [PSI+], overexpression of Hsp104
does not cure [URE3]. However, overexpression of Ydj1p results in the
gradual loss of [URE3].
 |
MATERIALS AND METHODS |
Strains and media.
Strains used are shown in Table
1. Strain 11514 (MAT
his3 leu2 lys2 ura3 hsp104::G418;
Research Genetics) was crossed with strain HM6B (MATa
ura2 can1 trp1 kar1), and URA3 ura2
hsp104::G418 meiotic segregants were chosen
for further study. Standard yeast media have been described previously
(50). Galactose media included 2% raffinose. USA medium was
synthetic dextrose (SD) containing required supplements and 100 µg of
sodium USA/ml in place of uracil. Uracil-negative dropout medium was
generally not satisfactory for the [URE3] test. Transformation was
carried out by a variant of the lithium acetate method (23).
Cytoduction.
Cytoplasm can be transferred from one strain
(the donor) to another (the recipient) using the kar1 mutant
that fails to undergo karyogamy (12). Cytoduction was
conducted as described previously (37) using the [URE3]
MATa and MAT
donor strains 3310 and 4645-8CU, respectively.
Tests for [URE3].
A ura2 strain blocked in USA
synthesis can use USA in place of uracil to grow if it carries
[URE3]. This is the growth test. In the presence of excess USA, a
[URE3] strain takes up more USA than it needs, converts it to uracil,
and excretes the excess uracil. This secreted uracil can be detected by
the feeding of a lawn of a Ura
strain. In this feeding
test, one uses minimal medium without uracil that includes 100 µg
USA/ml and a seeded lawn (1.0 ml of a suspension at 0.1 units of
optical density at 550 nm) of a diploid ura2/ura2 strain
(1065; Table 1). Strains to be tested are streaked on the surface, and
plates are observed after 48 h at 30°C. The feeding test can
also be used to determine the [URE3] state of strains that do not
have a ura2 mutation.
Plasmids.
Plasmids pH218, pH219, pH220, and pH221 were
constructed by insertion of the NotI-SalI
fragment carrying HSP104 from pFL44L-HSP104 (kindly provided
by Magdalena Boguta, Warsaw, Poland) into pRS313, pRS314, pRS423, and
pRS424 (11, 51), respectively. pH316 has the GAL1
promoter replacing the ADH1 promoter in CEN LEU2
plasmid pH124 (20). p901 was constructed by PCR
amplification of the YDJ1 open reading frame from lambda
PM-2784 (ATCC 70080) (48) using oligonucleotides RW43 (5'
ATATACCTC TATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCATGGTTAAAG AAACTAAGTTTTACG
3') and RW44 (5'
ACCTCTGGCGAAGAAGTCCA AAGCTTCAGCTGCTGCAGGCTCGAGTCATTGAGATGCACATTGAAC ACC
3') and cotransformation of the PCR product and
BamHI-digested pH316 into strain 3687 (35). pA
was constructed by PCR amplification of the HSP104 open
reading frame from pH218 using oligonucleotides GAL>HSP104 (5'
ATA TACCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCCATGA ACGACCAAACGCAATTTAC
3') and HSP104>MCS (5'
ACCTCTGGCGA AGAAGTCCAAAGCTTCAGCTGCTGCAGGCTCGAGTTATTAATCTAG GTCATCATCAATTTCC
3') and cotransformation of the PCR product and BamHI-
and XhoI-digested pH316 into strain YHE835. Plasmids
isolated from Leu+ transformants by transformation of
Escherichia coli were examined for inserts and sequenced.
Identification of the genomic site of transposon insertion.
Chromosomal DNA was isolated from the mutant, treated with
EcoRI, and ligated (to circularize it), and the site of
integration was amplified by PCR using primers within the LacZ gene
(cLacZ67 [5' TGTGCTGCAAGGCGATTAAGTTG 3'] and LacZ2946
[5' ATGGCTGAATATCGACGGTTTCC 3']). This fragment was then
sequenced. A second method to accomplish the same goal was use of the
"rescue plasmid" pRSQ2 (6). Since the rescue plasmid
uses the URA3 gene and our strain carried ura2, we made our strain URA2+ by transforming it with
a URA2 gene DNA fragment and then made it ura3
using 5 fluoro-orotic acid selection (5). By either method,
the same fragment of chromosomal DNA was detected and, as expected, the
insert was in the same gene (see Results).
Western blotting.
Strain YHE835 transformed with pH316
(CEN LEU2 GAL1 promoter) or pA (CEN LEU2
GAL1-HSP104) was streaked for single colonies and grown at 23 or
30°C on plates containing SD plus uracil, His, and Trp or with
galactose in place of glucose for 4 to 5 days. After the presence of
[URE3] was confirmed by the growth test, some of the single colonies
were transferred to 20 ml of the respective media and were grown at
23°C for 12 h to an A550 of 0.5 to 0.8. Cells were collected, suspended in 200 µl of 50 mM Tris-HCl (pH 7.5)-100 mM NaCl-1 mM phenylmethylsulfonyl fluoride-0.001%
aprotinin-0.001% pepstatin, and lysed with glass beads. Extracts were
centrifuged for 10 min at 15,000 × g at 4°C, and the
supernatant fraction was retained. Each extract included about 3 µg
of protein per µl. Sample buffer (50 mM Tris-HCl [pH 6.8], 2%
sodium dodecyl sulfate [SDS], 10% glycerol, 0.7 M 2-mercaptoethanol,
0.025% bromphenol blue) was added, and samples were boiled for 2 min.
Samples (20 µg of protein per lane) were analyzed by electrophoresis
on SDS-10% polyacrylamide gel electrophoresis gel, transferred to
Immobilon-P membranes (Millipore), and probed with a polyclonal
antibody to Hsp104 (Stress Gen Biotechnologies Corp.). Proteins of
hsp104::G418 strain 4751-11A were also
extracted. Detection was with an alkaline phosphatase-based
chemiluminescence detection assay.
 |
RESULTS |
Mutant isolation.
To determine what genes are necessary for
propagation of the [URE3] prion, we induced mutations in the stably
[URE3] haploid strain YHE835, which has the
1278b background
(3), because [URE3] diploids with this background produced
meiotic spore clones with a high proportion of [URE3] segregants,
unlike many other strains. We transformed YHE835 [URE3] with a bank
of yeast DNA mutagenized with a Tn3-based lacZ
LEU2 transposon (6). Since [URE3] makes cells grow
slowly, the primary screen was to choose transformant colonies of
normal size. Among these, colonies which could not grow on USA but
which could grow on uracil were selected. To confirm that these
candidates could not maintain [URE3], cytoplasm was transferred by
cytoduction from strain 3310 (kar1 [URE3]) and candidates
whose cytoductants were all USA
were chosen. These
cytoductants were then used as donors to wild-type strain 3310S
[ure-o] [rho0] and those which did not transfer
[URE3] (implying that they had lost it) were examined further.
Candidate mutants were then mated with a [URE3] strain also having
the
1278b background (YHE748), and tetrad analysis was carried out.
One mutant (P86) for which Leu2+ and USA
each
showed 2:2 segregation and generally cosegregated was found. Several
spore clones were Leu negative but became USA
. We
suspected that these spore clones had spontaneously lost [URE3] and
were in fact able to maintain it, as we confirmed by cytoduction
experiments using the [URE3] donor strains 3310 and 4645-8CU. The
combined results of the cytoduction experiments and the original tetrad
data showed that Leu2+ and USA
showed clear
2:2 segregation and cosegregated perfectly in all 12 tetrads except for
a single spore clone carrying the mutation which grew poorly on USA.
The diploids formed between mutant P86 and the [URE3] strain YHE748
were all stably [URE3], indicating that the P86 mutation is recessive.
To test whether the P86 mutant results in loss of [URE3] rather than,
for example, loss of ability to convert USA to uracil, cytoplasm
from two USA
spore clones and one USA+ spore
clone was transferred to the [ure-o] [rho0] strains
3310S and 4645-8C. Indeed, cytoplasm from the USA
spore
clones could not donate [URE3], while the USA+ spore
clone did, showing that the mutants specifically lose [URE3]. Diploids formed between mutant segregants and the wild-type [URE3] strains 3310 and 4645-8CU were nearly all slow growing and positive for
uracil feeding on USA plates, indicating that the mutation is recessive.
The transposon insertion is in HSP104.
Mutant
chromosomal DNA was digested with EcoRI and circularized by
ligation, and the site of integration was amplified by PCR using
primers in lacZ. The site of integration was also defined using rescue plasmid pRSQ2 (6). By both methods, the site of integration was found to be immediately downstream of bp 1677 in the
center of the HSP104 open reading frame.
Complementation tests of P86 mutants with HSP104.
To
confirm that the mutation producing loss of [URE3] was the insertion
in HSP104 and not a linked mutation, HSP104 on
single-copy or high-copy-number plasmids was introduced into the
[rho0] P86 mutant strains 4706-1C and 4706-1D (Table 1).
The transformants were used as cytoduction recipients from the [URE3]
strains 3310 and 4645-8CU, and the cytoductants were subjected to
growth and feeding tests. Cells with the control plasmid could not
maintain the [URE3] prion, but in cells transformed with the plasmids
carrying HSP104, whether on single-copy or multicopy
vectors, the mutation was complemented, and on USA the feeding
phenomenon was observed (Fig. 1, Table
2). Furthermore, these cytoductants of
the P86 mutant complemented with the HSP104 gene could
transfer [URE3] by cytoduction to 3310S [ure-o]
[rho0] or 4645-8C [ure-o] [rho0] (Table
2). For strain 4706-1D, transformants with a high-copy-number plasmid
(pH220) showed more-efficient [URE3] transmission to the recipient
than transformants with a low-copy-number plasmid (pH218) (Table 2).
When the HSP104-carrying plasmid was lost from the mutant,
none of the cells could grow on USA and [URE3] was no longer
transferred by cytoduction to the [ure-o] strains (data not shown).

View larger version (104K):
[in this window]
[in a new window]
|
FIG. 1.
The uracil feeding test shows that the P86 mutant is
complemented by the HSP104 gene. HSP104 on a
single-copy (pH218; CEN HIS3 HSP104) or high-copy-number
(pH220; 2µm HIS3 HSP104) plasmid was introduced into
O P86 mutant strain 4706-1D (MAT
ura2 his3 P86::LEU2). The transformants
were used as cytoduction recipients from [URE3] strain 3310, and four
cytoductants of each were examined by the feeding test on minimal
medium without uracil that includes USA and a seeded lawn of diploid
ura2 strain 1065. After incubation for 48 h at 30°C,
the cells transformed with the plasmids carrying HSP104 grew
on USA and showed the feeding phenomenon. Cells with the control
vectors (pRS313 [CEN HIS3] or pRS423 [2µm
HIS3]) could not grow on USA and could not feed the lawn.
|
|
hsp104 deletion mutants cannot maintain [URE3].
Transferring cytoplasm from [URE3] strains into an
hsp104::G418 null mutant recipient
produced cytoductants that were uniformly unable to grow on USA or to
feed uracil to a Ura
lawn (the feeding test). When mutant
cells were transformed with a plasmid carrying HSP104,
whether on single-copy or multicopy vectors, and used as cytoduction
recipients, cytoductants were able to grow on USA and the feeding
phenomenon was observed (Table 3). As
with the P86 mutants, using the
hsp104::G418 cytoductants (from the
[URE3-1] donor) as donors in cytoduction into a wild-type [ure-o]
recipient (4645-8CG) gave only [ure-o] cytoductants, showing again
that [URE3] was lost and not merely unexpressed (data not shown).
Crossing hsp104::G418 strain 4751-11A
with ure2 strain 4131 showed that meiotic segregants with
the hsp104 deletion were USA+ when carrying the
ure2 deletion, and thus deficiency of Hsp104 did not
interfere with the USA+ phenotype produced by deficiency of Ure2p.
Overproduction of Hsp104 does not cure [URE3].
To test the
effects of overproduction of Hsp104 on [URE3] stability, we
introduced single-copy (CEN-HSP104) or high-copy-number (2µm HSP104) plasmids, in which HSP104 was
controlled by its own promoter, into [URE3] strain YHE835.
Similar proportions of transformants with each plasmid were
USA+ (Table 4).
USA+ transformants were further grown on medium selective
for the plasmid, and single colonies were tested for
[URE3]. There was no increased loss of [URE3] compared to vector
controls. Furthermore, the high-copy-number HSP104 plasmids
did not affect the strength of the USA+ or uracil feeding
phenotypes.
A plasmid overproducing Hsp104 from the strong GAL1 promoter
was introduced into [URE3] strain YHE835, selecting transformants on
dextrose media where the promoter is repressed. Confirmed
USA+ transformants were then grown on media
containing galactose or galactose plus the nonrepressing sugar
raffinose. There was no detectable loss of [URE3] induced by
these conditions (Table 5). Confirmation
that Hsp104 was indeed dramatically overproduced was obtained by
Western blot analysis using an antibody to Hsp104 (Fig.
2).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Overexpression of HSP104 from the
GAL1 promoter. Strain YHE835 was transformed with control
vector pH316 (CEN LEU2 pGAL1) or the plasmid carrying
HSP104 under the control of GAL1 promoter pA
(CEN LEU2 GAL1-HSP104). The transformants were grown
on minimal medium (SD) or the same medium with galactose in place of
glucose (SGal). After galactose induction, proteins were extracted and
separated in SDS-10% polyacrylamide gels, transferred to the
membranes, and probed with a polyclonal antibody to Hsp104. Twenty
micrograms of protein of each extract was used. Deletion strain
4751-11A (hsp104 ), which was cultured in minimal medium
(SD), does not contain any Hsp104 protein.
|
|
As another control, the same plasmids were introduced into the
[PSI+] strain DM628-3Aa+. [PSI] was lost from all
transformants with the 2µm HSP104 plasmid (pH221) but not
with the parent vector. [PSI] remained in glucose-grown
transformants with the GAL1-promoted HSP104
plasmid but was uniformly lost after 1 day of growth on galactose-raffinose medium. Thus, the same conditions of Hsp104 overproduction that did not affect [URE3] stability uniformly cured
[PSI+].
Different [URE3] prion strains are cured by
hsp104
.
Most of the experiments reported here used
[URE3-1], the strain of [URE3] that was isolated by F. Lacroute
(31) and passed to various strains by cytoplasmic mixing
(cytoduction). To determine whether Hsp104 is necessary for propagation
of other independently isolated strains of [URE3], we used
[URE3-2], isolated in an earlier study by overproduction of Ure2p
(56) and transferred by cytoduction to strain 3686. When
[URE3-2] was transferred by cytoduction from 3686 to the
hsp104::G418 [rho0]
strain 4751-11A, all cytoductants were found to be
USA
(Table 6). When these
cytoductants were then used as donors to strain 4645-8C
0
[ure-o], all 20 of these second-generation cytoductants were also
USA
(Table 6). These results indicate that Hsp104 is
necessary for propagation of this strain of [URE3] as well. That
[URE3-1] and [URE3-2] are indeed distinct strains of [URE3] is
suggested by the fact that the latter slows cell growth more in the
same host than does the former (data not shown). Introduction into the
[URE3-2] strain YHE64 of the high-copy-number HSP104
plasmid p221, which in control experiments cured [PSI+],
did not result in the loss of [URE3-2].
[URE3] is cured by overexpression of Ydj1p.
The ability of
Ydj1p, with Ssa1p, to renature proteins in vitro (34) and
the interaction of Hsp104 with Hsp70s and with Ydj1p (25)
suggested that Ydj1, like Hsp104, might be involved in [URE3]
propagation. We introduced p901, in which YDJ1 was
transcribed from the GAL1 promoter, or the parent vector,
pH316, into [URE3-2] strain 3687 and [URE3-1] strain YHE835,
selecting transformants on dextrose media. USA+
transformants were picked and grown for about 20 or 40 generations by subcloning on Leu
plates containing
dextrose or galactose and raffinose. After 40 generations on glucose,
each of 16 clones of each transformant retained [URE3], as indicated
by the uracil feeding test, as did the vector transformants on
either glucose or galactose media. After 20 generations on
galactose-raffinose, most colonies with p901 were negative or weakly
positive on the uracil feeding test. After 40 generations, each of 16 clones with p901 grown on galactose-raffinose had lost [URE3], as
assessed by the uracil feeding test. In each case, the
feeding test was done on dextrose-containing media on which
overexpression of Ydj1p is repressed, so that Ydj1p
interference with expression of [URE3] is not an issue. The
extremely slow growth of ydj1
strains and their very
inefficient mating made it difficult to test their ability to
maintain [URE3].
 |
DISCUSSION |
The biology of scrapie argues for the "crystal" view of prions
(reviewed in reference 32). One characteristic of
crystals is that closely related molecules interfere with each other's crystal formation. Indeed, overproduction of hamster PrP in transgenic mice slows development of mouse scrapie and vice versa (46). Likewise, certain PrP peptides interfere with propagation of scrapie in
tissue culture cells (8). The curing of [URE3] by
overexpression of fragments of Ure2p may be similarly explained
(20). Curing of [URE3] by even low-level expression of
fusion proteins consisting of part or all of Ure2p fused to another
protein can likewise be explained as interference with growth of the
amyloid crystal (20). The crystal model also offers an
explanation of the propagation of the alteration of protein
conformation which is believed to be central to prion propagation.
According to this model, normal Ure2p is driven to change its
conformation by the energy of interaction with other Ure2p molecules in
the amyloid filaments (Fig. 3). Finally,
the in vitro formation of amyloid by Ure2p driven by the prion domain
suggests that this linear crystal is the basis of the [URE3]
phenomenon (53).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
The crystal seed model of prion generation and possible
roles of chaperones Hsp104 and Ydj1. The energy of interaction between
the free-normal-form and the abnormal-form molecules in the crystal
drives the change of the normal form to the abnormal form. Hsp104 may
promote conversion of normal Ure2p to an intermediate or break up
aggregates to provide seeds for daughter cells. Ydj1 may be involved in
dissolving aggregates or may block a step in aggregate formation.
|
|
The first demonstration of a role for chaperones in prion propagation
was the finding that [PSI+] is lost from strains that
either overproduce or are deficient in Hsp104 (9, 10).
Because [URE3] was reported to be independent of Hsp104
(33), we directly screened for chromosomal mutants defective
in its propagation. The first mutant identified had an insertion in the
middle of the HSP104 gene. We showed that this mutant was
actually unable to propagate the [URE3] genetic element. Moreover,
the hsp104::G418 mutant with the coding
sequence completely deleted showed the same behavior. The
hsp104::G418 deletion is compatible
with the USA+ phenotype resulting from a ure2
mutation, but the [URE3] prion cannot propagate in such a strain. We
showed that a second independent [URE3] prion strain is also lost in
hsp104 strains, indicating that this dependence is not
unique to [URE3-1].
In contrast to what was found for [PSI+], we find that
overproduction of Hsp104p does not eliminate [URE3]. Kushnirov
et al. likewise found that a "synthetic" hybrid prion formed
by the amino-terminal part of Pichia methanolica
Sup35p and the C-terminal part of Saccharomyces Sup35p
also requires Hsp104 for its propagation but is not cured by
overexpression (30). [PIN+] is a
nonchromosomal genetic element that is necessary for the induction of
[PSI+] appearance by the overproduction of Sup35p
(17). [PIN+] may be a prion and, like
[URE3], is cured by deletion of HSP104 but is not cured by
overexpression of Hsp104 (16).
The mechanisms by which Hsp104 is involved in prion propagation are not
entirely understood. Since Hsp104 is capable of renaturing heat-denatured proteins both in vitro and in vivo (40), it
is likely that overproduced Hsp104 can depolymerize the aggregated Sup35p and thereby reverse the [PSI+] state
(9). While this is certainly the end result and while Sup35p
interacts with Hsp104p in vitro (49), disassembly of Sup35p
amyloid by Hsp104 has not yet been demonstrated in vitro. Hsp104 has
been shown to cooperate with Hsp70s and Hsp40s (25), and
multiple components may thus be required to reproduce this reaction in
vitro. Moreover, it is not yet certain that amyloid is the prion form
of either Ure2p or Sup35p.
The explanation for the requirement for Hsp104 for the propagation of
[PSI+] and now for [URE3] is less clear. One model is
that Hsp104 is necessary to convert the native protein into an
intermediate form that is then susceptible to conversion to the prion
(amyloid) form (9) (Fig. 3). An alternate model suggests
that Hsp104 is necessary to ensure segregation of the aggregates to
both daughter cells, thus ensuring the stability of the prion (42,
43). This model holds that without Hsp104's conversion of large
aggregates to many small aggregates, daughter cells may fail to receive
a "seed" to ensure propagation of the prion. The formation of
amyloid in vitro in the absence of Hsp104 by both the recombinant prion domain of Sup35p (24, 28) and either the prion domain of or full-length native Ure2p (53) argues against a direct role
for Hsp104 in the amyloid formation process. However, under
physiological conditions or time constraints, there may be such a requirement.
Why does overproduction of Hsp104 efficiently cure [PSI] but does not
detectably affect [URE3]? It is unlikely that Hsp104 specifically
recognizes aggregates of Sup35p and not those of Ure2p. It is more
likely that a difference in the form of the aggregates or in their
stability or amount explains this difference. Possibly different
chaperones or combinations of chaperones are responsible for
surveillance of [URE3] prions.
The curing of [URE3] by Ydj1p (an Hsp40) may involve the interactions
of Ydj1p with Hsp70s or with Hsp104 or both. Lu and Cyr showed that
guanidine-denatured luciferase could be completely renatured by the in
vitro action of Ydj1p and Ssa1p (34). Hsp104 can also
promote the partial reactivation of denatured luciferase in a yeast
crude extract in a reaction requiring Ydj1p and Ssa1p as well
(25). Overproduced Ydj1p may directly block the
formation of amyloid by Ure2p without cooperation with other chaperones and thereby prevent propagation of [URE3] (Fig. 3). Alternatively, it
is possible that Ydj1p interferes with [URE3] propagation by occupying Hsp104 or Hsp70 in interactions not productive for
[URE3] propagation.
The involvement of the chaperones Hsp104 and Ydj1 in [URE3]
propagation indicates that the mechanism of [URE3] involves altered conformational states of Ure2p rather than a covalent modification. It
will be of interest to determine the effects of these chaperones and
others on in vitro amyloid formation by Ure2p and its fragments.
 |
ACKNOWLEDGMENTS |
We thank Daniel Masison for help with the [PSI] experiments,
Giman Jung for help with Western blots, and B. Tibor Roberts for
valuable advice. We are grateful to Magdalena Boguta (Warsaw, Poland)
for pFL44L-HSP104.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Bldg. 8, Room
225, N.I.H., 8 Center Dr. MSC0830, Bethesda, MD 20892-0830. Phone:
(301) 496-3452. Fax: (301) 402-0240. E-mail:
wickner{at}helix.nih.gov.
 |
REFERENCES |
| 1.
|
Alper, T.,
W. A. Cramp,
D. A. Haig, and M. C. Clarke.
1967.
Does the agent of scrapie replicate without nucleic acid?
Nature
214:764-766[CrossRef][Medline].
|
| 2.
|
Atencio, D., and M. Yaffe.
1992.
MAS5, a yeast homolog of DnaJ involved in mitochondrial import.
Mol. Cell. Biol.
12:283-291[Abstract/Free Full Text].
|
| 3.
|
Bechet, J.,
M. Grenson, and J. M. Wiame.
1970.
Mutations affecting the repressibility of arginine biosynthetic enzymes in Saccharomyces cerevisiae.
Eur. J. Biochem.
12:31-39[Medline].
|
| 4.
|
Becker, J.,
W. Walter,
W. Yan, and E. A. Craig.
1996.
Functional interaction of cytosolic hsp70 and a DnaJ-related protein, Ydj1p, in protein translocation in vivo.
Mol. Cell. Biol.
16:4378-4386[Abstract].
|
| 5.
|
Boeke, J. D.,
F. LaCroute, and G. R. Fink.
1984.
A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance.
Mol. Gen. Genet.
197:345-346[CrossRef][Medline].
|
| 6.
|
Burns, N.,
B. Grimwade,
P. B. Ross-Macdonald,
E. Y. Choi,
K. Finberg,
G. S. Roeder, and M. Snyder.
1994.
Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.
Genes Dev.
8:1087-1105[Abstract/Free Full Text].
|
| 7.
|
Caplan, A., and M. G. Douglas.
1991.
Characterization of YDJ1: a yeast homolog of the bacterial dnaJ protein.
J. Cell Biol.
114:609-621[Abstract/Free Full Text].
|
| 8.
|
Chabry, J.,
B. Caughey, and B. Chesebro.
1998.
Specific inhibition of in vitro formation of protease-resistant prion protein by synthetic peptides.
J. Biol. Chem.
273:13203-13207[Abstract/Free Full Text].
|
| 9.
|
Chernoff, Y. O.,
S. L. Lindquist,
B.-I. Ono,
S. G. Inge-Vechtomov, and S. W. Liebman.
1995.
Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+].
Science
268:880-884[Abstract/Free Full Text].
|
| 10.
|
Chernoff, Y. O., and B.-I. Ono.
1992.
Dosage-dependent modifiers of PSI-dependent omnipotent suppression in yeast, p. 101-107.
In
A. J. P. Brown, M. F. Tuite, and J. E. G. McCarthy (ed.), Protein synthesis and targeting in yeast. Springer-Verlag, Berlin, Germany.
|
| 11.
|
Christianson, T. W.,
R. S. Sikorski,
M. Dante,
J. H. Shero, and P. Hieter.
1992.
Multifunctional yeast high-copy-number shuttle vectors.
Gene
110:119-122[CrossRef][Medline].
|
| 12.
|
Conde, J., and G. R. Fink.
1976.
A mutant of Saccharomyces cerevisiae defective for nuclear fusion.
Proc. Natl. Acad. Sci. USA
73:3651-3655[Abstract/Free Full Text].
|
| 13.
|
Cooper, T. G.
1982.
Nitrogen metabolism in Saccharomyces cerevisiae, p. 39-99.
In
J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces: metabolism and gene expression, vol. 2. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 14.
|
Coschigano, P. W., and B. Magasanik.
1991.
The URE2 gene product of Saccharomyces cerevisiae plays an important role in the cellular response to the nitrogen source and has homology to glutathione S-transferases.
Mol. Cell. Biol.
11:822-832[Abstract/Free Full Text].
|
| 15.
|
Cox, B. S.
1965.
PSI, a cytoplasmic suppressor of super-suppressor in yeast.
Heredity
20:505-521.
|
| 16.
|
Derkatch, I. L.,
M. E. Bradley,
S. V. Masse,
S. P. Zadorsky,
G. V. Polozkov,
S. G. Inge-Vechtomov, and S. W. Liebman.
2000.
Dependence and independence of [PSI(+)] and [PIN(+)]: a two-prion system in yeast?
EMBO J.
19:1942-1952[CrossRef][Medline].
|
| 17.
|
Derkatch, I. L.,
M. E. Bradley,
P. Zhou,
Y. O. Chernoff, and S. W. Liebman.
1997.
Genetic and environmental factors affecting the de novo appearance of the [PSI+] prion in Saccharomyces cerevisiae.
Genetics
147:507-519[Abstract].
|
| 18.
|
Derkatch, I. L.,
Y. O. Chernoff,
V. V. Kushnirov,
S. G. Inge-Vechtomov, and S. W. Liebman.
1996.
Genesis and variability of [PSI] prion factors in Saccharomyces cerevisiae.
Genetics
144:1375-1386[Abstract].
|
| 19.
|
Drillien, R.,
M. Aigle, and F. Lacroute.
1973.
Yeast mutants pleiotropically impaired in the regulation of the two glutamate dehydrogenases.
Biochem. Biophys. Res. Commun.
53:367-372[CrossRef][Medline].
|
| 20.
|
Edskes, H. K.,
V. T. Gray, and R. B. Wickner.
1999.
The [URE3] prion is an aggregated form of Ure2p that can be cured by overexpression of Ure2p fragments.
Proc. Natl. Acad. Sci. USA
96:1498-1503[Abstract/Free Full Text].
|
| 21.
|
Edskes, H. K.,
J. A. Hanover, and R. B. Wickner.
1999.
Mks1p is a regulator of nitrogen catabolism upstream of Ure2p in Saccharomyces cerevisiae.
Genetics
153:585-594[Abstract/Free Full Text].
|
| 22.
|
Edskes, H. K., and R. B. Wickner.
2000.
A protein required for prion generation: [URE3] induction requires the Ras-regulated Mks1 protein.
Proc. Natl. Acad. Sci. USA
97:6625-6629[Abstract/Free Full Text].
|
| 23.
|
Gietz, R. D.,
R. H. Schiestl,
A. R. Willems, and R. A. Woods.
1995.
Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure.
Yeast
11:355-360[CrossRef][Medline].
|
| 24.
|
Glover, J. R.,
A. S. Kowal,
E. C. Shirmer,
M. M. Patino,
J.-J. Liu, and S. Lindquist.
1997.
Self-seeded fibers formed by Sup35, the protein determinant of [PSI+], a heritable prion-like factor of S. cerevisiae.
Cell
89:811-819[CrossRef][Medline].
|
| 25.
|
Glover, J. R., and S. Lindquist.
1998.
Hsp104, Hsp70, and Hsp40: a novel chaperone system that rescues previously aggregated proteins.
Cell
94:73-82[CrossRef][Medline].
|
| 26.
|
Griffith, J. S.
1967.
Self-replication and scrapie.
Nature
215:1043-1044[CrossRef][Medline].
|
| 27.
|
Jung, G.,
G. Jones,
R. D. Wegrzyn, and D. C. Masison.
2000.
A role for cytosolic Hsp70 in yeast [PSI+] prion propagation and [PSI+] as a cellular stress.
Genetics,
156:559-570[Abstract/Free Full Text].
|
| 28.
|
King, C.-Y.,
P. Tittmann,
H. Gross,
R. Gebert,
M. Aebi, and K. Wuthrich.
1997.
Prion-inducing domain 2-114 of yeast Sup35 protein transforms in vitro into amyloid-like filaments.
Proc. Natl. Acad. Sci. USA
94:6618-6622[Abstract/Free Full Text].
|
| 29.
|
Kirschner, D. A.,
D. B. Teplow, and A. M. Damas.
2000.
Twist and sheet: variations on the theme of amyloid.
J. Struct. Biol.
130:87-130[CrossRef][Medline].
|
| 30.
|
Kushnirov, V. V.,
N. V. Kochneva-Pervukhova,
M. B. Cechenova,
N. S. Frolova, and M. D. Ter-Avanesyan.
2000.
Prion properties of the Sup35 protein of yeast Pichia methanolica.
EMBO J.
19:324-331[CrossRef][Medline].
|
| 31.
|
Lacroute, F.
1971.
Non-Mendelian mutation allowing ureidosuccinic acid uptake in yeast.
J. Bacteriol.
106:519-522[Abstract/Free Full Text].
|
| 32.
|
Lansbury, P. T., and B. Caughey.
1995.
The chemistry of scrapie infection: implications of the `ice 9' metaphor.
Curr. Biol.
2:1-5.
|
| 33.
|
Liebman, S. W., and I. L. Derkatch.
1999.
The yeast [PSI+] prion: making sense out of nonsense.
J. Biol. Chem.
274:1181-1184[Free Full Text].
|
| 34.
|
Lu, Z., and D. M. Cyr.
1998.
Protein folding activity of Hsp70 is modified differentially by the Hsp40 co-chaperones Sis1 and Ydj1.
J. Biol. Chem.
273:27824-27830[Abstract/Free Full Text].
|
| 35.
|
Ma, H.,
S. Kunes,
P. J. Schatz, and D. Botstein.
1987.
Plasmid construction by homologous recombination in yeast.
Gene
58:201-216[CrossRef][Medline].
|
| 36.
|
Magasanik, B.
1992.
Regulation of nitrogen utilization, p. 283-317.
In
E. W. Jones, J. R. Pringle, and J. R. Broach (ed.), The molecular and cellular biology of the yeast Saccharomyces, 2nd ed., vol. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Masison, D. C.,
M.-L. Maddelein, and R. B. Wickner.
1997.
The prion model for [URE3] of yeast: spontaneous generation and requirements for propagation.
Proc. Natl. Acad. Sci. USA
94:12503-12508[Abstract/Free Full Text].
|
| 38.
|
Masison, D. C., and R. B. Wickner.
1995.
Prion-inducing domain of yeast Ure2p and protease resistance of Ure2p in prion-containing cells.
Science
270:93-95[Abstract/Free Full Text].
|
| 39.
|
Meacham, G. C.,
B. L. Browne,
W. Zhang,
R. Kellermayer,
D. M. Bedwell, and D. M. Cyr.
1999.
Mutations in the yeast Hsp40 chaperone protein Ydj1 cause defects in Axl1 biogenesis and pro-a-factor processing.
J. Biol. Chem.
274:34396-34402[Abstract/Free Full Text].
|
| 40.
|
Parsell, D. A.,
A. S. Kowal,
M. A. Singer, and S. Lindquist.
1994.
Protein disaggregation mediated by heat-shock protein Hsp104.
Nature
372:475-478[CrossRef][Medline].
|
| 41.
|
Patino, M. M.,
J.-J. Liu,
J. R. Glover, and S. Lindquist.
1996.
Support for the prion hypothesis for inheritance of a phenotypic trait in yeast.
Science
273:622-626[Abstract].
|
| 42.
|
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1997.
In vitro propagation of the prion-like state of yeast Sup35 protein.
Science
277:381-383[Abstract/Free Full Text].
|
| 43.
|
Paushkin, S. V.,
V. V. Kushnirov,
V. N. Smirnov, and M. D. Ter-Avanesyan.
1996.
Propagation of the yeast prion-like [psi+] determinant is mediated by oligomerization of the SUP35-encoded polypeptide chain release factor.
EMBO J.
15:3127-3134[Medline].
|
| 44.
|
Prusiner, S. B.
1982.
Novel proteinaceous infectious particles cause scrapie.
Science
216:136-144[Abstract/Free Full Text].
|
| 45.
|
Prusiner, S. B.
1998.
Prions.
Proc. Natl. Acad. Sci. USA
95:13363-13383[Abstract/Free Full Text].
|
| 46.
|
Prusiner, S. B.,
M. Scott,
D. Foster,
K.-M. Pan,
D. Groth,
C. Mirenda,
M. Torchia,
S.-L. Yang,
D. Serban,
G. A. Carlson,
P. C. Hoppe,
D. Westaway, and S. J. DeArmond.
1990.
Transgenic studies implicate interactions between homologous PrP isoforms in scrapie prion replication.
Cell
63:673-686[CrossRef][Medline].
|
| 47.
|
Rai, R.,
F. Genbauffe,
H. Z. Lea, and T. G. Cooper.
1987.
Transcriptional regulation of the DAL5 gene in Saccharomyces cerevisiae.
J. Bacteriol.
169:3521-3524[Abstract/Free Full Text].
|
| 48.
|
Riles, L.,
J. E. Dutchik,
A. Baktha,
B. K. McCauley,
E. C. Thayer,
M. P. Leckie,
V. V. Braden,
J. E. Depke, and M. V. Olson.
1993.
Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs.
Genetics
134:81-150[Abstract].
|
| 49.
|
Schirmer, E. C., and S. Lindquist.
1997.
Interactions of the chaperone Hsp104 with yeast Sup35 and mammalian PrP.
Proc. Natl. Acad. Sci. USA
94:13932-13937[Abstract/Free Full Text].
|
| 50.
|
Sherman, F.
1991.
Getting started with yeast.
Methods Enzymol.
194:3-21[CrossRef][Medline].
|
| 51.
|
Sikorski, R. S., and P. Hieter.
1989.
A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:19-27[Abstract/Free Full Text].
|
| 52.
|
Stansfield, I.,
K. M. Jones,
V. V. Kushnirov,
A. R. Dagkesamanskaya,
A. I. Poznyakovski,
S. V. Paushkin,
C. R. Nierras,
B. S. Cox,
M. D. Ter-Avanesyan, and M. F. Tuite.
1995.
The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae.
EMBO J.
14:4365-4373[Medline].
|
| 53.
|
Taylor, K. L.,
N. Cheng,
R. W. Williams,
A. C. Steven, and R. B. Wickner.
1999.
Prion domain initiation of amyloid formation in vitro from native Ure2p.
Science
283:1339-1343[Abstract/Free Full Text].
|
| 54.
|
Turoscy, V., and T. G. Cooper.
1987.
Ureidosuccinate is transported by the allantoate transport system in Saccharomyces cerevisiae.
J. Bacteriol.
169:2598-2600[Abstract/Free Full Text].
|
| 55.
|
Weissmann, C.
1999.
Molecular genetics of transmissible spongiform encephalopathies.
J. Biol. Chem.
274:3-6[Free Full Text].
|
| 56.
|
Wickner, R. B.
1994.
Evidence for a prion analog in S. cerevisiae: the [URE3] non-Mendelian genetic element as an altered URE2 protein.
Science
264:566-569[Abstract/Free Full Text].
|
| 57.
|
Wickner, R. B.
1997.
Prion diseases of mammals and yeast: molecular mechanisms and genetic features. R. G.
Landes Company, Austin, Tex.
|
| 58.
|
Wickner, R. B., and Y. Chernoff.
1999.
Prions of yeast and fungi: [URE3], [PSI] and [Het-s] discovered as heritable traits, p. 229-272.
In
S. B. Prusiner (ed.), Prions. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 59.
|
Wickner, R. B.,
H. K. Edskes,
M.-L. Maddelein,
K. L. Taylor, and H. Moriyama.
1999.
Prions of yeast and fungi: proteins as genetic material.
J. Biol. Chem.
274:555-558[Free Full Text].
|
| 60.
|
Zhouravleva, G.,
L. Frolova,
X. LeGoff,
R. LeGuellec,
S. Inge-Vectomov,
L. Kisselev, and M. Philippe.
1995.
Termination of translation in eukaryotes is governed by two interacting polypeptide chain release factors, eRF1 and eRF3.
EMBO J.
14:4065-4072[Medline].
|
Molecular and Cellular Biology, December 2000, p. 8916-8922, Vol. 20, No. 23
0270-7306/00/$04.00+0
This article has been cited by other articles:
-
Sharma, D., Masison, D. C.
(2008). Functionally Redundant Isoforms of a Yeast Hsp70 Chaperone Subfamily Have Different Antiprion Effects. Genetics
179: 1301-1311
[Abstract]
[Full Text]
-
Savistchenko, J., Krzewska, J., Fay, N., Melki, R.
(2008). Molecular Chaperones and the Assembly of the Prion Ure2p in Vitro. J. Biol. Chem.
283: 15732-15739
[Abstract]
[Full Text]
-
Bagriantsev, S. N., Gracheva, E. O., Richmond, J. E., Liebman, S. W.
(2008). Variant-specific [PSI+] Infection Is Transmitted by Sup35 Polymers within [PSI+] Aggregates with Heterogeneous Protein Composition. Mol. Biol. Cell
19: 2433-2443
[Abstract]
[Full Text]
-
Malato, L., Dos Reis, S., Benkemoun, L., Sabate, R., Saupe, S. J.
(2007). Role of Hsp104 in the Propagation and Inheritance of the [Het-s] Prion. Mol. Biol. Cell
18: 4803-4812
[Abstract]
[Full Text]
-
Shewmaker, F., Mull, L., Nakayashiki, T., Masison, D. C., Wickner, R. B.
(2007). Ure2p Function Is Enhanced by Its Prion Domain in Saccharomyces cerevisiae. Genetics
176: 1557-1565
[Abstract]
[Full Text]
-
Kryndushkin, D., Wickner, R. B.
(2007). Nucleotide Exchange Factors for Hsp70s Are Required for [URE3] Prion Propagation in Saccharomyces cerevisiae. Mol. Biol. Cell
18: 2149-2154
[Abstract]
[Full Text]
-
Lian, H.-Y., Zhang, H., Zhang, Z.-R., Loovers, H. M., Jones, G. W., Rowling, P. J. E., Itzhaki, L. S., Zhou, J.-M., Perrett, S.
(2007). Hsp40 Interacts Directly with the Native State of the Yeast Prion Protein Ure2 and Inhibits Formation of Amyloid-like Fibrils. J. Biol. Chem.
282: 11931-11940
[Abstract]
[Full Text]
-
Immel, F., Jiang, Y., Wang, Y.-Q., Marchal, C., Maillet, L., Perrett, S., Cullin, C.
(2007). In Vitro Analysis of SpUre2p, a Prion-related Protein, Exemplifies the Relationship between Amyloid and Prion. J. Biol. Chem.
282: 7912-7920
[Abstract]
[Full Text]
-
Loovers, H. M., Guinan, E., Jones, G. W.
(2007). Importance of the Hsp70 ATPase Domain in Yeast Prion Propagation. Genetics
175: 621-630
[Abstract]
[Full Text]
-
Hung, G.-C., Masison, D. C.
(2006). N-Terminal Domain of Yeast Hsp104 Chaperone Is Dispensable for Thermotolerance and Prion Propagation but Necessary for Curing Prions by Hsp104 Overexpression. Genetics
173: 611-620
[Abstract]
[Full Text]
-
Wu, Y.-X., Greene, L. E., Masison, D. C., Eisenberg, E.
(2005). Curing of yeast [PSI+] prion by guanidine inactivation of Hsp104 does not require cell division. Proc. Natl. Acad. Sci. USA
102: 12789-12794
[Abstract]
[Full Text]
-
Gokhale, K. C., Newnam, G. P., Sherman, M. Y., Chernoff, Y. O.
(2005). Modulation of Prion-dependent Polyglutamine Aggregation and Toxicity by Chaperone Proteins in the Yeast Model. J. Biol. Chem.
280: 22809-22818
[Abstract]
[Full Text]
-
Song, Y., Wu, Y.-x., Jung, G., Tutar, Y., Eisenberg, E., Greene, L. E., Masison, D. C.
(2005). Role for Hsp70 Chaperone in Saccharomyces cerevisiae Prion Seed Replication. Eukaryot Cell
4: 289-297
[Abstract]
[Full Text]
-
Tkach, J. M., Glover, J. R.
(2004). Amino Acid Substitutions in the C-terminal AAA+ Module of Hsp104 Prevent Substrate Recognition by Disrupting Oligomerization and Cause High Temperature Inactivation. J. Biol. Chem.
279: 35692-35701
[Abstract]
[Full Text]
-
Kimura, Y., Koitabashi, S., Kakizuka, A., Fujita, T.
(2004). The role of pre-existing aggregates in Hsp104-dependent polyglutamine aggregate formation and epigenetic change of yeast prions. GENES CELLS
9: 685-696
[Abstract]
[Full Text]
-
Jones, G., Song, Y., Chung, S., Masison, D. C.
(2004). Propagation of Saccharomyces cerevisiae [PSI+] Prion Is Impaired by Factors That Regulate Hsp70 Substrate Binding. Mol. Cell. Biol.
24: 3928-3937
[Abstract]
[Full Text]
-
Schirmer, E. C., Homann, O. R., Kowal, A. S., Lindquist, S.
(2004). Dominant Gain-of-Function Mutations in Hsp104p Reveal Crucial Roles for the Middle Region. Mol. Biol. Cell
15: 2061-2072
[Abstract]
[Full Text]
-
Wickner, R. B., Edskes, H. K., Roberts, B. T., Baxa, U., Pierce, M. M., Ross, E. D., Brachmann, A.
(2004). Prions: proteins as genes and infectious entities. Genes Dev.
18: 470-485
[Full Text]
-
Grimminger, V., Richter, K., Imhof, A., Buchner, J., Walter, S.
(2004). The Prion Curing Agent Guanidinium Chloride Specifically Inhibits ATP Hydrolysis by Hsp104. J. Biol. Chem.
279: 7378-7383
[Abstract]
[Full Text]
-
Baudin-Baillieu, A., Fernandez-Bellot, E., Reine, F., Coissac, E., Cullin, C.
(2003). Conservation of the Prion Properties of Ure2p through Evolution. Mol. Biol. Cell
14: 3449-3458
[Abstract]
[Full Text]
-
Rai, R., Tate, J. J., Cooper, T. G.
(2003). Ure2, a Prion Precursor with Homology to Glutathione S-Transferase, Protects Saccharomyces cerevisiae Cells from Heavy Metal Ion and Oxidant Toxicity. J. Biol. Chem.
278: 12826-12833
[Abstract]
[Full Text]
-
Jones, G. W., Masison, D. C.
(2003). Saccharomyces cerevisiae Hsp70 Mutations Affect [PSI+] Prion Propagation and Cell Growth Differently and Implicate Hsp40 and Tetratricopeptide Repeat Cochaperones in Impairment of [PSI+]. Genetics
163: 495-506
[Abstract]
[Full Text]
-
Ness, F., Ferreira, P., Cox, B. S., Tuite, M. F.
(2002). Guanidine Hydrochloride Inhibits the Generation of Prion "Seeds" but Not Prion Protein Aggregation in Yeast. Mol. Cell. Biol.
22: 5593-5605
[Abstract]
[Full Text]
-
Lockshon, D.
(2002). A Heritable Structural Alteration of the Yeast Mitochondrion. Genetics
161: 1425-1435
[Abstract]
[Full Text]
-
Jung, G., Jones, G., Masison, D. C.
(2002). Amino acid residue 184 of yeast Hsp104 chaperone is critical for prion-curing by guanidine, prion propagation, and thermotolerance. Proc. Natl. Acad. Sci. USA
99: 9936-9941
[Abstract]
[Full Text]
-
Kryndushkin, D. S., Smirnov, V. N., Ter-Avanesyan, M. D., Kushnirov, V. V.
(2002). Increased Expression of Hsp40 Chaperones, Transcriptional Factors, and Ribosomal Protein Rpp0 Can Cure Yeast Prions. J. Biol. Chem.
277: 23702-23708
[Abstract]
[Full Text]
-
Meriin, A. B., Zhang, X., He, X., Newnam, G. P., Chernoff, Y. O., Sherman, M. Y.
(2002). Huntingtin toxicity in yeast model depends on polyglutamine aggregation mediated by a prion-like protein Rnq1. J. Cell Biol.
157: 997-1004
[Abstract]
[Full Text]
-
Schwimmer, C., Masison, D. C.
(2002). Antagonistic Interactions between Yeast [PSI+] and [URE3] Prions and Curing of [URE3] by Hsp70 Protein Chaperone Ssa1p but Not by Ssa2p. Mol. Cell. Biol.
22: 3590-3598
[Abstract]
[Full Text]
-
Hattendorf, D. A., Lindquist, S. L.
(2002). Analysis of the AAA sensor-2 motif in the C-terminal ATPase domain of Hsp104 with a site-specific fluorescent probe of nucleotide binding. Proc. Natl. Acad. Sci. USA
10.1073/pnas.261693199v1
[Abstract]
[Full Text]
-
Volkov, K. V., Aksenova, A. Yu., Soom, M. J., Osipov, K. V., Svitin, A. V., Kurischko, C., Shkundina, I. S., Ter-Avanesyan, M. D., Inge-Vechtomov, S. G., Mironova, L. N.
(2002). Novel Non-Mendelian Determinant Involved in the Control of Translation Accuracy in Saccharomyces cerevisiae. Genetics
160: 25-36
[Abstract]
[Full Text]
-
Abbas-Terki, T., Donze, O., Briand, P.-A., Picard, D.
(2001). Hsp104 Interacts with Hsp90 Cochaperones in Respiring Yeast. Mol. Cell. Biol.
21: 7569-7575
[Abstract]
[Full Text]
-
Pierce, M. M., Maddelein, M.-L., Roberts, B. T., Wickner, R. B.
(2001). A novel Rtg2p activity regulates nitrogen catabolism in yeast. Proc. Natl. Acad. Sci. USA
10.1073/pnas.181486098v1
[Abstract]
[Full Text]
-
Schlumpberger, M., Prusiner, S. B., Herskowitz, I.
(2001). Induction of Distinct [URE3] Yeast Prion Strains. Mol. Cell. Biol.
21: 7035-7046
[Abstract]
[Full Text]
-
Wegrzyn, R. D., Bapat, K., Newnam, G. P., Zink, A. D., Chernoff, Y. O.
(2001). Mechanism of Prion Loss after Hsp104 Inactivation in Yeast. Mol. Cell. Biol.
21: 4656-4669
[Abstract]
[Full Text]
-
Speransky, V. V., Taylor, K. L., Edskes, H. K., Wickner, R. B., Steven, A. C.
(2001). Prion Filament Networks in [URE3] Cells of Saccharomyces cerevisiae. J. Cell Biol.
153: 1327-1336
[Abstract]
[Full Text]
-
Pierce, M. M., Maddelein, M.-L., Roberts, B. T., Wickner, R. B.
(2001). A novel Rtg2p activity regulates nitrogen catabolism in yeast. Proc. Natl. Acad. Sci. USA
98: 13213-13218
[Abstract]
[Full Text]
-
Hattendorf, D. A., Lindquist, S. L.
(2002). Analysis of the AAA sensor-2 motif in the C-terminal ATPase domain of Hsp104 with a site-specific fluorescent probe of nucleotide binding. Proc. Natl. Acad. Sci. USA
99: 2732-2737
[Abstract]
[Full Text]