INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Contrary to intuition, the predominant consequence of nonsense mutations in eukaryotes is not the synthesis of truncated proteins. Rather, many nonsense transcripts are recognized and selectively degraded by the cell via a pathway known as nonsense-mediated mRNA decay (NMD) (17, 20, 47). The basic process has been most comprehensively studied in the yeast Saccharomyces cerevisiae. NMD requires at least three trans-acting factors, termed Upf1p, Upf2p, and Upf3p (15, 27, 40, 42, 43), which localize predominantly to the cytoplasm and associate with polysomes (2, 3). An emerging model for the mechanism of NMD proposes that the first translating ribosomes displace bound proteins as they traverse a nascent cytoplasmic messenger ribonucleoprotein (mRNP) molecule (22). Ribosomal pausing at a termination codon signals recruitment of a surveillance complex consisting of, at least, eukaryotic release factors eRF1 and eRF3 and Upf1p (18). Transcript decay is induced if the surveillance complex senses premature translation termination as indicated by inappropriately bound proteins remaining 3' of the termination signal. Such proteins would normally be displaced by complete translation of the open reading frame (ORF). One such factor in yeast may be Hrp1p, a protein essential for NMD, which binds to the downstream sequence element (22), a cis-acting sequence that must be present 3' of a premature termination codon in order to trigger NMD (57, 78). Hrp1p also interacts directly with Upf1p. An intriguing possibility is that recently identified protein complexes which are deposited at spliced exon-exon junctions might serve an analogous function in mammalian cells (44).

The role of the other two Upf proteins may be to recruit transcripts to the decay pathway. Upf3p is an attractive candidate for this purpose since it contains multiple nuclear localization signals (NLS) and nuclear export signals (NES) that allow shuttling across the nuclear envelope (65). Upf2p interacts with both Upf3p and Upf1p and may function as a bridge, allowing Upf3p to deliver the nonsense transcript to the surveillance machinery (25, 26). Despite the appealing nature of this model, little is known about the precise and coordinated function of these factors. The fact that Upf proteins have pleiotropic functions adds to this complexity. The Upf proteins not only participate in the decay of nonsense transcripts but also enhance the efficiency of translational termination (48, 75). These effects are genetically separable. Forms of Upf1p with mutations in the N-terminal Cys- and His-rich domain support NMD but allow nonsense suppression (readthrough). In contrast, forms of Upf1p with mutations in the helicase domain can promote efficient translational termination but fail to effect NMD.

One theory holds that NMD may preclude or perturb events that actively determine transcript stability. Normal mRNA turnover in S. cerevisiae initiates with shortening of the poly(A) tail, followed by 5' decapping by Dcp1p and subsequent 5'-to-3' decay by the exonuclease Xrn1p (5, 39). In contrast, NMD is characterized by deadenylation-independent decapping and decay by Dcp1p and Xrn1p, respectively (53). The poly(A) tail may influence cap stability through the interaction of poly(A)-binding protein (PABP) with eukaryotic initiation factor 4G (eIF4G) (31, 70), which additionally binds the cap-binding complex (eIF4A and eIF4E) (29). The synergistic interactions of this protein complex are thought to dictate a closed-loop transcript conformation, which enhances both stability and translational efficiency (21, 60). Progressive poly(A) tail shortening accompanies transcript maturation (5). Attainment of a threshold length would preclude PABP binding and disrupt the protein complex bridging the ends of the transcript, exposing the 5' cap to the activity of Dcp1p. One model posits that NMD bypasses the need for deadenylation through prevention or disruption of the closed-loop conformation (34), although any concept of mechanism is lacking.

Many similarities, and a few apparent differences, exist between the NMD pathways in yeast and higher eukaryotes. For example, it appears that nonsense surveillance relies on conventional translation machinery in all organisms, as evidenced by sensitivity to pharmacologic translational inhibitors, hairpin structures that impair translation initiation, or suppressor tRNAs (20, 23, 47). Although the nuclear-cytoplasmic shuttling of Upf3p implies a role for the nuclear compartment in yeast NMD, even greater evidence exists for a nuclear role in mammalian cells. Subcellular fractionation studies revealed that nonsense mRNAs are reduced to the same extent in the nucleus and cytoplasm (11, 38). Furthermore, full stability was seen for cytoplasmic nonsense-containing mRNAs despite association with polysomes (66). One feature that distinguishes mammalian NMD from that in yeast is the general requirement for at least one intron downstream of the nonsense codon (10). An attractive hypothesis is that this intron serves an analogous function to the yeast downstream sequence element in defining a context within which a termination codon is considered premature. Other evidence suggests that the coding potential of a pre-mRNA can influence splicing decisions and induce either exon skipping or intron retention (9, 19). While nonsense-mediated perturbation of splicing may result via a different pathway from NMD, it suggests the ability to recognize a termination codon within an incompletely processed mRNA that is associated with the nucleus.

Very little is known about the NMD machinery in organisms other than S. cerevisiae. Although Upf1p orthologues have been identified in numerous species including Schizosaccharomyces pombe (Upf1p) (our unpublished observations), Caenorhabditis elegans (smg-2) (56), Mus musculus (rent1), and humans (rent1) (1, 58), homologues of Upf2p and Upf3p have not been described. The extent of structural and functional conservation of the NMD machinery in higher eukaryotes has therefore been left to speculation. A refined knowledge of the mechanism and role of NMD in mammals is of more than just academic importance. The function has been shown to be a potent modifier of selected dominant negative or gain-of-function phenotypes (16), presumably through the prevention of expression of deleterious truncated peptides. Furthermore, an emerging view holds that the NMD pathway regulates a significant proportion of physiologic transcripts, as evidenced by dysregulation of about 8% of the yeast transcriptome in Upf-deleted strains (45).

To further elucidate the mechanism of NMD in higher eukaryotes, we have identified and characterized homologues of Upf2p in S. pombe (Upf2p) and humans (rent2). We demonstrate that S. pombe Upf2p, a protein as structurally divergent from S. cerevisiae Upf2p as is rent2, is essential for NMD in fission yeast. rent2 interacts directly with rent1, a known trans-effector of mammalian NMD (67), utilizing regions that correspond to structurally and positionally defined domains within Upf1p and Upf2p in S. cerevisiae. rent2 harbors motifs that are capable of directing fusion peptides into the nucleus, but the native protein exists predominantly, if not exclusively, in the cytoplasm. Finally, we have identified two novel domains of Upf2p and rent2 that bear significant homology to eukaryotic proteins with a known function in the regulation of translational initiation including eukaryotic initiation factor 4G (eIF4G), poly(A)-binding protein-interacting protein 1 (PAIP-1), and NAT1 (also called DAP5 and p97) (13, 29, 32, 46, 76). Sequence conservation of these so-called eIF4G homology (4GH) domains is poorest in S. cerevisiae Upf2p, precluding recognition of this homology prior to our cloning of the S. pombe and human homologues. Regions of these proteins that mediate interactions proposed to be critical to the formation of the closed-loop conformation also span 4GH domains (33), and site-directed mutations within the 4GH domains of S. pombe Upf2p can abolish NMD activity. Additionally, we provide evidence that rent2 interacts with select components of the human translation initiation complex, eIF4AI and Sui1. The implications of these findings for the function of Upf2p and rent2 and the mechanism of NMD are discussed.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Cloning of the RENT2 cDNA. Following identification of a human expressed sequence tag (EST) (accession no. AA812020) with similarity to S. cerevisiae UPF2, the Genetrapper system (GIBCO BRL, Gaithersburg, Md.) was used to screen a SuperScript human heart cDNA library (GIBCO BRL) for additional clones. cDNA capture was performed with oligonucleotide Ob39f03.s1-1 (GCAGAAGCTGTAGCTTCCATCGTGG), and cDNA repair was carried out with Ob39f03.s1-2 (CTCTGATGTGAACTGTGCTGTGC) as specified by the manufacturer. Using this method, a clone containing 2.1 kb of coding sequence and 81 bp of the 5' untranslated region (UTR) was isolated (clone R2-GT3). The remainder of the 3' sequence was determined by sequencing EST64960 (accession no. AA356414). For 5' rapid amplification of cDNA ends (RACE), the Marathon system (Clontech, Palo Alto, Calif.) was used to amplify adult heart cDNA with primer R2-5'RACE-NEST (CGTTCCCAAGCTTCCTGATGAAGCTG). 5' RACE products were cloned into pCRII-TOPO (Invitrogen, Carlsbad, Calif.) and sequenced. The 5' endpoints of RACE products ranged from positions 110 to 124 relative to the first ATG. For 3' RACE, an initial round of amplification with primer GTR2-2A (ACACCAGAAGAACATGGGCCTGGA) was followed by nested PCR with primer GTR2-3A (CTGCATGTCTGATGTAGCAGAGG). All 3' RACE products ended at nucleotide 5093 relative to the first ATG.

Plasmid construction. For construction of the recombinant plasmids used in this study, all PCR amplifications were carried out with Pfu Turbo polymerase (Stratagene, La Jolla, Calif.) as specified by the manufacturer. All constructs were verified by direct sequencing.

UPF2::

Disruption of S. pombe Upf2p. For vegetative growth, S. pombe was grown in YEC medium (5 g of yeast extract and 2 g of Casamino Acids per liter). Selective growth was carried out in EMM supplemented with the appropriate amino acids (Bio 101, Vista, Calif.). All transformations were performed as previously described (55).

upf2::

h leu1-32 ura4-D18

h ade-M26 leu1-32 ura4-D18

h ade6-M216 leu1-32 ura4-D18

Analysis of S. pombe, mouse, and human RNA. Total RNA was isolated from logarithmically growing S. pombe using the hot-phenol method (42). For measurement of transcript decay rates, S. pombe cultures were grown to mid-log phase before inhibiting transcription with 10 µg of thiolutin (Pfizer, Groton, Conn.) per ml. Aliquots of cells were then removed at appropriate time points and immediately centrifuged, and the pellets were frozen in a dry-ice-ethanol bath. Transcript half-lives were calculated as described previously (42). For analysis of Gus transcript abundance, total RNA was isolated from mouse tissues pooled from four littermates by using Trizol reagent (GIBCO BRL). Poly(A) extraction was then performed using the Oligotex Midi kit (Qiagen). For Northern blotting, RNA was electrophoresed in 1.2% agarose-formaldehyde gels, transferred to nylon filters (GeneScreen Plus; NEN, Boston, Mass.), and hybridized with randomly primed radiolabeled probes. All hybridizations were carried out in ExpressHyb (Clontech) as specified by the manufacturer. Radioactive signals were directly quantified using an Instant Imager (Packard, Downers Grove, Ill.).

Tissue culture, transfections, and immunofluorescence. HeLa cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and an antibiotic-antimycotic mixture (GIBCO BRL). Standard tissue culture practices were followed. Transfections were carried out with Lipofectin and PLUS reagent (GIBCO BRL) as described by the manufacturer. For transfection of HA-N-rent2 or the rent2-GFP fusions, 6 µg of plasmid was used per 10-cm-diameter dish. At 48 h following transfection, appropriate cells were treated for 3 h with tissue culture medium supplemented with 2 ng of leptomycin B (a kind gift from M. Yoshida, University of Tokyo, Tokyo, Japan) per ml. Living cells expressing the GFP fusions were imaged directly. For visualization of HA-rent2 or cyclin B1, cells were fixed for 20 min in 3.7% paraformaldehyde, permeabilized for 15 min in 0.1% Triton X-100, and blocked for 30 min in 1% bovine serum albumin in phosphate-buffered saline. Anti-HA staining was carried out with a 1:1,000 dilution of affinity-purified monoclonal anti-HA antibody HA.11 (Covance, Denver, Pa.) followed by a 1:200 dilution of fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin G (Sigma, St. Louis, Mo.). A fluorescein isothiocyanate-conjugated monoclonal anti-cyclin B1 antibody (GNS1; Santa Cruz Biotechnology, Santa Cruz, Calif.) was used at a 1:50 dilution. All cells were imaged by confocal microscopy at the Johns Hopkins School of Medicine Microscopy Facility.

Two-hybrid analysis. All plasmids and strains for two-hybrid analysis were obtained from the Matchmaker system 3 kit (Clontech) with the exception of pACT2 and pAS2-1, which are components of the Matchmaker system 2 kit. YPDA and the appropriate synthetic dropout (SD) media, also obtained from Clontech, were prepared as specified by the manufacturer. Yeast transformations were performed by the lithium acetate method (63). The plasmid encoding AD(R1:1-415) led to restricted growth and mating of cells when present. For this reason, cotransformation was performed to combine this plasmid with GAL4BD fusions. All other combinations of GAL4AD and GAL4BD fusions were generated by mating. For yeast matings, GAL4AD fusions were transformed into strain Y187 and GAL4BD fusions were transformed into AH109. Single colonies from each transformed strain were mixed in 0.5 ml of YPDA medium, incubated overnight at 30°C, and plated on SD Trp, Leu plates. For conditional growth assays, colonies containing combinations of GAL4AD and GAL4BD fusions were grown overnight in liquid SD Trp, Leu medium. Stationary-phase cultures (10-µl volumes) were spotted on the appropriate selective medium and incubated at 30°C for 3 to 5 days.

Protein preparation, immunoprecipitation, and Western analysis. Total protein was isolated from logarithmically growing S. pombe strains harboring the c-myc-tagged wild-type or mutant Upf2p expression constructs as described previously (52). Protein was isolated from S. cerevisiae strains AH109 or Y187 harboring GAL4BD or GAL4AD fusions, respectively, as described previously (35). Equal amounts of protein, as confirmed by Coomassie staining, were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (8 to 10% polyacrylamide) and transferred to nitrocellulose for immunoblotting (see below).

Nucleotide sequence accession numbers. The human Upf2p orthologue rent2 and the S. pombe Upf2p sequences have been deposited in GenBank under accession no. AF301013 and AF301014, respectively.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Identification of UPF2 homologues in S. pombe and humans. The sequences for all known S. cerevisiae trans-effectors of NMD were submitted to the X-REF database genome cross-referencing effort (4). In this manner, we identified sequences from S. pombe and humans that exhibited homology to S. cerevisiae UPF2. An S. pombe chromosome I cosmid (accession no. Z98974) contained the complete genomic sequence encoding a putative Upf2p homologue (P = 1.4 × 10³⁴). The 3,150-bp ORF was not interrupted by introns. A human EST derived from tonsillar germinal B-cell cDNA (accession no. AA812010) encoded a short peptide with homology to Upf2p (P = 4.5 × 10⁵). This sequence was used to design oligonucleotides for screening a human heart cDNA library using the Genetrapper system. This resulted in the isolation of a clone containing 2.1 kb of coding sequence. An overlapping EST derived from a Jurkat cDNA library (accession no. AA356414) contained 3.1 kb of additional 3' sequence which included a termination codon and a polyadenylation signal. 5' and 3' RACE were then performed using human heart cDNA to complete and verify the terminal sequences of the cDNA. Radiation hybrid mapping using the Stanford G3 panel localized RENT2 to the human chromosomal subregion 10p13-10p15 with a logarithm of the odds (LOD) score of 13.64 at a distance of 5 centiRays from marker D10S2376 (data not shown).

View larger version (73K): [in this window] [in a new window]   FIG. 1.   Sequence alignment of S. cerevisiae Upf2p (ScUpf2p), S. pombe Upf2p (SpUpf2p), and human rent2. A ClustalW alignment was performed using the MacVector 6.5.1 package of sequence analysis software. Identical residues shared between at least two of the three proteins are shaded in black; similar residues shared between at least two of the proteins are shaded in gray. The previously identified putative or documented functional domains of S. cerevisiae Upf2p are indicated by lines.

Upf2p is required for NMD in S. pombe. To determine the effect of UPF2 deletion on the efficiency of NMD in S. pombe, a targeting vector was constructed to completely replace the Upf2p coding sequence with a URA4 expression cassette (24). The gene was disrupted in S. pombe strains containing three different nonsense mutations in the nonessential ADE6 gene (ade6-M26, ade6-M375, and ade6-469) (68). Transcripts derived from the two mutant ade6 alleles harboring 5' nonsense mutations (ade6-M26 and ade6-M375) were rapidly degraded, as inferred from low steady-state levels, while those harboring a 3' nonsense mutation (ade6-469) were not substrates for NMD. To rule out the possibility of nonspecific effects on mRNA metabolism, UPF2 was also disrupted in S. pombe strains with wild-type ADE6 or ade6 with a missense mutation (ade6-M216) (68). Correct targeting was confirmed by Southern blot analysis (data not shown). Northern blotting established that UPF2 encodes a transcript of approximately 3.7 kb which is absent in upf2 strains (Fig. 2A). All strains were viable and showed no apparent growth abnormality. Quantitative Northern blot analysis was used to measure the steady-state levels of ADE6 transcripts in the UPF2 and upf2 strains (Fig. 2B). Deletion of UPF2 had no effect on the steady-state levels of wild-type ADE6 transcripts or ade6 transcripts containing a 3' PTC or a missense mutation. In contrast, ade6 nonsense transcripts which exist at low steady-state levels in UPF2 strains accumulated to wild-type levels in upf2 strains, indicating loss of NMD function.

View larger version (61K): [in this window] [in a new window]   FIG. 2.   Upf2p is required for NMD in S. pombe. (A) S. pombe UPF2 encodes a single ~3.7-kb transcript which is absent in upf2 strains. Total RNA was isolated from logarithmically growing S. pombe strains and analyzed for UPF2 expression by Northern blotting. The blot was stripped and rehybridized with a YPT5 probe to control for loading differences. (B) Deletion of UPF2 specifically stabilizes nonsense transcripts in S. pombe. The complete UPF2 ORF was disrupted in S. pombe strains which were wild type at the nonessential ADE6 locus (wt), harbored two different nonsense mutations near the 5' end of the ADE6 gene which give rise to transcripts degraded by NMD (ade6-M26 and ade6-M375; 5' PTC1 and 5' PTC2, respectively), contained a nonsense mutation near the 3' end of ADE6 which is not a substrate for NMD (ade6-469; 3' PTC), or contained a missense mutation (ade6-M216; mis). To measure the steady-state levels of wild-type or mutant ADE6 transcripts, total RNA was analyzed by Northern blotting with an ADE6 probe. The blot was stripped and rehybridized with a YPT5 probe to control for loading differences. (C) The decreased steady-state level of ade6 nonsense transcripts is due to a UPF2-dependent accelerated mRNA decay rate. The half-life (t1/2) of wild-type (WT) ADE6 or mutant ade6 transcripts containing a nonsense mutation (5'PTC2; ade6-M375) was determined in UPF2 or upf2 strains. Transcription was inhibited with thiolutin, and transcript abundance was determined by Northern blot analysis at the indicated time points.

Tissue-specific variation in RENT2 expression does not influence the efficiency of NMD. A Northern blot containing mRNA from multiple adult human tissues was hybridized with a RENT2 cDNA fragment corresponding to nucleotides 2638 to 2879 (Fig. 3A). All tissues tested exhibited a single signal of variable intensity corresponding to a transcript size of approximately 5.2 kb, as predicted from the cDNA sequence. Thus, both RENT1 (58) and RENT2 are ubiquitously expressed and both show tissue-specific variation in abundance. Both are highly expressed in the heart, skeletal muscles, kidneys, and placenta. The brain shows the lowest expression of RENT2 but relatively high expression of RENT1, whereas the inverse is true for the liver.

View larger version (59K): [in this window] [in a new window]   FIG. 3.   Variation in RENT2 expression does not influence the efficiency of NMD. (A) Expression of RENT2 was assessed in adult human tissues by probing a multi-tissue Northern blot (Clontech) with a human RENT2 cDNA fragment. The blot was stripped and rehybridized with a -actin cDNA probe to control for loading differences. (B) Expression of mouse Rent2 in adult tissues was analyzed by hybridizing a mouse multi-tissue Northern blot (Clontech) with a mouse Rent2 cDNA probe. -Actin was again used as a loading control. (C) Northern blot analysis of poly(A) RNA from wild-type or homozygous mutant gusmps mice. To measure steady-state Gus transcript levels, 2 µg of poly(A) RNA from the indicated adult tissues was probed with a Gus cDNA fragment. The blot was stripped and rehybridized with a G3PDH probe to control for loading differences.

RENT2 localizes to the cytoplasmic compartment. As an initial attempt to determine the subcellular localization of rent2, an N-terminal HA-tagged full-length rent2 expression construct was fashioned and transiently transfected into HeLa cells. Western blotting confirmed the expression of a recombinant protein of the appropriate size (data not shown). Indirect immunofluorescence performed with a monoclonal anti-HA antibody followed by confocal microscopy revealed an exclusively cytoplasmic distribution of the tagged protein (Fig. 4).

View larger version (26K): [in this window] [in a new window]   FIG. 4.   rent2 localizes to the cytoplasmic compartment of mammalian cells despite possessing functional NLSs. The subcellular localization of N-terminal HA-tagged full-length rent2 (HA-rent2), a full-length C-terminal rent2-GFP fusion (rent2-GFP), or the N-terminal 120 amino acids of rent2 fused to GFP [rent2(1-120)GFP] was determined in transiently transfected HeLa cells in the presence or absence of the inhibitor of nuclear export leptomycin B. As a positive control for leptomycin B treatment, the subcellular localization of cyclin B1 was determined in the presence or absence of the drug.

Conserved rent1-rent2 interactions. In S. cerevisiae, interaction between Upf1p and Upf2p is required for the formation of a functional nonsense surveillance complex (25, 26). If the mechanism of NMD is conserved between yeast and mammals, rent1, a known trans effector of mammalian NMD and orthologue of Upf1p (1, 58, 67), should interact with rent2 in an analogous fashion. To test this hypothesis, we used the yeast two-hybrid system to assess for interactions between full-length and truncated forms of rent1 and rent2 (Fig. 5). rent1-GAL4 activating-domain (GAL4AD) fusion constructs and rent2-GAL4 DNA-binding-domain (GAL4BD) fusion constructs (Fig. 5A) were prepared and cointroduced into yeast strain AH109, which contains the ADE2 and HIS3 reporter genes driven by a GAL4 upstream activating sequence. The known interaction between SV40 large T antigen and p53 (51) served as a positive control, and the absence of interaction with lamin C served as a negative control. All fusion proteins were expressed as myc- or HA-tagged forms, and all showed comparable levels of expression by Western blot analysis except for the full-length rent2-GAL4BD fusion, which was produced at a significantly reduced level (data not shown).

View larger version (43K): [in this window] [in a new window]   FIG. 5.   Conserved rent1 and rent2 interactions. (A) Schematic representation of rent1-GAL4 activation domain (GAL4AD) and rent2-GAL4 DNA-binding domain (GAL4BD) fusion constructs. Predicted functional domains of rent1 and rent2 based on homology to S. cerevisiae Upf1p and Upf2p, respectively, are shaded. Overlying numbers indicate amino acid position. (B) Stringent growth assay for interaction. The indicated GAL4AD and GAL4BD fusion constructs were co-introduced into strain AH109 and plated on minimal medium lacking Trp and Leu (left) to select for cotransformants or plated on medium lacking Trp, Leu, His, and Ade (right) to select for interacting proteins. As a positive control, SV40 large T antigen (SV40-T)-GAL4AD and p53-GAL4BD fusion constructs were used to test a known interaction between these proteins. The lack of interactions with a lamin C-GAL4BD fusion peptide served as a negative control. (C) Reduced-stringency growth assay for interaction. rent2-GAL4BD fusions which failed to interact with rent1-GAL4AD fusions were tested on minimal media lacking Trp, Leu, and His. (D) Coimmunoprecipitation of rent1 and rent2. Cell extracts from HeLa cells overexpressing rent1 alone (lane 1) or rent1 plus either HA-tagged luciferase (lane 2), residues 1 to 1095 of rent2 with a C-terminal HA tag (lane 3), or residues 757 to 1272 of rent2 with a C-terminal HA tag (lane 4) were precipitated with an anti-HA monoclonal antibody (Covance) and analyzed by Western blotting. Duplicate blots from the same experiment are shown, probed with anti-rent1 antiserum (upper panel) or an anti-HA monoclonal antibody (lower panel). The intense lower band in all lanes is the heavy chain of the anti-HA antibody used for immunoprecipitation.

Novel functional domains of Upf2p/rent2 exhibit homology to eIF4G. BLAST analysis of the rent2 amino acid sequence revealed a domain with homology to proteins with a known function in the regulation of translation initiation, including eIF4G, PAIP-1, and NAT1/DAP5/p97 (Fig. 6A) (13, 29, 32, 46, 76). This motif, which we have termed the 4GH domain, is repeated twice in S. cerevisiae Upf2p (residues 469 to 517 and 677 to 725), S. pombe Upf2p (residues 543 to 590 and 746 to 794), and rent2 (residues 667 to 714 and 872 to 916). Sequence conservation is poorest in S. cerevisiae Upf2p, precluding recognition of this homology prior to our cloning of the S. pombe and human homologues. Interestingly, the more N-terminal 4GH domain, which we refer to as 4GH1, falls within the previously designated transmembrane domain of Upf2p (27). Deletion of this region of S. cerevisiae Upf2p is sufficient to abolish the function of this protein (25). The more C-terminal 4GH domain, termed 4GH2, falls within the Upf3p-interacting domain. All 4GH domains, including those contained within Upf2p homologues as well as eukaryotic translational regulatory proteins, show strict preservation of an aromatic residue (F or Y) at position 3 and a glutamic acid (E) at position 6 (Fig. 6A).

View larger version (43K): [in this window] [in a new window]   FIG. 6.   The 4GH domains of S. pombe Upf2p are required for NMD. (A) Alignment of all known 4GH domains. With the exception of S. cerevisiae Upf2p (ScUpf2p) and S. pombe Upf2p (SpUpf2p), all proteins shown are human. Arrows indicate residues mutated in the upf2-4GH1 and upf2-4GH2 S. pombe Upf2p expression constructs. (B) Effect of 4GH mutations on the function of S. pombe Upf2p. A upf2 S. pombe strain harboring a nonsense mutation in ADE6 (ade6-M375) was transformed with an empty expression vector or vector containing wild-type S. pombe UPF2 (UPF2), UPF2 mutated at positions 3 and 6 of 4GH1 (upf2-4GH1), UPF2 mutated at positions 3 and 6 of 4GH2 (upf2-4GH2), or UPF2 mutated at positions 3 and 6 of both 4GH domains (upf2-4GH1,2). The steady-state levels of the ade6 nonsense transcript were determined by quantitative Northern blot analysis. Following hybridization with an ADE6 probe, the blot was reprobed for YPT5 to standardize for loading differences. The ade6/YPT5 ratio was calculated for each sample and normalized to the ratio measured in the upf strain.

View larger version (50K): [in this window] [in a new window]   FIG. 7.   Two-hybrid analysis of rent2-translation initiation factor interactions. (A) Schematic representation of the rent2-GAL4 DNA-binding domain (GAL4BD) fusion constructs used in this study. (B) Growth assay for interaction. Full-length human eIF4AI [eIF4AI(1-407)], truncated human eIF4AI [eIF4AI(1-325)], human Sui1, and human Prt1 were fused to the GAL4AD and cointroduced into strain AH109 with the indicated GAL4BD fusions. Yeast strains were plated on minimal medium lacking Trp and Leu (left) to select for cotransformants or plated on medium lacking Trp, Leu, and His (right) to select for interacting proteins. SV40 large T antigen (SV40-T)-GAL4AD and p53-GAL4BD fusion constructs were used as a positive control, and a lamin C-GAL4BD fusion peptide served as a negative control.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The recognition and accelerated decay of transcripts harboring premature termination codons, a phenomenon known as NMD, is a ubiquitous feature of eukaryotic cells (17). Despite this complete conservation of function, very little is known about the mechanism of NMD in higher eukaryotes. In S. cerevisiae, at least three trans effectors, Upf1p to Upf3p, are required for NMD (15, 27, 40, 42, 43). In C. elegans, seven factors, termed smg-1 to smg-7, are necessary (7, 30, 59). smg-2, the C. elegans orthologue of the Upf1p protein, is the only smg gene with a known counterpart in yeast (56). The apparent minimal overlap between the proteins which mediate NMD in yeast and C. elegans has lead to the presumption that higher eukaryotes use an NMD apparatus based on a fundamentally different set of factors from those used by more primitive cells. Here, we provide evidence that the nonsense surveillance pathway in evolutionarily divergent organisms utilizes structurally and functionally related machinery.

Evolutionary conservation of Upf2p function. In this report, we describe Upf2p homologues in S. pombe and humans (rent2). Although S. pombe Upf2p exhibits only 22% identity to S. cerevisiae Upf2p, disruption of the gene established that the orthologue is essential for NMD in fission yeast. rent2, a protein equally divergent from S. cerevisiae Upf2p as is S. pombe Upf2p, interacts with rent1, a known trans effector of NMD in mammalian cells (1, 58, 67). This interaction is mediated by residues in rent1 and rent2 which correspond well to the domains which mediate the association of S. cerevisiae Upf1p and Upf2p (26). These data strongly argue that the function of Upf2p in the decay of nonsense transcripts is conserved throughout evolution. Indeed, other species also appear to possess Upf2p homologues. In addition to the genes described in this report, GenBank contains sequences from zebra fish, Drosophila, C. elegans, and Arabidopsis that encode proteins with significant homology to Upf2p (our unpublished observations). These results imply significant mechanistic overlap of the NMD pathway in many, if not all, eukaryotes.

Subcellular localization of rent2. It is widely accepted that cytoplasmic translation is required for nonsense surveillance in S. cerevisiae (49). Experimental perturbations or transcript conformations that are known to impair translation initiation or elongation also abrogate NMD in mammalian cells (20, 47). Nevertheless, careful subcellular fractionation of mammalian cells has established that for most nonsense mRNAs, any decrease in cytoplasmic steady-state abundance or stability can be fully attributed to a reduction observed in the nuclear fraction (11, 38). A role for the nucleus in yeast NMD is also suggested by the observation that Upf3p shuttles between nuclear and cytoplasmic compartments (65). The prevailing view contends that scanning and decay occur very early in the cytoplasmic life of a transcript, while the mRNA is still associated with, but not confined to, the nuclear compartment (73). Shuttling of Upf3p and perhaps additional NMD trans effectors would be an effective mechanism of positioning them at or near the nuclear pore, such that they could recruit the surveillance complex to the earliest-translating ribosomes.

Mechanistic implications of novel functional domains of Upf2p/rent2. The most stable mRNA conformation is believed to be a closed-loop structure which is mediated by poly(A) binding protein and eIFs (Fig. 8) (60). This arrangement is thought to promote translation and prevent removal of the 5' cap and subsequent 5'-to-3' degradation of transcripts (21, 34). Functional communication between the 5' and 3' termini of mRNAs is well established. For example, despite binding to the 3' end of transcripts, poly(A)-binding protein (PABP in mammalian cells, Pab1p in yeast) appears to protect or stabilize the 5' cap (5). Consistent with this function, generalized deadenylation-independent decapping occurs in pab1 strains of S. cerevisiae (8) and tethering of Pab1p to transcripts lacking poly(A) tails is sufficient to prevent premature decapping (12). The poly(A) tail is also known to have stimulatory effects on translation initiation (60). Additionally, several lines of evidence suggest a role for the translation initiation factors in the regulation of transcript stability. Temperature-sensitive mutations in eIF4G, eIF4A, eIF4E, and PRT1 (a subunit of eIF3) cause accelerated deadenylation and decay of wild-type transcripts at the nonpermissive temperature (64). Perhaps more relevant to the deadenylation-independent decay of nonsense transcripts, specific alleles of PRT1 (74) and SUI1 (another eIF3 subunit) (14) selectively impair the efficiency of NMD without affecting wild-type transcript stability.

View larger version (56K): [in this window] [in a new window]   FIG. 8.   Proposed model of 4GH domain-mediated transcript destabilization. Stable, efficiently translated transcripts are believed to adopt a closed-loop conformation mediated by protein-protein interactions which bridge the 5' cap (m7G) and the 3' poly(A) tail. The model suggests that the 4GH domains of rent2 and NAT1 may compete with the corresponding domain in eIF4G (and perhaps PAIP-1) for interacting partners eIF3 and/or eFI4A. Such associations (dashed lines) may occur in cis when rent2 is a component of a mature surveillance complex (partnered with rent1 and rent3) but in trans upon induction of NAT1 expression.