Previous Article | Next Article 
Molecular and Cellular Biology, December 2000, p. 8969-8982, Vol. 20, No. 23
Department of Adult Oncology, Dana-Farber
Cancer Institute,1 and Departments of
Internal Medicine2 and
Pathology,3 Brigham and Women's
Hospital, Harvard Medical School, Boston, Massachusetts 02115
Received 24 April 2000/Returned for modification 13 June
2000/Accepted 21 August 2000
PTEN acts as a tumor suppressor, at least in part, by antagonizing
phosphoinositide 3-kinase (PI3K)/Akt signaling. Here we show that
Forkhead transcription factors FKHRL1 and FKHR, substrates of the Akt
kinase, are aberrantly localized to the cytoplasm and cannot activate
transcription in PTEN-deficient cells. Restoration of PTEN function
restores FKHR to the nucleus and restores transcriptional activation.
Expression of a constitutively active form of FKHR that cannot be
phosphorylated by Akt produces the same effect as reconstitution of
PTEN on PTEN-deficient tumor cells. Specifically, activated FKHR
induces apoptosis in cells that undergo PTEN-mediated cell
death and induces G1 arrest in cells that undergo
PTEN-mediated cell cycle arrest. Furthermore, both PTEN and
constitutively active FKHR induce p27KIP1 protein but not
p21. These data suggest that Forkhead transcription factors are
critical effectors of PTEN-mediated tumor suppression.
The PTEN/MMAC/TEP-1 tumor
suppressor gene (hereafter referred to as PTEN) is a common
target of somatic mutation in a number of malignancies including
prostate and endometrial cancers, glioblastoma, and melanoma (6,
26, 34, 36, 38, 54, 63, 67, 69, 73). In addition, germ line
mutations in the PTEN gene are associated with the
development of Cowden disease, an inherited hamartoma syndrome
associated with an elevated risk of breast and thyroid cancers
(37, 45). The PTEN protein product (PTEN) functions as both a protein and lipid phosphatase (39, 44). The former activity is associated with inhibition of cell spreading and
dephosphorylation of focal adhesion kinase (65). PTEN lipid phosphatase activity is specific for the 3 position of
phosphatidylinositol-3,4,5-trisphosphate and
phosphatidylinositol-3,4-bisphosphate, both of which are by-products of
the lipid kinase activity of the phosphoinositide 3-kinase (PI3K)
(39). This latter PTEN activity is associated with the ability of PTEN to antagonize signaling through the PI3K pathway and
hence to block inappropriate activation of the serine threonine kinase
Akt (reviewed in references 7 and
71).
Reintroduction of PTEN into certain PTEN-null tumor cells, such as
U87-MG and 786-O, leads to the induction of a G1 arrest (21, 33, 53). This arrest requires the lipid phosphatase activity of PTEN and can be overridden by a constitutively active form
of the Akt, a downstream effector of PI3K (21, 53). In keeping with these data, PTEN heterozygosity results in
excessive proliferation in murine prostate and thyroid tissues;
PTEN Introduction of PTEN into certain other PTEN-null tumor cells such as
LNCaP, MDA-MB-468, and U251 results in the induction of
apoptosis or anoikis (14, 15, 35, 43). This
induction is also tied to inhibition of PI3K and Akt (35,
43). Further, the study of murine PTEN
loss-of-function alleles has revealed defects in apoptosis.
PTEN Potential effectors of PI3K signaling, downstream of PTEN, include a
number of identified Akt substrates such as BAD, caspase 9, IKK Here we show for the first time that members of the forkhead
transcription factor family are deregulated and inactive in PTEN null
cells. Furthermore, a form of the Forkhead factor FKHR (FKHR;AAA) that
cannot be phosphorylated by Akt is sufficient to induce
apoptosis in PTEN-null cells. In addition, this constitutively
active form of FKHR induced a cell cycle arrest rather than
apoptosis in PTEN-null cells that likewise undergo a
G1 arrest following restoration of PTEN function. As shown
before for PTEN, the phosphosite mutant form of FKHR was also capable
of inducing p27 and not p21. These data suggest that an active form
of FKHR can complement PTEN deficiency in both the cell cycle and
apoptotic pathways and suggest that FKHR may function as
regulator of both proliferation and cell survival in the PI3K signaling
pathway. These results further suggest that FKHR or its related family
members AFX and FKHRL1 are critical proteins downstream of PTEN and
that restoration of forkhead function might suppress tumorigenesis in
PTEN-deficient tumor cells.
Plasmids.
pCD19, pSG5L, pSG5L-HA-PTEN, pSG5L-HA-PTEN;G129R,
pSG5L-HA-PTEN;G129E, pSG5L-HA-PTEN;1-353, pBABE-puroL,
pBABE-puroL-HA-PTEN; pBABE-puroL-HA-PTEN;G129R and pGL3-promoter
(Promega) were described previously (53, 57, 68).
pcDNA3-Flag-FKHR, pcDNA3-Flag-FKHR;H215, pcDNA3-Flag-FKHR;AAA,
and pGL2promoter-3×IRS were gifts of E. Tang, F. Barr, and K. Guan (66). The inserts from pcDNA3-Flag-FKHR or the mutant
derivatives, restricted with BamHI and XbaI, were ligated to the vector from similarly restricted pcDNA3-GFP to give
pcDNA3-GFP-FKHR, pcDNA3-GFP-FKHR;H215R and pcDNA3-GFP-FKHR;AAA. Oligonucleotides 5'-GCGCGGATCCATGGCCGAGGCGCCTCAGGTG-3'
and 5'-CGCGCTCGAGGAATTCTCAGCCTGACACCCAGCTATG-3' were
used to PCR amplify the FKHR cDNAs. The PCR products, restricted with BamHI and XhoI, were ligated to similarly
restricted pBABE-puroL to give pBABE-puroL-FKHR,
pBABE-puroL-FKHR;H215R, and pBABE-puroL-FKHR;AAA. Oligonucleotides
5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTATTTAAATAAATAAGTAAATAAATAAAC-3' and
5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were
phosphorylated, annealed, and ligated to pGL3-promoter restricted with
BglII and NheI to give pGL3-promoter-FasL. This
plasmid was subsequently restricted with BglII and
HindIII, blunted, and ligated to remove the simian virus
40 promoter and give pGL3-FasL. pAdTrack-CMV and pAdEasy-1 were
the gifts of B. Vogelstein and K. Polyak (28). The insert
from pcDNA3-Flag-FKHR;AAA liberated by restriction with XbaI
and partial digestion with HindIII was ligated to
similarly restricted pAdTrack-CMV vector to give pAd-FKHR;AAA.
Cell lines, cell culture, transfection, and MTS assay.
LNCaP
cells were maintained at 37°C in a humidified 5% CO2
atmosphere in RPMI 1640 containing 10% fetal calf serum (FCS)
(HyClone), penicillin and streptomycin (PS), 2.5 g of glucose per
liter, 10 mM HEPES, 1 mM sodium pyruvate, and 2 mM
L-glutamine. DU-145 cells were maintained at 37°C in a
humidified 10% CO2 atmosphere in Dulbecco's modified
Eagle's medium containing 10% FCS and PS. ACHN, 786-O, and U2-OS
cells were maintained as previously described (53).
Phoenix-ampho (
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Forkhead Transcription Factors Are Critical Effectors of Cell
Death and Cell Cycle Arrest Downstream of PTEN
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
/ embryos have widespread excess
bromodeoxyuridine incorporation, and PTEN/
embryonic stem ES cells show abnormal cell cycle kinetics and reduced
p27KIP1 (p27) levels (19, 62, 64). These
data demonstrate a necessary role for PTEN in cell cycle regulation.
/ murine fibroblasts are impaired in
their response to apoptotic stimuli such as UV irradiation and
osmotic stress (62). PTEN+/ mice
have abnormal lymphoid aggregates, and lymphocytes from these mice have
reduced annexin V staining, a marker of apoptosis (52). Finally, PTEN+/ mice also
develop a lymphoproliferative syndrome that results from, and
phenocopies, defects in Fas signaling (18). Collectively, these data support a necessary role for PTEN in mediating
apoptosis in fibroblasts and lymphocytes. PTEN, like p53, is
therefore a regulator of both cell cycle progression and apoptosis.
, and
the Forkhead transcription factors FKHR, FKHRL1, and AFX (4, 5, 8,
13, 31, 48, 66). Each of these substrates is implicated in cell
survival. Other downstream targets of Akt include nitric oxide
synthetase, GSK3, and 4E-BP1/Phas-I (12, 24, 41). While each
of these proteins is a known Akt substrate, with respect to the
function of PTEN as a tumor suppressor it is not known which substrates
are necessary and/or sufficient for enacting cell cycle control or for
inducting apoptosis. One possibility is that different Akt
substrates are responsible for enacting cell cycle control and
regulating apoptosis. Alternatively, it is possible that one
Akt target might be critical for both functions. Therefore, we
sought to determine whether one or more of these substrates was
deregulated in PTEN-null tumors and, in addition, to determine whether
any one target was either necessary or sufficient for PTEN to regulate
the cell cycle or to induce apoptosis.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
X-A) cells were maintained at 37°C in a humidified
10% CO2 atmosphere in Dulbecco's modified Eagle's medium
containing 10% FCS and PS. 786-O cells were transfected using Fugene
reagent (Boehringer Mannheim) as previously described (70).
U2-OS, ACHN, and X-A cells were transfected by the
N,N-bis-(2-hydroxyethyl)-2-aminoethanesulfuric acid-buffered
saline (BBS)-calcium phosphate method as previously described
(10, 57).
Antibodies, immunoblotting, protein extraction, cell fractionation. Anti-PTEN(C54) (53), anti-HA (BabCo), anti-FKHRL1, anti-phospho-FKHRL1 (Upstate Biotechnology), anti-GSK3 (New England Biolabs [NEB]), anti-phospho-GSK3 (NEB), anti-phospho-Akt (NEB), anti-Akt (NEB), anti-p27 (Transduction Laboratories), anti-p70S6K (Santa Cruz Biotechnology), and 245 anti-RB (Pharmingen) antibodies were used at a dilution of 1:1,000. M5 anti-flag antibody (Sigma) was used at 10 µg/ml. Anti-p21 antibody (Transduction Laboratories) was used at 1:500. Anti-tubulin antibody (ICN) was used at 1:2,000. Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Biodesign International) was used at 1:5,000.
Cell lysates were prepared and immunoblot analyses were performed as previously described (70). 786-O and ACHN cells were fractionated by swelling for 10 min in RBS buffer (10 mM HEPES [pH 7.2], 10 mM NaCl, 1.5 mM MgCl2) containing 5 µg of leupeptin per ml, 2 µg of aprotinin per ml, 50 µg of phenylmethylsulfonyl fluoride per ml, 5 mM NaF, and 0.5 mM sodium orthovanadate. The cells were disrupted by 60 (786-O) or 10 (ACHN) manual strokes of a Dounce homogenizer. Nuclei were pelleted by centrifugation at 2,700 rpm for 5 min, washed three times in RBS buffer, and lysed in RIPA buffer (10 mM NaPO4, 150 mM NaCl, 1% NP-40, 0.1% deoxycholate, 0.1% sodium dodecyl sulfate). Cytoplasmic proteins were precipitated with 10% trichloroacetic acid, washed with 80% acetone, washed with double-distilled H2O, and solubilized in 1× protein sample buffer.FACS and cell cycle analysis. Cell cycle analysis was performed as previously described (57, 70). Briefly, 786-O cells grown on p100 plates were transfected with 4 µg of pCD19 plasmid and the amounts of either pSG5 or pcDNA3 expression plasmid indicated in the figure legends. At 48 h after transfection, the cells were harvested, stained with fluorescein isothiocyanate-conjugated anti-CD19 antibody and propidium iodide, and analyzed by two-color fluorescence-activated cell sorting (FACS) (Beckton-Dickinson).
Retrovirus production and infection.
Amphotrophic retroviral
supernatants were produced as previously described (51).
Briefly, X-A cells, split 1:4 the previous day, were transfected
with 25 µg of the indicated pBABEpuroL plasmid DNA. After 16 h
the medium was changed and the cells were incubated in a 10%
CO2 incubator for 48 h. The medium was harvested and stored at 
70°C until needed. 786-O and LNCaP cells were incubated with 5 ml of thawed viral supernatant containing 5 µg of Polybrene (hexadimethine bromide) (Sigma H9268) per ml and incubated at 37°C
for 4 h. A 5-ml volume of complete medium was added, and the cells
were maintained for 40 h under standard growth conditions, after
which the medium was changed to complete medium supplemented with 2 µg of puromycin per ml. Drug-resistant cells were selected and
harvested after 72 h. Typically, 85% of the LNCaP or 786-O cells
infected with the pBABE-puroL retrovirus were drug resistant.
Adenovirus production and infection. Recombinant FKHR;AAA adenovirus was generated as previously described (28). Briefly, pAdTrack-CMV and pAd-FKHR;AAA were linearized and individually cotransformed into electrocompetent BJ5183 cells (Quantum Biotechnologies) along with pAdEasy-1. Next, recombinant adenovirus DNA, isolated from kanamycin-resistant colonies, was amplified in Top10 cells (Invitrogen), purified by CsCl2 density gradient centrifugation, linearized with Pac1, and transfected into 293 cells with Lipofectamine (Life Technologies). After 7 to 10 days, packaged virus was collected and used to infect 20 p150 plates of 293 cells. The amplified virus was isolated by freeze-thaw extraction, purified by CsCl2 density gradient centrifugation, and subjected to titer determination by lysis of 293 cells. LNCaP and 786-O cells were infected with Ad-vector at a multiplicity of infection of 50 and with Ad-FKHR;AAA at a multiplicity of infection of 100.
Reporter assays.
Transfections for reporter assays were
carried out in 6- or 24-well plates. At 36 h after transfection,
cells were lysed in 1× reporter lysis buffer as specified by the
manufacturer (Promega). Cleared lysates were used in luciferase and
-galactosidase assays as described previously (57).
Relative light units were normalized to -galactosidase activity. The
fold activation was obtained by dividing corrected luciferase values by
the corrected luciferase value obtained in the presence of the vector
and reporter plasmids alone.
Real-time quantitative PCR. RNA was prepared using the RNeasy RNA isolation kit (Qiagen) as specified by the manufacturer, including DNase treatment. Total RNA (1 µg) was reverse transcribed at 42°C for 45 min in a 20-µl reaction mixture containing 250 µM each deoxynucleoside triphosphate, 20 U of RNase inhibitor, 50 U of murine leukemia virus reverse transcriptase (RT), 2.5 µM random hexamers, and 1× RT buffer (1.5 mM MgCl2) and then denatured at 99°C for 5 min. An RT-minus reaction was also performed for each sample. Specific primers and fluorogenic probe for human p27 (Fw, 5'-GCAATGCGCAGGAATAAGGA-3'; Rev, 5'-TCCACAGAACCGGCATTTG-3'; probe, 5'-CGACCTGCAACCGACGATTCTTCTACTCA-3') were designed using Primer Express 1.0 software. Amplification of the GAPDH gene was used to standardize the amount of RNA in each reaction mixture (Taqman GAPDH control reagents). PCR was performed using an ABI Prism 7700 sequence detector. The Taqman PCR core reagent kit was used as specified by the manufacturer with the following modifications: dUTP was replaced by dTTP and incubation with AmpErase was omitted. PCR mixtures each contained 1 µl of cDNA (equivalent o 50 ng of template RNA), 2.5 U of AmpliTaq Gold, and 100 nM (each) oligonucleotide primers and fluorogenic probe in a volume of 50 µl. Amplifications consisted of 60 cycles of 94°C for 45 s, 58°C for 45 s, and 72°C for 1 min. All reagents for real-time PCR were purchased from Perkin-Elmer Applied Biosystems.
In each experiment, additional reactions with seven serial twofold dilutions of 786-O cDNA as template were performed with each set of primers and probes on the same 96-well plate to generate standard curves, which related the threshold cycle (CT) to the log input amount of template. All samples were amplified in triplicate. The relative amount of p27 transcripts in each sample was determined by using the standard-curve method and by normalizing for GAPDH mRNA expression levels, as previously described (20; Applied Biosystems, ABI Prism 7700 Sequence Detection System User Bulletin, vol. 2, p. 1-35, 1997).Protein half-life determination by cycloheximide treatment.
At 20 h after adenovirus infection, 786-O cells were treated with
25 µg of cycloheximide per ml. At the indicated times, the cells were
washed, scrape harvested into 500 µl of phosphate-buffered saline,
pelleted by centrifugation at 400 × g for 5 min, and
stored at 70°C. Cell extracts were prepared as described above and
immunoblotted with the indicated antibodies. Multiple exposures were
obtained and then digitized using a Scanmaker III flatbed scanner. The resulting immunoblot signals were quantified using ImageQuant software
(Molecular Dynamics). Only radiographs where the peak quantification
showed nonsaturating signals were used. The half-life was calculated
from exponential curve fits to the data plotted in log-linear fashion,
as previously described (70).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
FKHRL1 protein levels and phosphorylation are deregulated in
the absence of PTEN.
A survey of the activation state of
downstream targets of Akt was undertaken using antibodies against
specific phosphopeptides. Two pairs of cell lines were used, ACHN and
786-O renal carcinoma cells and DU145 and LNCaP prostate
carcinoma cells. ACHN and DU145 both retain wild-type PTEN alleles and
express an intact PTEN protein, while 786-O and LNCaP cells fail
to express any full-length PTEN protein (53) (Fig.
1). Whole-cell extracts were prepared from serum-starved cells or from starved cells that were
stimulated with serum. As previously shown, in these
PTEN/ cells the phosphorylated and activated
form of Akt is overabundant (53) (Fig. 1). Extracts were
immunoblotted with antibodies that detect phosphorylation of GSK3 and
FKHRL1. In the absence of serum, deregulation of GSK3-
phosphorylation was noted in the two PTEN-null cell lines (Fig. 1).
Immunoblotting also demonstrated a marked increase in phosphorylated
FKHRL1 in the PTEN-null cell lines; however, the total amount of
FKHRL1 was also elevated in these cells. While both endogenous
AFX and FKHR were detected in all of these cells (data not
shown), phosphospecific antibodies were, in our hands, incapable of
recognizing endogenous phosphorylated AFX or FKHR. In contrast to the
results obtained with FKHRL1 and GSK3, phosphorylated Bad was not
detected in these cells and p70S6K was not consistently
hyperphosphorylated in a manner that reflected the loss of PTEN (Fig. 1
and data not shown).
|
FKHR localization is constitutively cytoplasmic in
PTEN/ cells.
Previous data showed that
Akt-dependent inhibition of FKHR or FKHRL1 is mediated, at least in
part, by phosphorylation-dependent localization of these
transcription factors to the cytoplasm (4, 5). These
considerations and the data in Fig. 1 led us to ask whether Forkhead
factors might be aberrantly localized in PTEN-null cells. To this end,
786-O and ACHN cells were fractionated into cytoplasmic and nuclear
fractions. Anti-FKHRL1 immunoblotting demonstrated that FKHRL1 was
indeed cytoplasmic in PTEN-null 786-O cells while it was primarily
localized to the nucleus in ACHN cells (Fig.
2C). As controls for fractionation,
immunoblotting demonstrated that -tubulin was found in the cytoplasm
and the retinoblastoma protein (pRB) was found in the nucleus
(Fig. 2C).
|
PTEN expression relocalizes GFP-FKHR to the nucleus in PTEN null
cells.
To determine whether reexpression of PTEN protein
could effect a change in the localization of GFP-FKHR, plasmids
encoding either wild-type or mutant PTEN derivatives were transfected
into both 786-O and LNCaP cells along with the plasmid encoding
GFP-FKHR. In greater than 90% of LNCaP or 786-O cells cotransfected
with PTEN;WT, GFP-FKHR was localized to the nuclei (Fig. 3A to
C). In contrast, GFP-FKHR remained
cytoplasmic when coproduced with either PTEN mutant (PTEN;G129R or
PTEN;G129E) (Fig. 3A to C). PTEN;G129E retains protein but not lipid
phosphatase activity, whereas PTEN;G129R lacks both these activities
(21, 43, 53). Thus, PTEN protein phosphatase activity is not
sufficient for the induction of nuclear localization of GFP-FKHR.
PTEN;1-353 is a truncated form of PTEN that retains lipid and protein
phosphatase activity and can inhibit cell cycle progression and Akt
kinase activity comparably to wild-type PTEN (Fig. 3A to C)
(32, 70; S. Ramaswamy and W. R. Sellers,
unpublished data). In keeping with these data, expression of
PTEN;1-353 led to the nuclear accumulation of GFP-FKHR;WT. Together,
these data suggest that FKHR is aberrantly localized in PTEN-null cells
and that reconstitution of PTEN lipid phosphatase activity is
sufficient for localizing FKHR to the nucleus.
|
FKHR transcriptional activity is defective in PTEN-null
cells.
FKHR can activate transcription from a minimal promoter
element contained within the IGFBP-1 promoter (27, 66).
Likewise, FKHRL1 can activate transcription from a sequence derived
from the FasL promoter (5). The localization data obtained
using GFP-FKHR fusion proteins suggested that FKHR might not activate transcription in a PTEN-null cell. To test this,
PTEN+/+ ACHN and U2-OS cell were transfected
with a luciferase reporter plasmid containing a 3×IRS element or a
FasL promoter element, along with a plasmid encoding Flag-tagged FKHR.
In these cells, FKHR transfection resulted in a dose-dependent increase
in transcription (Fig. 4A and B and data
not shown). In these cells, FKHR;H215R, harboring a point mutation in
the DNA-binding domain, had no effect (data not shown). In contrast to
these results, transfection of wild-type FKHR in the PTEN-null 786-O
and LNCaP cells did not activate transcription from either the 3×IRS
or FasL promoter elements (Fig. 4C and D and data not shown). These
data demonstrate that the ability of FKHR to activate transcription is
defective in PTEN-null cells. Note that neither reporter used in these
experiments was capable of assaying endogenous forkhead activity.
Specifically, in the absence of exogenous FKHR, when these reporters
were compared to the same reporters lacking an intact Forkhead DNA
binding, there was no significant difference in overall transcriptional activation (data not shown). This presumably indicates that other elements in these synthetic promoters contribute to the relatively high
level of basal activity.
|
|
Activated FKHR induces cell death in LNCaP cells.
Certain
PTEN-null cells, such as PTEN/ mouse embryo fibroblasts
are resistant to apoptotic stimuli (62), and PTEN
reconstitution to or treatment with PI3K inhibitors of certain
PTEN-null tumor cells (e.g., UMG-251 or LNCaP cells) results in
the induction of cell death that is, at least in part, mediated through
apoptosis (9, 14, 15, 35). Likewise, FKHRL1
and FKHR can both induce apoptosis (5, 66).
Thus, we next asked whether FKHR or the FKHR;AAA mutant could induce
cell death in PTEN-null LNCaP or 786-O cells. To test this, PTEN-null
786-O or LNCaP cells were incubated with culture supernatants
containing amphotrophic retroviruses encoding PTEN;WT, PTEN;G129R,
FKHR;WT, and FKHR;AAA and were then selected with puromycin. In keeping
with previously reported results (14, 43), PTEN induced cell
death in LNCaP cells and completely suppressed the emergence of
puromycin-resistant cells (Fig. 6A and
C). On the other hand, infection with
retroviruses producing PTEN;G129R had no effect on cell viability.
Cells infected with FKHR;WT were more prone to cell death than were
vector-infected controls; however, puromycin-resistant populations
expressing FKHR;WT were obtained (data not shown). In comparison,
infection with retroviruses producing FKHR;AAA, like PTEN, led to
marked suppression of cell viability and completely suppressed the
emergence of puromycin-resistant clones. Thus, the activated form of
FKHR complemented PTEN deficiency in these cells.
|
FKHR induces a cell cycle block in PTEN-null cells.
In U87-MG
and 768-O cells, reintroduction of PTEN by adenovirus infection or
transient transfection induces a cell cycle arrest in G1
rather than inducing apoptosis (21, 35, 53). One
possibility, among many, for the lack of apoptosis in these
cells is that additional genetic alterations in these cells render PTEN
incapable of inducing apoptosis. If FKHR is a critical
downstream activator of apoptosis in these cells, perhaps this
putative defect is a defect in FKHR function. If so, this might account
for the lack of effect of the FKHR;AAA mutant in the cell death assay
performed with 786-O cells (Fig. 6A). Alternatively, FKHR or other
Forkhead factors might function in both the apoptotic and cell
cycle function of the PI3K/PTEN/Akt pathway. To test this hypothesis, a
transient cell cycle assay was used. 786-O cells were transiently
transfected with a plasmid encoding the cell surface marker CD19 along
with plasmids encoding PTEN;WT or PTEN;G129R. PTEN;WT, but not
PTEN;G129R, induced a modest cell cycle block. While FKHR;WT had a
minimal effect on the G1 population, FKHR;AAA induced a
robust G1 arrest (Fig. 7A)
but FKHR;H215R did not. Thus, activated FKHR can complement the
loss of PTEN in 786-O cells. We next asked whether PTEN could "rescue" the apparent defect in FKHR;WT-mediated cell cycle arrest. In keeping with the ability of PTEN to relocalize FKHR and to restore
transcriptional activation, cotransfection of PTEN;WT along with
FKHR;WT led to an increase in the G1 population comparable to that induced by the FKHR;AAA mutant (Fig. 7B). These data suggest that restoration of functional FKHR to these cells, by cotransfection of PTEN or by rendering FKHR immune to Akt phosphorylation, is sufficient to arrest PTEN-null cells in G1.
|
|
FKHR;AAA induces p27 mRNA and prolongs the p27 protein half-life. To begin to address the mechanism through which FKHR regulates p27, p27 mRNA levels were determined in 786-O cells following adenovirus infection with Ad-FKHR;AAA. At 24 h, cells infected with Ad-FKHR;AAA demonstrated a modest (1.3- to 1.5-fold) induction of the p27 mRNA compared to that in cells infected with Ad-vector (Fig. 8B). Consistent with these results, we have found that Ad-PTEN induces a 1.8-fold induction in p27 mRNA (S. Ramaswamy, S. Signoretti, M. Loda and W. R. Sellers, unpublished data). Next, 786-O cells were again infected with Ad-vector or Ad-FKHR;AAA. At 24 h after infection, the cells were treated continuously with cycloheximide (25 µg/ml). At specific time points, the p27 protein level was determined by immunoblotting in both the Ad-vector- and Ad-FKHR;AAA-infected cells. Here, we found that the protein half-life was increased from 123 to 329 min in the Ad-FKHR;AAA infection. Thus, FKHR;AAA induces a modest change in the p27 mRNA level and a significant increase in the p27 protein half-life.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Our data show that localization and transcriptional activity of FKHR is aberrant in PTEN-null cells. Reconstitution of wild-type PTEN, but not lipid phosphatase-inactive mutants, restores both localization and transcriptional activation of FKHR in these cells. While wild-type FKHR is relatively inactive in PTEN null cells, a phosphosite mutant of FKHR (FKHR;AAA) that is no longer phosphorylated by Akt can still localize to the nucleus and activate transcription in such cells. This mutant induces death in a cell line susceptible to PTEN-mediated cell death. Surprisingly, it does not induce apoptosis but, rather, induces a G1 arrest in cells that likewise arrest with wild-type PTEN. Together, the data derived from the cell death assays and the cell cycle arrest assays support the notion that an intact and active FKHR protein is capable of carrying out PTEN function in its absence. That is, activated FKHR complements the loss of PTEN in two different functional assays. These data support the idea that FKHR is sufficient for PTEN function in cells. Finally, previous data have shown that PTEN-null cells have low levels of p27 and that reintroduction of PTEN up regulates p27 levels (33, 64). We find that FKHR;AAA dramatically induces p27 levels in PTEN-null cells. These data suggest that the finding of aberrant p27 levels in the absence of PTEN might arise as a consequence of the lack of FKHR function in such cells. In keeping with these data, Medema et al. recently reported similar data which demonstrated a role for Forkhead factors as regulators of cell cycle progression and, using defined genetic cells, showed that such regulation does indeed depend on the induction of p27 (40).
The PI3K/Akt pathway is a well-known oncogenic signaling pathway (75). Cell survival and cell proliferation have been linked to this pathway in multiple systems. For example, interleukin-3-dependent cell lines require Akt for survival, as do cells in which anoikis is blocked by Ras activation (17, 29, 61). On the other hand, expression of activated PI3K in the absence of serum can induce DNA synthesis (30). Furthermore, PTEN is capable of inducing apoptosis or a cell cycle arrest, and loss of PTEN in primary cells leads to either excessive proliferation or defects in apoptosis. In mammalian cell-based assays, a diverse group of substrates have been linked to Akt activation. In C. elegans, on the other hand, the insulin/PI3K/Akt signaling pathway that regulates aging, while conserved with mammalian cells, has thus far yielded only the Forkhead homologue daf-16 as a downstream target (46). It is possible that the deregulated activity of multiple Akt substrates contributes to the neoplastic properties inherent to a PTEN-null tumor cell and that certain substrates might individually contribute to the regulation of apoptosis and cell proliferation. Our data, however, support the notion that the pathway linking PI3K and PTEN to transformation of mammalian cells is essentially identical to the pathway regulating aging in C. elegans. This pathway is comprised of a receptor tyrosine kinase such as IGF-IR (daf-2), PI3K (ageI), Akt-1 (akt1) and Akt-2 (akt2), PDK-1 (pdk1), PTEN (daf-18), and the daf-16 homologues (FKHR, FKHRL1, and AFX) (23, 25, 42, 46, 47, 49, 50, 55).
It is interesting that elements of this pathway that are linked genetically in C. elegans are the same elements of the pathway that have been associated with genetic alterations in human tumors. The PI3KCA gene is amplified in ovarian cancer and is also found as a retroviral oncogene (1, 59). Akt-1 and Akt-2 are amplified in a limited number of tumors, and Akt-1 is the cellular homologue of v-Akt (2, 3, 11, 56). Finally, PTEN is widely mutated in cancer, and FKHR has been the target of translocation in rhabdomyosarcoma. Interestingly, in this tumor, two different translocations give rise to the fusion proteins PAX3-FKHR or PAX7-FKHR (16, 22, 58). Our data support the notion that FKHR could act as a tumor suppressor; thus, one untested possibility is that these translocations might produce chimeric proteins that could act in a dominant negative manner to inactivate FKHR function.
The notion that a transcription factor might induce a G1 arrest or induce cell death is not new. Indeed, this is precisely the case for p53. The parallels between these pathways are striking. p53 receives signals that reflect the state of the genome (DNA damage) at least in part from a PI3K family member, ATM. This signal may be transmitted through phosphorylation of p53. p53 can then enact a G1 arrest through transcriptional regulation of p21. p53 induces apoptotic cell death through both transcription-dependent and -independent mechanisms. FKHR, on the other hand, receives signals primarily from the environment external to the cell. These signals are transmitted through a type I PI3K and result in the phosphorylation of FKHR and its subsequent inactivation. In its active state FKHR, can promote a G1 arrest through the induction of p27 and can induce apoptosis perhaps through regulation of Fas signaling or through regulation of FasL itself.
How does FKHR regulate p27? p27 is primarily regulated posttranscriptionally, both through ubiquitin-mediated proteolysis and through translation controls. There is limited information to suggest that transcriptional regulation of p27 is important. Furthermore, PTEN did not alter p27 mRNA levels (33). On the other hand, Medema et al. (40) have demonstrated activation of the p27 promoter by AFX, and we have shown that both wild-type PTEN and wild-type FKHR, but not mutant controls, were capable of inducing activation of the p27 promoter (data not shown). In addition, Medema et al. reported a modest induction in p27 mRNA levels (40). We have also seen a modest (1.3- to 1.5-fold induction in mRNA upon adenovirus expression of FKHR;AAA (Fig. 8B) and upon adenovirus expression of PTEN. In addition, however, the half-life of p27 protein is significantly prolonged. Here, it is possible that a modest increase in p27 levels induced through transcription might lead to inhibition of cyclin-dependent kinase activity followed by a decrease in p27 phosphorylation and then a change in the half-life of p27 protein. Since this process involves a catalytic mechanism, a small change in p27 mRNA levels could lead to a large difference in protein half-life. For example, an increase in the transcription of p27 could alter the balance between the two proposed complexes of p27 and cyclin E-cdk2, one inhibitory and one in which p27 is degraded (60, 72). Alternatively, it is possible that FKHR;AAA directly alters or regulates components of the p27 degradation apparatus. Specifically, it will be of interest to know whether Forkhead factors can alter the levels of any of the components of the Skp-Cul-F box (SCF) complex.
The mechanism that underlies FKHR induction of apoptosis is
likewise not yet clear. FKHRL1 can regulate the FasL promoter, suggesting that these transcription factors might directly regulate the
levels of this death effector (5). In keeping with this notion, PTEN+/ mice develop an autoimmune
lymphoid hyperplasia syndrome that phenocopies mutations in the murine
Fas gene (18, 74). On the other hand, cells from the
PTEN+/ animals did not demonstrate defects in
FasL or Fas but, rather, were defective in the apoptotic
response to Fas (18). In either case, it would appear that
PTEN-mediated and, by extension, FKHR-mediated apoptosis
probably involves the Fas pathway.
Finally, our data support the notion that, as is the case in C. elegans, signaling pathways might be more linear, at least with respect to transformation, than is commonly suspected. This would lead one to further suspect that PTEN-null cells might be particularly sensitive to inhibitors directed against members of this pathway; if true, such dependence would bode well for the future success of therapeutics aimed at intervening in PI3K signaling.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the Department of Defense (DAMD17-98-1-8596), NIH (RO1CA85912), Gillette Women's Cancer Program, and CaPCURE foundation to W.R.S.; from the NIH (RO1CA81755) to M.L.; and from the Department of Defense to F.V.
We thank E. Tang, F. Barr, K. Guan, K. Polyak, and B. Vogelstein for the generous gift of plasmid reagents; Kornelia Polyak for assistance in adenovirus production; and Myles Brown, Bill Kaelin, Mark Ewen, David Livingston, Matt Meyerson, Kornelia Polyak, and Barrett Rollins for their critical review of the manuscript. N.N. thanks Takehisa Iwai for scientific advice.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Dana-Farber Cancer Institute, D720C, 44 Binney St., Boston, MA 02115. Phone: (617) 632-5261. Fax: (617) 632-5417. E-mail: William_Sellers{at}dfci.harvard.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Aoki, M.,
O. Batista,
A. Bellacosa,
P. Tsichlis, and P. K. Vogt.
1998.
The akt kinase: molecular determinants of oncogenicity.
Proc. Natl. Acad. Sci. USA
95:14950-14955 |
| 2. | Bellacosa, A., D. de Feo, A. K. Godwin, D. W. Bell, J. Q. Cheng, D. A. Altomare, M. Wan, L. Dubeau, G. Scambia, V. Masciullo, et al. 1995. Molecular alterations of the AKT2 oncogene in ovarian and breast carcinomas. Int. J. Cancer. 64:280-285[Medline]. |
| 3. |
Bellacosa, A.,
J. R. Testa,
S. P. Staal, and P. N. Tsichlis.
1991.
A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region.
Science
254:274-277 |
| 4. |
Biggs, W. H., III,
J. Meisenhelder,
T. Hunter,
W. K. Cavenee, and K. C. Arden.
1999.
Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1.
Proc. Natl. Acad. Sci. USA
96:7421-7426 |
| 5. | Brunet, A., A. Bonni, M. J. Zigmond, M. Z. Lin, P. Juo, L. S. Hu, M. J. Anderson, K. C. Arden, J. Blenis, and M. E. Greenberg. 1999. Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96:857-868[CrossRef][Medline]. |
| 6. |
Cairns, P.,
K. Okami,
S. Halachmi,
N. Halachmi,
M. Esteller,
J. G. Herman,
J. Jen,
W. B. Isaacs,
G. S. Bova, and D. Sidransky.
1997.
Frequent inactivation of PTEN/MMAC1 in primary prostate cancer.
Cancer Res.
57:4997-5000 |
| 7. |
Cantley, L. C., and B. G. Neel.
1999.
New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway.
Proc. Natl. Acad. Sci. USA
96:4240-4245 |
| 8. |
Cardone, M. H.,
N. Roy,
H. R. Stennicke,
G. S. Salvesen,
T. F. Franke,
E. Stanbridge,
S. Frisch, and J. C. Reed.
1998.
Regulation of cell death protease caspase-9 by phosphorylation.
Science
282:1318-1321 |
| 9. |
Carson, J. P.,
G. Kulik, and M. J. Weber.
1999.
Antiapoptotic signaling in LNCaP prostate cancer cells: a survival signaling pathway independent of phosphatidylinositol 3'-kinase and Akt/protein kinase B.
Cancer Res.
59:1449-1453 |
| 10. |
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752 |
| 11. |
Cheng, J. Q.,
B. Ruggeri,
W. M. Klein,
G. Sonoda,
D. A. Altomare,
D. K. Watson, and J. R. Testa.
1996.
Amplification of AKT2 in human pancreatic cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA.
Proc. Natl. Acad. Sci. USA
93:3636-3641 |
| 12. | Cross, D. A., D. R. Alessi, P. Cohen, M. Andjelkovich, and B. A. Hemmings. 1995. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378:785-789[CrossRef][Medline]. |
| 13. | Datta, S. R., H. Dudek, X. Tao, S. Masters, H. Fu, Y. Gotoh, and M. E. Greenberg. 1997. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell. 91:231-241[CrossRef][Medline]. |
| 14. |
Davies, M. A.,
D. Koul,
H. Dhesi,
R. Berman,
T. J. McDonnell,
D. McConkey,
W. K. Yung, and P. A. Steck.
1999.
Regulation of Akt/PKB activity, cellular growth, and apoptosis in prostate carcinoma cells by MMAC/PTEN.
Cancer Res.
59:2551-2556 |
| 15. |
Davies, M. A.,
Y. Lu,
T. Sano,
X. Fang,
P. Tang,
R. LaPushin,
D. Koul,
R. Bookstein,
D. Stokoe,
W. K. Yung,
G. B. Mills, and P. A. Steck.
1998.
Adenoviral transgene expression of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis.
Cancer Res.
58:5285-5290 |
| 16. |
Davis, R. J.,
C. M. D'Cruz,
M. A. Lovell,
J. A. Biegel, and F. G. Barr.
1994.
Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma.
Cancer Res.
54:2869-2872 |
| 17. |
del Peso, L.,
M. Gonzalez-Garcia,
C. Page,
R. Herrera, and G. Nunez.
1997.
Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt.
Science
278:687-689 |
| 18. |
Di Cristofano, A.,
P. Kotsi,
Y. F. Peng,
C. Cordon-Cardo,
K. B. Elkon, and P. P. Pandolfi.
1999.
Impaired fas response and autoimmunity in Pten(+/) mice.
Science
285:2122-2125 |
| 19. | Di Cristofano, A., B. Pesce, C. Cordon-Cardo, and P. P. Pandolfi. 1998. Pten is essential for embryonic development and tumour suppression. Nat. Genet. 19:348-355[CrossRef][Medline]. |
| 20. | Fink, L., W. Seeger, L. Ermert, J. Hanze, U. Stahl, F. Grimminger, W. Kummer, and R. M. Bohle. 1998. Real-time quantitative RT-PCR after laser-assisted cell picking. Nat. Med. 4:1329-1333[CrossRef][Medline]. |
| 21. |
Furnari, F. B.,
H. J. Huang, and W. K. Cavenee.
1998.
The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive G1 growth arrest in glioma cells.
Cancer Res.
58:5002-5008 |
| 22. | Galili, N., R. J. Davis, W. J. Fredericks, S. Mukhopadhyay, F. J. D. Rauscher, B. S. Emanuel, G. Rovera, and F. G. Barr. 1993. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat. Genet. 5:230-235[CrossRef][Medline]. |
| 23. |
Gil, E. B.,
E. Malone Link,
L. X. Liu,
C. D. Johnson, and J. A. Lees.
1999.
Regulation of the insulin-like developmental pathway of Caenorhabditis elegans by a homolog of the PTEN tumor suppressor gene.
Proc. Natl. Acad. Sci. USA
96:2925-2930 |
| 24. |
Gingras, A. C.,
S. G. Kennedy,
M. A. O'Leary,
N. Sonenberg, and N. Hay.
1998.
4E-BP1, a repressor of mRNA translation, is phosphorylated and inactivated by the Akt(PKB) signaling pathway.
Genes Dev.
12:502-513 |
| 25. | Gottlieb, S., and G. Ruvkun. 1994. daf-2, daf-16 and daf-23: genetically interacting genes controlling Dauer formation in Caenorhabditis elegans. Genetics 137:107-120[Abstract]. |
| 26. |
Guldberg, P.,
P. thor Straten,
A. Birck,
V. Ahrenkiel,
A. F. Kirkin, and J. Zeuthen.
1997.
Disruption of the MMAC1/PTEN gene by deletion or mutation is a frequent event in malignant melanoma.
Cancer Res.
57:3660-3663 |
| 27. |
Guo, S.,
G. Rena,
S. Cichy,
X. He,
P. Cohen, and T. Unterman.
1999.
Phosphorylation of serine 256 by protein kinase B disrupts transactivation by FKHR and mediates effects of insulin on insulin-like growth factor-binding protein-1 promoter activity through a conserved insulin response sequence.
J. Biol. Chem.
274:17184-17192 |
| 28. |
He, T. C.,
S. Zhou,
L. T. da Costa,
J. Yu,
K. W. Kinzler, and B. Vogelstein.
1998.
A simplified system for generating recombinant adenoviruses.
Proc. Natl. Acad. Sci. USA
95:2509-2514 |
| 29. | Khwaja, A., P. Rodriguez-Viciana, S. Wennstrom, P. H. Warne, and J. Downward. 1997. Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J. 16:2783-2793[CrossRef][Medline]. |
| 30. |
Klippel, A.,
M. A. Escobedo,
M. S. Wachowicz,
G. Apell,
T. W. Brown,
M. A. Giedlin,
W. M. Kavanaugh, and L. T. Williams.
1998.
Activation of phosphatidylinositol 3-kinase is sufficient for cell cycle entry and promotes cellular changes characteristic of oncogenic transformation.
Mol. Cell. Biol.
18:5699-5711 |
| 31. | Kops, G. J., N. D. de Ruiter, A. M. De Vries-Smits, D. R. Powell, J. L. Bos, and B. M. Burgering. 1999. Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature 398:630-634[CrossRef][Medline]. |
| 32. | Lee, J. O., H. Yang, M. M. Georgescu, A. Di Cristofano, T. Maehama, Y. Shi, J. E. Dixon, P. Pandolfi, and N. P. Pavletich. 1999. Crystal structure of the PTEN tumor suppressor: implications for its phosphoinositide phosphatase activity and membrane association. Cell 99:323-334[CrossRef][Medline]. |
| 33. |
Li, D., and H. Sun.
1998.
PTEN/MMAC1/TEP1 suppresses the tumorigenicity and induces G1 cell cycle arrest in human glioblastoma cells.
Proc. Natl. Acad. Sci. USA
95:15406-15411 |
| 34. |
Li, D. M., and H. Sun.
1997.
TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor beta.
Cancer Res.
57:2124-2129 |
| 35. |
Li, J.,
L. Simpson,
M. Takahashi,
C. Miliaresis,
M. P. Myers,
N. Tonks, and R. Parsons.
1998.
The PTEN/MMAC1 tumor suppressor induces cell death that is rescued by the AKT/protein kinase B oncogene.
Cancer Res.
58:5667-5672 |
| 36. |
Li, J.,
C. Yen,
D. Liaw,
K. Podsypanina,
S. Bose,
S. I. Wang,
J. Puc,
C. Miliaresis,
L. Rodgers,
R. McCombie,
S. H. Bigner,
B. C. Giovanella,
M. Ittmann,
B. Tycko,
H. Hibshoosh,
M. H. Wigler, and R. Parsons.
1997.
PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer.
Science
275:1943-1947 |
| 37. | Liaw, D., D. J. Marsh, J. Li, P. L. Dahia, S. I. Wang, Z. Zheng, S. Bose, K. M. Call, H. C. Tsou, M. Peacocke, C. Eng, and R. Parsons. 1997. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat. Genet. 16:64-67[CrossRef][Medline]. |
| 38. |
Liu, W.,
C. D. James,
L. Frederick,
B. E. Alderete, and R. B. Jenkins.
1997.
PTEN/MMAC1 mutations and EGFR amplification in glioblastomas.
Cancer Res.
57:5254-5257 |
| 39. |
Maehama, T., and J. E. Dixon.
1998.
The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-triphosphate.
J. Biol. Chem.
273:13375-13378 |
| 40. | Medema, R. H., G. J. P. Kops, J. L. Bos, and B. M. T. Burgering. 2000. AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27Kip1. Nature 404:782-787[CrossRef][Medline]. |
| 41. | Michell, B. J., J. E. Griffiths, K. I. Mitchelhill, I. Rodriguez-Crespo, T. Tiganis, S. Bozinovski, P. R. de Montellano, B. E. Kemp, and R. B. Pearson. 1999. The Akt kinase signals directly to endothelial nitric oxide synthase. Curr. Biol. 12:845-848. |
| 42. |
Mihaylova, V. T.,
C. Z. Borland,
L. Manjarrez,
M. J. Stern, and H. Sun.
1999.
The PTEN tumor suppressor homolog in Caenorhabditis elegans regulates longevity and dauer formation in an insulin receptor-like signaling pathway.
Proc. Natl. Acad. Sci. USA
96:7427-7432 |
| 43. |
Myers, M. P.,
I. Pass,
I. H. Batty,
J. Van der Kaay,
J. P. Stolarov,
B. A. Hemmings,
M. H. Wigler,
C. P. Downes, and N. K. Tonks.
1998.
The lipid phosphatase activity of PTEN is critical for its tumor suppressor function.
Proc. Natl. Acad. Sci. USA
95:13513-13518 |
| 44. |
Myers, M. P.,
J. P. Stolarov,
C. Eng,
J. Li,
S. I. Wang,
M. H. Wigler,
R. Parsons, and N. K. Tonks.
1997.
P-TEN, the tumor suppressor from human chromosome 10q23, is a dual-specificity phosphatase.
Proc. Natl. Acad. Sci. USA
94:9052-9057 |
| 45. |
Nelen, M. R.,
W. C. van Staveren,
E. A. Peeters,
M. B. Hassel,
R. J. Gorlin,
H. Hamm,
C. F. Lindboe,
J. P. Fryns,
R. H. Sijmons,
D. G. Woods,
E. C. Mariman,
G. W. Padberg, and H. Kremer.
1997.
Germline mutations in the PTEN/MMAC1 gene in patients with Cowden disease.
Hum. Mol. Genet.
6:1383-1387 |
| 46. | Ogg, S., S. Paradis, S. Gottlieb, G. I. Patterson, L. Lee, H. A. Tissenbaum, and G. Ruvkun. 1997. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389:994-999[CrossRef][Medline]. |
| 47. | Ogg, S., and G. Ruvkun. 1998. The C. elegans PTEN homolog, DAF-18, acts in the insulin receptor-like metabolic signaling pathway. Mol. Cell 2:887-893[CrossRef][Medline]. |
| 48. | Ozes, O. N., L. D. Mayo, J. A. Gustin, S. R. Pfeffer, L. M. Pfeffer, and D. B. Donner. 1999. NF-KappaB activation by tumor necrosis factor requires the Akt serine-threonine kinase. Nature 401:82-85[CrossRef][Medline]. |
| 49. |
Paradis, S.,
M. Ailion,
A. Toker,
J. H. Thomas, and G. Ruvkun.
1999.
A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans.
Genes Dev.
13:1438-1452 |
| 50. |
Paradis, S., and G. Ruvkun.
1998.
Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor.
Genes Dev.
12:2488-2498 |
| 51. |
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396 |
| 52. |
Podsypanina, K.,
L. H. Ellenson,
A. Nemes,
J. Gu,
M. Tamura,
K. M. Yamada,
C. Cordon-Cardo,
G. Catoretti,
P. E. Fisher, and R. Parsons.
1999.
Mutation of Pten/Mmac1 in mice causes neoplasia in multiple organ systems.
Proc. Natl. Acad. Sci. USA
96:1563-1568 |
| 53. |
Ramaswamy, S.,
N. Nakamura,
F. Vazquez,
D. B. Batt,
S. Perera,
T. M. Roberts, and W. R. Sellers.
1999.
Regulation of G1 progression by the PTEN tumor suppressor protein is linked to inhibition of the phosphatidylinositol 3-kinase/Akt pathway.
Proc. Natl. Acad. Sci. USA
96:2110-2115 |
| 54. |
Risinger, J. I.,
A. K. Hayes,
A. Berchuck, and J. C. Barrett.
1997.
PTEN/MMAC1 mutations in endometrial cancers.
Cancer Res.
57:4736-4738 |
| 55. | Rouault, J. P., P. E. Kuwabara, O. M. Sinilnikova, L. Duret, D. Thierry-Mieg, and M. Billaud. 1999. Regulation of dauer larva development in Caenorhabditis elegans by daf-18, a homologue of the tumour suppressor PTEN. Curr. Biol. 9:329-332[CrossRef][Medline]. |
| 56. | Ruggeri, B. A., L. Huang, M. Wood, J. Q. Cheng, and J. R. Testa. 1998. Amplification and overexpression of the AKT2 oncogene in a subset of human pancreatic ductal adenocarcinomas. Mol. Carcinog. 21:81-86[CrossRef][Medline]. |
| 57. |
Sellers, W. R.,
B. G. Novitch,
S. Miyake,
A. Heith,
G. A. Otterson,
F. J. Kaye,
A. B. Lassar, and W. G. Kaelin, Jr.
1998.
Stable binding to E2F is not required for the retinoblastoma protein to activate transcription, promote differentiation, and suppress tumor cell growth.
Genes Dev.
12:95-106 |
| 58. |
Shapiro, D. N.,
J. E. Sublett,
B. Li,
J. R. Downing, and C. W. Naeve.
1993.
Fusion of PAX3 to a member of the forkhead family of transcription factors in human alveolar rhabdomyosarcoma.
Cancer Res.
53:5108-5112 |
| 59. | Shayesteh, L., Y. Lu, W. L. Kuo, R. Baldocchi, T. Godfrey, C. Collins, D. Pinkel, B. Powell, G. B. Mills, and J. W. Gray. 1999. PIK3CA is implicated as an oncogene in ovarian cancer. Nat. Genet. 21:99-102[CrossRef][Medline]. |
| 60. |
Sheaff, R. J.,
M. Groudine,
M. Gordon,
J. M. Roberts, and B. E. Clurman.
1997.
Cyclin E-CDK2 is a regulator of p27Kip1.
Genes Dev.
11:1464-1478 |
| 61. |
Songyang, Z.,
D. Baltimore,
L. C. Cantley,
D. R. Kaplan, and T. F. Franke.
1997.
Interleukin 3-dependent survival by the Akt protein kinase.
Proc. Natl. Acad. Sci. USA
94:11345-11350 |
| 62. | Stambolic, V., A. Suzuki, J. L. de la Pompa, G. M. Brothers, C. Mirtsos, T. Sasaki, J. Ruland, J. M. Penninger, D. P. Siderovski, and T. W. Mak. 1998. Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95:29-39[CrossRef][Medline]. |
| 63. | Steck, P. A., M. A. Pershouse, S. A. Jasser, W. K. Yung, H. Lin, A. H. Ligon, L. A. Langford, M. L. Baumgard, T. Hattier, T. Davis, C. Frye, R. Hu, B. Swedlund, D. H. Teng, and S. V. Tavtigian. 1997. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat. Genet. 15:356-362[CrossRef][Medline]. |
| 64. |
Sun, H.,
R. Lesche,
D. M. Li,
J. Liliental,
H. Zhang,
J. Gao,
N. Gavrilova,
B. Mueller,
X. Liu, and H. Wu.
1999.
PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5-triphosphate and Akt/protein kinase B signaling pathway.
Proc. Natl. Acad. Sci. USA
96:6199-6204 |
| 65. |
Tamura, M.,
J. Gu,
K. Matsumoto,
S. Aota,
R. Parsons, and K. M. Yamada.
1998.
Inhibition of cell migration, spreading, and focal adhesion by tumor suppressor PTEN.
Science
280:1614-1617 |
| 66. |
Tang, E. D.,
G. Nunez,
F. G. Barr, and K. L. Guan.
1999.
Negative regulation of the forkhead transcription factor FKHR by Akt.
J. Biol. Chem.
274:16741-16746 |
| 67. |
Tashiro, H.,
M. S. Blazes,
R. Wu,
K. R. Cho,
S. Bose,
S. I. Wang,
J. Li,
R. Parsons, and L. H. Ellenson.
1997.
Mutations in PTEN are frequent in endometrial carcinoma but rare in other common gynecological malignancies.
Cancer Res.
57:3935-3940 |
| 68. | Tedder, T. F., and C. M. Isaacs. 1989. Isolation of cDNAs encoding the CD19 antigen of human and mouse B lymphocytes. J. Immunol. 143:712-717[Abstract]. |
| 69. |
Teng, D. H.,
R. Hu,
H. Lin,
T. Davis,
D. Iliev,
C. Frye,
B. Swedlund,
K. L. Hansen,
V. L. Vinson,
K. L. Gumpper,
L. Ellis,
A. El-Naggar,
M. Frazier,
S. Jasser,
L. A. Langford,
J. Lee,
G. B. Mills,
M. A. Pershouse,
R. E. Pollack,
C. Tornos,
P. Troncoso,
W. K. Yung,
G. Fujii,
A. Berson, and P. A. Steck.
1997.
MMAC1/PTEN mutations in primary tumor specimens and tumor cell lines.
Cancer Res.
57:5221-5225 |
| 70. |
Vazquez, F.,
S. Ramaswamy,
N. Nakamura, and W. R. Sellers.
2000.
Phosphorylation of the PTEN tail regulates protein stability and function.
Mol. Cell. Biol.
20:5010-5018 |
| 71. | Vazquez, F., and W. R. Sellers. 2000. The PTEN tumor suppressor protein: an antagonist of phosphoinositide 3-kinase signaling. Biochim. Biophys. Acta 1470:M21-M35[Medline]. |
| 72. | Vlach, J., S. Hennecke, and B. Amati. 1997. Phosphorylation-dependent degradation of the cyclin-dependent kinase inhibitor p27. EMBO J. 16:5334-5344[CrossRef][Medline]. |
| 73. |
Wang, S. I.,
J. Puc,
J. Li,
J. N. Bruce,
P. Cairns,
D. Sidransky, and R. Parsons.
1997.
Somatic mutations of PTEN in glioblastoma multiforme.
Cancer Res.
57:4183-4186 |
| 74. | Watanabe-Fukunaga, R., C. I. Brannan, N. G. Copeland, N. A. Jenkins, and S. Nagata. 1992. Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356:314-317[CrossRef][Medline]. |
| 75. | Whitman, M., D. R. Kaplan, B. Schaffhausen, L. Cantley, and T. M. Roberts. 1985. Association of phosphatidylinositol kinase activity with polyoma middle-T competent for transformation. Nature 315:239-242[CrossRef][Medline]. |
Molecular and Cellular Biology, December 2000, p. 8969-8982, Vol. 20, No. 23
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Everly, D. N. Jr., Mainou, B. A., Raab-Traub, N.
(2009). Transcriptional Downregulation of p27KIP1 through Regulation of E2F Function during LMP1-Mediated Transformation. J. Virol.
83: 12671-12679
[Abstract] [Full Text] -
Mahimainathan, L., Ghosh-Choudhury, N., Venkatesan, B., Das, F., Mandal, C. C., Dey, N., Habib, S. L., Kasinath, B. S., Abboud, H. E., Ghosh Choudhury, G.
(2009). TSC2 Deficiency Increases PTEN via HIF1{alpha}. J. Biol. Chem.
284: 27790-27798
[Abstract] [Full Text] -
Turner, J. G., Marchion, D. C., Dawson, J. L., Emmons, M. F., Hazlehurst, L. A., Washausen, P., Sullivan, D. M.
(2009). Human Multiple Myeloma Cells Are Sensitized to Topoisomerase II Inhibitors by CRM1 Inhibition. Cancer Res.
69: 6899-6905
[Abstract] [Full Text] -
Lau, C. J., Koty, Z., Nalbantoglu, J.
(2009). Differential Response of Glioma Cells to FOXO1-Directed Therapy. Cancer Res.
69: 5433-5440
[Abstract] [Full Text] -
Mojsilovic-Petrovic, J., Nedelsky, N., Boccitto, M., Mano, I., Georgiades, S. N., Zhou, W., Liu, Y., Neve, R. L., Taylor, J. P., Driscoll, M., Clardy, J., Merry, D., Kalb, R. G.
(2009). FOXO3a Is Broadly Neuroprotective In Vitro and In Vivo against Insults Implicated in Motor Neuron Diseases. J. Neurosci.
29: 8236-8247
[Abstract] [Full Text] -
Nucera, C., Eeckhoute, J., Finn, S., Carroll, J. S., Ligon, A. H., Priolo, C., Fadda, G., Toner, M., Sheils, O., Attard, M., Pontecorvi, A., Nose, V., Loda, M., Brown, M.
(2009). FOXA1 Is a Potential Oncogene in Anaplastic Thyroid Carcinoma. Clin. Cancer Res.
15: 3680-3689
[Abstract] [Full Text] -
Fu, W., Ma, Q., Chen, L., Li, P., Zhang, M., Ramamoorthy, S., Nawaz, Z., Shimojima, T., Wang, H., Yang, Y., Shen, Z., Zhang, Y., Zhang, X., Nicosia, S. V., Zhang, Y., Pledger, J. W., Chen, J., Bai, W.
(2009). MDM2 Acts Downstream of p53 as an E3 Ligase to Promote FOXO Ubiquitination and Degradation. J. Biol. Chem.
284: 13987-14000
[Abstract] [Full Text] -
Boyer, A., Paquet, M., Lague, M.-N., Hermo, L., Boerboom, D.
(2009). Dysregulation of WNT/CTNNB1 and PI3K/AKT signaling in testicular stromal cells causes granulosa cell tumor of the testis. Carcinogenesis
30: 869-878
[Abstract] [Full Text] -
Mutka, S. C., Yang, W. Q., Dong, S. D., Ward, S. L., Craig, D. A., Timmermans, P. B.M.W.M., Murli, S.
(2009). Identification of Nuclear Export Inhibitors with Potent Anticancer Activity In vivo. Cancer Res.
69: 510-517
[Abstract] [Full Text] -
Szabolcs, M., Keniry, M., Simpson, L., Reid, L. J., Koujak, S., Schiff, S. C., Davidian, G., Licata, S., Gruvberger-Saal, S., Murty, V. V.V.S., Nandula, S., Efstratiadis, A., Kushner, J. A., White, M. F., Parsons, R.
(2009). Irs2 Inactivation Suppresses Tumor Progression in Pten+/- Mice. Am. J. Pathol.
174: 276-286
[Abstract] [Full Text] -
Liu, P., Li, S., Gan, L., Kao, T. P., Huang, H.
(2008). A Transcription-Independent Function of FOXO1 in Inhibition of Androgen-Independent Activation of the Androgen Receptor in Prostate Cancer Cells. Cancer Res.
68: 10290-10299
[Abstract] [Full Text] -
Dabrowska, A., Kim, N., Aldovini, A.
(2008). Tat-Induced FOXO3a Is a Key Mediator of Apoptosis in HIV-1-Infected Human CD4+ T Lymphocytes. J. Immunol.
181: 8460-8477
[Abstract] [Full Text] -
Fukuda, M., Jones, J. E., Olson, D., Hill, J., Lee, C. E., Gautron, L., Choi, M., Zigman, J. M., Lowell, B. B., Elmquist, J. K.
(2008). Monitoring FoxO1 Localization in Chemically Identified Neurons. J. Neurosci.
28: 13640-13648
[Abstract] [Full Text] -
Shankar, S., Ganapathy, S., Srivastava, R. K.
(2008). Sulforaphane Enhances the Therapeutic Potential of TRAIL in Prostate Cancer Orthotopic Model through Regulation of Apoptosis, Metastasis, and Angiogenesis. Clin. Cancer Res.
14: 6855-6866
[Abstract] [Full Text] -
Snoeks, L., Weber, C. R., Turner, J. R., Bhattacharyya, M., Wasland, K., Savkovic, S. D.
(2008). Tumor Suppressor Foxo3a Is Involved in the Regulation of Lipopolysaccharide-Induced Interleukin-8 in Intestinal HT-29 Cells. Infect. Immun.
76: 4677-4685
[Abstract] [Full Text] -
Brenkman, A. B., de Keizer, P. L.J., van den Broek, N. J.F., van der Groep, P., van Diest, P. J., van der Horst, A., Smits, A. M.M., Burgering, B. M.T.
(2008). The Peptidyl-Isomerase Pin1 Regulates p27kip1 Expression through Inhibition of Forkhead Box O Tumor Suppressors. Cancer Res.
68: 7597-7605
[Abstract] [Full Text] -
Lombardi, M., Castoria, G., Migliaccio, A., Barone, M. V., Di Stasio, R., Ciociola, A., Bottero, D., Yamaguchi, H., Appella, E., Auricchio, F.
(2008). Hormone-dependent nuclear export of estradiol receptor and DNA synthesis in breast cancer cells. JCB
182: 327-340
[Abstract] [Full Text] -
Monick, M. M., Powers, L. S., Barrett, C. W., Hinde, S., Ashare, A., Groskreutz, D. J., Nyunoya, T., Coleman, M., Spitz, D. R., Hunninghake, G. W.
(2008). Constitutive ERK MAPK Activity Regulates Macrophage ATP Production and Mitochondrial Integrity. J. Immunol.
180: 7485-7496
[Abstract] [Full Text] -
Chahdi, A., Sorokin, A.
(2008). Endothelin-1 Couples {beta}Pix to p66Shc: Role of {beta}Pix in Cell Proliferation through FOXO3a Phosphorylation and p27kip1 Down-Regulation Independently of Akt. Mol. Biol. Cell
19: 2609-2619
[Abstract] [Full Text] -
Choi, H.-J., Chung, T.-W., Kim, S.-J., Cho, S.-Y., Lee, Y.-S., Lee, Y.-C., Ko, J.-H., Kim, C.-H.
(2008). The AP-2{alpha} transcription factor is required for the ganglioside GM3-stimulated transcriptional regulation of a PTEN gene. Glycobiology
18: 395-407
[Abstract] [Full Text] -
Ward, E. C., Hoekstra, A. V., Blok, L. J., Hanifi-Moghaddam, P., Lurain, J. R., Singh, D. K., Buttin, B. M., Schink, J. C., Kim, J. J.
(2008). The Regulation and Function of the Forkhead Transcription Factor, Forkhead Box O1, Is Dependent on the Progesterone Receptor in Endometrial Carcinoma. Endocrinology
149: 1942-1950
[Abstract] [Full Text] -
Evans-Anderson, H. J., Alfieri, C. M., Yutzey, K. E.
(2008). Regulation of Cardiomyocyte Proliferation and Myocardial Growth During Development by FOXO Transcription Factors. Circ. Res.
102: 686-694
[Abstract] [Full Text] -
Emerling, B. M., Weinberg, F., Liu, J.-L., Mak, T. W., Chandel, N. S.
(2008). PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a). Proc. Natl. Acad. Sci. USA
105: 2622-2627
[Abstract] [Full Text] -
Xue, L., Nolla, H., Suzuki, A., Mak, T. W., Winoto, A.
(2008). Normal development is an integral part of tumorigenesis in T cell-specific PTEN-deficient mice. Proc. Natl. Acad. Sci. USA
105: 2022-2027
[Abstract] [Full Text] -
Bouchard, C., Lee, S., Paulus-Hock, V., Loddenkemper, C., Eilers, M., Schmitt, C. A.
(2007). FoxO transcription factors suppress Myc-driven lymphomagenesis via direct activation of Arf. Genes Dev.
21: 2775-2787
[Abstract] [Full Text] -
Andres-Pons, A., Rodriguez-Escudero, I., Gil, A., Blanco, A., Vega, A., Molina, M., Pulido, R., Cid, V. J.
(2007). In vivo Functional Analysis of the Counterbalance of Hyperactive Phosphatidylinositol 3-Kinase p110 Catalytic Oncoproteins by the Tumor Suppressor PTEN. Cancer Res.
67: 9731-9739
[Abstract] [Full Text] -
Huang, H., Tindall, D. J.
(2007). Dynamic FoxO transcription factors. J. Cell Sci.
120: 2479-2487
[Abstract] [Full Text] -
Delpuech, O., Griffiths, B., East, P., Essafi, A., Lam, E. W.-F., Burgering, B., Downward, J., Schulze, A.
(2007). Induction of Mxi1-SR{alpha} by FOXO3a Contributes to Repression of Myc-Dependent Gene Expression. Mol. Cell. Biol.
27: 4917-4930
[Abstract] [Full Text] -
Lee, H.-Y., Chung, J.-W., Youn, S.-W., Kim, J.-Y., Park, K.-W., Koo, B.-K., Oh, B.-H., Park, Y.-B., Chaqour, B., Walsh, K., Kim, H.-S.
(2007). Forkhead Transcription Factor FOXO3a Is a Negative Regulator of Angiogenic Immediate Early Gene CYR61, Leading to Inhibition of Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia. Circ. Res.
100: 372-380
[Abstract] [Full Text] -
Hinman, R. M., Bushanam, J. N., Nichols, W. A., Satterthwaite, A. B.
(2007). B Cell Receptor Signaling Down-Regulates Forkhead Box Transcription Factor Class O 1 mRNA Expression via Phosphatidylinositol 3-Kinase and Bruton's Tyrosine Kinase. J. Immunol.
178: 740-747
[Abstract] [Full Text] -
Minaguchi, T., Waite, K. A., Eng, C.
(2006). Nuclear Localization of PTEN Is Regulated by Ca2+ through a Tyrosil Phosphorylation-Independent Conformational Modification in Major Vault Protein. Cancer Res.
66: 11677-11682
[Abstract] [Full Text] -
Gil, A., Andres-Pons, A., Fernandez, E., Valiente, M., Torres, J., Cervera, J., Pulido, R.
(2006). Nuclear Localization of PTEN by a Ran-dependent Mechanism Enhances Apoptosis: Involvement of an N-Terminal Nuclear Localization Domain and Multiple Nuclear Exclusion Motifs. Mol. Biol. Cell
17: 4002-4013
[Abstract] [Full Text] -
Monick, M. M., Powers, L. S., Gross, T. J., Flaherty, D. M., Barrett, C. W., Hunninghake, G. W.
(2006). Active ERK Contributes to Protein Translation by Preventing JNK-Dependent Inhibition of Protein Phosphatase 1. J. Immunol.
177: 1636-1645
[Abstract] [Full Text] -
Dong, X.-Y., Chen, C., Sun, X., Guo, P., Vessella, R. L., Wang, R.-X., Chung, L. W.K., Zhou, W., Dong, J.-T.
(2006). FOXO1A Is a Candidate for the 13q14 Tumor Suppressor Gene Inhibiting Androgen Receptor Signaling in Prostate Cancer.. Cancer Res.
66: 6998-7006
[Abstract] [Full Text] -
Patterson, C., Mapera, S., Li, H.-H., Madamanchi, N., Hilliard, E., Lineberger, R., Herrmann, R., Charles, P.
(2006). Comparative Effects of Paclitaxel and Rapamycin on Smooth Muscle Migration and Survival: Role of Akt-Dependent Signaling. Arterioscler. Thromb. Vasc. Bio.
26: 1473-1480
[Abstract] [Full Text] -
Zhang, X., Zhang, S., Yamane, H., Wahl, R., Ali, A., Lofgren, J. A., Kendall, R. L.
(2006). Kinetic Mechanism of AKT/PKB Enzyme Family. J. Biol. Chem.
281: 13949-13956
[Abstract] [Full Text] -
Li, G., Hu, Y., Huo, Y., Liu, M., Freeman, D., Gao, J., Liu, X., Wu, D.-C., Wu, H.
(2006). PTEN Deletion Leads to Up-regulation of a Secreted Growth Factor Pleiotrophin. J. Biol. Chem.
281: 10663-10668
[Abstract] [Full Text] -
Friedrichsen, B. N, Neubauer, N., Lee, Y. C, Gram, V. K, Blume, N., Petersen, J. S, Nielsen, J. H, Moldrup, A.
(2006). Stimulation of pancreatic {beta}-cell replication by incretins involves transcriptional induction of cyclin D1 via multiple signalling pathways.. J Endocrinol
188: 481-492
[Abstract] [Full Text] -
Yamamura, Y., Lee, W. L., Inoue, K.-i., Ida, H., Ito, Y.
(2006). RUNX3 Cooperates with FoxO3a to Induce Apoptosis in Gastric Cancer Cells. J. Biol. Chem.
281: 5267-5276
[Abstract] [Full Text] -
Reagan-Shaw, S., Ahmad, N.
(2006). RNA Interference-Mediated Depletion of Phosphoinositide 3-Kinase Activates Forkhead Box Class O Transcription Factors and Induces Cell Cycle Arrest and Apoptosis in Breast Carcinoma Cells. Cancer Res.
66: 1062-1069
[Abstract] [Full Text] -
Moreno, C. S., Evans, C.-O., Zhan, X., Okor, M., Desiderio, D. M., Oyesiku, N. M.
(2005). Novel Molecular Signaling and Classification of Human Clinically Nonfunctional Pituitary Adenomas Identified by Gene Expression Profiling and Proteomic Analyses. Cancer Res.
65: 10214-10222
[Abstract] [Full Text] -
Ni, J., Wen, X., Yao, J., Chang, H.-C., Yin, Y., Zhang, M., Xie, S., Chen, M., Simons, B., Chang, P., di Sant'Agnese, A., Messing, E. M., Yeh, S.
(2005). Tocopherol-Associated Protein Suppresses Prostate Cancer Cell Growth by Inhibition of the Phosphoinositide 3-Kinase Pathway. Cancer Res.
65: 9807-9816
[Abstract] [Full Text] -
Willingham, A. T., Orth, A. P., Batalov, S., Peters, E. C., Wen, B. G., Aza-Blanc, P., Hogenesch, J. B., Schultz, P. G.
(2005). A Strategy for Probing the Function of Noncoding RNAs Finds a Repressor of NFAT. Science
309: 1570-1573
[Abstract] [Full Text] -
Abid, Md. R., Yano, K., Guo, S., Patel, V. I., Shrikhande, G., Spokes, K. C., Ferran, C., Aird, W. C.
(2005). Forkhead Transcription Factors Inhibit Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia. J. Biol. Chem.
280: 29864-29873
[Abstract] [Full Text] -
Valiente, M., Andres-Pons, A., Gomar, B., Torres, J., Gil, A., Tapparel, C., Antonarakis, S. E., Pulido, R.
(2005). Binding of PTEN to Specific PDZ Domains Contributes to PTEN Protein Stability and Phosphorylation by Microtubule-associated Serine/Threonine Kinases. J. Biol. Chem.
280: 28936-28943
[Abstract] [Full Text] -
Hughes, C, Murphy, A, Martin, C, Sheils, O, O'Leary, J
(2005). Molecular pathology of prostate cancer. J. Clin. Pathol.
58: 673-684
[Abstract] [Full Text] -
Xiao, A., Yin, C., Yang, C., Di Cristofano, A., Pandolfi, P. P., Van Dyke, T.
(2005). Somatic Induction of Pten Loss in a Preclinical Astrocytoma Model Reveals Major Roles in Disease Progression and Avenues for Target Discovery and Validation. Cancer Res.
65: 5172-5180
[Abstract] [Full Text] -
Chung, J.-H., Ginn-Pease, M. E., Eng, C.
(2005). Phosphatase and Tensin Homologue Deleted on Chromosome 10 (PTEN) Has Nuclear Localization Signal-Like Sequences for Nuclear Import Mediated by Major Vault Protein. Cancer Res.
65: 4108-4116
[Abstract] [Full Text] -
Smith, W. W., Norton, D. D., Gorospe, M., Jiang, H., Nemoto, S., Holbrook, N. J., Finkel, T., Kusiak, J. W.
(2005). Phosphorylation of p66Shc and forkhead proteins mediates A{beta} toxicity. JCB
169: 331-339
[Abstract] [Full Text] -
Ramljak, D., Romanczyk, L. J., Metheny-Barlow, L. J., Thompson, N., Knezevic, V., Galperin, M., Ramesh, A., Dickson, R. B.
(2005). Pentameric procyanidin from Theobroma cacao selectively inhibits growth of human breast cancer cells. Molecular Cancer Therapeutics
4: 537-546
[Abstract] [Full Text] -
Fabre, S., Lang, V., Harriague, J., Jobart, A., Unterman, T. G., Trautmann, A., Bismuth, G.
(2005). Stable Activation of Phosphatidylinositol 3-Kinase in the T Cell Immunological Synapse Stimulates Akt Signaling to FoxO1 Nuclear Exclusion and Cell Growth Control. J. Immunol.
174: 4161-4171
[Abstract] [Full Text] -
Park, K.-W., Kim, D.-H., You, H.-J., Sir, J.-J., Jeon, S.-I., Youn, S.-W., Yang, H.-M., Skurk, C., Park, Y.-B., Walsh, K., Kim, H.-S.
(2005). Activated Forkhead Transcription Factor Inhibits Neointimal Hyperplasia After Angioplasty Through Induction of p27. Arterioscler. Thromb. Vasc. Bio.
25: 742-747
[Abstract] [Full Text] -
Alikhani, M., Alikhani, Z., Graves, D. T.
(2005). FOXO1 Functions as a Master Switch That Regulates Gene Expression Necessary for Tumor Necrosis Factor-induced Fibroblast Apoptosis. J. Biol. Chem.
280: 12096-12102
[Abstract] [Full Text] -
Lynch, R. L., Konicek, B. W., McNulty, A. M., Hanna, K. R., Lewis, J. E., Neubauer, B. L., Graff, J. R.
(2005). The Progression of LNCaP Human Prostate Cancer Cells to Androgen Independence Involves Decreased FOXO3a Expression and Reduced p27KIP1 Promoter Transactivation. Mol Cancer Res
3: 163-169
[Abstract] [Full Text] -
Huang, H., Regan, K. M., Wang, F., Wang, D., Smith, D. I, van Deursen, J. M. A., Tindall, D. J.
(2005). Skp2 inhibits FOXO1 in tumor suppression through ubiquitin-mediated degradation. Proc. Natl. Acad. Sci. USA
102: 1649-1654
[Abstract] [Full Text] -
Brandts, C. H., Bilanges, B., Hare, G., McCormick, F., Stokoe, D.
(2005). Phosphorylation-independent Stabilization of p27kip1 by the Phosphoinositide 3-Kinase Pathway in Glioblastoma Cells. J. Biol. Chem.
280: 2012-2019
[Abstract] [Full Text] -
Fraser, M. M., Zhu, X., Kwon, C.-H., Uhlmann, E. J., Gutmann, D. H., Baker, S. J.
(2004). Pten Loss Causes Hypertrophy and Increased Proliferation of Astrocytes In vivo. Cancer Res.
64: 7773-7779
[Abstract] [Full Text] -
Guo, S., Sonenshein, G. E.
(2004). Forkhead Box Transcription Factor FOXO3a Regulates Estrogen Receptor Alpha Expression and Is Repressed by the Her-2/neu/Phosphatidylinositol 3-Kinase/Akt Signaling Pathway. Mol. Cell. Biol.
24: 8681-8690
[Abstract] [Full Text] -
Sinor, A. D., Lillien, L.
(2004). Akt-1 Expression Level Regulates CNS Precursors. J. Neurosci.
24: 8531-8541
[Abstract] [Full Text] -
van Doorn, R., Dijkman, R., Vermeer, M. H., Out-Luiting, J. J., van der Raaij-Helmer, E. M. H., Willemze, R., Tensen, C. P.
(2004). Aberrant Expression of the Tyrosine Kinase Receptor EphA4 and the Transcription Factor Twist in Sezary Syndrome Identified by Gene Expression Analysis. Cancer Res.
64: 5578-5586
[Abstract] [Full Text] -
Bemis, D. L., Capodice, J. L., Desai, M., Buttyan, R., Katz, A. E.
(2004). A Concentrated Aglycone Isoflavone Preparation (GCP) That Demonstrates Potent Anti-Prostate Cancer Activity In vitro and In vivo. Clin. Cancer Res.
10: 5282-5292
[Abstract] [Full Text] -
Sansal, I., Sellers, W. R.
(2004). The Biology and Clinical Relevance of the PTEN Tumor Suppressor Pathway. JCO
22: 2954-2963
[Abstract] [Full Text] -
Daitoku, H., Hatta, M., Matsuzaki, H., Aratani, S., Ohshima, T., Miyagishi, M., Nakajima, T., Fukamizu, A.
(2004). Silent information regulator 2 potentiates Foxo1-mediated transcription through its deacetylase activity. Proc. Natl. Acad. Sci. USA
101: 10042-10047
[Abstract] [Full Text] -
Cunningham, M. A., Zhu, Q., Hammond, J. M.
(2004). FoxO1a Can Alter Cell Cycle Progression by Regulating the Nuclear Localization of p27kip in Granulosa Cells. Mol. Endocrinol.
18: 1756-1767
[Abstract] [Full Text] -
Halmos, B., Basseres, D. S., Monti, S., D'Alo, F., Dayaram, T., Ferenczi, K., Wouters, B. J., Huettner, C. S., Golub, T. R., Tenen, D. G.
(2004). A Transcriptional Profiling Study of CCAAT/Enhancer Binding Protein Targets Identifies Hepatocyte Nuclear Factor 3{beta} as a Novel Tumor Suppressor in Lung Cancer. Cancer Res.
64: 4137-4147
[Abstract] [Full Text] -
Hutchinson, J. N., Jin, J., Cardiff, R. D., Woodgett, J. R., Muller, W. J.
(2004). Activation of Akt-1 (PKB-{alpha}) Can Accelerate ErbB-2-Mediated Mammary Tumorigenesis but Suppresses Tumor Invasion. Cancer Res.
64: 3171-3178
[Abstract] [Full Text] -
Mahimainathan, L., Choudhury, G. G.
(2004). Inactivation of Platelet-derived Growth Factor Receptor by the Tumor Suppressor PTEN Provides a Novel Mechanism of Action of the Phosphatase. J. Biol. Chem.
279: 15258-15268
[Abstract] [Full Text] -
Huang, H., Muddiman, D. C., Tindall, D. J.
(2004). Androgens Negatively Regulate Forkhead Transcription Factor FKHR (FOXO1) through a Proteolytic Mechanism in Prostate Cancer Cells. J. Biol. Chem.
279: 13866-13877
[Abstract] [Full Text] -
Chang, B.-l., Zheng, S. L, Isaacs, S. D., Wiley, K. E., Turner, A., Li, G., Walsh, P. C., Meyers, D. A., Isaacs, W. B., Xu, J.
(2004). A Polymorphism in the CDKN1B Gene Is Associated with Increased Risk of Hereditary Prostate Cancer. Cancer Res.
64: 1997-1999
[Abstract] [Full Text] -
Tomlinson, C. C., Damania, B.
(2004). The K1 Protein of Kaposi's Sarcoma-Associated Herpesvirus Activates the Akt Signaling Pathway. J. Virol.
78: 1918-1927
[Abstract] [Full Text] -
Garl, P. J., Wenzlau, J. M., Walker, H. A., Whitelock, J. M., Costell, M., Weiser-Evans, M. C.M.
(2004). Perlecan-Induced Suppression of Smooth Muscle Cell Proliferation Is Mediated Through Increased Activity of the Tumor Suppressor PTEN. Circ. Res.
94: 175-183
[Abstract] [Full Text] -
Vasudevan, K. M., Gurumurthy, S., Rangnekar, V. M.
(2004). Suppression of PTEN Expression by NF-{kappa}B Prevents Apoptosis. Mol. Cell. Biol.
24: 1007-1021
[Abstract] [Full Text] -
Hu, C.-L., Cowan, R. G., Harman, R. M., Quirk, S. M.
(2004). Cell Cycle Progression and Activation of Akt Kinase Are Required for Insulin-Like Growth Factor I-Mediated Suppression of Apoptosis in Granulosa Cells. Mol. Endocrinol.
18: 326-338
[Abstract] [Full Text] -
Quirk, S. M., Cowan, R. G., Harman, R. M., Hu, C.-L., Porter, D. A.
(2004). Ovarian follicular growth and atresia: The relationship between cell proliferation and survival. J ANIM SCI
82: E40-52
[Abstract] [Full Text] -
Li, L., Ren, C. H., Tahir, S. A., Ren, C., Thompson, T. C.
(2003). Caveolin-1 Maintains Activated Akt in Prostate Cancer Cells through Scaffolding Domain Binding Site Interactions with and Inhibition of Serine/Threonine Protein Phosphatases PP1 and PP2A. Mol. Cell. Biol.
23: 9389-9404
[Abstract] [Full Text] -
Cunningham, M. A., Zhu, Q., Unterman, T. G., Hammond, J. M.
(2003). Follicle-Stimulating Hormone Promotes Nuclear Exclusion of the Forkhead Transcription Factor FoxO1a via Phosphatidylinositol 3-Kinase in Porcine Granulosa Cells. Endocrinology
144: 5585-5594
[Abstract] [Full Text] -
Lu, Y., Yu, Q., Liu, J. H., Zhang, J., Wang, H., Koul, D., McMurray, J. S., Fang, X., Yung, W.K. A., Siminovitch, K. A., Mills, G. B.
(2003). Src Family Protein-tyrosine Kinases Alter the Function of PTEN to Regulate Phosphatidylinositol 3-Kinase/AKT Cascades. J. Biol. Chem.
278: 40057-40066
[Abstract] [Full Text] -
Radu, A., Neubauer, V., Akagi, T., Hanafusa, H., Georgescu, M.-M.
(2003). PTEN Induces Cell Cycle Arrest by Decreasing the Level and Nuclear Localization of Cyclin D1. Mol. Cell. Biol.
23: 6139-6149
[Abstract] [Full Text] -
Torres, J., Rodriguez, J., Myers, M. P., Valiente, M., Graves, J. D., Tonks, N. K., Pulido, R.
(2003). Phosphorylation-regulated Cleavage of the Tumor Suppressor PTEN by Caspase-3: IMPLICATIONS FOR THE CONTROL OF PROTEIN STABILITY AND PTEN-PROTEIN INTERACTIONS. J. Biol. Chem.
278: 30652-30660
[Abstract] [Full Text] -
Tang, T. T.-L., Lasky, L. A.
(2003). The Forkhead Transcription Factor FOXO4 Induces the Down-regulation of Hypoxia-inducible Factor 1{alpha} by a von Hippel-Lindau Protein-independent Mechanism. J. Biol. Chem.
278: 30125-30135
[Abstract] [Full Text] -
Nelson, W. G., De Marzo, A. M., Isaacs, W. B.
(2003). Prostate Cancer. NEJM
349: 366-381
[Full Text] -
Perrot, V., Rechler, M. M.
(2003). Characterization of Insulin Inhibition of Transactivation by a C-terminal Fragment of the Forkhead Transcription Factor Foxo1 in Rat Hepatoma Cells. J. Biol. Chem.
278: 26111-26119
[Abstract] [Full Text] -
Majumder, P. K., Yeh, J. J., George, D. J., Febbo, P. G., Kum, J., Xue, Q., Bikoff, R., Ma, H., Kantoff, P. W., Golub, T. R., Loda, M., Sellers, W. R.
(2003). Prostate intraepithelial neoplasia induced by prostate restricted Akt activation: The MPAKT model. Proc. Natl. Acad. Sci. USA
100: 7841-7846
[Abstract] [Full Text] -
Burgering, B. M. T., Medema, R. H.
(2003). Decisions on life and death: FOXO Forkhead transcription factors are in command when PKB/Akt is off duty. J. Leukoc. Biol.
73: 689-701
[Abstract] [Full Text] -
Bouscary, D., Pene, F., Claessens, Y.-E., Muller, O., Chretien, S., Fontenay-Roupie, M., Gisselbrecht, S., Mayeux, P., Lacombe, C.
(2003). Critical role for PI 3-kinase in the control of erythropoietin-induced erythroid progenitor proliferation. Blood
101: 3436-3443
[Abstract] [Full Text] -
Yu, C., Rahmani, M., Dai, Y., Conrad, D., Krystal, G., Dent, P., Grant, S.
(2003). The Lethal Effects of Pharmacological Cyclin-dependent Kinase Inhibitors in Human Leukemia Cells Proceed through a Phosphatidylinositol 3-Kinase/Akt-dependent Process. Cancer Res.
63: 1822-1833
[Abstract] [Full Text] -
Komatsu, N., Watanabe, T., Uchida, M., Mori, M., Kirito, K., Kikuchi, S., Liu, Q., Tauchi, T., Miyazawa, K., Endo, H., Nagai, T., Ozawa, K.
(2003). A Member of Forkhead Transcription Factor FKHRL1 Is a Downstream Effector of STI571-induced Cell Cycle Arrest in BCR-ABL-expressing Cells. J. Biol. Chem.
278: 6411-6419
[Abstract] [Full Text] -
Hawke, T. J., Jiang, N., Garry, D. J.
(2003). Absence of p21CIP Rescues Myogenic Progenitor Cell Proliferative and Regenerative Capacity in Foxk1 Null Mice. J. Biol. Chem.
278: 4015-4020
[Abstract] [Full Text] -
Li, P., Lee, H., Guo, S., Unterman, T. G., Jenster, G., Bai, W.
(2003). AKT-Independent Protection of Prostate Cancer Cells from Apoptosis Mediated through Complex Formation between the Androgen Receptor and FKHR. Mol. Cell. Biol.
23: 104-118
[Abstract] [Full Text] -
Modur, V., Nagarajan, R., Evers, B. M., Milbrandt, J.
(2002). FOXO Proteins Regulate Tumor Necrosis Factor-related Apoptosis Inducing Ligand Expression. IMPLICATIONS FOR PTEN MUTATION IN PROSTATE CANCER. J. Biol. Chem.
277: 47928-47937
[Abstract] [Full Text] -
Schmidt, M., Fernandez de Mattos, S., van der Horst, A., Klompmaker, R., Kops, G. J. P. L, Lam, E. W.-F., Burgering, B. M. T., Medema, R. H.
(2002). Cell Cycle Inhibition by FoxO Forkhead Transcription Factors Involves Downregulation of Cyclin D. Mol. Cell. Biol.
22: 7842-7852
[Abstract] [Full Text] -
Yellaturu, C. R., Bhanoori, M., Neeli, I., Rao, G. N.
(2002). N-Ethylmaleimide Inhibits Platelet-derived Growth Factor BB-stimulated Akt Phosphorylation via Activation of Protein Phosphatase 2A. J. Biol. Chem.
277: 40148-40155
[Abstract] [Full Text] -
Ghatak, S., Misra, S., Toole, B. P.
(2002). Hyaluronan Oligosaccharides Inhibit Anchorage-independent Growth of Tumor Cells by Suppressing the Phosphoinositide 3-Kinase/Akt Cell Survival Pathway. J. Biol. Chem.
277: 38013-38020
[Abstract] [Full Text] -
Khare, L, Astrinidis, A, Senapedis, W, Adams, P D, Henske, E P.
(2002). Expression of wild type and mutant TSC2, but not TSC1, causes an increase in the G1 fraction of the cell cycle in HEK293 cells. J. Med. Genet.
39: 676-680
[Full Text] -
Tseng, Y.-H., Ueki, K., Kriauciunas, K. M., Kahn, C. R.
(2002). Differential Roles of Insulin Receptor Substrates in the Anti-apoptotic Function of Insulin-like Growth Factor-1 and Insulin. J. Biol. Chem.
277: 31601-31611
[Abstract] [Full Text] -
Knobbe, C. B., Merlo, A., Reifenberger, G.
(2002). Pten signaling in gliomas. Neuro Oncol Duke
4: 196-211
[Abstract] -
Xu, Z., Stokoe, D., Kane, L. P., Weiss, A.
(2002). The Inducible Expression of the Tumor Suppressor Gene PTEN Promotes Apoptosis and Decreases Cell Size by Inhibiting the PI3K/Akt Pathway in Jurkat T Cells. Cell Growth Differ.
13: 285-296
[Abstract] [Full Text] -
Wu, K., Wang, C., D'Amico, M., Lee, R. J., Albanese, C., Pestell, R. G., Mani, S.
(2002). Flavopiridol and Trastuzumab Synergistically Inhibit Proliferation of Breast Cancer Cells: Association with Selective Cooperative Inhibition of Cyclin D1-dependent Kinase and Akt Signaling Pathways. Molecular Cancer Therapeutics
1: 695-706
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»