Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2000, p. 9028-9040, Vol. 20, No. 23
Friedrich-Miescher Institut, CH-4058 Basel,
Switzerland
Received 27 July 2000/Returned for modification 30 August
2000/Accepted 12 September 2000
The H/ACA small nucleolar RNAs (snoRNAs) are involved in
pseudouridylation of pre-rRNAs. In the yeast Saccharomyces
cerevisiae, four common proteins are associated with H/ACA
snoRNAs: Gar1p, Cbf5p, Nhp2p, and Nop10p. In vitro reconstitution
studies showed that four proteins also specifically interact with H/ACA
snoRNAs in mammalian cell extracts. Two mammalian proteins,
NAP57/dyskerin (the ortholog of Cbf5p) and hGAR1, have been
characterized. In this work we describe properties of hNOP10 and hNHP2,
human orthologs of yeast Nop10p and Nhp2p, respectively, and further
characterize hGAR1. hNOP10 and hNHP2 complement yeast cells depleted of
Nhp2p and Nop10p, respectively. Immunoprecipitation experiments with extracts from transfected HeLa cells indicated that epitope-tagged hNOP10 and hNHP2 specifically associate with hGAR1 and H/ACA RNAs; they
also interact with the RNA subunit of telomerase, which contains an
H/ACA-like domain in its 3' moiety. Immunofluorescence microscopy experiments showed that hGAR1, hNOP10, and hNHP2 are localized in the
dense fibrillar component of the nucleolus and in Cajal (coiled)
bodies. Deletion analysis of hGAR1 indicated that its evolutionarily
conserved core domain contains all the signals required for
localization, but progressive deletions from either the N or the C
terminus of the core domain abolish localization in the nucleolus
and/or the Cajal bodies.
Synthesis, maturation, and also
packaging of rRNAs into ribosomal particles in eukaryotes take place in
the nucleolus. The 18S, 5.8S, and 25/28S rRNAs are generated from a
single large precursor RNA by a complex series of endonucleolytic and
exonucleolytic processing steps. In addition, rRNAs undergo extensive
modifications: 2'-hydroxyl groups of many riboses are methylated, and
specific uridines are converted into pseudouridines (reviewed in
references 1, 51, 69, and 74).
Cleavage and modification events are assisted by a large number of
small nucleolar RNAs (snoRNAs), which function in the cell in the form
of small nucleolar ribonucleoprotein particles (snoRNPs) (reviewed in
references 1, 54, 72, 78, and
81). Two major classes of snoRNAs, box C/D and box H/ACA, have been identified based on conserved structural elements (3, 19, 73). Most C/D snoRNAs act as guides for the
2'-O-methylation of pre-rRNAs, whereas most H/ACA snoRNAs
direct the site-specific pseudouridylation of pre-rRNAs, and each class
is associated with specific proteins (10, 18, 39,
61; reviewed in references 1, 43, 72, 74,
and 78). RNase MRP, an RNP involved in the
endonucleolytic cleavage of pre-rRNA in yeast (references 13 and 50 and references
therein), is structurally similar to RNase P (11, 16) and
does not belong to either of the families.
Four common proteins associated with H/ACA snoRNAs have been identified
in Saccharomyces cerevisiae: Gar1p (25 kDa), Cbf5p (65 kDa),
Nhp2p (22 to 25 kDa), and Nop10p (10 kDa). All four are essential for
growth; depletion of any of them causes inhibition of 18S rRNA
production and impairs pseudouridylation of rRNA (6, 23, 29, 31,
44, 77). Gar1p and Nhp2p orthologs in the fission yeast
Schizosaccharomyces pombe have also been described (24,
52). In vitro reconstitution studies with HeLa cell extracts showed that four proteins specifically interact with mammalian H/ACA
snoRNAs (15). Two mammalian proteins have been
characterized: NAP57/dyskerin, which is the ortholog of Cbf5p (27,
56, 58, 80), and hGAR1 (15).
Yeast Gar1p is characterized by the presence of glycine- and
arginine-rich (GAR) domains flanking a highly conserved central core
domain, which is necessary and sufficient for localization and function
of the protein in vivo (23, 24, 25, 77). Although Gar1p has
been shown to interact with snR10 and snR30 RNAs in vitro
(2), it does not appear to be a primary binding protein. In
yeast, depletion of Gar1p does not affect accumulation of H/ACA snoRNAs
(6, 23). Moreover, in the mammalian in vitro reconstitution
system, the presence of hGAR1 does not appear to be a prerequisite for
the assembly of other H/ACA proteins (15). In contrast to
depletion of Gar1p, depletion of Cbf5p affects the accumulation of
H/ACA snoRNAs and also Gar1p (44). Cbf5p has sequence
similarity with pseudouridine synthases involved in tRNA and bacterial
rRNA modifications, which strongly suggests that it may represent the
pseudouridine synthase of H/ACA snoRNPs (42, 44, 82).
Orthologs of Cbf5p have been identified in rats (NAP57), humans
(dyskerin), and flies (MFL or Nop60B) (22, 27, 56, 64).
Mutations in the associated gene result in growth and developmental
defects in Drosophila melanogaster (22), whereas
in humans they cause dyskeratosis congenita, an X-linked recessive
disease associated with bone marrow failure, skin defects, chromosome
instability, and a predisposition to certain types of malignancy
(27, 40). NAP57 was shown to interact with the phosphoprotein Nopp140, which is present in both the nucleolus and the
Cajal (coiled) bodies (CBs) and which shuttles between the nucleolus
and the cytoplasm on intranuclear tracks (30, 55, 80).
Nhp2p and Nop10p are two other core components of the yeast H/ACA
snoRNPs. As for Cbf5p, their genetic depletion interferes with
accumulation of H/ACA snoRNAs and Gar1p. Both proteins are highly
conserved nucleolar proteins (29, 77). Interestingly, Nhp2p
contains a putative RNA-binding domain shared by some spliceosomal and
ribosomal proteins (29, 41, 52, 62, 70, 77).
The observation that mammalian telomerase RNA contains a 3'-terminal
domain that structurally resembles H/ACA snoRNAs (57) has
greatly stimulated interest in H/ACA snoRNPs and their components. Telomerase is a ribonucleoprotein enzyme responsible for maintaining telomeric ends of the chromosomes. The enzyme uses a short internal region of its RNA subunit as a template to synthesize sequence repeats
that form telomeres (reviewed in references 4, 5, and 14). Mitchell et al. (57) have shown
that the H/ACA domain is required for the accumulation and function of
human telomerase RNA (hTR) in vivo. Moreover, both dyskerin and
hGAR1 are associated with hTR in vivo (15, 58), and dyskerin
was found to be a component of active telomerase (58). hGAR1
can also associate with hTR in vitro (15). It has been
suggested that decreased telomerase activity, and not a failure in rRNA
processing and/or pseudouridylation, is the main factor contributing to
the development of dyskeratosis congenita (58).
In this work we describe the characterization of hNHP2 and hNOP10, the
human orthologs of yeast Nhp2 and Nop10 proteins, and further analysis
of hGAR1. Both hNHP2 and hNOP10 are functionally conserved proteins
that can complement yeast cells depleted of Nhp2p or Nop10p.
Immunoprecipitation experiments indicate that hNHP2 and hNOP10
specifically associate with hGAR1 and H/ACA snoRNAs. They also
associate with hTR, as previously shown for dyskerin and hGAR1. Tagged
hNHP2 and hNOP10 expressed in HeLa cells colocalize with hGAR1 in the
dense fibrillar components (DFC) of nucleoli and in CBs. Finally, we
demonstrate that short conserved sequences at the N and C termini of
the hGAR1 core domain are essential for localization of the protein in
HeLa cells.
Cloning of hNHP2 and hNOP10 cDNAs.
Expressed sequence tag
(EST) sequences encoding putative human orthologs of Nhp2p were
identified in BLAST searches using the yeast Nhp2p sequence as a query.
5' and 3' rapid amplifications of cDNA ends (RACE) were performed on
total RNA isolated from HeLa cells to determine the complete sequence
of hNHP2 cDNA. Three different hNHP2-specific oligonucleotides,
GGGCAGTGTGTCTCCTGCCAAAACC, CTGAACCTCTTTCACCCCGCGCCG,
and CCGAATCTGCTTCTGCTTCACGC, were used for 5' RACE,
and primer GTCTATATCCCCTCTAAGACGGACCTGGG was used for the 3'
RACE, in accordance with the manufacturer's instructions (Boehringer
Mannheim). Primers specific for the 5'
(CCGGAATTCATGACCAAAATAAAGGCAGATCCCGAC) and 3'
(GCGGAATTCTCATAGGGGTAGCAGGGAC) ends of the hNHP2
coding region (EcoRI sites are underlined) were used to
amplify by PCR the hNHP2 coding region from a plasmid cDNA library
derived from a human Namalwa (Burkitt lymphoma) cell line
(71). The amplified fragment was cleaved with
EcoRI and cloned into the EcoRI site of
pcDNA3.1/HisC (Invitrogen) to generate plasmid pcDNA-hNHP2.
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Human H/ACA Small Nucleolar RNPs and Telomerase
Share Evolutionarily Conserved Proteins NHP2 and NOP10
i
,
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
GFP fusion expression constructs.
The ORF of hGAR1
(15) (accession no. AJ276003) was amplified by PCR using
primers CCCGATATCATGTCTTTTCGAGGCGGAGG and
GGGGATATCTGGAGGTCCTTTCTCACCTG (EcoRV
sites are underlined) and cloned in the EcoRV site of
p
act-ECGFP (49) to generate p
hGAR1-EGFP, which encodes
full-length hGAR1 fused to the N terminus of enhanced green fluorescent
protein (EGFP). For simplicity, this and other fusions to EGFP are
referred to as green fluorescent protein (GFP) fusions. The portion
encoding the core domain of hGAR1 (amino acids 62 to 168) was cloned
similarly, using appropriate primers, to generate p
core-EGFP. Coding
sequences for shorter forms of the core domain, truncated at either the N or C terminus, were likewise amplified by PCR and cloned in the
EcoRV site of p
act-ECGFP. Plasmids p
core
3N-EGFP,
p
core
6N-EGFP, p
core
8N-EGFP, and p
core
14N-EGFP encode
the core domain N-terminal deletion mutant derivatives lacking 3, 6, 8, and 14 amino acids, respectively. Plasmids p
core
9C-EGFP,
p
core
13C-EGFP, and p
core
20C-EGFP encode the core domain
C-terminal deletion mutant derivatives lacking 9, 13, and 20 amino
acids, respectively. The ORFs encoding hNHP2 and hNOP10 were amplified
by PCR and cloned similarly to generate p
hNHP2-EGFP and
p
hNOP10-EGFP, respectively. The primers used were
CCCGATATCGCTGCGATGACCAAAATAAAGGC and
GGGGATATCTAGGGGTAGGGGCAGGGACTG (hNHP2) and
CCCGATATCATGTTTCTCCAGTATTACCTCAACGAG and
GGGGATATCGAGGACAGGGCGCGGTTGCTG (hNOP10)
(EcoRV sites are underlined). The ORF encoding dyskerin was
amplified by PCR as described previously (see above) and cloned into
the EcoRV site of p
act-mGFP6 (a kind gift from A. Matus, Friedrich Miescher Institute) to generate p
mGFP6-DKC1, which encodes
dyskerin with GFP at its N terminus. The identities of all constructs
were checked by sequencing. DNA manipulations were carried out as
described by Sambrook et al. (67).
Subcellular localization.
HeLa cells were grown on glass
coverslips in Dulbecco modified Eagle medium supplemented with 10%
fetal bovine serum (Gibco-BRL) in a 5% CO2 humidified
atmosphere at 37°C. For transient transfection assays with GFP- or
Xpress-tagged constructs, HeLa cells were transfected with plasmid DNA
using FuGENE as recommended by the manufacturer (Boehringer Mannheim)
and further incubated for 24 to 48 h. Indirect immunofluorescence
microscopy was performed essentially as described by Genschik et al.
(21), using purified rabbit anti-hGAR1 antibodies (Abs)
(15) at 1/1,000 dilution, mouse antifibrillarin monoclonal
antibody (MAb) 72B9 (a kind gift from J. A. Steitz and K. T. Tycowski, Yale University School of Medicine, and K. M. Pollard,
The Scripps Research Institute) at 1/400 dilution, mouse
anti-p80-coilin MAb (5P10-
; kindly provided by M. Carmo-Fonseca,
University of Lisbon) at 1/100 dilution, rabbit polyclonal
anti-p80-coilin (sera 204/5; a kind gift from A. Lamond, University of
Dundee) at 1/2,000 dilution, mouse anti-p120 MAb (Ab-1; Calbiochem) at
1/200 dilution, mouse anti-U2B" MAb (4G3; Cappel) at 1/200 dilution,
mouse anti-GFP MAbs (Boehringer Mannheim) at 1/400 dilution, mouse
antiubiquitin MAb (Ubi-1; ZYMED Laboratories), and mouse anti-Xpress
MAb (Invitrogen) at a dilution of 1/500. Appropriate secondary
antibodies (Jackson ImmunoResearch Laboratories), specified in the
figure legends, were used at 1/400 dilution. Samples were examined with
a laser scanning confocal microscope from Leica. Direct GFP
fluorescence microscopy on living cells was performed as described
previously (33).
Immunoprecipitations. Protein G-Sepharose (PGS) beads (Pierce) or protein A-Sepharose (PAS) beads (Amersham Pharmacia Biotech) were incubated with appropriate antibodies (mouse anti-GFP MAbs for the analysis of the coimmunoprecipitated RNAs with PGS and rabbit anti-hGAR1 Abs and mouse antifibrillarin MAb 72B9 for the analysis of the coimmunoprecipitated proteins with PAS) in NET-2 buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.05% Nonidet P-40) with gentle agitation overnight at 4°C. HeLa cells were transfected using FuGENE as described above and grown for additional 24 to 48 h (90% confluency). Cells were scraped from the petri dishes, washed three times with phosphate-buffered saline and resuspended in NET-2 buffer supplemented with the protease inhibitor Complete cocktail (Boehringer Mannheim). Whole-cell extracts, prepared by sonication (three times for 30 s at 50 W; Braun sonicator), were spun at 15,000 × g for 10 min. For each immunoprecipitation, the lysate of ~5 × 106 cells was used. Lysates (500 µl) were mixed with the antibody-coated beads and incubated with a gentle agitation for 1 h at 4°C. Beads were then washed five times with NET-2 buffer containing 400 mM NaCl. Immunoprecipitated RNAs and total RNA from the whole-cell sonicates (HeLa cells used for preparation of total RNA were grown in suspension cultures) were extracted with phenol-chloroform containing 0.5% sodium dodecyl sulfate (SDS) and precipitated with ethanol in the presence of 40 µg of glycogen. To analyze the immunoprecipitated proteins, beads were washed as described above and resuspended in SDS-gel loading buffer. Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) on 12% gels and analyzed by Western blotting using anti-GFP MAbs.
RNase A/T1 protection assays.
Individual RNA species were
identified by an RNase A/T1 protection assay as described previously
(26) using antisense RNA probes complementary to U17
(37), U3 (35), U19 (38), U13 (36), and hTR (15). Probes were labeled with
[
-32P]UTP (800 Ci/mmol; NEN). Immunoprecipitated RNA
from 5 × 106 cells was used for three protection
reactions. Protected RNA fragments were fractionated on 6% sequencing gels.
Heterocomplementation. The region coding for hNHP2 was excised from pcDNA-hNHP2 by digestion with EcoRI and cloned into the EcoRI site of yeast 2 µm expression vector pYX242 (a kind gift from B. Séraphin, EMBL, Heidelberg, Germany), resulting in plasmid pYX-hNHP2. The sequence coding for hNOP10 was amplified by PCR from pcDNA-hNOP10 using primers GCGGAATTCATGTTTCTCCAGTATTACCTCAACGAGC and CCGCTCGAGTCAGAGGACAGGGCGCGGTTG (EcoRI and XhoI sites are underlined) and cloned in the EcoRI-XhoI sites of pYX242, resulting in pYX-hNOP10. Expression of both proteins is driven from the triose phosphate isomerase promoter.
The pGAL-NHP2 and pGAL-NOP10 yeast strains (29), conditionally expressing Nhp2p and Nop10p, were transformed with either pYX-hNHP2, pYX-hNOP10, or the empty vector pYX242. Transformants were selected on glucose- or galactose-containing (SD-L or SGal-L, respectively) plates. Drop tests were performed from independent colonies at either permissive conditions (YPGal or SGal plates) or nonpermissive conditions (YPD or SD plates). Heterocomplementation was monitored by analyzing the growth of transformants under nonpermissive conditions. Genetic manipulations and preparation of standard yeast media followed established procedures (7).Nucleotide sequence accession number. The sequence of the hNHP2 cDNA has been deposited in the EMBL database under accession no. HAJ293309.
| |
RESULTS |
|---|
|
|
|---|
cDNAs encoding hNHP2 and hNOP10. In yeast, four protein components of H/ACA snoRNP have been identified: Gar1p, Cbf5p, Nhp2p, and Nop10p. Two H/ACA snoRNP proteins have also been characterized in mammals. NAP57/dyskerin, which is the ortholog of the putative pseudouridine synthase Cbf5 (44, 82), has been studied in mouse and human cells (27, 56, 80). hGAR1, the human ortholog of yeast Gar1p, has recently been described (15).
The in vitro reconstitution studies carried out with HeLa cell extracts suggested that four proteins interact specifically with human H/ACA snoRNAs (15). Indeed, database searches have previously identified human ESTs coding for proteins related to yeast Nop10p and Nhp2p (29, 52, 77). To functionally characterize human Nop10p- and Nhp2p-like proteins (hNOP10 and hNHP2, respectively), full-length cDNAs encoding the likely human orthologs (see Materials and Methods) were cloned into different expression vectors and their activity in S. cerevisiae and human HeLa cells was investigated. The selected hNOP10 sequence corresponds to the protein included in the alignment of Henras et al. (29). The hNHP2 protein is an extended and corrected version of sequences presented by other groups (29, 52, 77). hNHP2 and hNOP10 consist of 153 and 64 amino acids, respectively.hNHP2 and hNOP10 complement yeast deletion mutants.
hNHP2 is
54.7% identical and 68.4% similar to yeast Nhp2p, while hNOP10 and
yeast Nop10p are 60.3% identical and 67.2% similar. In order to find
out whether the human proteins can complement yeast cells depleted of
Nhp2p and Nop10p, the ORFs encoding hNHP2 and hNOP10 were cloned into
the expression vector pYX242 to produce pYX-hNHP2 and pYX-hNOP10,
respectively. Yeast strains pGAL-NHP2 and
pGAL-NOP10 (29) were transformed with pYX-hNHP2,
pYX-hNOP10, or the empty vector pYX242 and grown on either glucose-
(YPD) or galactose-containing (YPGal) plates. As shown in Fig.
1, expression of human proteins
complemented growth of pGAL-NHP2 and pGAL-NOP10 strains on YPD plates under conditions where the yeast proteins are not
produced.
|
hNHP2, hNOP10, and dyskerin interact with hGAR1.
We
investigated whether hNHP2, hNOP10, and dyskerin can be
coimmunoprecipitated with hGAR1, the previously characterized protein component of human H/ACA snoRNPs. GFP fusions with hNHP2, hNOP10, and
dyskerin were transiently expressed in HeLa cells, and whole-cell extracts were incubated with anti-hGAR1 Abs attached to PAS beads (for
simplicity, we refer to these as anti-hGAR1 beads and we use this
appellation for other antibody-bead complexes). As a control, the same
extracts were incubated with antifibrillarin beads, since fibrillarin
is a protein component of box C/D snoRNPs. The immunoprecipitated
proteins were fractionated by SDS-PAGE. Western blotting with anti-GFP
MAbs revealed that GFP fusions with hNHP2, hNOP10, and dyskerin were
present in the anti-hGAR1 immunoprecipitates but not in the
antifibrillarin immunoprecipitates (Fig.
2). Similar results were obtained when
the association of hGAR1 with hNHP2, hNOP10, and dyskerin, expressed as
fusions with the Xpress-tag (see Materials and Methods), was studied in
HeLa cells (data not shown). These results indicate that hNHP2, hNOP10, dyskerin, and hGAR1 associate together in structures very likely corresponding to H/ACA snoRNPs.
|
hNHP2 and hNOP10 are specifically associated with H/ACA
snoRNAs.
To determine if hNHP2 and hNOP10 are indeed components of
the H/ACA snoRNPs, we investigated whether they are associated with H/ACA snoRNAs in human cells. GFP-tagged hNHP2, hNOP10, and dyskerin were transiently expressed in HeLa cells, and whole-cell extracts were
incubated with anti-GFP beads. Immunoprecipitated RNAs were extracted,
and individual RNA species were identified by RNase A/T1 mapping. H/ACA
snoRNAs U17 and U19 were immunoprecipitated from cells expressing
hNHP2-, hNOP10-, and dyskerin-GFP fusions but not from control cells
expressing GFP alone (Fig. 3, lanes 4 to
6). Box C/D snoRNAs U3 and U13 were not detected in anti-GFP immunoprecipitates but were present in antifibrillarin
immunoprecipitates isolated from control HeLa cells (Fig. 3, lane 7).
hTR possesses an H/ACA-like domain and associates with dyskerin and
hGAR1 (15, 57, 58). Mappings of RNAs isolated from different
immunoprecipitates indicated that hNHP2 and hNOP10 also specifically
associate with hTR (Fig. 3). Specific coprecipitation of H/ACA snoRNAs
and hTR with hNHP2, hNOP10, and dyskerin expressed as fusions with the Xpress tag was also observed (data not shown). Taken together, our data
suggest that hNHP2 and hNOP10 are components of H/ACA snoRNPs and
telomerase in human cells.
|
Comparison of hNOP10 and hNHP2 with likely orthologs from other
organisms.
hNHP2 and hNOP10 have calculated molecular masses of
17.2 and 7.7 kDa, respectively, and their sizes are similar to those of
yeast Nhp2p (calculated mass, 18.9 kDa) and Nop10p (6.6 kDa). However,
as already observed for the yeast proteins (29, 77), the
mobilities of hNHP2 and hNOP10 in SDS gels appear to be substantially slower then expected (data not shown). Hence, it is very likely that
hNHP2 and hNOP10 correspond to p23 and p14, respectively, two of the
four human proteins that can be specifically UV cross-linked to RNA in
H/ACA snoRNPs reconstituted in vitro (15). We compared the
sequences of these proteins with their likely orthologs from other
organisms. Database searches indicated that sequences similar to hNOP10
are encoded not only in genomes of many other eukaryotes (29, 52,
77) but also in all archaeal genomes sequenced to date (Fig.
4); E values for the
similarity of hNOP10 to different archaeal sequences, derived from
BLAST searches, range from 0.011 to 1.2 (with the exception of a
substantially higher value for the protein from Methanococcus
jannaschii). Although these values are low, similar lengths and a
nearly perfect colinearity of eukaryotic and archaeal NOP10-like
proteins (four of the archaeal proteins differ from eukaryotic ones
only by insertions of single Cys residues at two positions) add to the
potential significance of this relationship (76) (see
Discussion). No sequences with significant similarity to Nop10p or
hNOP10 could be identified in Bacteria.
|
33 to 10
8 (data
not shown). Since NHP2-like proteins are members of a large family of
RNA-associated proteins, which include some ribosomal and spliceosomal
proteins (references 29, 41, 52, 62, 70, and
77 and references therein), database searches with hNHP2 identified also other proteins in both eukaryotes and
Archaea (data not shown). Archaeal sequences most probably
represent ribosomal proteins (34, 52) (see Discussion).
Subcellular localization of human H/ACA snoRNP proteins. Of the four identified protein components of the H/ACA snoRNPs in mammalian cells (15, 27, 58, 80; this work), only the cellular localization of NAP57/dyskerin was studied. This protein is localized in the DFC of the nucleolus and in CBs (28, 56). We investigated the intracellular distribution of hGAR1, hNHP2, and hNOP10 in HeLa cells.
Localization of hGAR1 was studied by indirect immunofluorescence microscopy using affinity-purified anti-hGAR1 Abs (15). The following proteins were monitored in parallel as markers: (i) the box C/D snoRNP protein fibrillarin, which localizes to the DFC of nucleoli and in CBs (reviewed in references 45 and 68); (ii) p80-coilin, a marker for CBs (reviewed in references 17, 45, and 53); (iii) p120 nucleolar proliferation antigen localizing to the granular component of nucleoli (63); (iv) the splicesomal protein U2B" present in the nucleoplasmic speckles and in CBs (9). Double-staining experiments showed that hGAR1 colocalizes perfectly with fibrillarin in the DFC of nucleoli and in CBs (Fig. 5, left panels) and with p80-coilin in CBs (Fig. 5, second panels from left). Double labeling with p120 revealed that hGAR1 is excluded from nucleolar regions occupied by p120. Furthermore, hGAR1 did not colocalize with the U2-specific protein U2B" in the nucleoplasm; however, colocalization of the two proteins was observed in CBs.
|
|
Localization of hGAR1 deletion mutants. Previous work has indicated that GAR1 is not a primary snoRNA binding protein (see the introduction). It is possible that GAR1 is only required for the activity or localization of H/ACA snoRNPs. In order to get more insight into the function of hGAR1, we studied the intracellular localization of different mutant derivatives of the protein that were transiently expressed in HeLa cells.
The overall structure of GAR1 is preserved among eukaryotes (15, 23, 24, 77). The GAR domains that flank the core domain vary in length and amino acid composition, while the core domain is very highly conserved at the primary sequence level (Fig. 7A). We have found that localization of the core domain fused to GFP (core-GFP) is similar to that of hGAR1-GFP, except that more staining is observed in the nucleoplasm and cytoplasm (Fig. 7B), indicating that GAR domains may help in targeting the protein to its functional sites. This result also suggests that the core-GFP hybrid protein is functional and that the core domain contains all the signals required for localization in the DFC of the nucleolus and in CBs. The data are consistent with the observation that the core domain of yeast Gar1p is sufficient for nucleolar targeting and function (25).
|
3N; for the structures of this and other mutant
derivatives, see Fig. 7A) had no effect, but deleting three amino acids
more (
6N), which eliminated the strictly conserved GPP motif,
impaired localization of the hybrid protein. This mutant protein
accumulated in cytoplasmic clumps or dot-like structures. A similar
phenotype was observed with cells expressing the deletion mutant
derivatives
8N and
14N, which are missing 8 and 14 amino acids at
the N terminus of the core, respectively. In living cells, the
cytoplasmic dots are mobile (data not shown). Moreover, the cytoplasmic
clumps or dots were shown to be enriched in ubiquitin (Fig. 8C). These observations and the fact that the large clumps accumulated near the
nuclear membrane (Fig. 8A) strongly suggest that the N-terminal deletions induce the formation of aggresomes in response to protein misfolding (20, 32, 79). Therefore, the GPP motif could be
important for both protein folding and nucleolar localization, since
the fraction of mutated proteins that could enter the nucleus remained
excluded from nucleoli and CBs.
|
9C) had no effect on the subcellular localization of
the hybrid protein (Fig. 8B); however, deleting four amino acids more
(
13C), which removed the RFLP tetrapeptide that is perfectly
conserved in all GAR1 sequences (Fig. 7A), impaired accumulation of the
fusion protein in the nucleolus but not in CBs. It is important to note
that core
13C-GFP was not excluded from the nucleolus, but it could
not accumulate in this compartment. A longer C-terminal deletion (20 amino acids) that eliminated the KLLPL pentapeptide, another highly
conserved portion of the core domain, completely abolished localization
of the core
20C-GFP hybrid protein in the nucleolus and CBs. Taken
together these results indicate that highly conserved amino acids at
the C-terminal border of the core domain are required for localization
in the nucleolus and CBs.
Association of hGAR1 mutant derivatives with U17 RNP.
We
investigated whether deletions in the core domain disrupted its
potential to associate with U17 RNP. Western blotting analysis indicated that the deletion mutant derivatives
3N,
9C,
13C, and
20C accumulate to levels comparable to that of the core-GFP (Fig. 9A). Accumulation of the mutant
derivatives
6N,
8N, and
14N was low (data not shown),
supporting the suggestion that these mislocalizing hybrid proteins
undergo ubiquitin-mediated proteolysis (Fig. 8), and their
characterization was not pursued further. As shown in Fig. 9B, core-GFP
and the mutant derivatives
3N and
9C, which accumulate in both
the nucleolus and CBs, and the mutant derivative
13C, which
accumulates in CBs but not the nucleolus, efficiently coprecipitated
the U17 snoRNA, suggesting that they are competent in assembling into
an RNP. The
20C mutant derivative, which could not accumulate in the
nucleolus or CBs, was unable to associate with the U17 RNP.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the yeast S. cerevisiae, four protein components of the H/ACA snoRNPs have been identified: Gar1p, Cbf5p, Nhp2p, and Nop10p. Based on in vitro reconstitution studies, four proteins were also found to specifically interact with H/ACA snoRNAs in HeLa cell extracts. Two of the mammalian proteins have already been characterized, namely, hGAR1 and NAP57/dyskerin, the ortholog of Cbf5p. In this work we describe properties of hNOP10 and hNHP2, the human orthologs of yeast Nop10p and Nhp2p, and further characterize hGAR1. We find that hNOP10 and hNHP2 complement yeast cells depleted of endogenous Nop10p and Nhp2p. Moreover, transiently expressed epitope-tagged hNOP10 and hNHP2 specifically associate with hGAR1, H/ACA snoRNAs, and the telomerase RNA in HeLa cells. hNOP10, hNHP2, hGAR1, and dyskerin localize to the DFC of the nucleolus and in CBs. We demonstrate that the evolutionarily conserved core domain of hGAR1 contains all the signals required for localization but that progressive deletions from either the N or the C terminus of the core domain abolish localization in the nucleolus or both the nucleolus and CBs.
A comparison of hNOP10 and hNHP2 with the orthologs from S. cerevisiae and the recently characterized NHP2 of the fission yeast S. pombe and database searches indicate that both
proteins are highly conserved among eukaryotes 29, 52,
77; this work; our unpublished results). NHP2 is likely to be
a primary RNA-binding protein since it belongs to a family of proteins
containing a novel type of RNA-binding domain (41); this
family includes proteins highly similar to NHP2, such as some ribosomal
proteins (rp) from both eukaryotes (reference 41 and
references therein) and Archaea (34), and the
spliceosomal 15.5-kDa protein associated with U4 snRNA (62)
(for the most recent alignments and the phylogenetic analysis of NHP2
and related proteins, see references 52 and 62). Genetic depletion of Nhp2p, similar to
depletion of Nop10p and Cbf5p, results in a reduction of the
steady-state levels of the H/ACA snoRNAs in yeast, which is consistent
with the notion that Nhp2p interacts directly with the RNA and that
this interaction is required for stability. Importantly, the
H/ACA-specific p23 protein, which most probably corresponds to hNHP2
(see below), was by far the most efficiently cross-linked to RNA
(15). Moreover, NHP2 can bind directly to RNA in vitro (A. Henras, personal communication; N. Watkins, and R. Lührmann,
personal communication; V. Poga
i
, unpublished data). For
two NHP2-related proteins, the yeast rpL30 (formerly rpL32) and the
human 15.5-kDa protein associated with U4, the structure of the
RNA-binding sites has been characterized (48, 62, 75).
Henras et al. (29) suggested that there is some similarity
between the rpL30 RNA-binding site and functionally important regions
of H/ACA, but our attempts to model any conserved H/ACA regions as
structures recognized by rpL30 or the 15.5-kDa protein have not been successful.
Interestingly, database searches indicated that sequences similar to that of the hNOP10 protein are encoded not only in eukaryotes but also in all archaeal genomes (Fig. 4). No sequences with similarity to that of NOP10 could be identified in Bacteria. While this study was being prepared for publication, Watanabe and Gray (76) also reported detection of NOP10-like sequences in Archaea. Moreover, these authors identified archaeal genes encoding proteins having weak but significant similarity to GAR1. Since the existence of Cbf5p- and dyskerin-like proteins in Archaea has also been proposed (reference 76 and references therein), it is possible that pseudouridylation of rRNA in these organisms involves particles related to eukaryotic H/ACA snoRNPs (76). To date not RNAs resembling H/ACA snoRNAs have been identified in Archaea. In addition, it is likely that archaeal NHP2-like sequences correspond to ribosomal proteins (34, 52) (see above); however, the possibility that these ribosomal proteins could also function as components of H/ACA-like RNPs cannot be excluded.
Immunoprecipitation experiments performed with epitope-tagged hNHP2 and hNOP10 expressed in HeLa cells revealed that these proteins associate with box H/ACA but not box C/D snoRNAs in vivo. Tagged hNHP2, hNOP10, and dyskerin also coprecipitated with hGAR1, providing additional evidence that all four proteins function together as components of human H/ACA snoRNPs. Four proteins, p60, p29, p23, and p14, were previously found by UV cross-linking to specifically interact with H/ACA snoRNAs in HeLa cell extracts, and immunodepletion experiments indicated that p29 corresponds to hGAR1 (15). Based on the mobility in SDS gels of proteins expressed in transfected cells or translated in vitro (data not shown), it is very likely that dyskerin, hNHP2, and hNOP10 correspond to p60, p23, and p14, respectively.
The telomerase RNA in vertebrates contains a 3'-terminal domain that structurally resembles H/ACA snoRNAs (12, 57). This domain is required for the accumulation and function of hTR in vivo. Two human H/ACA proteins, dyskerin (58) and hGAR1 (15), were previously shown to associate with hTR in vivo, and dyskerin was found to be a component of active telomerase. hGAR1 also associates with hTR in the in vitro reconstitution system (15). We showed that epitope-tagged hNHP2 and hNOP10 expressed in transfected HeLa cells specifically immunoprecipitate hTR (Fig. 3). We can thus conclude that all four core H/ACA proteins are components of telomerase in human cells. The function of the H/ACA domain in hTR is not well understood. Based on the recently derived structural model of vertebrate telomerase RNAs, the region resembling the pseudouridylation pocket of H/ACA snoRNAs is unlikely to act as a guide in RNA modification (12). More probably, association of H/ACA proteins with hTR is required for correct 3'-end processing and/or stabilization of hTR (57, 58). Indeed, mutations in dyskerin which lead to dyskeratosis congenita result in reduced hTR accumulation and shortening of telomeres (58). The H/ACA domain might also be required for bringing hTR to the nucleolus (57, 59), possibly for progressive assembly of the RNP, which would be analogous to the partial nucleolar assembly of the signal recognition particle (65). Finally, the observation that the replacement of the H/ACA-like domain of hTR with a conventional H/ACA snoRNA sequence does not produce the active telomerase in vivo (57) suggests that this domain contains some specific sequences likely to be recognized by telomerase proteins, a possibility supported by the results of previous in vitro assembly experiments (15).
In S. cerevisiae, Gar1p, Nhp2p, and Nop10p were shown to localize to the nucleolus, whereas for mammalian orthologs cellular localization was only studied for NAP57/dyskerin. This protein localizes to the DFC of the nucleolus and to CBs (28, 56). We have found that hGAR1, hNHP2, and hNOP10 also localize to the DFC of nucleoli and to CBs. Localization of all known H/ACA proteins to the DFC is consistent with the pseudouridylation of rRNA being an early maturation event in the nucleolus (reviewed in reference 51). Association of the H/ACA proteins with CBs supports a proposed role for these structures in biogenesis, trafficking, or recycling of small nucleoplasmic and nucleolar RNPs (reviewed in references 17, 45, 47, and 53). Importantly, the H/ACA snoRNA U17 localizes similarly to H/ACA proteins in HeLa cells; it is present in both the nucleolus and CBs (M. Hebert, G. Matera, P. Pelczar, and W. Filipowicz, unpublished results). However, it should be noted that localization of box C/D snoRNAs in CBs, but not box H/ACA snoRNAs, could be visualized in microinjected Xenopus oocytes (46, 59, 60).
We have shown that, as in yeast (25), the core domain of hGAR1 contains all the signals required for proper subcellular localization. In the absence of GAR domains, the core-GFP hybrid protein was found in the nucleolus and CBs, but residual staining in the nucleoplasm and cytoplasm indicates that GAR domains help in targeting the protein to, or retaining it in, its functional sites. It is noteworthy that GAR domains are found in many nucleolar proteins and might be required for optimal nucleolar targeting or retention. Additional deletions in the core domain revealed that the GPP motif at the N-terminal border of the core domain is required for proper folding and nucleolar localization. Removal of this motif induced the formation of aggresomes, a protein misfolding response that is activated when the proteasome is overwhelmed (20, 32, 79). An active transport mechanism is required for localization of GAR1 (25); since the GPP tripeptide is strictly conserved among Eucarya, this motif might be required at some stage during the cytosol-to-nucleolus itinerary.
Conserved motifs at the C-terminal border of the core domain are also
required for proper targeting and accumulation in the nucleolus and
CBs. Indeed, deletion of the RFLP motif, which is strictly conserved
among Eucarya, impaired accumulation, but not targeting, of
the
13C mutant derivative in the nucleolus. This protein could,
however, accumulate in CBs. The RFLP motif might be required for
function and/or interaction with other nucleolar components; in its
absence, defective snoRNPs could be rejected and targeted to CBs for
recycling (53). This view is in agreement with the
observation that nucleolar targeting of dyskerin in microinjected mammalian cells precedes accumulation in CBs (28). Moreover, the nucleolar and CB protein Nopp140, which associates with H/ACA and
C/D snoRNPs and which has been proposed to act as an snoRNP chaperone,
also accumulates in the nucleolus prior to associating with CBs
(30, 80). Immunoprecipitation experiments indicated that the
core
13C mutant derivative interacts with the U17 snoRNP. In
contrast, the
20C mutant derivative, which is missing an additional motif (KLLPL), did not coprecipitate with U17 RNA and did not accumulate in the nucleolus or CBs. Thus, the conserved C-terminal motifs play an important role in assembly and localization of H/ACA
snoRNPs. Our results further suggest that mutant proteins need to bind
snoRNP before entering the nucleolus and CBs. Alternatively, it is
possible that RNP binding occurs in the nucleolus and that proteins
that fail to enter the nucleolus cannot form RNPs. However, we favor
the former scenario since it is very likely that snoRNP assembly is
concomitant with snoRNA transcription in the nucleoplasm (8,
66).
Bagni and Lapeyre (2) have shown that yeast Gar1p
specifically binds H/ACA box snoRNAs snR10 and snR30 in vitro. The
N-terminal half of the core domain is absolutely essential but not
sufficient for this interaction to take place; it additionally requires
the presence of either one of the GAR domains or the C-proximal half of
the core domain. Based on the yeast Gar1p mutagenesis studies (2), the hGAR1 mutant derivatives
9C and
13C are
unlikely to retain the potential to bind RNA. The ability of these
mutant derivatives to associate with the U17 snoRNP may, therefore,
indicate that protein-protein contacts rather than binding to RNA are
responsible for the association of hGAR1 with the particle.
Investigation of the RNA-binding potential of hGAR1 and other H/ACA
proteins and of interactions between individual components of H/ACA
snoRNPs will be important for a better understanding of the assembly
and function of these particles.
| |
ACKNOWLEDGMENTS |
|---|
V. Poga
i
and F. Dragon contributed equally to this work.
We are grateful to J. A. Steitz, K. T. Tycowski, K. M. Pollard, M. Carmo-Fonseca, and A. Lamond for generous gifts of
antibodies and to A. K. Winteroe (The Royal Veterinary and
Agricultural University, Denmark) and S. A. Williams (Clark
Science Center, Smith College) for the Sus scrofa and
Brugia malayi GAR1 cDNA clones, respectively. We thank our
FMI colleagues Andrew Matus for plasmids, Patrick Matthias for the
plasmid cDNA library, Peter Müller for oligonucleotide synthesis,
Herbert Angliker for DNA sequencing, and Zdravko Lorkovi
for
help with art work.
The Friedrich Miescher Institute is part of the Novartis Research Foundation.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Friedrich Miescher Institut, Maulbeerstrasse 66, CH-4058 Basel, Switzerland. Phone: 41 61 697 4128. Fax: 41 61 697 3976. E-mail: Witold.Filipowicz{at}fmi.ch.
Present address: Department of Therapeutic Radiology, Yale
University School of Medicine, New Haven, CT 06520-8040.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bachellerie, J.-P., J. Cavaillé, and L.-H. Qu. 2000. Nucleotide modifications of eukaryotic rRNAs: the world of small nucleolar RNA guides revisited, p. 191-203. In R. A. Garrett, S. R. Douthwaite, A. Liljas, A. T. Matheson, P. B. Moore, and H. F. Noller (ed.), The ribosome: structure, function, antibiotics, and cellular interactions ASM Press, Washington, D.C. |
| 2. |
Bagni, C., and B. Lapeyre.
1998.
Gar1p binds to the small nucleolar RNAs snR10 and snR30 in vitro through a nontypical RNA binding element.
J. Biol. Chem.
273:10868-10873 |
| 3. | Balakin, A. G., L. Smith, and M. J. Fournier. 1996. The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86:823-834[CrossRef][Medline]. |
| 4. | Blackburn, E. H., and C. W. Greider. 1995. Telomeres. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 5. | Blackburn, E. H. 1999. Telomerase, p. 609-635. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), The RNA world, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 6. | Bousquet-Antonelli, C., Y. Henry, J.-P. Gélugne, M. Caizergues-Ferrer, and T. Kiss. 1997. A small nucleolar RNP protein is required for pseudouridylation of eukaryotic ribosomal RNAs. EMBO J. 16:4770-4776[CrossRef][Medline]. |
| 7. | Brown, A. J. P., and M. Tuite. 1998. Yeast gene analysis. Academic Press, London, United Kingdom. |
| 8. | Caffarelli, E., A. Fatica, S. Prislei, E. De Gregorio, P. Fragapane, and I. Bozzoni. 1996. Processing of the intron-encoded U16 and U18 snoRNAs: the conserved C and D boxes control both the processing reaction and the stability of the mature snoRNA. EMBO J. 15:1121-1131[Medline]. |
| 9. |
Carmo-Fonseca, M.,
R. Pepperkok,
M. T. Carvalho, and A. I. Lamond.
1992.
Transcription-dependent colocalization of the U1, U2, U4/U6, and U5 snRNPs in coiled bodies.
J. Cell Biol.
117:1-14 |
| 10. | Cavaillé, J., M. Nicoloso, and J.-P. Bachellerie. 1996. Targeted ribose methylation of RNA in vivo directed by tailored antisense RNA guides. Nature 383:732-735[CrossRef][Medline]. |
| 11. |
Chamberlain, J. R.,
Y. Lee,
W. S. Lane, and D. R. Engelke.
1998.
Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit overlap with RNase MRP.
Genes Dev.
12:1678-1690 |
| 12. | Chen, J.-L., M. A. Blasco, and C. W. Greider. 2000. Secondary structure of vertebrate telomerase RNA. Cell 100:503-514[CrossRef][Medline]. |
| 13. |
Chu, S.,
R. H. Archer,
J. M. Zengel, and L. Lindahl.
1994.
The RNA of RNase MRP is required for normal processing of ribosomal RNA.
Proc. Natl. Acad. Sci. USA
91:659-663 |
| 14. | Collins, K. 2000. Mammalian telomeres and telomerase. Curr. Opin. Cell Biol. 12:378-383[CrossRef][Medline]. |
| 15. |
Dragon, F.,
V. Poga i , and W. Filipowicz.
2000.
In vitro assembly of human H/ACA small nucleolar RNPs reveals unique features of U17 and telomerase RNAs.
Mol. Cell. Biol.
20:3037-3048 |
| 16. | Foster, A. C., and S. Altman. 1990. Similar cage-shaped structures for the RNA components of all ribonuclease P and ribonuclease MRP enzymes. Cell 62:407-409[CrossRef][Medline]. |
| 17. |
Gall, J. G.,
M. Bellini,
Z. Wu, and C. Murphy.
1999.
Assembly of the nuclear transcription and processing machinery: Cajal bodies (coiled bodies) and transcriptosomes.
Mol. Biol. Cell
10:4385-4402 |
| 18. | Ganot, P., M.-L. Bortolin, and T. Kiss. 1997. Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89:799-809[CrossRef][Medline]. |
| 19. |
Ganot, P.,
M. Caizergues-Ferrer, and T. Kiss.
1997.
The family of box ACA small nucleolar RNAs is defined by an evolutionarily conserved secondary structure and ubiquitous sequence elements essential for RNA accumulation.
Genes Dev.
11:941-956 |
| 20. |
García-Mata, R.,
Z. Bebök,
E. J. Sorscher, and E. J. Sztul.
1999.
Characterization and dynamics of aggresome formation by a cytosolic GFP-chimera.
J. Cell Biol.
146:1239-1254 |
| 21. | Genschik, P., E. Billy, M. Swianiewicz, and W. Filipowicz. 1997. The human RNA 3'-terminal phosphate cyclase is a member of a new family of proteins conserved in Eucarya, Bacteria and Archaea. EMBO J. 16:2955-2967[CrossRef][Medline]. |
| 22. |
Giordano, E.,
I. Peluso,
S. Senger, and M. Furia.
1999.
minifly, a Drosophila gene required for ribosome biogenesis.
J. Cell Biol.
144:1123-1133 |
| 23. | Girard, J.-P., H. Lehtonen, M. Caizergues-Ferrer, F. Amalric, D. Tollervey, and B. Lapeyre. 1992. GAR1 is an essential small nucleolar RNP protein required for pre-rRNA processing in yeast. EMBO J. 11:673-682[Medline]. |
| 24. |
Girard, J.-P.,
M. Caizergues-Ferrer, and B. Lapeyre.
1993.
The SpGAR1 gene of Schizosaccharomyces pombe encodes the functional homologue of the snoRNP protein GAR1 of Saccharomyces cerevisiae.
Nucleic Acids Res.
21:2149-2155 |
| 25. |
Girard, J.-P.,
C. Bagni,
M. Caizergues-Ferrer,
F. Amalric, and B. Lapeyre.
1994.
Identification of a segment of the small nucleolar ribonucleoprotein-associated protein GAR1 that is sufficient for nucleolar accumulation.
J. Biol. Chem.
269:18499-18506 |
| 26. | Goodall, G. J., K. Wiebauer, and W. Filipowicz. 1990. Analysis of pre-mRNA processing in transfected plant protoplasts. Methods Enzymol. 181:148-161[Medline]. |
| 27. | Heiss, N. S., S. W. Knight, T. J. Vulliamy, S. M. Klauck, S. Wiemann, P. J. Mason, A. Poustka, and I. Dokal. 1998. X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions. Nat. Genet. 19:32-38[Medline]. |
| 28. |
Heiss, N. S.,
A. Girod,
R. Salowsky,
S. Wiemann,
R. Pepperkok, and A. Poustka.
1999.
Dyskerin localizes to the nucleolus and its mislocalization is unlikely to play a role in the pathogenesis of dyskeratosis congenita.
Hum. Mol. Genet.
8:2515-2524 |
| 29. | Henras, A., Y. Henry, C. Bousquet-Antonelli, J. Noaillac-Depeyre, J.-P. Gélugne, and M. Caizergues-Ferrer. 1998. Nhp2p and Nop10p are essential for the function of H/ACA snoRNPs. EMBO J. 17:7078-7090[CrossRef][Medline]. |
| 30. |
Isaac, C.,
Y. Yang, and U. T. Meier.
1998.
Nopp140 functions as a molecular link between the nucleolus and the coiled bodies.
J. Cell Biol.
142:319-329 |
| 31. |
Jiang, W.,
K. Middleton,
H. J. Yoon,
C. Fouquet, and J. Carbon.
1993.
An essential yeast protein, Cbf5p, binds in vitro to centromeres and microtubules.
Mol. Cell. Biol.
13:4884-4893 |
| 32. |
Johnston, J. A.,
C. L. Ward, and R. R. Kopito.
1998.
Aggresomes: a cellular response to misfolded proteins.
J. Cell Biol.
143:1883-1898 |
| 33. | Kaech, S., B. Ludin, and A. Matus. 1996. Cytoskeletal plasticity in cells expressing neuronal microtubule-associated proteins. Neuron 17:1189-1199[CrossRef][Medline]. |
| 34. | Kimura, J., E. Arndt, and M. Kimura. 1987. Primary structures of three highly acidic ribosomal proteins S6, S12, and S15 from the archaebacterium Halobacterium marismortui. FEBS Lett. 224:65-70[CrossRef][Medline]. |
| 35. | Kiss, T., and W. Filipowicz. 1992. Evidence against a mitochondrial location of the 7-2/MRP RNA in mammalian cells. Cell 70:11-16[CrossRef][Medline]. |
| 36. | Kiss, T., and W. Filipowicz. 1993. Small nucleolar RNAs encoded by introns of the human cell cycle regulatory gene RCC1. EMBO J. 12:2913-2920[Medline]. |
| 37. |
Kiss, T., and W. Filipowicz.
1995.
Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns.
Genes Dev.
9:1411-1424 |
| 38. | Kiss, T., M.-L. Bortolin, and W. Filipowicz. 1996. Characterization of the intron-encoded U19 RNA, a new mammalian small nucleolar RNA that is not associated with fibrillarin. Mol. Cell. Biol. 16:1391-1400[Abstract]. |
| 39. | Kiss-László, Z., Y. Henry, J.-P. Bachellerie, M. Caizergues-Ferrer, and T. Kiss. 1996. Site-specific ribose methylation of preribosomal RNA: a novel function for small nucleolar RNAs. Cell 85:1077-1088[CrossRef][Medline]. |
| 40. | Knight, S. W., N. S. Heiss, T. J. Vulliamy, S. Greschner, G. Stavrides, G. S. Pai, G. Lestringant, N. Varma, P. J. Mason, I. Dokal, and A. Poustka. 1999. X-linked dyskeratosis congenita is predominantly caused by missense mutations in the DKC1 gene. Am. J. Hum. Genet. 65:50-58[CrossRef][Medline]. |
| 41. |
Koonin, E. V.,
P. Bork, and C. Sander.
1994.
A novel RNA-binding motif in omnipotent suppressor of translation termination, ribosomal proteins and a ribosomal modification enzyme?
Nucleic Acids Res.
22:2166-2167 |
| 42. |
Koonin, E. V.
1996.
Pseudouridine synthases: four families of enzymes containing a putative uridine-binding motif also conserved in dUTPases and dCTP deaminases.
Nucleic Acids Res.
24:2411-2415 |
| 43. | Lafontaine, D. L., and D. Tollervey. 1998. Birth of the snoRNPs: the evolution of the modification-guide snoRNAs. Trends Biochem. Sci. 23:383-388[CrossRef][Medline]. |
| 44. |
Lafontaine, D. L. J.,
C. Bousquet-Antonelli,
Y. Henry,
M. Caizergues-Ferrer, and D. Tollervey.
1998.
The box H + ACA snoRNAs carry Cbf5p, the putative rRNA pseudouridine synthase.
Genes Dev.
12:527-537 |
| 45. |
Lamond, A. I., and W. C. Earnshaw.
1998.
Structure and function in the nucleus.
Science
280:547-553 |
| 46. |
Lange, T. S.,
M. Ezrokhi,
F. Amaldi, and S. A. Gerbi.
1999.
Box H and box ACA are nucleolar localization elements of U17 small nucleolar RNA.
Mol. Biol. Cell
10:3877-3890 |
| 47. |
Lewis, J. D., and D. Tollervey.
2000.
Like attracts like: getting RNA processing together in the nucleus.
Science
288:1385-1389 |