INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

In vertebrates, methylation of DNA occurs predominantly at the cytosine of CpG dinucleotides. This reversible modification is required for mouse development (33), plays an active role in X-chromosome inactivation and imprinting (25), and may be involved in tissue-specific gene repression (4) and in the silencing of parasitic sequences (52). Dynamic changes in methylation have been implicated in malignant transformation (26), and thus far two genetic disorders have been correlated to defects in genes involved in maintenance of methylation and methylation-induced repression (18).

The predominant consequence of methylation is transcriptional repression, which can be mediated either directly, by blocking the binding of transcription factors to CpG containing binding sites (23), or indirectly by proteins that specifically bind to methylated DNA via a methyl-CpG-binding domain (MDB) (37). Recently, several MBD-containing proteins have been described (19), of which four have been implicated in transcriptional repression. These proteins are thought to modify chromatin structure by recruiting histone deacetylase (HDAC) activity to methylated DNA, resulting in a repressive nucleosomal structure (reviewed in references 1 and 43).

The repressive effect of methylation on a given gene depends on the nature of its control elements (such as enhancer and promoter) (2), the density of methylated CpGs (21), the protein environment of a given cell type, and the chromosomal context of the gene, which can support or repress transcription. Thus, to determine the consequences of methylation on gene activity, it is important to compare unmethylated and methylated DNAs in the same cellular system and at the same position in the genome. The availability of methylases from bacteria permits the methylation of plasmid DNA in vitro prior to transfer into vertebrate cells. Thus far, standard techniques of gene transfer involving injection or transfection have been used to introduce such in vitro-methylated DNA into cells to determine the effects of DNA methylation on expression and/or chromatin structure. Studies using this experimental approach have contributed much information to our current understanding of methylation-induced repression. However, this approach is limited by the non-chromosomal-chromatin structure and the absence of replication in the case of the nonintegrated DNA and by the influences of copy number and different integration site(s) on transcription of the transgene(s) in the case of the stable transfections.

Here we show that in vitro-methylated DNA can be efficiently targeted into defined genomic sites using Cre recombinase. In order to analyze the mechanism of methylation-induced repression, as well as the dynamics of the methylation pattern, we used this approach to compare methylated and unmethylated DNA after insertion into the same chromosomal position. We targeted two genomic loci, both of which support expression from an unmethylated transgene (9), with either a fully methylated construct or an unmethylated, but otherwise identical control.

Our results suggest that DNA methylation at a genomic site permissive for transcription is stably propagated and is sufficient to repress transcription. This repression occurs in the absence of de novo methylation of adjacent DNA and without a change in the early timing of replication, suggesting that methylation does not result in a widespread change in the structure of the locus. Furthermore, we show that the enhancer becomes demethylated and remodeled but is not sufficient to overcome the repression, which occurs at the level of transcriptional initiation. Consistent with the model of HDAC recruitment by methylated DNA (1), we observe hypoacetylation of histones H3 and H4 at the methylated regions of the transgene, implicating a localized histone deacetylation as the cause of repression.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Vectors and in vitro methylation. The targeting plasmid pL1HS2EGFP1L was constructed by standard methods; the complete sequence is available on request. It contains L1 and 1L loxP sites as defined previously (10) flanking a HS2 fragment of the human -globin LCR (GenBank HUMHBB file 7764 to 9218) linked to the human -globin promoter (fragment 374 to +44 relative to the cap site) driving an enhanced green fluorescent protein (EGFP) reporter gene. The EGFP reporter consist of the simian virus 40 (SV40) 16S-19S splicing sites fused to the EGFP coding sequences (fragment NcoI-NotI, positions 677 to 1401 of Clontech [Palo Alto, Calif.] plasmid pEGFP-N1) and to SV40 polyadenylation sites. The SV40 16S-19S splicing sites and the poly(A) signal were derived from Clontech plasmid pCMVBeta. In vitro methylation was performed with SssI methylase (NEB) according to the protocol supplied by the manufacturer, followed by organic extraction and ethanol precipitation. Completeness of reaction was verified by full resistance to digestion with the methylation-sensitive enzymes HpaII and HhaI.

Cell lines and gene targeting. MEL cell clones RL5 and RL6 contain a HYTK fusion gene flanked by inverted loxP sites (9). These cells were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% calf serum and split every 4 days. Prior to Cre-mediated targeting, cells were cultured in medium supplemented with 750 µg of hygromycin (Roche) per ml to select cells expressing the HYTK fusion gene. After selection, 4 × 10⁶ cells were cotransfected with 25 µg of pL1HS2EGFP1L, 20 µg of Cre expression plasmid (CMV-Cre) (17), and 200 µg of sonicated salmon sperm DNA as a carrier in a BTX electroporator set to 250 V and 1,100 µF. Cells were plated in nonselective media and split after 3 days into media containing 10 µM ganciclovir to select against HYTK-expressing cells. After 1 week in selection, dilutions were plated to obtain single clones, which were then expanded and analyzed by genomic DNA Southern blot.

FACS analysis. For GFP expression analysis, a single-cell suspension was harvested and washed with staining media (phosphate-buffered saline supplemented with 3% calf serum). Cells were resuspended in staining media supplemented with 1 µg of propidium iodide (PI) per ml for live-dead discrimination. Fluorescence-activated cell sorter (FACS) analysis was carried out on a FACSCalibur cytometer (Becton Dickinson) equipped with the standard fluorescein filter set. Data on a minimum of 10,000 live cells were collected and analyzed with the software CellQuest (Becton Dickinson).

Nuclease sensitivity analysis. DNase I digestion of nuclei and subsequent Southern blot analyses were performed as described previously (11). The complete GFP coding region was used as a probe.

Replication timing analysis. Replication timing was analyzed essentially as described elsewhere (7). Exponentially growing cells were pulse-labeled with bromodeoxyuridine (BrdU) and fixed. After being stained with PI, cells were sorted into different phases of the cell cycle according to DNA content, and BrdU-containing nascent DNA was purified by immunoprecipitation with an antibody against BrdU-DNA (Becton Dickinson). PCR (23 cycles) was performed using 2 µl (500 cell equivalents) of each nascent strand sample as a template. Southern blots were prepared and probed with radiolabeled probes synthesized by random priming the equivalent PCR product, amplified separately from a clone containing the transgene. In each experiment, genomic DNA from the same clone was included as a control for the strength and specificity of the PCR. All primers were specific and yielded a single primary product.

Analysis of histone acetylation. Chromatin fixation and purification were performed as described earlier (46). Exponentially growing cells (2 × 10⁸) were fixed in 150 ml of Dulbecco's modified Eagle's medium with 1% formaldehyde for 3 min at room temperature. After sonication, protein-DNA complexes were purified by isopycnic centrifugation (40). DNA content of cross-linked chromatin was quantified using a Hoefer Instruments fluorometer. Polyclonal antibodies against all acetylated isoforms of histone H4 (H4-Ac) and against histone H3 acetylated at lysines 9 and 14 (H3-Ac) were purchased from Upstate Biotechnology. Immunoprecipitation conditions for both antisera were as described elsewhere (46). Quantitative PCR of input and antibody-bound chromatin was performed with 1 to 2 ng of DNA as a template in a total volume of 25 µl with the appropriate primer pairs. Primers for transgene sequences were designed and tested to be specific and to give a product size ranging from 340 to 380 bp. The primer pair for the mouse amylase gene (amy4+6) gives a product of 400 bp, allowing us to perform duplex PCR with any of the transgene primer sets. A total of 0.1 µl of [³²P]dCTP (NEN) was added to each reaction. For each sequence, PCR reactions were performed in parallel under conditions of linear amplification (see Fig. 2 in reference 46; also data not shown) in a Perkin-Elmer 9600 thermocycler, for 27 cycles, using identical temperature profiles for all primer pairs. One-third of the reaction was subjected to electrophoresis on a 5% nondenaturing polyacrylamide gel, and products were quantified with a PhosphorImager and the ImageQuant software (Molecular Dynamics).

Nuclear run-on analysis. Nuclear run-on assays were performed as described earlier (31) using [-³²P]CTP as the label. A 369-bp fragment, starting 47 bp downstream of the cap site and ending 170 bp into the GFP reading frame was used as a promoter-proximal probe, generated by PCR using the primer pair roGFP1+2. The distal probe was generated with the primer pair GFP1+2 and corresponds to the 3' half of the GFP gene (bp 232 to 611 of the reading frame).

Methylation analysis. Southern blot analysis to detect the methylation state of HpaII sites was carried out using standard procedures. Bisulfite conversion was conducted as described previously (34). To obtain the methylation status of the enhancer, nested PCR of converted genomic DNA was carried out with primer pairs +bisHS2-1 and bisHS2-1 in the first round (30 cycles; annealing temperature, 50°C) and +bisHS2-2 and bisHS2-2 in the second round of PCR (29 cycles; annealing temperature, 50°C). For the  promoter, primer pairs +bispr1 and bispr1 (30 cycles; annealing temperature, 50°C) and +bispr2 and bispr1 (29 cycles; annealing temperature, 50°C) were used in the first and second rounds, respectively. PCR products were cloned using the TA Cloning Kit (Invitrogen, Carlsbad, Calif.), and individual clones were sequenced with an ABI PRISM 377 DNA sequencer (Perkin-Elmer) as described earlier (34).

Primer sequences. Listed are the names, product sizes, and sequences (in parentheses) of primers used in this study. The sequences in the transgene were as follows: GFP1+2, 377 bp, GFP-1 (ACATGAAGCAGCACGACTTC) and GFP-2 (TGCTCAGGTAGTGGTTGTC); roGFP1+2, 369 bp, roGFP-1 (ACCGGTGGTCGAGGAACTGA) and roGFP-2 (AGGGCACGGGCAGCTTGC); hubPr1+5, 342 bp, hubPr-1 (TGCTTACCAAGCTGTGATTCC) and hubPr-5 (GTGTCTGTTTGAGGTTGCTAG); huHS21+4, 343 bp, huHS2-1 (TTCCAGCATCCTCATCTCTGA) and huHS2-4 (TTTAGTCAGGTGGTCAGCTTCTC); mouse amylase 2.1y gene amy4+6, 401 bp, Amy4 (TCAGTTGTAATTCTCCTTGTACGG) and Amy6 (CATTCCTTGGCAATATCAACC); amyl1+2, 370 bp, mAmyl1 (AGCACTGAGGATTCAGTCTATG) and mAmyl2, (CCCGTACAAGGAGAATTACAAC); and mouse -globin 5'Ey (located 1.1 kb 5' of the Ey start codon), 376 bp, 5Ey-3 (GCACATGGATGCAGTTAAACAC) and 5Ey-4 (GAGTGACAGTGTAGAGAAGATG). The primers for bisulfite converted DNA of the transgene were as follows: +bisHS2-1 (GTTATATTTTTGTGTGTTTTTATTAGTGAT), +bisHS2-2 (TATAGTTTAAGTATGAGTAGTTTTGGTTAG), +bisHS2-2 (TATAGTTTAAGTATGAGTAGTTTTGGTTAG), bisHS2-2 (TACACATATATTAATAAAACCTAATTCTAC), +bispr-1 (ATATGAAATAAGGATATGGAAGAGGAAGGT), +bispr-2 (TTTTAAGGTATTTTTGGATAGTTAGGTGGT), and bispr-1 (CAAACCTAAAAATAAAAACAACATCCACTA).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Experimental strategy. Our goal was to define the effects of DNA methylation in a defined chromosomal position. To accomplish this, we targeted control and in vitro-methylated DNA to the same sites in the genome. The likely repressive effect of methylation on transcription precluded the use of homologous or site-specific recombination targeting strategies, which depend upon the expression of a marker gene on the DNA molecule to be inserted. Instead, we made use of recombinase-mediated cassette exchange (RMCE), which allows the targeted insertion of a DNA cassette by selection against the HYTK fusion gene introduced during the original derivation of the targeting sites (10, 47).

View larger version (24K): [in this window] [in a new window]   FIG. 1.   (A) Principle of Cre-RMCE with inverted loxP sites. First, a stable cell line is generated with a construct encoding the positive-negative selectable marker gene HYTK (a fusion of hygromycin B phosphotransferase and herpes simplex virus thymidine kinase) flanked by inverted loxP sites. For the replacement reaction, a construct containing a similar set of loxP sites flanking the cassette to be recombined is transfected together with a Cre recombinase expression plasmid. Recombination between the loxP sites in the two constructs results in exchange of the cassettes and loss of the TK-negative selectable marker. The inverted loxP sites on the same DNA molecule can also recombine, resulting in the inversion of the intervening DNA (10). Ganciclovir is used to select against cells that still express the HYTK gene, allowing isolation of cells that have undergone the targeting reaction. (B) Representative Southern blot analysis of clones derived from RL6 using a restriction enzyme and probe combination that allows determination of the correct integration and orientation. Clones containing the transgene exclusively in one orientation (lanes 1, 2, 4, 5, and 6) were further analyzed, a mixture of both orientations (lane 3), or additional random insertions of the targeting construct (lane 7) were discarded. (C) Expression of the reporter gene, as measured by flow cytometry, is independent of the time in culture and is repressed by in vitro methylation. After targeted insertion into RL5 and RL6, clones containing the unmethylated transgene (RL5-HS2 and RL6-HS2 [black]) or the in vitro-methylated transgene (RL5-HS2meth and RL6-HS2meth [grey]) were analyzed by FACS either immediately after derivation (upper profile) or after an additional 10 weeks in culture (lower profile). The original RL5 and RL6 clones (containing only the HYTK marker) served as a negative control (white). The fluorescence values shown reflect the difference between the median of the transgene containing clone and that of the GFP negative parental clone.

Methylation-induced repression in permissive genomic sites. To measure the effect of methylation on reporter gene expression, GFP fluorescence was analyzed by flow cytometry. As shown in Fig. 1C, both RL5 and RL6 insertion sites support pancellular GFP expression from the unmethylated transgene at high levels. In contrast, at both genomic sites, methylation of the reporter construct represses GFP expression in all cells analyzed. At RL5, GFP expression from the methylated construct is reduced to just above the background fluorescence level. Analysis of steady-state RNA using Northern blot analysis revealed that the residual GFP fluorescence reflects low-level transcription (data not shown). A similar expression pattern for the unmethylated and in vitro-methylated construct was observed at RL5 and RL6 when the transgene was integrated in the opposite orientation, indicating that in both genomic sites these expression characteristics are not orientation dependent (data not shown). The repressed and active expression states of the methylated and unmethylated transgenes, respectively, are stable over at least 12 weeks in culture, corresponding to ca. 100 cell divisions (Fig. 1C). The expression status at the RL5 integration site did not change even after 10 months in culture, whereas at RL6 noticeable silencing of the unmethylated transgene was observed in one orientation by the fourth month of culture, as described elsewhere (9).

Maintenance of methylation. The stable expression states of the unmethylated and premethylated transgenes at RL5, even after extended periods in culture, suggest that the original methylation state is propagated in vivo. To determine if the methylation state of the introduced cassette is faithfully maintained, genomic DNA was isolated immediately after clone derivation (day 14) and after an additional 10 weeks in culture (day 90). First, the extent of methylation of the transgene and the adjacent genomic sequence was characterized by Southern blotting using the methylation-sensitive restriction enzyme HpaII. The position of each restriction site and the DNA fragment used as a probe are shown in Fig. 2A. The HpaII sites in the GFP gene of the unmethylated construct at RL5 (RL5-HS2) are susceptible to digestion at the early and late time points, suggesting that no de novo methylation has occurred. In contrast, digestion of the RL5-HS2meth clone yields a larger fragment, indicating that these sites are methylated. The XbaI/HpaII digest reveals that all nine HpaII sites in the promoter and the GFP gene are blocked, suggesting that this part of the transgene remains completely methylated. However, the resulting fragment is smaller than a fragment obtained with the XbaI digest alone, indicating that digestion occurs at an endogenous, unmethylated HpaII site outside of the transgene. Thus methylation is stably maintained in this part of the transgene, and we find no evidence for de novo methylation at one CpG in the flanking genomic DNA.

View larger version (35K): [in this window] [in a new window]   FIG. 2.   Maintenance of the methylation status. (A) Map of the L1-HS2GFP-1L transgene, including locations of the HpaII (black diamonds) XbaI (X), BglII (B), and loxP sites (black triangles). For Southern blot analyses, genomic DNA from the early and late time points was digested with either XbaI or BglII, in combination with the methylation-sensitive enzyme HpaII, and hybridized with a GFP probe (black bar). The unmethylated clone RL5-HS2 yields a 600-bp fragment with both HpaII-containing digests at both time points, indicating that no de novo methylation of the GFP gene has occurred. The in vitro-methylated clone RL5-HS2meth shows methylation of all HpaII sites in the transgene, with the exception of the three HpaII sites at the 5' end of the transgene, as indicated by the 2.4-kb fragment obtained with a BglII/HpaII digest (see the text). (B) Detailed mapping of the methylation status of the enhancer and promoter region. Genomic DNA from the late time point was bisulfite converted, and the sequences of interest were PCR amplified, subcloned, and sequenced (see Materials and Methods). The positions of primers are indicated by open triangles. Open or filled circles correspond to unmethylated or methylated CpGs, respectively.

Early timing of replication in the methylated state. Early timing of DNA replication has been associated in many systems with active transcription, open chromatin structure, and hypomethylation of the DNA, whereas late replication has been correlated with transcriptional inactivity, closed chromatin structure, and hypermethylation (48). Thus, we sought to determine whether the targeted introduction of methylation affects the replication timing at both integration sites (RL5 and RL6) by determining the relative abundance of specific genomic sequences in nascent DNA synthesized during different windows of the cell cycle (Fig. 3 and reference 7). Exponentially growing cells were pulse-labeled with BrdU and sorted by FACS into different fractions of the cell cycle based on their DNA content. BrdU-labeled DNA was enriched by immunoprecipitation and analyzed by PCR, using primers specific for the transgene or endogenous loci with a known timing of replication. As a control for early replication, we used the endogenous mouse -globin locus and as a control for late replication we used the mouse amylase 2.1y gene, which we have shown previously to be late replicating in erythroid cells (7). The unmethylated transgene in the clone RL5-HS2 replicates early during S phase in comparison to the late control and as early as the mouse -globin locus (Fig. 3). The replication timing of the RL5 locus is also early in the methylated and transcriptionally repressed clone RL5-HS2meth (Fig. 3), which is indistinguishable from the unmethylated clone. At the RL6 locus we find the same result: early timing of replication with both the unmethylated and the methylated constructs (data not shown). Thus, at both genomic sites, methylation of the transgene does not interfere with its early replication. We conclude that the establishment of methylation-induced repression neither requires nor results in late replication of these genomic regions.

View larger version (51K): [in this window] [in a new window]   FIG. 3.   Replication timing of the RL5 insertion site containing the unmethylated (RL5-HS2) and methylated transgene (RL5-HS2meth). (A) Histograms of PI staining intensity (DNA content) of cells for timing analysis are shown. The gates used to sort cells into fractions corresponding approximately to G1, S phase (S1 to S4), and G2 are labeled. (B) PCR-Southern analysis of replication timing of the transgene and control loci. Analysis was performed as described in Materials and Methods, using primers for the early-replicating control loci (endogenous murine -globin [5'Ey3+4]), a late-replicating control locus (murine amylase [mAmyl1+2]), and the transgene enhancer (huHS21+2) and reporter gene (roGFP1+2). In RL5-HS2 and RL5-HS2meth, the transgene replicates as early as the endogenous murine -globin locus, indicating that methylation of the transgene does not delay its replication timing.

Remodeling of the enhancer is not influenced by the local methylation state. Despite the localized demethylation of HS2 observed in the RL5-HS2meth transgene, the enhancer is unable to activate transcription. Thus, we asked whether methylation of the promoter and gene interferes with remodeling of the enhancer. Nuclei were isolated and incubated with increasing amount of DNase I, and the resulting genomic DNA was analyzed on a Southern blot. In the unmethylated RL5-HS2 clone, we detect hypersensitive-site (HS) formation at the -promoter, at the HS2 enhancer and in addition, at an endogenous site 5' of the transgene (Fig. 4A). In the transcriptionally repressed and methylated clone RL5-HS2meth, no HS forms at the promoter, while the enhancer and the endogenous sites form as in the unmethylated control.

View larger version (74K): [in this window] [in a new window]   FIG. 4.   Analysis of enhancer and promoter remodeling. Nuclei were isolated and digested with increasing concentrations of DNase I. Subsequently, genomic DNA was isolated, digested with Bgl II, and hybridized with a probe corresponding to the GFP gene. (A) Analysis of integration site RL5 with the unmethylated (RL5-HS2) and methylated (RL5-HS2meth) transgene. (B) Analysis of integration site RL6. Each hypersensitive site detected is marked with an arrow.

Methylation represses initiation of transcription. Several mechanisms have been proposed to explain how DNA methylation interferes with the process of transcription. A study in the fungus Neurospora crassa suggested that DNA methylation inhibits RNA-polymerase elongation, whereas the loading of polymerases is not disturbed (45). On the other hand, experiments in Xenopus oocytes with nonreplicating plasmids suggested that methylation blocks the loading of RNA-polymerase (29). Genomic targeting of in vitro-methylated DNA allowed us to examine this question in a mammalian system, with the advantage that the methylated and unmethylated constructs reside in the same chromosomal locus and in a single copy.

View larger version (39K): [in this window] [in a new window]   FIG. 5.   Nuclear run-on analysis to determine the density of polymerases in the unmethylated and methylated transgenes at the RL5 integration site. Nuclei from the RL5-HS2 clone, containing the unmethylated transgene, the RL5-HS2meth clone, containing the methylated transgene and the control parental clone RL5 without the transgene were isolated. Nuclear run-on assays were performed in the presence of radioactively labeled CTP, and nascent RNA was hybridized to three different DNA probes: -actin as an endogenous control; 5'GFP, a promoter-proximal fragment containing the 3' end of the -globin promoter and the 5' half of the GFP gene (a PCR product generated with the primer pair roGFP1+2); and 3'GFP, a promoter-distal fragment containing most of the 3' half of the GFP coding region (generated with the primer pair GFP1+2). The actively expressing clone RL5-HS2 yields a higher signal for the proximal than for the distal probe, indicating that promoter-proximal pausing of polymerases occurs (see the text). In contrast, RL5-HS2meth gives no signal above background for either probes, suggesting a strong reduction of polymerase loading in the methylated state.

Methylation density defines the level of histone acetylation. Hyperacetylation of histones has been shown to mark open chromatin and to be required for transcriptional activation (49). The recent finding that MBD proteins interact with HDACs suggests that methylation represses transcription by recruiting HDAC activity, resulting in hypoacetylation of histones residing in methylated DNA (1). We measured the relative level of histone acetylation of the methylated and unmethylated transgenes integrated at the RL5 genomic site. Formaldehyde cross-linked chromatin was purified and immunoprecipitated with antisera against acetylated isoforms of histone H3 and H4, as described previously (46). The antibody-bound DNA was analyzed with a duplex PCR approach using one primer pair specific for a transgenic sequence and a second pair specific for the endogenous amylase 2.1y gene, under conditions of linear amplification (46; see also Materials and Methods). This amylase gene is in a closed chromatin conformation and is characterized by relative hypoacetylation of histones H3 and H4 in MEL cells (46). The ratio of the two PCR products was determined for the antibody-bound fraction and normalized to the ratio obtained from the input material prior to immunoprecipitation. Three different regions in the RL5-HS2 and RL5-HS2meth transgenes were analyzed: the enhancer, the promoter, and the coding region of the reporter gene. A representative set of PCR products and the resulting enrichments relative to amylase are shown in Fig. 6A.

View larger version (38K): [in this window] [in a new window]   FIG. 6.   Chromatin immunoprecipitation analysis of histone H3 and H4 acetylation in different regions of the methylated and unmethylated transgene. Antibodies recognizing all acetylated isoforms of H4 (H4) or histone H3 acetylated at lysines 9 and 14 (H3) were used for immunoprecipitation. PCRs were performed on the input and antibody-bound chromatin fractions in the presence of a radiolabeled nucleotide under conditions of linear amplifications, as we have shown previously (see reference 46 and Materials and Methods). One primer pair amplifies a sequence from the transgene and the other amplifies a sequence from the endogenous mouse amylase 2.1y gene. The PCR products from the input (I) and antibody-bound DNA (H3 and H4) were electrophoresed on a nondenaturing acrylamide gel; a representative gel is shown. (B) Quantification of duplex PCR products from three independent immunoprecipitation experiments. The transgene/amylase ratio from each bound fraction was standardized by dividing by the transgene/amylase ratio from the input material to determine the relative enrichment of transgenic sequences during the immunoprecipitation. The mean value and standard error of the mean for the enrichment are plotted (see the text). The x axis is drawn at 1, which reflects no enrichment.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Genomic targeting of methylated DNA results in stable transcriptional repression. We have targeted in vitro-methylated DNA into the genome to analyze methylation-induced repression at defined genomic insertion sites. DNA methylation studies have typically utilized either nonchromosomal templates, such as transiently transfected plasmids (2, 29), drug-selectable episomal constructs (21), or stably integrated transgenes (12, 30). While these experiments have been informative, nonchromosomal templates do not necessarily resemble the chromatin structure of chromosomal DNA and thus may not accurately reflect the effect of CpG methylation on transcription and chromatin structure. While stable transfection results in chromosomal integration, current protocols do not allow for control of the copy number or integration site, and thus different constructs are analyzed in different chromosomal contexts. Variable effects of different integration sites on transcription and chromatin structure are well documented (13, 20), complicating the analysis of cell lines harboring stably transfected reporter constructs. The Cre-RMCE targeting strategy described here circumvents these limitations, permitting the stable introduction of unmethylated and in vitro-methylated DNA at the same integration site.

Methylation of the transgene does not alter the methylation state, chromatin structure, or replication timing of flanking DNA. Consistent with the active expression state of the unmethylated transgene over time, we find no de novo methylation of this construct. On the other hand repression of the in vitro-methylated transgene is stable, a result consistent with the maintenance of its methylation at the promoter and the reporter gene. It has been proposed that spreading of methylation in cis into nonmethylated DNA is one mechanism by which de novo methylation occurs (50); however, we do not observe de novo methylation in the genomic DNA adjacent to the methylated construct. In addition, a DNase I-hypersensitive site flanking one of the insertion sites is present independent of the methylation state of the transgene. These observations suggest that the introduced patch of methylated DNA at the promoter and gene is propagated through cell division but is not sufficient to cause de novo methylation or to alter the chromatin structure of flanking DNA.

Methylation-induced repression of transcriptional initiation is dominant over a demethylated and remodeled enhancer. Analysis of the methylation status of the transgenes by bisulfite sequencing reveals that methylation at the promoter and gene is maintained over time, whereas the enhancer is demethylated after integration of the in vitro-methylated construct. Previous reports suggest that the binding of transactivators to DNA can interfere with the maintenance of methylation, probably by masking the CpG dinucleotide after DNA replication (22, 35). Thus, the observed demethylation at the enhancer could be a consequence of transcription factor binding to the enhancer.

Is localized deacetylation of histones sufficient for repression? Two mechanisms of methylation-induced transcriptional repression have been proposed. The binding of a subset of transcription factors is sensitive to methylation of their cognate binding sites (23), suggesting that CpG methylation of a promoter could directly block transactivator binding. However, a direct block of binding is unlikely to be responsible for the repression of the -globin promoter used in this study, as the 120-bp element upstream of the initiation site does not contain any CpGs (Fig. 2B), yet is sufficient for promoter activity (reference 36 and references therein). An alternative mechanism of transcriptional repression involving the MBD family of proteins has been proposed (reviewed in reference 1). These proteins interact with, or are integral components of, complexes which include HDACs (27, 38, 39, 51, 53), suggesting that recruitment of HDAC activity, resulting in a modified nucleosomal structure, is a common motif in methylation-induced repression. Accordingly, it has been shown that methylated transgenes are hypoacetylated (6, 8, 12, 42). Here, we observe a reduction of histone acetylation at the promoter and gene of the in vitro-methylated transgene. The degree of deacetylation is more prominent for histone H3 than for H4 and correlates with the density of methylated CpGs: the GFP gene, which has a high density of CpGs, is the most hypoacetylated, while the promoter and enhancer, with lower densities, are acetylated to a lesser extent. This localized deacetylation suggests that the recruited HDACs act only on nearby nucleosomes, a result consistent with that reported for the HDAC activity of the yeast Sin3A complex (28).