INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Heterotrimeric G proteins transduce signals from ligand-activated seven-transmembrane domain receptors to effector proteins that regulate the release of intracellular second messengers, such as Ca²⁺ and cyclic AMP. A diverse family of G-protein-coupled receptors bind numerous hormones and neurotransmitters, peptides, small proteins, and lipid molecules. The biological functions mediated by G proteins are equally diverse, including behavioral and sensory functions, appetite control, arousal, metabolism, development, inflammation, and chemotaxis.

Heterotrimeric G proteins are composed of  and subunits that can independently regulate effector proteins. Mammals express 16 distinct G subunit genes that are grouped in four classes, Gq, Gi, Gs, and G12, according to sequence similarity, effector regulation, and responsiveness to RGS (regulators of G-protein signaling) proteins, a recently identified family of GTPase-activating proteins (GAPs) for G subunits (30). The Gq class  subunits activate all isoforms of phospholipase C (PLC), which hydrolyze the membrane lipid phosphatidylinositol-4,5-bisphosphate to produce inositol trisphosphate and diacylglycerol. PLC2 and PLC3 are also activated by G subunits, primarily released from Gi class G proteins (31), which is the basis for pertussis toxin inhibition of PLC activity and Ca²⁺ signaling evoked by Gi-coupled receptors (2, 20). Inositol trisphosphate produced by the activity of PLC evokes calcium release from intracellular stores, and diacylglycerol activates several isoforms of protein kinase C (PKC). Thus, Gq class  subunits regulate signaling pathways that are implicated in cellular proliferation and differentiation.

There are four Gq class  subunits in mice and humans; Gq, G11, G14, and G15 or G16 (mouse or human ortholog, respectively [13, 33]). G15 and G11 are encoded by the tandemly duplicated Gna15 and Gna11 genes and colocalize to mouse chromosome 10, while Gq and G14, encoded by the Gnaq and Gna14 genes, colocalize to mouse chromosome 19 (28). The two widely expressed Gq class  subunits, Gq and G11, are 89% identical in amino acid sequence, and they couple an identical repertoire of receptors to PLC activation with similar efficiencies in vitro, in cultured cells, and in primary cells isolated from animals (28, 35). Analysis of single- and double-knockout (KO) mice with deficiencies in Gq and/or G11 suggests that gene dosage may be a key factor in dissecting Gq class signaling pathways and their biological functions (28). The only apparent phenotypes of the single-KO Gq^/ mice involve cell types or tissues, such as platelets and cerebellum, where G11, G14, and G15 expression is weak or absent (24, 27). Although mice with homozygous disruption of either the Gq or G11 gene are viable and fertile, with only discrete phenotypic defects (24, 27), deletion of both genes (Gq^/ G11^/) results in embryonic lethality during midgestation (embryonic day 10.5) from a defect in cardiomyocyte proliferation (28). Cultured embryonic cardiomyocytes express Gq and G11 but little or no G14 and G15, and in the absence of Gq/11, Ca²⁺ signaling is no longer stimulated by the mitogenic factor angiotensin II (28).

The requirement of Gq class signaling in cell proliferation suggested a possible function of G15 in hematopoiesis. G15 is the most divergent of the Gq class  subunits (55% amino acid identity to Gq, G11, and G14) and has the most restricted expression pattern, being principally confined to hematopoietic cells (Fig. 2 and reference 33). Though G15 activates PLC isoforms similarly to other family members, it possesses different pharmacological and biochemical properties in vitro (21). G15 couples to many receptors that are not activators of Gq and G11 (26, 37) and therefore was proposed for high-throughput screens to identify ligands and orphan receptors (12). The receptor promiscuity of G15 suggested that it may have unique functions in hematopoietic cells not performed by other Gq class proteins. However, the receptor promiscuity of G15 is less apparent when cotransfected with some C-C chemokine receptors which are coexpressed with G15 (3, 22). Signaling specificity in hematopoietic cells may also be controlled by other factors, such as RGS proteins, that could further limit the range of receptors which are functionally coupled by G15.

We created G15-deficient mice to identify the putative biological roles of G15 in development, hematopoiesis, and immune function. The hypothesis was that G15, due to its unique characteristics within the Gq class of  subunits, may have evolved specific functions that cannot be compensated by the coexpressed family members Gq and G11. The G15 gene was disrupted by homologous recombination in embryonic stem (ES) cells. Surprisingly, hematopoiesis and responses to several inflammatory challenges were normal in G15^/ mice. This suggested that either the differences in signaling were too small to provide a biological consequence or that G15 deficiency was compensated for by other G proteins. We used primary cultures of macrophages derived from the G15^/ mice and their G15^+/+ littermates to show that the phosphoinositide (PI) and Ca²⁺ responses to the anaphylatoxin C5a were greatly diminished in the KO macrophages. We show that three receptors involved in the inflammatory response (C5a, P2Y2, and platelet-activating factor [PAF]) each have different G-protein coupling specificity and utilize at least two distinct pathways to induce PI release, which may provide intrinsic compensatory mechanisms in G-protein signaling pathways.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Knockout of Gna15. ES cells were maintained essentially as described previously (28). R1 ES cells from 129SV embryos were grown on primary embryonic fibroblasts rendered mitotically inactive by treatment with mitomycin. The Gna15 KO vector was linearized at a unique NotI site (Fig. 1) and electroporated into ES cells. Twelve heterozygous clones were obtained of 241 neomycin-resistant colonies. Four independent Gna15 heterozygous ES cell clones were injected into blastocysts, and one chimera gave germ line transmission of the mutant allele. Southern blots and ³²P radiolabeling of probes were performed exactly as described elsewhere (13). Following extensive characterization of the ES clones and founder mice by Southern blot analyses to confirm homologous recombination and single integration of the targeting vector, genotyping was done by PCR. Oligonucleotide primers used were CT133 (CAGCACGCCAGCCTAGTGATG) and CT115 (CTTCACGGAGAAGCAGTACTC), to amplify a 550-bp fragment in the wild-type allele, and TW30 (AGATGCGCATCATTCACGGT) and TW144 (GATCAGCAGCCTCTGTTCCAC), to amplify a 720-bp fragment in the KO allele (Fig. 1).

View larger version (30K): [in this window] [in a new window]   FIG. 1.   KO vector and strategies for characterizing homologous recombination by Southern blotting and genotyping by PCR after electroporation of the G15 replacement vector. (A) Wild-type (wt) allele and the targeting vector. The restriction sites are shown to scale. tk, thymidine kinase. (B) The KO allele. The pgk::neo insertion cassette is not drawn to scale. The SpeI, EcoRV, and HindIII sites used in characterizing the wild-type and KO alleles by Southern blot are shown on each allele. The inserted pgk::neo cassette is 2.1 kb in size and contains both EcoRV and SpeI restriction sites. The 5' probe hybridizes to a 14-kb fragment in the wild-type allele and 9.5 kb in the KO allele when DNA is digested with EcoRV. The 3' probe recognizes 9.2- and 7-kb fragments in wild-type and KO mice after digest with SpeI and HindIII. The Neo probe hybridizes to a 14-kb SpeI fragment in the KO allele. The relative positions of PCR products obtained from amplification of the wild-type allele with primers CT115 and CT133 (550 bp) and the KO allele with primers TW30 and TW144 (720 bp) are indicated. (C) Results obtained from genotyping G15+/+, G15+/, and G15/ tail DNA by Southern blot using the 5' probe after digest with EcoRV; ethidium bromide-stained 2.5% agarose gel of PCR products obtained from amplifying the same tail DNA with the primers described above.

Preparation of membrane proteins for Western blot analysis of G-protein  subunits. Tissues were collected, and homogenates were prepared with a Dounce homogenizer in HMED (20 mM HEPES, 2 mM MgCl₂, 1 mM EDTA, and 1 mM dithiothreitol containing protease inhibitors (0.01 mg each of leupeptin and lima bean trypsin inhibitor per ml and 0.016 mg each of phenylmethyl sulfonyl fluoride, N-p-tosyl-L-lysine chloromethyl ketone, and tosylsulfonyl phenylalanyl chloromethyl ketone per ml. Homogenates were centrifuged at 500 × g to remove unbroken cells and nuclei, and supernatants were centrifuged at 100,000 × g. Membranes were resuspended in HMED, and protein concentrations were determined by Bradford assay using the Bio-Rad protein assay dye reagent concentrate prior to storage at 80°C. For sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), 5 µg of membrane protein was loaded per lane unless specified. Antibody B861 recognizes specifically the C-terminal end of G15, and antibodies W082 and B825 recognize specifically Gq and G11, respectively.

Fluorescence-activated cell sorting. Peripheral blood was collected from the tail vein into Alsever's solution (Gibco-BRL, Grand Island, N.Y.), and single-cell suspensions were prepared from hematopoietic tissues for antibody analysis. Conjugated anti-mouse antibodies used were B220-biotin, CD4-fluorescein isothiocyanate, CD8-biotin, Gr-1-biotin, Mac-1-biotin, and Mel-14-fluorescein isothiocyanate; streptavidin-phycoerythrin (Pharmingen, San Diego, Calif.) was used when applicable; 5,000 events were collected per sample on a FACScan analytical instrument (Becton Dickinson Co., San Jose, Calif.).

Bone marrow transfer and growth. Single-cell suspensions were prepared from bone marrow of wild-type and KO donor mice and was used for growth studies in MethoCult M-3430 (StemCell Technologies Inc., Vancouver, British Columbia, Canada) or for bone marrow transfer. Recipient mice (BALB/c) were exposed to two doses of irradiation, 500 and 400 rads, in a Gamma Cell 40 small-animal irradiator containing two ¹³⁹Cs sources (Atomic Energy Ltd., Ottawa, Ontario, Canada). Irradiated recipient mice were injected with 5 × 10⁴ donor cells in the lateral tail vein. Spleens were collected from recipient mice 9 days later and fixed in Bouin's fixative. Spleen CFU (CFU-S) were counted in a Zeiss dissection microscope. In a first experiment, four recipient mice were injected with medium alone, eight were injected with wild-type cells, and eight were injected with G15^/ cells. In a second, independent experiment, 4 recipient mice were injected with medium 10 were injected with wild-type cells, and 10 were injected with Gq^/ G15^/ cells.

Thioglycolate-induced peritonitis. Mice between 8 and 12 weeks of age were injected with 1 ml of 3% thioglycolate. Peritoneal cavities were lavaged at 0 (uninjected), 18, 48, or 96 h following intraperitoneal (i.p.) injection of thioglycolate. Cells from the peritoneal lavage fluid were spun onto a slide with a cytospin. Slides were stained with Diff-Quik (Fisher Diagnostic). Two to seven mice of each genotype were analyzed at each time point. Differential counts of neutrophils, eosinophils, and mononuclear cells were determined with a 100× oil immersion lens. A minimum of 100 cells were counted three times per slide.

Trichinella spiralis infection. Twelve-week-old mice were administered 500 infective larvae orally. Six mice of each genotype (G15^+/+ and G15^/) were analyzed. Blood smears were taken from the tail vein in duplicates at days 0, 6, 9, 11, 13, 15, 17, 21, 23, 25, 27, and 30 after infection and stained with Diff-Quik. The proportion of eosinophils in 100 to 200 leukocytes was determined for each smear.

Thioglycolate-elicited macrophages for ex vivo experiments and macrophage culture. Six- to ten-week-old mice were injected i.p. with 2 ml of 4% aged brewer's thioglycolate. Peritoneal exudates were collected with Dulbecco modified Eagle medium (DMEM) containing 5% fetal bovine serum (FBS) 4 days after injection. Cells from two to three mice were pooled per genotype. Macrophages were purified by adherence to the tissue culture dish.

Fura-2 Ca²⁺ imaging. Cells were plated on coverslips and processed as described elsewhere (36). Cells were loaded with Fura-2/AM in the presence of Pluronic for 20 min and then set on ice. Coverslips were mounted onto perfusion chambers, and cells were continuously perfused during fluorescence recordings. Fluorescence was recorded with the Delta Scan I imaging system and an IC-200 camera. The images were captured with the Image Master program and analyzed with Felix.

PI assay. Cells were distributed to 12-well tissue culture dishes at 10⁶ cells per well and metabolically labeled 48 h with 8 µCi of [³H]myo-inositol (Dupont) per ml in labeling medium (inositol-free DMEM, 5% FBS, penicillin-streptomycin, glutamine). Labeling medium was added to each well in non-pertussis toxin-treated cells. The assay was performed essentially as described elsewhere (17). The K_D for binding of ¹²⁵I-C5a to the purified receptor is approximately 1.7 to 20 nM (6), and maximum PI release was determined to be obtained between 50 and 120 nM (1). The PI assays were performed with 100 nM C5a in the G15^+/+ and G15^/ thioglycolate-elicited peritoneal macrophages. For UTP and PAF, dose-response curves were performed to obtain a 50% effective concentration. The 50% effective concentration for UTP stimulation of PI release was determined to be 5 to 7 µM, whereas half-maximal activity was obtained with 10 ng of PAF per ml. Subsequent assays were therefore performed with 10 µM UTP and 30 ng of PAF per ml. For treatment with pertussis toxin, pertussis toxin (List Biological Laboratories) was added to each well in labeling medium to a final concentration of 100 ng/ml, 24 h before the start of the assay.

ERK activation. Day 4 thioglycolate-elicited peritoneal macrophages were plate purified on 100-mm-diameter dishes. Cells were incubated in starvation medium (DMEM [Cellgro], 0.5% FBS, 4% penicillin-streptomycin, glutamine) for 14 to 18 h prior to stimulation. When needed, pertussis toxin was added to 100 ng/ml with the starvation medium. Cells were stimulated with 100 nM C5a for 3 min, then rapidly rinsed, and lysed (50 mM HEPES [pH 7.5], 150 mM NaCl, 10% glycerol, 1% Triton X-100, 100 mM NaF, 0.2 mM sodium orthovanadate, 10 µg of aprotinin per ml, 1 mM phenylmethylsulfonyl fluoride). Protein concentrations were determined by Bradford analysis, and 20 µg of whole-cell lysate was loaded per lane on a 10% polyacrylamide gel for SDS-PAGE. Following transfer to a nitrocellulose membrane, the Western blots were probed with antibody V6671 (Promega).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Knockout of Gna15. The G15 gene (Gna15) was disrupted in mice by homologous recombination in ES cells. The replacement vector (Fig. 1A) contained a neomycin resistance gene under the control of the PGK promoter (pgk::neo) flanked by 5' (5-kb) and 3' (3.4-kb) segments of Gna15. A null allele was created by homologous recombination of the replacement vector to delete 8 kb that included exons 3 through 6 of Gna15. The deleted exons contained three of the five amino acid motifs (7) which are essential for guanine nucleotide binding to the  subunit. The targeting vector was electroporated into ES cells, and heterozygous clones were obtained under selection with Geneticin and ganciclovir. Heterozygous ES cell clones were identified with the 5' probe (Fig. 1B) and confirmed with the 3' probe and the Neo probe. Nine chimeric mice were obtained, and one transmitted the G15 null allele to offspring. Intercrossing heterozygous G15^+/ mice produced viable and fertile homozygous null (G15^/) progeny (Fig. 1C).

/

/

/

Hematopoiesis appears normal in single and double Gq class KO mice. Differential expression of G15/G16 in hematopoietic cells according to their maturational stage (2, 16, 32, 33) suggested that hematopoiesis might be altered in the G15^/ mice. Therefore, we characterized the cellular composition of hematopoietic tissues of G15^/ mice by FACScan analysis. Single-cell suspensions were prepared for analysis from peripheral blood, spleen, thymus, peripheral and mesenteric lymph nodes, Peyer's patches, and bone marrow isolated from wild-type or mutant mice. No differences between G15^/ and wild-type mice were observed in the tissue composition of B cells, CD4⁺ and/or CD8⁺ T cells, neutrophils, and monocytes. The architecture of the major lymphoid organs, including thymus, spleen, peripheral lymph nodes, and Peyer's patches, was likewise intact. The proportion of plasma erythrocytes was normal as determined by hematocrit (wild type, 49.8 ± 0.003%; G15^/, 50.9 ± 0.013).

/

/

/

/

/

/

/

/

/

/

/

/

/

The G15^/ mice perform adequately in in vivo models of inflammation and infection. G15 (and G16) couple many receptors for chemokines and other chemotactic molecules to the activation of PLC in cotransfection systems (1, 22, 26, 34, 37). These receptors, including the receptors for interleukin-8 (IL-8), C5a, PAF, thrombin, formylmethionyl-leucyl-phenylalanine, and purine nucleotides, are involved in chemotaxis and inflammation and are present on neutrophils and/or monocyte lineages that express G15 abundantly. We therefore tested the role of G15 in thioglycolate-induced peritonitis to assay the mobilization and recruitment of neutrophils (18 h following i.p. injection of thioglycolate) and macrophages (48 to 96 h following injection). The resident peritoneal cell populations, as well as recruited neutrophils and macrophages, were comparable between wild-type and KO mice at all time points studied (data not shown). Population of the peritoneal cavity with eosinophils was larger in wild-type than in G15^/ mice at 48 h following thioglycolate injection but not significantly different at 96 h.

/

/

/

/

C5a-induced signaling is defective in G15^/ macrophage. To address the possibility that biological functions of G15 may be compensated for by other signaling pathways in the G15 KO mice, we measured the biochemical responses to stimulation by various agonists in cultured primary cells. Thioglycolate-elicited macrophages, which express G15 abundantly (Fig. 2), were collected by peritoneal lavage and purified by adherence. In an initial screen for agonists that may utilize G15 during the inflammatory response, we used fluorescence microscopy to measure Ca²⁺ release in Fura-2-loaded macrophages. Ca²⁺ responses were evoked by 100 µM ATP, 100 µM UTP, 100 nM C5a, and 1 µg of PAF per ml. The Ca²⁺ responses to ATP and to UTP were similar in wild-type and G15^/ macrophages (Fig. 3 and data not shown). By contrast, the response to C5a was significantly reduced in the G15^/ macrophages (Fig. 3). To corroborate these findings and characterize these signaling events in populations of cells, we measured PLC activation in response to C5a, UTP, and PAF in wild-type and G15^/ macrophages metabolically labeled with [³H]myo-inositol in culture. Because ATP can also activate purinergic receptors on macrophages that are not G-protein coupled, we did not characterize its activity further.

View larger version (66K): [in this window] [in a new window]   FIG. 2.   Expression of the Gq class  subunits G15, Gq, and G11 in wild-type and G15 KO mice. (A) Expression of G15 in mouse hematopoietic cells. The G15 C-terminal antibody B861-7 was used to detect G15 in membranes obtained from murine resident peritoneal exudate leukocytes (PEL), peritoneal exudate macrophages collected and purified by adherence 5 days after thioglycolate injection (PEM), and total bone marrow (BM) or mouse bone marrow separated into fractions by synchrony elutriation. Fraction 1 (Fr.1) is enriched in lymphocytes and may contain erythrocytes; fraction 2 (Fr.2) contains lymphocytes and blasts; fraction 3 (Fr.3) is enriched in blasts and mature neutrophils, fraction 4 (Fr.4) contains mostly mature neutrophils. rG15, recombinant G15. (B) Expression of G15, Gq, and G11 in membranes from hematopoietic tissues of G15 wild-type and G15/ mice, using antibodies B861-7, W082, and B825. The liver was used as a negative control for G15 and as a positive control for Gq and G11. +/+, G15 wild-type mice; /, G15 KO mice; rG15, membranes from G15 expressed in Sf9 cells; rG, recombinant G15, Gq, or G11 on their respective blots. Five micrograms of membrane protein was loaded per lane except in day 5 peritoneal exudate macrophages (3 µg).

View larger version (27K): [in this window] [in a new window]   FIG. 3.   Ca2+ release in response to C5a and UTP in wild-type and G15/ macrophages. Changes in fluorescence over time in Fura-2-loaded wild-type and G15/ macrophages that responded to C5a were analyzed with the Felix program and reported as a ratio of optical density at 355 nm to optical density at 380 nm (OD355/OD380). Each tracing represents the average fluorescence changes of at least five individual cells. (A and B) Cells were exposed to C5a for 2 min and allowed to recover in the presence of Ca2+-free medium for 5 min. The cells were then exposed to UTP. (A) Wild-type cells; (B) G15/ cells; (C and D) wild-type (C) and G15/ (D) cells exposed to UTP for 2 min and washed with regular medium for a total of 15 min. Recording was stopped at 8 min to avoid photobleaching and restarted at 17 min prior to stimulation with C5a. Ca2+ release in the G15/ macrophages was blunted in response to C5a in both protocols, whereas the response to UTP was unchanged.

/

/

/

/

/

/

View larger version (32K): [in this window] [in a new window]   FIG. 4.   Signaling response of wild-type and G15/ peritoneal macrophages to agonist stimulation and effect of pertussis toxin. (A-C) PI release in response to PAF, UTP, and C5a. Thioglycolate-elicited peritoneal macrophages from wild-type (wt) and G15/ mice were metabolically labeled with [3H]myo-inositol, and PI release was measured in 5-min time courses in response to PAF (30 ng/ml; A) UTP (10 µM; B), and C5a (100 nM; C). When indicated, cells were treated for 24 h with 100 ng of pertussis toxin (Ptx; islet-activating protein) per ml prior to stimulation with agonist. The data represents average ± standard error of the mean of a total of four experiments, three with pertussis toxin (A and B), and a total of seven experiments, four with pertussis toxin (C). The data are presented as counts per minute after subtraction of the background (bkg; counts per minute when cells are treated with buffer control). (D) ERK activation in response to stimulation with C5a. Macrophages were exposed to C5a (or buffer) for 3 min and lysed in buffer containing protease and phosphatase inhibitors; 20 mg of cell lysate was loaded per lane. When indicated, the cells were exposed to pertussis toxin (100 ng/ml) overnight prior to C5a stimulation. Western blot analysis was performed with antibody V6671 (Promega), which recognizes the dually phosphorylated ERKs. p44, ERK1; p42, ERK2; Ptx, pertussis toxin.

ERK activation by C5a is normal in G15^/ macrophages. Agonist stimulation of the C5a receptor was shown to activate the mitogen-activated protein (MAP) kinase pathway in a pertussis toxin-sensitive manner in human neutrophils (8) and in transfected cells (9). Because we observed a synergistic effect of Gi and G15 on PI release in response to C5a in wild-type and G15^/ macrophages, we addressed the possibility of a similar effect on ERK activation. Wild-type and G15^/ macrophages treated with or without pertussis toxin were stimulated with 100 nM C5a for 3 min. The activation of ERK1 and ERK2 was assessed by Western blotting. The V667A antibody (Promega) recognizes only the active, dually phosphorylated ERKs. The activation of ERKs in response to C5a was rapid, equivalent in wild-type and G15^/ cells, and completely inhibited by pertussis toxin treatment in both wild-type and G15^/ macrophages (Fig. 4D). These data indicate that C5a-induced ERK activation is entirely dependent on Gi signaling in murine macrophages, as it is in mouse and human neutrophils (8).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

G proteins mediate responses to a multitude of signaling molecules that evoke neuronal, hormonal, and sensory signal transduction as well as inflammatory and immune responses. The inflammatory response to destroy foreign particles and pathogens requires an intimate interaction between numerous cell types that stimulate cell proliferation and differentiation and activate leukocyte motility and chemotaxis to the site of infection. Chemokines and classical chemoattractants stimulate these processes and are implicated in autoimmune diseases (reviewed in reference 29). Many of these agonists, including IL-8, C5a, and formylmethionyl-leucyl-phenylalanine, bind heptahelical receptors to active PLC and evoke Ca²⁺ release. A number of these chemokine receptors are coupled by pertussis toxin-sensitive Gi class proteins and G15, the pertussis toxin-insensitive Gq class  subunit that is predominantly expressed in hematopoietic cells (3, 22).

Several features of G15 made it an interesting target for mutational analysis in mice. A wide variety of heptahelical receptors which were initially found to activate Gs or Gi class  subunits were later found to also couple G15 and G16 (mouse and human orthologs, respectively), but not Gq/11, to the activation of PLC. This suggested that G15 may have unique functions, independent of Gq/11, in hematopoietic tissues where it is normally expressed. G15 exhibits the most restricted expression pattern of any G-protein subunit, with the exception of those expressed only in specialized sensory transduction cells. G15 also has evolved at an accelerated rate relative to all other mammalian  subunit genes (13). Many genes whose primary function serves hematopoietic cell types have been noted to diverge at an accelerated rate relative to other members of the same gene family (23). This may reflect selection pressures on G15 and other genes which are specifically expressed in the immune cells that defend against pathogens (23). Therefore, although G15 is always coexpressed with Gq and G11, we anticipated that it would have unique functions in hematopoiesis or immune cell function.

Not only are the G15^/ mice viable and fertile, but G15 does not appear to be required for hematopoiesis. This result was surprising since G15 is abundantly expressed in murine erythroleukemia cells (33), and antisense expression of G16 reportedly inhibited cellular growth rates of erythroleukemia cells in culture (15). By contrast, we observed normal production of plasma erythrocytes in G15^/ adult mice, and we did not observe an increase in fetal mortality which could have been indicative of a deficiency in fetal erythropoiesis. Furthermore, G15 is abundantly expressed in pre- and pro-B-cell lines and in the bone marrow (16, 33), which is rich in B cells, myeloid and lymphoid precursors, and mature neutrophils. However, all hematopoietic lineages, including B cells, T cells, neutrophils, and monocytes, appeared to be normal in the G15^/ mice, as did the architecture of the major lymphoid organs. Minimally, we anticipated a perturbation in the ratios of these cell-types in G15^/ mice, as was observed in the IL-8 receptor (IL-8R) knockout mice, because IL-8R is coupled by G15 (but not Gq or G11) to the activation of PLC (34). The IL-8R^/ mice exhibited neutrophil and B-cell expansion resulting in lymphadenopathy, splenomegaly, and foci of hematopoiesis in the liver (11). Our analysis of G15^/ mice indicates either that G15 does not couple the IL-8R in vivo or that compensatory mechanisms allow IL-8 signaling in the absence of G15.

Analysis of Gq class KO mice indicates that Gq/11 signaling is subject to gene dosage effects (28), consistent with their similarities in receptor coupling and effector activation (35). Gq and G11 are widely expressed throughout development and in adult mice. Homozygous deficiency of either gene can be tolerated, and the phenotypic abnormalities in Gq^/ and G11^/ mice are relatively mild. By contrast, double-KO (Gq^/ G11^/) mice die during midgestation (embryonic day 11) due to cardiomyocyte hypoplasia and subsequent heart failure (28). Addition of a single active allele of either Gq or G11 allows fetuses to survive until shortly after birth, and addition of two active gene copies, one of each or two of either gene, allows mice to survive to adulthood and to reproduce. The most obvious phenotypes in Gq^/ mice, ataxia and a bleeding disorder (24, 27), are not apparent in either G11^/ or Gq^+/ G11^+/ mice. These phenotypic differences may result from the fact that Gq is more widely expressed and is more abundant than G11 in the affected tissues, although molecular mechanisms of signaling specificity have not been rigorously tested. We reasoned that gene dosage effects may be revealed in G15^/ Gq^/ mice. The ataxia and bleeding disorder previously found in Gq^/ mice were not enhanced in the double-KO mice, nor were additional defects in hematopoiesis detected. G11 is the only Gq class  subunit remaining in most hematopoietic cells in G15^/ Gq^/ mice. To explain the absence of phenotypic defects in the double-KO mice, and assuming that Gq class signaling is important in hematopoietic cells, either G11 conveys all Gq class activity during hematopoiesis in normal mice or these Gq proteins are functionally redundant and G11 compensates for the absence of G15 and/or Gq in the double-KO mice. The former possibility appears unlikely because the G11^/ single-KO mice have no apparent hematopoietic defect (data not shown). Unfortunately, the G11^/ G15^/ double-KO mice cannot be obtained by crossing the single-KO strains due to their chromosomal colocalization and analysis of triple mutants will require conditional KO technology because the Gq^/ G11^/ mice die in utero before initiation of hematopoiesis in the fetal liver. It is therefore not yet possible to determine the function of Gq class signaling in hematopoiesis.

We next tested the possibility that G15 mediates signaling during immune challenge. The chemokine receptors expressed on leukocytes mediate inflammatory responses and the riddance of pathogens, and these receptors have been shown in transfection assays to couple to Gi class  subunits and G15 but not Gq or G11 (14, 22, 34). We used thioglycolate-induced peritonitis to survey the response of neutrophils and mononuclear cells to a non-antigen-specific, T-cell-independent agent (thioglycolate). Infection with T. spiralis was used to monitor the eosinophil response to a challenge that required recognition of specific antigens. The G15^/ mice performed normally in these and several other challenges not described, such as ovalbumin-induced eosinophilia, croton oil-induced dermatitis, and turpentine-induced fever. A normal response to all tests was observed in G15^/ mice despite the fact that defective responses to an inflammatory challenge with thioglycolate occurred in chemokine receptor (e.g., IL-8R and CCR2) KO mice as well as in the PLC2 KO mice (5, 11, 19). Thus, the approach of using systemic readouts such as hematopoiesis or immune challenges, which are regulated by multiple signaling mechanisms, failed to detect a deficiency in G15^/ mice.

Many cell types and signaling pathways which may mask a deficiency in G15 are engaged during inflammation. We reasoned that signaling defects in isolated cells might identify physiologically relevant pathways coupled by G15. Therefore, we challenged purified thioglycolate-elicited macrophages of wild-type and G15^/ mice with different G-protein-coupled agonists and measured activation of PLC in single cells. We found three agonists, the anaphylatoxin C5a, UTP, and PAF, that stimulated G-protein-dependent Ca²⁺ signaling (Fig. 3 and 4). G15^/ macrophage stimulated with C5a exhibited diminished inositol phosphate production and Ca²⁺ release compared with wild-type cells (Fig. 3 and 4C). By contrast, UTP and PAF stimulated similar responses in mutant and wild-type macrophage. Our studies are in agreement with previous analysis of the C5a response in cultured cells cotransfected with C5aR and G16, which suggested that C5aR-evoked Ca²⁺ signaling was mediated by G15 but not Gq/11 (1, 9). However, pertussis toxin inhibition of PLC was more pronounced in the macrophage from G15^/ mice than in either study. Additionally, transfected cells apparently required both Gi and G15 coupling to the C5aR for full activation of the MAP kinase (10). By contrast, activation of MAP kinase was completely dependent on Gi-mediated signaling in both mouse macrophages (Fig. 4) and human neutrophils (8).

C5a is an 8.6-kDa terminal by-product of complement activation with inflammatory properties. Mice with an homozygous disruption of the C5aR (C5aR^/) have several inflammatory phenotypes. They are sensitive to pulmonary infection with Pseudomonas aeruginosa and are resistant to the reverse-passive Arthus reaction (immunocomplex-induced granuloma formation) in the lung, skin, and peritoneum (18). G15 may be involved in mediating these effects. However, due to the ability of the receptor to induce a PI signal and Ca²⁺ release in the absence of G15, the remaining signal observed may be sufficient to produce a full biological response.

In a previous study, the Ca²⁺ response evoked by UTP was entirely and specifically blocked by the expression of antisense G16 RNA in the HEL human erythroleukemia cell line (4). In the same study, pertussis toxin partially inhibited UTP-mediated signaling in the parental cells, suggesting a synergistic activity between G16 and released from Gi. However, we found that UTP-evoked PI production and Ca²⁺ release appeared normal in macrophages isolated from G15^/ mice (Fig. 4). Thus, the UTP responsive P2Y2 receptor expressed in murine macrophages can apparently be coupled by Gi and Gq/11. The PAF receptor is similarly coupled by Gi and Gq/11 in G15^/ macrophages.

The ex vivo experiments with peritoneal macrophages suggest that the absence of an apparent phenotype in G15^/, G11^/, and G15^/ Gq^/ mice may be explained by the ability of the receptors that mediate hematopoiesis and inflammatory responses to couple to multiple G proteins, including those of both the Gi and the Gq class.