Previous Article | Next Article 
Molecular and Cellular Biology, February 2000, p. 878-882, Vol. 20, No. 3
Millennium Pharmaceuticals, Inc., Cambridge,
Massachusetts 02139
Received 1 November 1999/Accepted 4 November 1999
The mouse tubby phenotype is characterized by
maturity-onset obesity accompanied by retinal and cochlear
degeneration. A positional cloning effort to find the gene responsible
for this phenotype led to the identification of tub, a
member of a novel gene family of unknown function. A splice defect
mutation in the 3' end of the tub gene, predicted to
disrupt the C terminus of the Tub protein, has been implicated in the
genesis of the tubby phenotype. It is not clear, however,
whether the Tub mutant protein retains any biological activity, or
perhaps has some dominant function, nor is it established that the
tubby mutation is itself responsible for all of the
observed tubby phenotypes. To address these questions, we
generated tub-deficient mice and compared their phenotype
to that of tubby mice. Our results demonstrate that
tubby is a loss-of-function mutation of the tub
gene and that loss of the tub gene is sufficient to give
rise to the full spectrum of tubby phenotypes. We also demonstrate that loss of photoreceptors in the retina of
tubby and tub-deficient mice occurs by
apoptosis. In addition, we show that Tub protein expression is not
significantly altered in the ob, db, or
melanocortin 4 receptor-deficient mouse model of obesity.
The tubby strain of obese
mice arose spontaneously in a mouse colony at the Jackson Laboratory
(5). The tubby phenotype is inherited in an
autosomal recessive manner and is characterized by late-onset weight
gain accompanied by progressive retinal and cochlear degeneration
(16, 17). The combination of these phenotypes resembles
human syndromes, such as Usher's (retinal and cochlear degeneration),
Bardet-Biedl, and Alstrom's (obesity and sensory deficits).
The obesity of tubby mice is relatively mild and late in
onset, resembling the weight gain in human populations more closely than that observed in other murine models of obesity, such as obese (ob) and diabetes
(db) (4). Weight gain in tubby mice occurs relatively slowly, and the mice reach about twice the weight of
their unaffected siblings. Tubby mice are not sterile, but they become infertile after significant obesity develops. The retinal
and cochlear degeneration has been proposed to be due to apoptosis of
retinal and cochlear neurosensory cells.
The identity of the tub gene was determined by positional
cloning (11, 14). The expression pattern of tub
mRNA appears to be specific for the nervous system (10).
tub is a member of a novel gene family of unknown function
(7). Tub family proteins are quite hydrophilic but otherwise
lack any distinguishing features that might provide insight into their
function. There are no recognizable structural motifs or obvious
homology to any known proteins.
The tubby mutation is a G-to-T transversion that abolishes
the donor splice site in the penultimate exon (exon 11), resulting in
an aberrant transcript (11). Translation of intron sequence results in the substitution of the Tub C-terminal 44 amino acids with
24 different amino acids encoded by the intron. The aberrant transcript
is expressed at elevated levels in tubby mice
(5), but Tub expression at the protein level has not been investigated.
The C terminus is highly conserved among Tub family members
(15), suggesting that the tubby mutation may have
disrupted a domain important for the biological function of tub.
Strikingly, mutation of the tub family member
TULP1, at a position exactly corresponding to that mutated
in the murine tub allele, was recently found to be the cause
of a form of retinitis pigmentosa (RP 14) in humans (1, 7).
Three other pathogenic missense mutations of TULP1 have been
characterized (7), and they all fall within the highly
conserved carboxy-terminal 250 amino acids of Tub.
Despite elucidation of the molecular basis of the tubby
mutation, it remains unclear whether the tubby phenotype
represents a complete or partial loss of function or possibly even a
gain of function. Furthermore, it has not been established whether the
suite of tubby phenotypes (obesity, insulin resistance, and retinal and cochlear degeneration) are necessarily all attributable to
mutation of the tub gene. It has not been ruled out that
some features of the phenotype may be caused by a tightly linked, as yet unidentified gene.
Targeting of tub.
Murine tub gene sequences
were isolated from a 129/Sv genomic bacterial artificial chromosome
library (Research Genetics). To generate a targeting construct, an
approximately 4.5-kb HpaI-XbaI fragment from the
3' end of the tub gene, spanning exons 9 to 12, was
subcloned into the XbaI site of pNEB 193 (New England Biolabs). An approximately 2.6-kb HincII-EagI
fragment derived from just upstream of exon 1 was then subcloned into
the BssHII site of the pNEB193 polylinker, situating it
upstream of the 3' tub genomic fragment, in the same
transcriptional orientation. A PGK-neo expression cassette,
consisting of the neo gene under the transcriptional control
of the mouse phosphoglycerate kinase (PGK-1) promoter and
the PGK-1 poly(A) addition site, was obtained from the
plasmid pKJ1 (13). The cassette was subcloned into the
PacI site of the pNEB193 polylinker, between the 5' and 3' tub homologous sequences. The vector was linearized with
XhoI digestion prior to electroporation.
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Targeted Deletion of the tub Mouse
Obesity Gene Reveals that tubby Is a Loss-of-Function
Mutation
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
View larger version (36K):
[in a new window]
FIG. 1.
Disruption of the mouse tub locus. (A)
Schematic representation and partial restriction maps of the
tub wild-type locus, targeting vector, and targeted allele.
Closed boxes represent tub exons 1 and 12, the hatched box
indicates the 5' flanking probe, the shaded box is the
PGK-neo expression cassette, and the horizontal dotted line
is plasmid DNA. The arrow below neo indicates the direction
of transcription. (B) Southern blot analysis of
EcoRI-digested tail DNA from F2 progeny
hybridized with the radiolabeled probe shown in panel A. The wild-type
(+/+) hybridizing band is 6 kb; the band from homozygous mutant mice
( 
/) is 4 kb; mice heterozygous for the mutation (+/) show both 6- and 4-kb bands. (C) PCR analysis of tail DNA of F2 +/+ and
/ mice. Each PCR was done in duplicate. The primers are from exons
2 and 3 (lanes 1 to 4) or 7 and 8 (lanes 5 to 8) and 12 (all lanes).
Exons 2, 3, 7, and 8 are absent in / mice. Exon 12 is present in
both +/+ and / mice.
Generation of mutant mice. The targeted ES clone was injected into BALB/cByJ blastocysts as described previously (2) to generate chimeras. Male chimeras were bred with C57BL/6 females. Black offspring heterozygous for the mutation were interbred to generate F2 progeny for analysis. Mice were maintained on a 12-h light/12-h dark cycle, fed PMI 5021 chow containing 9% fat, and provided water ad libitum.
Southern blot hybridization and PCR analysis. For Southern blot analysis, genomic DNAs from ES cells and tail biopsies were prepared as described by Laird et al. (12). EcoRI-digested genomic DNA (approximately 20 µg) was electrophoresed through a 1% agarose gel, transferred to a Hybond N+ membrane (Amersham), and hybridized with the 32P-labeled 5' flanking probe depicted in Fig. 1A.
Genomic DNA derived from tail biopsies of tub+/+ and tub
/ mice was used as the template for
PCR analysis. The primers used were derived from sequences contained in
exons 2 (forward, TGAGGCAGCAGAAGC), 3 (reverse,
CACTGCTGCTGAGGTAGGACTC), 7 (forward,
GGACAAGAAGGGGATGGAC), 8 (reverse,
GTTGGGTCCACAGAGATGATGGA), and 12 (forward,
GGGTAGCAGAAGATGTGT; reverse, GCAGCAGAGGCAGAGC) of
tub. The reactions were carried out as described in the
legend to Fig. 1C.
Immunoprecipitation and Western blots.
Chinese hamster ovary
(CHO) cells were transfected with either an empty expression vector
(pN8
) or an expression vector containing hemagglutinin epitope
(HA)-tagged wild-type or mutant Tub (8 µg/100-mm-diameter plate) by
the Lipofectamine method (Gibco-BRL, Gaithersburg, Md.). At 48 h
posttransfection, cells were lysed in 400 µl of lysis buffer (20 mM
HEPES [pH 7.5], 0.15 M NaCl, 0.2 mM EDTA, 1.5 mM MgCl2, 1 mM dithiothreitol, 1 mM sodium vanadate, 10 mM NaF, 10% glycerol, 1%
Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and 1 µg each of
leupeptin, pepstatin, and aprotinin per ml). An aliquot was taken from
the cleared whole cell lysate and boiled in sodium dodecyl sulfate
(SDS)-containing sample buffer. Alternatively, the lysates were
incubated with either anti-HA (10 µl; 12CA5; Boehringer Mannheim) or
anti-Tub (5 µl; raised against full-length His6-tagged
wild-type Tub [murine] and kindly provided by Rene Devos, Roche-Gent
Research Institute) antibody in the presence of protein A-Sepharose
beads (Pharmacia Biotech, Piscataway, N.J.). The precipitates were then
washed three times with high-salt wash buffer (20 mM HEPES [pH 7.5],
0.3 M NaCl, 2.5 mM MgCl2, 0.5% Triton X-100) and twice
with low-salt wash buffer (20 mM HEPES [pH 7.5], 0.05 M NaCl, 2.5 mM
MgCl2, 0.5% Triton X-100) and boiled in SDS-containing sample buffer. Lysates from brain and spleen were generated by mincing
the organs with a razor blade and then douncing them with a
tight-fitting pestle in EBC buffer (50 mM Tris-HCl [pH 8], 120 mM
NaCl, 0.5% NP-40) supplemented with Complete Mini protease inhibitor
cocktail tablets (Boehringer Mannheim). Dounced lysates were pelleted
in a microcentrifuge at 12,000 rpm for 15 min at 4°C. Supernatants
were boiled in SDS-containing sample buffer.
Weight measurements.
Ten animals of each sex and genotype
(+/+, tub/tub, and /), were maintained on a chow diet ad
libitum. Their weight was monitored once a week for a period of 15 weeks, starting at 5 weeks of age, using a Sartorius model 14800 P balance.
Histological analysis of the retina and TUNEL apoptosis assay for
fragmented DNA.
Eight-week-old male mice of each genotype (+/+,
tub/tub, and /) were anesthetized and perfused with
phosphate-buffered saline (PBS) followed by 4% paraformaldehyde
(PFA)-PBS. Eyes were removed for processing and embedding in paraffin,
using a TissueTek tissue processor. For terminal
deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling
(TUNEL) assay, 5-µm cross sections were cut, deparaffinized, and
postfixed with 4% PFA-PBS for 15 min. Following a 5-min wash with
PBS, sections were digested with proteinase K (2 µg/ml) at 37°C for
15 min, fixed again with 4% PFA-PBS for 15 min, washed twice with
Tris-buffered saline for 1 min, and washed twice with H2O
for 1 min. Terminal transferase labeling of fragmented DNA was
performed with a Boehringer Mannheim fluorescein in situ death
detection kit (product no. 1-684-795) essentially as described.
Briefly, sections were incubated in reaction mixture (100-µl
volume/slide) for 90 min at 37°C and washed three times in
Tris-buffered saline-0.1% Tween. Slides were visualized and photographed with a Zeiss BX100 microscope equipped with a fluorescein isothiocyanate filter (magnification, ×40). For comparison, adjacent retina sections were stained with hematoxylin and eosin (magnification, ×400).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Generation of tub-deficient mice.
The
tub gene was inactivated by gene targeting in C57BL/6 ES
cells. Approximately 16 kb of tub genomic sequence, spanning exons 1 through 8, were deleted from the tub locus by
homologous recombination, using the targeting vector shown in Fig. 1A.
This represents deletion of over 60% of the coding sequence.
Interbreeding of mice heterozygous for the mutation generated
F2 progeny that were wild type, heterozygous, and
homozygous for the targeted allele (Fig. 1B), with the expected 1:2:1
distribution. PCR analysis verified the predicted absence of
tub exons 2, 3, 7, and 8, and the presence of exon 12, in
homozygous mutant mice (Fig. 1C). Together with the Southern analyses
(Fig. 1B), these data confirm the generation of mice carrying a large
deletion of the tub coding sequence.
tub/ mice were viable and had no obvious
defects at birth or in the neonatal period.
Expression of the Tub protein in wild-type and
tub/ mice.
We used an anti-Tub
antiserum raised against His6-tagged full-length wild-type
murine Tub to assess expression of Tub at the protein level. As shown
in Fig. 2A, this antiserum recognizes HA-tagged wild-type Tub protein expressed in CHO cells. Lanes 1 and 2 show a Western blot of lysate from CHO cells transfected with either
the empty vector (lane 1) or a vector expressing HA-Tub (lane 2). The
antibody recognizes a specific band of the correct size only in the
cells transfected with HA-Tub. Furthermore, when the lysates are
immunoprecipitated with an antibody against the HA tag, the anti-Tub
antiserum recognizes the HA-tagged tub protein (lane 4). Finally,
transfected Tub protein is specifically immunoprecipitated by the
anti-Tub antiserum (lane 6). The band below Tub in lanes 5 and 6 is the
immunoglobulin heavy chain.
|
/ mice by Western blotting
(Fig. 2B). We chose the brain because tub mRNA is
extensively expressed there (5, 10). As an additional negative control, lysates were also prepared from the spleen, which was
not expected to express tub (19). Lysates
containing equivalent amounts of protein were resolved by SDS-PAGE and
probed with anti-Tub antiserum. As shown in the Western blot in Fig. 2B, a specific band was detected in the lane with brain lysate from
wild-type (lane 1) but not tub/ (lane 2)
mice, verifying the null mutation of tub in the knockout mice. No tub expression was detected in spleens of either
wild-type or tub/ mice (Fig. 2B, lanes 3 and 4).
Weight gain of tubby and
tub/ mice.
The weight gains of
tubby (tub/tub) mice, homozygous mutant
(tub/) targeted mice, and their wild-type
(+/+) littermate controls were monitored regularly over a 19-week
period. All mice were on the C57BL/6 strain background. As shown in
Fig. 3, the weights of all genotypes were
comparable for the first 8 weeks of life. At this time, the weight of
both male (Fig. 3A) and female (Fig. 3B) tub/tub mice begins
to diverge from that of the wild-type mice, and at 19 weeks of age, the
weight of the tub/tub mice is almost twice that of their
wild-type littermates. This finding is consistent with a previous
characterization of tubby weight gain (5),
although in our study, the weight of the tubby mice diverges
from that of the wild-type animals slightly earlier (8 weeks rather
than 12 weeks). As shown, the weight gain of the tub/ mice was indistinguishable from that of
the tub/tub mice (Fig. 3). Both male and female heterozygous
mice (+/tub or +/) exhibited weight curves
indistinguishable from that of wild-type mice (data not shown).
|
Retinal degeneration in tubby and tub
knockout mice.
Earlier studies have shown that tubby
mice exhibit early progressive retinal degeneration, possibly due to
apoptosis (16, 17). Photoreceptor cells, the main cell type
lost, have been shown to express Tub (19). We examined the
retinas of 8-week-old wild-type (+/+), tub/tub, and knockout
(tub/) mice. It is evident from the
histological sections shown in Fig. 4B and
C that tubby and
tub/ mice exhibit severe and comparable
retinal degeneration at this age, with significant loss of the
photoreceptor and outer nuclear layers (arrows) relative to their
wild-type littermates (Fig. 4A). The remaining layers of the retina
appear normal. The retinas of the tub+/ mice
are unaffected and appear indistinguishable from those of wild-type
mice (not shown).
|
/ mice (Fig. 4E and F, arrows) but not in
retinas from wild-type littermates (Fig. 4D). This finding is
consistent with a recent report (9) and demonstrates that
the retinal degeneration observed in tubby and
tub knockout mice is in fact due to apoptosis of the
photoreceptor cells.
Expression of the Tub protein in tubby mice and other mouse models of obesity. The tubby mutant protein is 20 residues shorter than wild-type Tub. As shown by Western blotting, using the anti-Tub antiserum (Fig. 5A), HA-tagged mutant tubby protein, overexpressed in CHO cells, migrates slightly but detectably faster (lanes 5 and 6) than HA-Tub (lanes 3 and 4) on an SDS-polyacrylamide gel. We used the anti-Tub antibody to investigate the expression of this protein in tub/tub mice.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In this study we have generated tub-deficient
mice by targeted deletion of tub exons 1 to 8 in C57BL6 ES
cells. Mice homozygous for the targeted allele
(tub/) are phenotypically indistinguishable
from tubby mice with regard to weight gain and retinal
degeneration. These observations demonstrate that these two very
different tubby phenotypes are caused by disruption of a
single gene, not two closely linked genes.
If the mutated allele of tub expressed by the
tubby (tub/tub) mice retained some residual
function, one might expect the phenotype of the tub knockout
mice to be more severe than that of tubby mice. Conversely,
if the tubby allele was nonfunctional, one might expect the
phenotypes of tubby and tub knockout mice to be
identical. Our observation that tub/ and
tubby mice have indistinguishable phenotypes supports the hypothesis that tubby is a null allele. In addition, we
unexpectedly found that the expression levels of the mutant protein in
tubby mice are so low as to be undetectable. Since Northern
blot and in situ analyses (11) indicate that tub
mRNA levels are elevated in tubby mice, the defect must be
at the posttranscriptional level. The elevated mRNA levels in
tubby mice may represent an attempt to upregulate expression
of the Tub protein. The inability to detect tubby mutant
protein in spite of the elevated mRNA levels may be due to protein
instability, perhaps resulting from disruption of the highly conserved
carboxy terminus of Tub. It is possible that this region forms an as
yet unrecognized structural motif required for stability of the
tubby protein.
We also show that the retinal degeneration observed in tub/tub and tub knockout mice is due to apoptosis. Programmed cell death has been proposed as the cause of both retinal and cochlear degeneration in tubby mice (16, 17), and this has now been formally demonstrated for retinal degeneration by our data as well as a very recent report (9). This result suggests that Tub function is important for the survival of retinal photoreceptor cells in the adult animal.
It is possible that the late-onset obesity observed in tubby
mice is similarly due to the apoptotic loss of cells in hypothalamic nuclei involved in body weight regulation. Tubby obesity and
hypersinulinemia are reminiscent of the effect of surgical ablation of
the ventral-medial hypothalamus (3). We searched for, but
did not find, any cellular alterations in the hypothalamus of
tubby and tub/ mice (data not
shown). However, we cannot rule out the possibility of subtle changes
that we may not be able to detect, such as the loss of a small
subpopulation of neurons.
It is possible that the defect leading to obesity in tubby mice lies in the peripheral rather than the central nervous system. It is interesting that unilateral denervation of fat pads results in increased size of the denervated pad but not of the contralateral pad (6), suggesting that fat innervation is important for the control of body weight.
If tub function is important for neuronal survival, why does absence of tub not result in a more severe phenotype, given the extensive expression of Tub in the brain and other neuron-derived tissues (19)? One possibility is that the Tub protein does not play a critical role in most of the tissues where it is expressed. Alternatively, there may be redundancy between Tub family members. Tub is a member of a newly discovered class of proteins, only a few of which have been cloned. According to one estimate, the family consists of approximately 6 to 10 members (15). Mouse tub may be functional in many neuronal tissues, but a phenotype may be seen only in the few tissues where other family members are not expressed or cannot compensate for tub loss.
While we now have a wealth of genetic data relating to Tub, the biochemical function of the protein remains unclear. Although Tub lacks known protein motifs, Tub family members share a remarkably conserved carboxy terminus, suggesting that this domain is very important for Tub function. Furthermore, Tub-like proteins are found in a variety of organisms, including plants, worms, flies, and mammals, suggesting that Tub may have an evolutionarily conserved biological function.
Tub's hydrophilic character and lack of signal sequence or transmembrane domains suggest that Tub is an intracellular protein. Our data showing that the retinal degeneration resulting from loss of Tub function is due to apoptosis suggest that Tub may play a role in the intracellular pathways involved in the survival of neurosensory cells. We have previously demonstrated that the Tub protein can be phosphorylated on tyrosine in response to insulin (10). A better understanding of Tub function awaits further elucidation of the biochemical properties of the protein and the pathways in which it acts.
| |
ACKNOWLEDGMENTS |
|---|
We thank Rene Devos and colleagues at Roche-Gent Research Institute for the anti-Tub sera. We thank Lou Tartaglia, Jim Lillie, Frank Lee, and Bob Tepper for helpful discussions and advice, Suzy Dembsky for help with tissue dissection, Pei Ge and Michael Donovan for pathology, and Tanya Macek for genotyping. We are also grateful to all the members of Millennium's Metabolic Diseases Biology team for helpful and stimulating discussions.
This work was partly supported by Hoffmann-La Roche, Inc.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Millennium Pharmaceuticals, Inc., 75 Sidney St., Cambridge, MA 02139. Phone: (617) 679-7176. Fax: (617) 374-9379. E-mail: kapeller{at}mpi.com.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Banerjee, P., P. W. Kleyn, J. A. Knowles, C. A. Lewis, B. M. Ross, E. Parano, S. G. Kovats, J. J. Lee, G. K. Penchaszadeh, J. Ott, S. G. Jacobson, and T. C. Gilliam. 1998. TULP1 mutation in two extended Dominican kindreds with autosomal recessive retinitis pigmentosa. Nat. Genet. 18:177-179[CrossRef][Medline]. |
| 2. | Bradley, A. 1987. Production and analysis of chimaeric mice, p. 113-115. In E. J. Robertson (ed.), Teratocarcinomas and embryonic stem cells: a practical approach IRL, Oxford, England. |
| 3. | Bray, G. A., S. Inoue, and Y. Nishizawa. 1981. Hypothalamic obesity. The autonomic hypothesis and the lateral hypothalamus. Diabetologia 20:366-377. |
| 4. | Coleman, D. L. 1978. Obese and diabetes: two mutant genes causing diabetes-obesity syndromes in mice. Diabetologia 14:141-148[CrossRef][Medline]. |
| 5. |
Coleman, D. L., and E. M. Eicher.
1990.
Fat (fat) and tubby (tub): two autosomal recessive mutations causing obesity syndromes in the mouse.
J. Hered.
81:424-427 |
| 6. |
Cousin, B.,
L. Casteilla,
M. Lafontan,
L. Ambid,
D. Langin,
M. F. Berthault, and L. Penicaud.
1993.
Local sympathetic denervation of white adipose tissue in rats induces preadipocyte proliferation without noticeable changes in metabolism.
Endocrinology
133:2255-2262 |
| 7. | Hagstrom, S. A., M. A. North, P. L. Nishina, E. L. Berson, and T. P. Dryja. 1998. Recessive mutations in the gene encoding the tubby-like protein TULP1 in patients with retinitis pigmentosa. Nat. Genet. 18:174-176[CrossRef][Medline]. |
| 8. | Huszar, D., C. A. Lynch, V. Fairchild-Huntress, J. H. Dunmore, Q. Fang, L. R. Berkemeier, W. Gu, R. A. Kesterson, B. A. Boston, R. D. Cone, F. J. Smith, L. A. Campfield, P. Burn, and F. Lee. 1997. Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88:131-141[CrossRef][Medline]. |
| 9. |
Ikeda, S.,
W. He,
A. Ikeda,
J. K. Naggert,
M. A. North, and P. M. Nishina.
1999.
Cell-specific expression of tubby gene family members (tub, Tulp1,2, and 3) in the retina.
Investig. Ophthalmol. Vis. Sci.
40:2706-2712 |
| 10. | Kapeller, R., A. Moriarty, A. Strauss, H. Stubdal, K. Theriault, E. Siebert, T. Chickering, J. P. Morgenstern, L. A. Tartaglia, and J. Lillie. 1999. Tyrosine phosphorylation of Tub and its association with Src homology 2 domain-containing proteins implicate Tub in intracellular signaling by insulin. J. Biol. Chem. 275:24980-24986. |
| 11. | Kleyn, P. W., W. Fan, S. G. Kovats, J. J. Lee, J. C. Pulido, Y. Wu, L. R. Berkemeier, D. J. Misumi, L. Holmgren, O. Charlat, E. A. Woolf, O. Tayber, T. Brody, P. Shu, F. Hawkins, B. Kennedy, L. Baldini, C. Ebeling, G. D. Alperin, J. Deeds, N. D. Lakey, J. Culpepper, H. Chen, M. A. Glucksmann-Kuis, K. J. Moore, et al. 1996. Identification and characterization of the mouse obesity gene tubby: a member of a novel gene family. Cell 85:281-290[CrossRef][Medline]. |
| 12. |
Laird, P. W.,
A. Zijderveld,
K. Linders,
M. A. Rudnicki,
R. Jaenisch, and A. Berns.
1991.
Simplified mammalian DNA isolation procedure.
Nucleic Acids Res.
19:4293 |
| 13. |
McBurney, M. W.,
L. C. Sutherland,
C. N. Adra,
B. Leclair,
M. A. Rudnicki, and K. Jardine.
1991.
The mouse Pgk-1 gene promoter contains an upstream activator sequence.
Nucleic Acids Res.
19:5755-5761 |
| 14. | Noben-Trauth, K., J. K. Naggert, M. A. North, and P. M. Nishina. 1996. A candidate gene for the mouse mutation tubby. Nature 380:534-538[CrossRef][Medline]. |
| 15. |
North, M. A.,
J. K. Naggert,
Y. Yan,
K. Noben-Trauth, and P. M. Nishina.
1997.
Molecular characterization of TUB, TULP1, and TULP2, members of the novel tubby gene family and their possible relation to ocular diseases.
Proc. Natl. Acad. Sci. USA
94:3128-3133 |
| 16. | Ohlemiller, K. K., R. M. Hughes, J. M. Lett, J. M. Ogilvie, J. D. Speck, J. S. Wright, and B. T. Faddis. 1997. Progression of cochlear and retinal degeneration in the tubby (rd5) mouse. Audiol. Neurootol. 2:175-185[Medline]. |
| 17. | Ohlemiller, K. K., R. M. Hughes, J. Mosinger-Ogilvie, J. D. Speck, D. H. Grosof, and M. S. Silverman. 1995. Cochlear and retinal degeneration in the tubby mouse. Neuroreport 6:845-849[Medline]. |
| 18. | Robertson, E. J. 1987. Embryo-derived stem cell lines, p. 71-112. In E. J. Robertson (ed.), Teratocarcinomas and embryonic stem cells: a practical approach. IRL, Oxford, England. |
| 19. |
Sahly, I.,
K. Gogat,
A. Kobetz,
D. Marchant,
M. Menasche,
M. Castel,
F. Revah,
J. Dufier,
M. Guerre-Millo, and M. M. Abitbol.
1998.
Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation.
Hum. Mol. Genet.
7:1437-1447 |
Molecular and Cellular Biology, February 2000, p. 878-882, Vol. 20, No. 3
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Patterson, V. L., Damrau, C., Paudyal, A., Reeve, B., Grimes, D. T., Stewart, M. E., Williams, D. J., Siggers, P., Greenfield, A., Murdoch, J. N.
(2009). Mouse hitchhiker mutants have spina bifida, dorso-ventral patterning defects and polydactyly: identification of Tulp3 as a novel negative regulator of the Sonic hedgehog pathway. Hum Mol Genet
18: 1719-1739
[Abstract] [Full Text] -
Perry, C. A., Pravetoni, M., Teske, J. A., Aguado, C., Erickson, D. J., Medrano, J. F., Lujan, R., Kotz, C. M., Wickman, K.
(2008). Predisposition to late-onset obesity in GIRK4 knockout mice. Proc. Natl. Acad. Sci. USA
105: 8148-8153
[Abstract] [Full Text] -
Bera, T. K., Liu, X.-F., Yamada, M., Gavrilova, O., Mezey, E., Tessarollo, L., Anver, M., Hahn, Y., Lee, B., Pastan, I.
(2008). A model for obesity and gigantism due to disruption of the Ankrd26 gene. Proc. Natl. Acad. Sci. USA
105: 270-275
[Abstract] [Full Text] -
Wang, Y., Seburn, K., Bechtel, L., Lee, B. Y., Szatkiewicz, J. P., Nishina, P. M., Naggert, J. K.
(2006). Defective carbohydrate metabolism in mice homozygous for the tubby mutation. Physiol. Genomics
27: 131-140
[Abstract] [Full Text] -
Beck, B
(2006). Neuropeptide Y in normal eating and in genetic and dietary-induced obesity. Phil Trans R Soc B
361: 1159-1185
[Abstract] [Full Text] -
Figlewicz, D. P., Zavosh, A., Sexton, T., Neumaier, J. F.
(2004). Catabolic action of insulin in rat arcuate nucleus is not enhanced by exogenous "tub" expression. Am. J. Physiol. Endocrinol. Metab.
286: E1004-E1010
[Abstract] [Full Text] -
Benoit, S. C., Air, E. L., Coolen, L. M., Strauss, R., Jackman, A., Clegg, D. J., Seeley, R. J., Woods, S. C.
(2002). The Catabolic Action of Insulin in the Brain Is Mediated by Melanocortins. J. Neurosci.
22: 9048-9052
[Abstract] [Full Text] -
Bouchard, G., Johnson, D., Carver, T., Paigen, B., Carey, M. C.
(2002). Cholesterol gallstone formation in overweight mice establishes that obesity per se is not linked directly to cholelithiasis risk. J. Lipid Res.
43: 1105-1113
[Abstract] [Full Text] -
Majdic, G., Young, M., Gomez-Sanchez, E., Anderson, P., Szczepaniak, L. S., Dobbins, R. L., McGarry, J. D., Parker, K. L.
(2002). Knockout Mice Lacking Steroidogenic Factor 1 Are a Novel Genetic Model of Hypothalamic Obesity. Endocrinology
143: 607-614
[Abstract] [Full Text] -
Ikeda, A., Nishina, P. M., Naggert, J. K.
(2002). The tubby-like proteins, a family with roles in neuronal development and function. J. Cell Sci.
115: 9-14
[Abstract] [Full Text] -
Pijl, H., de Meijer, P. H. E. M., Langius, J., Coenegracht, C. I. G. M., van den Berk, A. H. M., Chandie Shaw, P. K., Boom, H., Schoemaker, R. C., Cohen, A. F., Burggraaf, J., Meinders, A. E.
(2001). Food Choice in Hyperthyroidism: Potential Influence of the Autonomic Nervous System and Brain Serotonin Precursor Availability. J. Clin. Endocrinol. Metab.
86: 5848-5853
[Abstract] [Full Text] -
Hagstrom, S. A., Adamian, M., Scimeca, M., Pawlyk, B. S., Yue, G., Li, T.
(2001). A Role for the Tubby-Like Protein 1 in Rhodopsin Transport. IOVS
42: 1955-1962
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»