INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Retinoids, a class of natural and synthetic vitamin A analogs, exert profound effects on many biological processes, including cell proliferation and differentiation, vision, reproduction, morphogenesis, and pattern formation, both in normal and transformed cells (9, 30). They have been well recognized as promising agents for the prevention of human cancers (9, 13, 30, 58). Their therapeutic potential has also received a great amount of attention, since all-trans-retinoic acid (RA) showed dramatic antitumor effects in patients with acute promyelocytic leukemia (58). However, retinoid resistance associated with many different types of cancer has prevented the further application of retinoids (13, 58).

The effects of retinoids are mainly mediated by two classes of nuclear receptors, the RA receptors (RARs) and retinoid X receptors (RXRs) (18, 34, 67). 9-cis-RA is a high-affinity ligand for both RARs and RXRs, whereas all-trans-RA is a ligand for only RARs. RARs and RXRs are encoded by three distinct genes (, , and ) and are members of the steroid/thyroid hormone receptor superfamily, which function as ligand-activated transcription factors (18, 34, 67). RARs and RXRs primarily function as RXR-RAR heterodimers that bind to a variety of RA response elements (RAREs) and regulate their transactivation function (18, 34, 67). Transcriptional activation by retinoid receptors requires a carboxy-terminal helical region, termed activation function-2, that forms part of the ligand-binding pocket and that undergoes a conformational change required for the recruitment of coactivator proteins, such as CREB binding protein (CBP) (17). This appears to provide a direct link to the core transcriptional machinery and modulates chromatin structure (62).

In addition to retinoid receptors, a number of orphan receptors whose ligands are unknown have been implicated in the regulation of the retinoid response (25, 47). One of the factors is COUP-TF. COUP-TF is encoded by two distinct genes, COUP-TFI (ear-3) (36, 56) and COUP-TFII (ARP-1) (22). Both genes show an exceptionally high degree of homology, and their expression patterns often overlap, suggesting that they may serve redundant functions (47). However, each factor possesses its own distinct expression profile during development (47). A null mutation of COUP-TFI resulted in defects in neurogenesis, axon guidance, and arborization (46), whereas deletion of COUP-TFII resulted in striking defects in angiogenesis, vascular remodeling, and fetal heart development (41). COUP-TF was originally shown to stimulate gene transcription (40). However, subsequent work has demonstrated that COUP-TF can repress the transcription induced by a number of nuclear receptors including RARs, thyroid hormone receptors, and vitamin D receptor (3, 20, 24, 53, 59). It has been recently reported that COUP-TFs can function as positive regulators for many different genes. In the arrestin gene promoter, a DR-7 element mediates the positive transcriptional effect of COUP-TF (32), while in the other genes, such as the trout estrogen receptor (23), the phosphoenolpyruvate carboxykinase (10), the vHNF1 (45), the human immunodeficiency virus long terminal repeat (49), and the NGFI-A (44) genes, the positive-transcription function of COUP-TF is mediated through its interaction with other transcriptional factors. For the NGFI-A gene, COUP-TF enhances transcription by recruiting coactivator SRC-1 through its interaction with SP-1 (44).

Retinoids exert their anticancer activities mainly through their abilities to modulate the growth, differentiation, and apoptosis of cancer cells. Recent studies have indicated that RAR plays a critical role in mediating the growth-inhibitory effect of retinoids in many different types of cancer cells, including those of breast cancer (27, 29), lung cancer (28), ovarian cancer (42), prostate cancer (2), neuroblastoma (6), renal cell carcinoma (11), pancreatic cancer (16), liver cancer (26), and head and neck cancer (70). Expression of RAR in RAR-negative cancer cells restored RA-induced growth inhibition and apoptosis, whereas inhibition of RAR expression in RAR-positive cancer cells abolished RA effects (27-29). In addition, transgenic mice expressing RAR antisense sequences showed increased incidence of lung tumor (1), whereas suppression of RAR expression was responsible for diminished anticancer activities of retinoids in animals (57). Moreover, up-regulation of RAR is associated with a positive clinical response to retinoids in patients with premalignant oral lesions (31, 50).

The finding that a deletion of the short arm of chromosome 3p24, close to where the RAR gene maps, occurs with high frequency in human tumors (21, 38) led to studies on abnormalities of the RAR gene and its expression. These studies revealed a high frequency of abnormal expression of the RAR gene, but not of genes of the other RAR subtypes, in human cancer cell lines and primary human cancer tissues (8, 14, 15, 39, 55, 68, 69). Thus, the loss of RAR may be a key mechanism by which cancer cells escape normal growth control and a contributing factor in cancer development (35, 63). Indeed, it has been shown that loss of RAR is an early event in carcinogenesis (43, 60, 63, 64) and may be involved in liver cancer development (4).

How RAR expression is regulated and how its expression is lost in cancer cells remain largely unknown and are subjects of intensive study. Expression of RAR is highly induced by RA through a RARE (RARE) present in its promoter (5, 12, 51) that is activated by RAR-RXR heterodimers (54, 65). However, we and others have recently demonstrated that expression of RARs and RXRs is not sufficient to render RAR expression responsive to RA (19, 37, 55, 68). In the majority of lung cancer cell lines, RAR expression could not be induced by RA, despite expression of RARs and RXRs (68). Similarly, retinoid refractoriness occurs during lung carcinogenesis despite the expression of functional retinoid receptors (19). Thus, factors other than RARs and RXRs are required for RA to induce RAR expression.

We have previously demonstrated that expression of COUP-TF is positively correlated with RAR induction and growth inhibition by RA in lung cancer cell lines (61). In this study, we further investigated the effect of COUP-TF in the regulation of RA-dependent RAR induction and the underlying molecular mechanism. Our results demonstrate that COUP-TF is required for RA to induce RAR expression, growth inhibition, and apoptosis in cancer cells. In addition, our studies showed that COUP-TF could strongly induce transcriptional activity of the RAR promoter in a RA- and RAR-dependent manner through its binding to a DR-8 element present in the promoter. Furthermore, we observed that COUP-TF, through its interaction with RAR, strongly enhanced the interaction of RAR with its coactivator CBP, demonstrating that COUP-TF induces RAR promoter transcription by acting as an accessory protein for RAR to recruit its coactivator.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Cell culture. CV-1, HeLa, MDA-MB231, and MDA-MB468 cells were grown in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum (FCS). Calu-6, HT-1376, J82, SK-MES-1, and 5637 cells were maintained in minimal essential medium supplemented with 10% FCS. H292, H520, H460, H596, H441, and H661 cells were grown in RPMI 1640 supplemented with 10% FCS. A-549 cells were maintained in F12 medium supplemented with 10% FCS.

Plasmid constructions. The RAR promoter reporter (745RARCAT) has been described previously (12). The coding sequence of RAR was inserted into the multiple cloning sites of the eukaryotic expression vector pECE (65). The insertion of COUP-TFI cDNA into pRC/CMV vector (Invitrogen, San Diego, Calif.) in sense and antisense orientations followed the procedure described previously (29). The RAR promoter deletion mutants were created by cloning BamHI-flanked PCR products derived from 745RAR promoter into the pBluescript chloramphenicol acetyltransferase (CAT) plasmid (12). The forward primers were as follows: for the 516RAR promoter, CATGGATCCTAGCCATTCTCGTTCTACAGT; for the 300RAR promoter, CATGGATCCAGAAGTTGGTGCTCAACGTGA; for the 126RAR promoter, CATGGATCCAGCTCTGTGAGAATCCTGGG. The oligonucleotide CATGGATCCTACCCCGACGGTGCCCAGA was used as the reverse primer for the above mutants. The 60RAR promoter mutant was constructed by subcloning a SmaI/BamHI-flanked fragment from the RAR promoter into the pBluescript CAT plasmid. The COUP-TF-RE and RARE mutant constructs were generated by ligating the mutated RAR promoter PCR products into the pBluescript CAT vector. The following primers were used to incorporate the appropriate mutations: TCCCCCGGGCTGCTAACCTTCAAATGACCCAAGTGACATCACCAA for COUP-TF-RE/M1, TCCCCCGGGCTGCTAACCTTCAAATGACCCAACTAGTCGAGCATCACCAA for COUP-TF-RE/M2, TCCCCCGGGTAGAACTCACCGAAAGTTCAC for RARE/M1, and TCCCGGGTAGGGTTCACCGAGTTCAC for RARE/M2. The COUP-TF-RE-tk-CAT reporter was obtained by inserting the DR-8 synthetic oligonucleotide into the BamHI site of pBL-CAT₂ (65). For COUP-TFII receptor mutations, pBSCOUP-TFII deletion mutants were obtained by cloning PCR products from COUP-TFII into pBluescript (Stratagene). The oligonucleotide CATCGAGTGCGTGAGACGGGAAGCGGTG was used as the forward primer, while the reverse primers were as follows: GCCATGTCGACTCAGTTAAAACTGCTGCC for pBS-COUP-TFII/7, TGCTGGTCGACTATAACATATCCCGGATG for pBS-COUP-TFII/14, and ACCTGTCGACTAGACGAAAAACAATTGC for pBS COUP-TFII/30. pBS-COUP-TFII/80 was obtained by digesting pBS-COUP-TFII with HindIII, whereas pBS-COUP-TFII/108 was obtained by digesting pBS-COUP-TFII with HindII. pBS-COUP-TFII/179 was generated by subcloning an EcoRI/PstI COUP-TFII fragment into EcoRI/PstI-digested pBluescript. The orientations and sequences of all mutants were confirmed by DNA sequencing. To generate COUP-TFIIDBD, the N terminus coding sequence of COUP-TFII was amplified by PCR with a primer (CCGCTTCCCGTCTCACGCACTCGATGTG) corresponding to COUP-TFII cDNA sequences that preceded the DNA binding domain, whereas the C terminus coding sequence of COUP-TFII was amplified with a primer (CATCGAGTGCGTGAGACGGGAAGCGGTG) corresponding to COUP-TFII cDNA sequences right after the DNA binding domain. The resulting PCR products were then ligated to generate a COUP-TFII mutant with the DNA binding domain deleted. The COUP-TFII cDNA deletion mutants were also cloned into pCDNA₃ (Invitrogen) for a transient transfection assay.

Preparation of COUP-TF proteins. Receptor proteins for COUP-TFI and COUP-TFII were synthesized by an in vitro transcription and translation system using rabbit reticulocyte lysate (Promega) as described previously (65). The relative amounts of the translated proteins were determined by using [³⁵S]methionine-labeled protein in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), quantitating the amount of incorporated radioactivity and normalizing it relative to the content of methionine in each protein.

Transient and stable transfection assay. CV-1 cells were plated at 10⁵ cells per well in a 24-well plate 16 to 24 h before transfection, as described previously (66). For cancer cells, 5 × 10⁵ cells were seeded in a six-well plate. A modified calcium phosphate precipitation procedure was used for transient transfection and is described elsewhere (66). Briefly, 700 ng of reporter plasmid, 100 ng of -galactosidase (-Gal) expression vector (pCH 110; Pharmacia), and various amounts of COUP-TF expression vector and RAR were mixed with carrier DNA (pBluescript) to 1,000 ng of total DNA per well. CAT activity was normalized for transfection efficiency to the corresponding -Gal activity. For stable transfection, the pRc/CMV-COUP-TFI recombinant plasmid was stably transfected into MDA-MB231 cells, and pRC/CMV-antisense-COUP-TFI was stably transfected into J82 cells by the calcium phosphate precipitation method, and stable clones were screened with G418 (GIBCO BRL, Grand Island, N.Y.) as described previously (29). Southern blotting and Northern blotting were used to determine the integration and expression of transfected cDNA, respectively.

Gel retardation assay. Oligonucleotides used for the gel retardation assay are described in the text. For the protein-DNA binding assay, in vitro-translated protein (1 to 4 µl, depending on the translation efficiency) was incubated with the ³²P-labeled oligonucleotides in a 20-µl reaction mixture containing 10 mM HEPES buffer, pH 7.9, 50 mM KCl, 1 mM dithiothreitol, 2.5 mM MgCl₂, 10% glycerol, and 1 µg of poly(dI-dC) at 25°C for 20 min. Unprogrammed reticulocyte lysate was used to maintain equal protein concentrations in all reaction mixtures. Each reaction mixture was then loaded on a 5% nondenaturing polyacrylamide gel containing 0.5× TBE (1× TBE is 0.089 M Tris-borate, 0.088 M boric acid, and 0.002 M EDTA).

GST pull-down assay. To prepare the glutathione S-transferase (GST)-receptor fusion protein, the receptor cDNA (COUP-TFI or RAR) was cloned in frame into the expression vector pGEX-2T (Pharmacia). The fusion protein was expressed in bacteria by the procedure provided by the manufacturer and was analyzed by a gel retardation assay and Western blotting (data not shown). To analyze the interaction between RAR and COUP-TFI and between COUP-TFI and CBP, the fusion protein was immobilized to glutathione-Sepharose beads. For a control, the vector protein (GST), prepared under the same conditions, was also immobilized. The beads were preincubated with bovine serum albumin (1 mg/ml) at room temperature for 5 min. ³⁵S-labeled, in vitro-synthesized receptor proteins (2 to 5 µl, depending on translation efficiency) were then added to the beads. The beads were then continuously rocked for 1 h at 4°C in a final volume of 200 µl in EBC buffer (140 mM NaCl, 0.5% NP-40, 100 mM NaF, 200 µM sodium orthovanadate, and 50 mM Tris, pH 8.0). After being washed five times with NETN buffer (100 mM NaCl, 1 mM EDTA, 20 mM Tris [pH 8.0], 0.5% NP-40), the bound proteins were analyzed by SDS-PAGE.

Growth inhibition assays. To determine the effect of all-trans-RA on the viability of the stable transfectants, cells were seeded at 1,000 per well in a 96-well plate and treated with various concentrations of all-trans-RA for 6 days. Media were changed every 48 h. The number of viable cells was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay as described previously (29). For the anchorage-independent growth assay, 30,000 cells/60-mm-diameter dish in culture medium containing 10% FCS, 0.3% agar (Difco, Detroit, Mich.), and 10⁷ M RA were plated onto an already-hardened 0.6% agar underlayer in medium supplemented with 10% FCS. The plates were incubated for 21 days in a 5% CO₂ incubator. Colonies with more than 40 cells were counted with a microscope.

Apoptosis assay. Cells were treated with or without all-trans-RA (10⁶ M). Forty-eight hours later, cells were trypsinized, washed with phosphate-buffered saline (PBS; pH 7.4), and fixed in 1% formaldehyde in PBS. After being washed in PBS, cells were resuspended in 70% ice-cold ethyl alcohol and immediately stored at 20°C overnight. Cells were then labeled with biotin-16-dUTP by terminal deoxynucleotidyltransferase (TdT) and stained with avidin-fluorescein isothiocyanate (Boehringer, Mannheim, Germany). Fluorescently labeled cells were analyzed with a FACScater-plus as described previously (29). Representative histograms are shown.

Northern blotting. For Northern blot analysis, total RNAs were prepared with an RNeasy Mini Kit (Qiagen, Hilden, Germany). Thirty micrograms of total RNA from different cell lines treated with or without all-trans-RA (10⁶ M) was analyzed by Northern blotting. An EcoRI fragment in the ligand binding domain of RAR or a PstI fragment in the ligand binding domain of COUP-TFI cDNA was used as a probe to study the expression of RAR or COUP-TFII, respectively. The PstI fragment could detect the expression of COUP-TFI and COUP-TFII due to the high degree of homology of both receptor genes in the region. To determine that equal amounts of RNA were used, the expression of -actin was studied.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Correlation between COUP-TF expression and RAR induction by RA. We recently showed that expression of COUP-TF is required for RA sensitivity in certain lung cancer cell lines (61). To examine to what degree COUP-TF is involved in the regulation of RAR expression, we analyzed the expression of COUP-TF in various cancer cell lines, including breast cancer cell lines ZR-75-1, MDA-MB468, MDA-MB231, and T-47D, bladder cancer cell lines J82, HT-1376, 5637, and SCaBER, and lung cancer cell lines H520, H292, Calu-6, H460, H596, A-549, H441, SK-MES-1, and H661. A PstI fragment in the ligand binding domain of COUP-TF was used as a probe. The probe could detect transcripts for COUP-TFI and COUP-TFII. When the expression of COUP-TFs was compared with RA-induced RAR expression, we found a perfect correlation between COUP-TFI expression and the ability of RA to induce RAR in breast cancer cell lines (Fig. 1). COUP-TFI was expressed in ZR-75-1 and T-47D cell lines, in which RAR expression was highly induced by RA. In contrast, COUP-TF transcripts were not detected in MDA-MB468 and MDA-MB231 cell lines that did not show a clear induction of RAR by RA. In bladder cancer cell lines, RAR was highly induced by RA in COUP-TFI-positive J82 cells but not in COUP-TFI-negative 5637 and SCaBER cells. Although HT-1376 cells expressed COUP-TFI, we did not observe any RAR expression. This is due to lack of RAR expression in these cells (see Discussion). A correlation was also observed in lung cancer cell lines, except SK-MES-1 and H661 lines. COUP-TFI and COUP-TFII were highly expressed in RAR-inducible cell lines Calu-6, H460, and H596 but not in RAR-noninducible H520, H292, A549, and H441 cell lines. These observations suggest that expression of COUP-TF may be required for RA to induce RAR expression in different types of cancer cells.

View larger version (62K): [in this window] [in a new window]   FIG. 1.   Correlation between COUP-TF expression and RAR induction by RA in human breast cancer (A), bladder cancer (B), and lung cancer (C) lines. Total RNAs were prepared from the indicated cancer cell lines treated with or without all-trans-RA (106 M) for 24 h and analyzed for the expression of COUP-TFI and RAR. For a control, the expression of -actin is shown.

Levels of COUP-TFI expression modulate RA-dependent RAR expression, growth inhibition, and apoptosis. To further determine the requirement of COUP-TF for RA-dependent activation of RAR gene expression, we stably expressed COUP-TFI in COUP-TF-negative MDA-MB231 breast cancer cells. Two stable clones (MB231/COUP#10 and MB231/COUP#16) that expressed a high level of transfected COUP-TFI (Fig. 2A) were subjected to an analysis of RAR gene expression in the absence or presence of RA. Under the conditions used, we did not detect any expression of the RAR transcript in the parental MDA-MB231 cells in either the absence or presence of RA (Fig. 2B), consistent with our previous observation (29). However, RA treatment strongly induced RAR expression in the COUP-TFI-stable clones, not in the MDA-MB231 cells transfected with the empty vector (MB231/vector) (Fig. 2B). This suggests that expression of COUP-TFI confers on MDA-MB231 cells sensitivity to RA regulation of RAR expression. When the effect of the stable transfection of COUP-TFI on growth of MDA-MB231 cells was analyzed, we observed that RA, which was unable to regulate the growth of the parental MDA-MB231 cells, could strongly inhibit the growth of the clones carrying stably transfected COUP-TFI, with about 41 and 54% inhibition in MB231/COUP#16 and MB231/COUP#10 cells, respectively, when they were treated with 10⁶ M RA for 6 days (Fig. 2C). The growth-inhibitory effect of RA is specific to COUP-TFI expression since RA had no effect on the growth of MB231/vector cells. We also examined the effect of COUP-TFI expression on apoptosis induction by RA. The TdT assay showed extensive DNA fragmentation in MB231/COUP#10 and MB231/COUP#16 cells but not in MDA-MB231 and MB231/vector cells. About 2% apoptotic cells were detected in cultures of MDA-MB231 and MB231/vector cells when they were treated with 10⁶ M RA for 2 days. However, the same RA treatment resulted in about 36 and 24% apoptotic cells in cultures of MB231/COUP#10 and MB231/COUP#16 cells, respectively (Fig. 2D), suggesting that expression of COUP-TFI could allow RA to induce apoptosis of MDA-MB231 cells. Thus, expression of COUP-TFI in COUP-TF-negative cancer cells can restore their response to RA effects on RAR expression, growth inhibition, and apoptosis.

View larger version (28K): [in this window] [in a new window]   FIG. 2.   Stable expression of COUP-TF in COUP-TF-negative, RA-resistant MDA-MB231 cells enhances the effect of RA on RAR induction, growth inhibition, and apoptosis induction. (A) Expression of transfected COUP-TFI in MDA-MB231 cells. COUP-TFI was stably transfected into MDA-MB231 cells, and expression of transfected COUP-TFI was determined by Northern blotting. For comparison, cells transfected with the empty vector (MB231/vector) were used. (B) Expression of RAR gene in MDA-MB231 cells and MDA-MB231/COUP-TF stable clones. Total RNAs were prepared from MDA-MB231, its COUP-TFI stable clones (MB231/COUP#16 and MB231/COUP#10), and MDA-MB231 transfected with the empty vector (MB231/vector). Cells were treated with or without all-trans-RA (106 M) for 24 h and analyzed for the expression of RAR by Northern blotting. In the control, the expression of -actin is shown. (C) Growth-inhibitory effect of RA in MDA-MB231 and MDA-MB231/COUP-TF stable clones. Cells were seeded at 1,000 cells per well in a 96-well plate and treated with the indicated concentrations of all-trans-RA for 6 days. The numbers of viable cells were determined by the MTT assay. (D) Effect of RA on apoptosis of MDA-MB231 cells and MDA-MB231/COUP-TF stable clones. Cells were treated with or without all-trans-RA (106 M) for 48 h, and DNA fragmentations were then determined by the TdT assay. Representative histograms show relative apoptotic cell numbers.

6

View larger version (26K): [in this window] [in a new window]   FIG. 3.   Inhibition of COUP-TF expression by stable expression of COUP-TF anti-sense RNA in COUP-TF-positive J82 cells represses effect of RA on RAR expression, growth inhibition, and apoptosis induction. (A) Expression of transfected COUP-TFI antisense RNA in J82 cells. COUP-TFI cDNA was stably transfected into J82 cells, and expression of transfected COUP-TFI antisense RNA in a selected stable clone (J82/A-COUP) was analyzed by Northern blotting. For comparison, the parental J82 cells and J82 cells stably transfected with the empty vector (J82/vector) were used. (B) Inhibition of RAR induction by RA by stable expression of COUP-TFI antisense RNA in J82 cells. Total RNAs were prepared from J82, J82/vector, and J82/A-COUP cells treated with or without all-trans-RA (106 M) for 24 h and analyzed for the expression of RAR by Northern blotting. The expression of -actin is shown for the control. (C) Inhibition of RA-induced growth inhibition by stable expression of COUP-TF antisense RNA in J82 cells. Cells were seeded at 1,000 cells per well in a 96-well plate and treated with the indicated concentrations of all-trans-RA for 6 days. The numbers of viable cells were determined by the MTT assay. (D) Inhibition of RA-induced apoptosis of J82 cells by COUP-TF antisense RNA. Cells were treated with or without all-trans-RA (106 M) for 48 h, and DNA fragmentations were then determined by the TdT assay. Representative histograms show relative apoptotic cell numbers.

View larger version (37K): [in this window] [in a new window]   FIG. 4.   Inhibition of anchorage-independent growth of MDA-MB231 cells by COUP-TF gene expression. (A) Visualization of colonies formed in the soft agar by parental MDA-MB231, MB231/COUP#10, MB231/COUP#16, and MB231/vector cells in the presence or absence of RA (107 M). (B) Quantitation of colonies formed by parental MDA-MB231, MB231/COUP#10, MB231/COUP#16, and MB231/vector cells. Colonies formed by MB231/COUP#10, MB231/COUP#16, MB231/vector, and parental MDA-MB231 cells in the presence or absence of all-trans-RA (107 M) were scored and expressed as percentages of colonies formed by cells treated with control solvent.

COUP-TF enhances RAR promoter activity in a RAR- and RA-dependent manner. To investigate the possibility that COUP-TFI induced RAR expression by activating RAR promoter transcription, a reporter construct that contains the RAR promoter sequences from 745 to +162 linked to the CAT reporter gene (745RARCAT) (12) was transiently transfected into CV-1 cells. Cotransfection of the RAR expression vector induced RAR promoter activity in response to RA (Fig. 5A), while cotransfection of the COUP-TFII expression vector slightly enhanced the reporter gene activity. However, when both COUP-TFII and RAR were cotransfected, a synergistic induction of RAR promoter activity in response to RA was observed. Induction of RAR promoter activity by RAR was enhanced from 16-fold to 44-fold when 20 ng of COUP-TFII was cotransfected, while a 56-fold induction was observed when 50 ng of COUP-TFII was cotransfected. A similar observation was also made with COUP-TFI (data not shown). We also investigated the effect of COUP-TFII in HT-1376 bladder cancer cells, which express a low level of COUP-TF (Fig. 1) and an undetectable level of RAR (our unpublished result). Cotransfection of the RAR expression vector slightly induced RAR promoter activity in response to RA in these cells, while cotransfection of COUP-TFII did not show any effect on RAR promoter activity (Fig. 5B). The lack of COUP-TFII activity is likely due to loss of RAR expression in these cells (see Discussion). When COUP-TFII was cotransfected with RAR, the RAR-induced RAR activity was strongly increased, compared to a 5-fold induction of RAR promoter activity by RAR alone and a 24-fold induction when both RAR and COUP-TFII were present. Similar results were also obtained when COUP-TFI was used and in other cancer cell lines, such as HeLa cells and MDA-MB231 cells (data not shown). Together, our data demonstrate that expression of COUP-TF is required for efficient induction of RAR promoter activity by RA in a RAR-dependent manner.

View larger version (17K): [in this window] [in a new window]   FIG. 5.   COUP-TF enhances RAR promoter activity in a RAR- and RA-dependent manner. (A) Activation of RAR promoter activity by COUP-TF in CV-1 cells. RAR promoter reporter (745RARCAT; 700 ng) was cotransfected with the indicated amounts of expression vector for COUP-TFII and RAR into CV-1 cells. Cells were treated with or without all-trans-RA (106 M) for 24 h and assayed for CAT activity. (B) Activation of RAR promoter in HT-1376 bladder cancer cells by COUP-TF. Cells were transfected with 1,500 ng of 745RARCAT reporter gene together with expression vectors for RAR (300 ng) and/or COUP-TFII (300 ng). Cells were treated with or without all-trans-RA (106 M) and 24 h later were assayed for CAT activity. Data shown represent the means of three independent experiments.

A DR-8 element in the RAR promoter mediates the COUP-TF effect. To identify DNA sequences responsible for the COUP-TF effect in the RAR promoter, we generated a series of 5' deletion mutants of the RAR promoter (Fig. 6A). The resulting RAR promoter fragments were fused to the CAT reporter gene and analyzed for the effect of COUP-TFII in enhancing RA-induced RAR activity in CV-1 cells (Fig. 6B). Deletion of 229 bp from the 5' end of the RAR promoter (516RARCAT) did not have any effect on the ability of COUP-TFII to enhance RAR activity. Recently, it was shown that COUP-TF could positively regulate gene transcription through an SP-1 site (44, 49). There is an SP-1 site (from 378 to 370) in the RAR promoter that could bind the SP-1 protein (data not shown). However, COUP-TFII retained its ability to induce RAR activity in 300RARCAT and 126RARCAT reporters in spite of deletion of the SP-1 binding site. This suggests that the effect of COUP-TFII on the RAR promoter is not mediated through the SP-1 binding site. Further deletion of 66 bp from 126RARCAT, however, completely abolished the COUP-TFII effect (Fig. 6B). This suggests that position 126 to 60 of the RAR promoter contains a COUP-TF response element (COUP-TF-RE). Inspection of the fragment between positions 126 and 60 revealed a direct repeat of AGGTCA-like motifs with 8-bp spacing (DR-8) located from 99 to 78 (Fig. 7A). COUP-TF is known to bind to a variety of nuclear receptor response elements containing AGGTCA-like motifs arranged in different orientations with different spacings (53). We therefore examined whether the DR-8 element in the RAR promoter could bind to COUP-TF. An oligonucleotide containing the sequence was synthesized and analyzed by gel retardation assay for its COUP-TF binding activity. As shown in Fig. 7B, in vitro-synthesized COUP-TFI or COUP-TFII formed a strong complex with the sequence. For comparison, RAR, RXR, or the RAR-RXR heterodimer did not exhibit any binding. The complex formed by COUP-TFI could be abolished by a 50-fold-excess amount of TREpal or CRBPII-RARE, which are known to bind with high affinity to COUP-TFs (53), while the same amount of SP-1 oligonucleotide did not show any effect on the binding. Thus, COUP-TF may exert its effect on the RAR promoter through its binding to the DR-8 element.

View larger version (20K): [in this window] [in a new window]   FIG. 6.   Identification of COUP-TF response element in the RAR promoter. (A) Schematic representation of the RAR promoter deletion mutants. The Sp-1 binding site, RARE, and the TATA box are indicated. (B) Effect of COUP-TFII on RA-induced RAR transactivation activity of various RAR promoter deletion mutants. CV-1 cells were transfected with 700 ng of CAT reporter gene containing the indicated RAR promoter fragment together with expression vectors for COUP-TFII (50 ng) and RAR (20 ng). Cells were then treated with or without all-trans-RA (106 M) and 24 h later were assayed for CAT activity. , without receptor cotransfection. Data shown represent the means of three independent experiments.

View larger version (47K): [in this window] [in a new window]   FIG. 7.   Analysis of COUP-TF binding on the COUP-TF-RE in the RAR promoter. (A) Sequence of the COUP-TF-RE. Arrows indicate the AGGTCA-like core motifs. (B) Binding of COUP-TF on the COUP-TF-RE. In vitro-synthesized COUP-TFI or COUP-TFII was incubated with 32P-labeled oligonucleotide containing the COUP-TF-RE and analyzed by a gel retardation assay. For comparison, the binding of RAR, RXR, and the RAR-RXR heterodimer was analyzed. For the competition assay, a 50-fold excess amount of the indicated oligonucleotide was used. , without competitor; solid arrowheads, specific COUP-TF binding complex; open arrowheads, nonspecific binding complex.

View larger version (30K): [in this window] [in a new window]   FIG. 8.   COUP-TF-RE is required for positive regulation of RAR promoter activity by COUP-TF. (A) Mutations of the COUP-TF-RE. Depicted are the COUP-TF-RE sequence and its mutations (boldfaced). (B) The mutated COUP-TF-REs failed to bind to the COUP-TF protein. The indicated COUP-TF-RE mutant was synthesized and analyzed for its binding to COUP-TF by the gel retardation assay. In vitro-synthesized COUP-TF protein was incubated with 32P-labeled COUP-TF-RE or the mutated COUP-TF-RE and analyzed by a gel retardation assay. Solid arrowhead, specific COUP-TAF binding complex; open arrowhead, nonspecific binding. (C) Mutations of COUP-TF-RE abolished the effect of COUP-TF on the RAR transactivation function in the RAR promoter. The COUP-TF-RE in the RAR promoter was mutated by PCR. The resulting RAR promoter mutants (745RARCAT/COUP-TF-RE/M1 and 745RARCAT/COUP-TF-RE/M2) were analyzed by transient transfection assay in CV-1 cells for their effect on COUP-TF activity. CV-1 cells were transfected with the 700-ng reporter gene together with the indicated amounts of expression vectors for RAR and COUP-TFII. Cells were treated with or without all-trans-RA (106 M) and 24 h later were assayed for CAT activity. CAT activity was normalized for transfection efficiency to the corresponding -Gal activity. Data shown represent the means of three independent experiments.

DNA binding of COUP-TF is required for its transactivation function. To determine which region of COUP-TF is required for the binding of the DR-8 element and the activation of the RAR promoter, a number of COUP-TFII mutants were generated (Fig. 9A) and analyzed for their binding to the element (Fig. 9B) and their enhancing effect on RAR activity in the 745RARCAT reporter (Fig. 9C). Deletion of seven amino acids from the C-terminal end of the COUP-TFII protein did not affect the binding of COUP-TF-RE (Fig. 9B). The same mutant also bound strongly to TREpal as the wild-type receptor. However, removal of an additional seven amino acid residues resulted in a mutant (COUP-TFII/14) that could not bind either to COUP-TF-RE or to TREpal. As expected, other mutants analyzed, including COUP-TFII/30, COUP-TFII/80, COUP-TFII/108, and COUP-TFII/179 (Fig. 9A), did not exhibit any detectable binding on both elements (Fig. 9B). When the effect of these mutants on RAR transactivation function in 745RARCAT was analyzed, we observed that removal of as few as 14 amino acid residues from the C-terminal end of the COUP-TFII protein completely abolished the enhancing effect of COUP-TFII (Fig. 9C). Other C-terminal deletion mutants, which could not bind to the DR-8 element, also failed to enhance RAR activity (data not shown). A mutant with the DNA binding domain deleted (COUP-TF/DBD) was also unable to enhance RAR activity (Fig. 9C). Thus, the DNA binding of COUP-TF is essential for its enhancing effect on RAR activity.

View larger version (35K): [in this window] [in a new window]   FIG. 9.   DNA binding of COUP-TF is required for its enhancing effect on RAR activity in the RAR promoter. (A) Schematic representation of COUP-TF mutants. The DNA binding domain and the ligand domain of COUP-TFII as well as the A/B, C, D, and E/F domains are indicated. (B) Binding of the COUP-TFII mutants to COUP-TF-RE and TREpal. In vitro-synthesized COUP-TFII or the indicated COUP-TFII deletion mutant was incubated with 32P-labeled COUP-TF-RE or TREpal as indicated and analyzed by a gel retardation assay. The arrowheads indicate the specific COUP-TF binding complexes. (C) Effect of the COUP-TFII mutants on RAR activity in the RAR promoter. CV-1 cells were transfected with 700 ng of 745RARCAT reporter gene together with the expression receptor for RAR (20 ng) and the indicated amount of COUP-TFII or COUP-TFII deletion mutants. Cells were treated with or without all-trans-RA (106 M) for 24 h and were assayed for CAT activity. Data shown represent the means of three independent experiments.

RARE is required for the DR-8 element to confer the RA- and RAR-dependent transactivation function of COUP-TF. To further determine the role of the DR-8 element in mediating the COUP-TF transactivation function, we cloned the sequence into the pBLCAT₂ plasmid, which contains the thymidine kinase (TK) promoter linked with the CAT reporter gene (65). The resulting construct, COUP-TF-RE-tk-CAT, was transiently transfected into CV-1 cells. Surprisingly, we did not see any effect of COUP-TFII on reporter transcription either in the absence or presence of RA, indicating that the binding of COUP-TFII could not transactivate the reporter (Fig. 10). Cotransfection of the RAR expression vector did not have any effect on the reporter activity, either in the absence or presence of RA, consistent with our gel retardation assay showing lack of RAR binding to the DR-8 element (Fig. 7B). Furthermore, cotransfection of COUP-TFII and RAR expression vectors failed to activate reporter transcription. These data demonstrate that the DR-8 element alone is not sufficient to confer the RA- and RAR-dependent transactivation function of COUP-TF observed in the RAR promoter.

View larger version (21K): [in this window] [in a new window]   FIG. 10.   COUP-TF-RE alone is not sufficient to confer the activation function of COUP-TF. COUP-TF-RE was cloned into pBLCAT2, which contained the TK promoter linked with the CAT gene. The resulting reporter construct (COUP-TF-RE-tk-CAT) was analyzed for its response to the COUP-TF effect by transient transfection assay. The reporter gene (100 ng) was cotransfected with the indicated amounts of expression receptor for RAR and COUP-TFII into CV-1 cells. After transfection, cells were treated with or without all-trans-RA (106 M) and 24 h later were assayed for CAT activity. Data shown represent the means of three independent experiments.

View larger version (30K): [in this window] [in a new window]   FIG. 11.   RARE in the RAR promoter is required for the enhancing effect of COUP-TF on RAR activity in the RAR promoter. (A) Schematic representation of the RARE mutations. Depicted are wild-type RARE in the RAR promoter and its mutations (boldface). Arrows indicate the care motifs of the RARE. (B) Effect of RARE mutations on retinoid receptor binding. In vitro-synthesized RAR and RXR were incubated with 32P-labeled RARE or the mutated RARE and analyzed by a gel retardation assay. The arrowhead indicates specific RAR-RXR heterodimer binding. (C) Mutations of the RARE impair the enhancing effect of COUP-TF on RAR activity in the RAR promoter. Mutations in the RARE of the RAR promoter were introduced by PCR as described in Materials and Methods. The resulting RAR promoter mutants (745RARCAT/RARE/M1 and 745RARCAT/RARE/M2) were analyzed by transient transfection assay for the effect of COUP-TF. CV-1 cells were transfected with 700 ng of reporter gene together with the indicated amounts of expression vectors for COUP-TFII and RAR. Cells were then treated with or without all-trans-RA (106 M) and 24 h later were assayed for CAT activity. Data shown represent the means of three independent experiments.

COUP-TF enhances recruitment of CBP by RAR. The transactivation function of nuclear receptors requires their interaction with receptor coactivators (62), such as CBP (17). The transactivation function of COUP-TF could be due to its interaction with CBP. We therefore investigated whether COUP-TFI could interact with CBP by the GST pull-down assay. Under the conditions used, we did not observe a clear interaction between COUP-TFI and CBP (Fig. 12A), consistent with a previous report (44). This demonstrates that the transactivation function of COUP-TFI is unlikely to be mediated through its direct interaction with CBP. The facts that the transactivation function of COUP-TF is RAR and RA dependent and requires RARE suggest that the effect of COUP-TF may be mediated by RAR, which is known to interact with CBP (17). We then incubated GST-COUP-TFI with CBP in the presence of in vitro-synthesized RAR. As shown in Fig. 12A, a significant amount of CBP was pulled down by the GST-COUP-TFI fusion protein when RAR was present. We also determined whether COUP-TF could enhance the interaction between RAR and CBP. As shown in Fig. 12A, CBP was slightly pulled down by the GST-RAR fusion protein. However, when GST-RAR was mixed with in vitro-synthesized COUP-TFI protein, a significant amount of CBP was pulled down. The observation that both RAR and COUP-TFI are required for their maximum interaction with CBP suggests that COUP-TFI may interact with RAR. Indeed, in vitro-synthesized RAR was efficiently pulled down by GST-COUP-TFI, but not by the GST control protein (Fig. 12B), demonstrating that COUP-TFI could directly interact with RAR. Thus, COUP-TF may facilitate the RAR-CBP interaction by interacting with RAR, resulting in a RAR conformation favorable for CBP interaction.

View larger version (18K): [in this window] [in a new window]   FIG. 12.   COUP-TF enhances recruitment of CBP by RAR. (A) COUP-TF enhances interaction of RAR and CBP. COUP-TFI or RAR protein was synthesized in bacteria with pGEX-2T (Pharmacia). The GST-COUP-TFI or GST-RAR fusion protein was immobilized on glutathione-Sepharose beads, while the same amount of GST was also immobilized on beads as a control. 35S-labeled CBP was then mixed with beads and in vitro-synthesized RAR (for GST-COUP-TFI) or in vitro-synthesized COUP-TFI (for GST-RAR) in the presence of 106 M all-trans-RA. After extensive washing, the bound proteins were analyzed by SDS-PAGE. The input proteins are shown for comparison. (B) COUP-TFI interacts with RAR. To analyze the interaction between COUP-TF and RAR, 35S-labeled RAR was mixed with GST-COUP-TFI fusion protein on beads. After extensive washing, the bound proteins were analyzed by SDS-PAGE. As a comparison, the input proteins are shown. (C) COUP-TF increases the effect of CBP on RAR activity. The indicated amounts of expression vector for RAR, COUP-TFII, and CBP were cotransfected with RAR promoter into CV-1 cells. Cells were treated with or without all-trans-RA (106 M) for 24 h and then were assayed for CAT activity. The corresponding -Gal activity was normalized as a control.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

RAR plays a crucial role in the mediating growth-inhibitory effect of retinoids, and lack of its expression contributes to retinoid resistance in many different types of cancer cells. Expression of RAR is induced by RA through binding of RAR-RXR heterodimers to the RARE in the RAR promoter. However, expression of RAR and RXR in cancer cells is not sufficient to account for induction of RAR by RA. Here, we provide convincing evidence that orphan receptor COUP-TF is required for RA to induce RAR expression, growth inhibition, and apoptosis in cancer cells and that loss of COUP-TF expression is the main factor contributing to the lack of RAR expression in cancer cells. In addition, we show that COUP-TF synergistically increases the RA-dependent RAR transactivation function in the RAR promoter through its binding to a DR-8 element in the promoter, which enhances the interaction of RAR with its coactivator CBP.

Expression of COUP-TF is required for efficient RAR induction by RA in cancer cells. Several lines of evidence provided in this study demonstrate that expression of COUP-TF is required for efficient RAR induction by RA in cancer cells. First, expression of COUP-TF is positively correlated with induction of RAR by RA in breast cancer, lung cancer, and bladder cancer cell lines (Fig. 1). A perfect correlation was observed in breast cancer cell lines, while a close correlation was found in lung cancer and bladder cancer cell lines. This observation is consistent with previous studies (33, 47, 48) demonstrating that RAR and COUP-TFII are coexpressed in motor neurons. In addition, our stable expression of COUP-TFI in COUP-TF-negative MDA-MB-231 breast cancer cells (Fig. 2) showed that expression of COUP-TFI could restore the ability of RA to induce RAR expression. Furthermore, inhibition of COUP-TF expression by stable expression of COUP-TFI antisense RNA in COUP-TF-positive J82 cancer cells reduced the ability of RA to induce RAR expression (Fig. 3). Finally, our transient transfection assays clearly demonstrated that COUP-TF could activate the RAR promoter in response to RA when RAR was expressed (Fig. 5). Thus expression of COUP-TF is required for RA to effectively induce RAR expression, and loss of COUP-TF in cancer cells may be one of the important mechanisms responsible for the lack of RAR expression in cancer cells.

Effect of COUP-TF on growth inhibition and apoptosis induction by RA. RA is known to inhibit the growth of and induce apoptosis in cancer cells, in part due to its induction of RAR (27-29). Our observation that COUP-TF expression is required for RAR induction by RA implies that COUP-TF is also involved in RA-induced growth inhibition and apoptosis signaling. This is clearly shown by our stable transfection of COUP-TFI in COUP-TF-negative MDA-MB231 cells (Fig. 2). MDA-MB231 breast cancer cells are RA resistant due to lack of RAR induction by RA (29). When COUP-TFI was stably expressed in these cells, their growth was strongly inhibited by RA (Fig. 2C). Furthermore, the cells underwent extensive apoptosis in response to RA treatment (Fig. 2D). The observation that RAR was strongly induced in the COUP-TFI stable clones (Fig. 2B) suggests that the observed growth inhibition and apoptosis induction are likely mediated by the induced RAR expression. The involvement of COUP-TF in the regulation of RA-dependent growth inhibition and apoptosis induction is further supported by our stable expression of COUP-TFI antisense RNA in COUP-TF-positive J82 bladder cancer cells (Fig. 3). Expression of COUP-TFI antisense RNA in this RA-sensitive cell line dramatically reduced the ability of RA to induce growth inhibition (Fig. 3C) and apoptosis of the cells (Fig. 3D), which was accompanied by a reduced level of RAR expression (Fig. 3B). Together, our results demonstrate that COUP-TF may play a critical role in the regulation of the growth-inhibitory effect of retinoids in cancer cells.

Transactivation function of COUP-TF requires both COUP-TF-RE and RARE in the RAR promoter. By mutation analysis, we demonstrated that a DNA sequence comprising two AGGTCA-like core motifs arranged as a direct repeat with 8-bp spacing (the DR-8 element) is required for the COUP-TF effect. The DR-8 element bound strongly with COUP-TF (Fig. 7). Interestingly, the binding of COUP-TF did not repress the RAR promoter. Instead, it is essential for the transactivation function of COUP-TF. Deletion of the sequence from the RAR promoter completely abolished the effect of COUP-TF on RAR promoter activity (Fig. 6). In addition, mutations in the DR-8 element that impaired the binding of COUP-TF reduced the COUP-TF effect on the enhancement of RAR