Previous Article | Next Article 
Molecular and Cellular Biology, February 2000, p. 957-970, Vol. 20, No. 3
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Orphan Receptor COUP-TF Is Required for Induction
of Retinoic Acid Receptor
, Growth Inhibition, and Apoptosis by
Retinoic Acid in Cancer Cells
Bingzhen
Lin,
Guo-quan
Chen,
Dongmei
Xiao,
Siva Kumar
Kolluri,
Xihua
Cao,
Hong
Su, and
Xiao-kun
Zhang*
Cancer Research Center, The Burnham
Institute, La Jolla, California 92037
Received 31 August 1999/Returned for modification 1 October
1999/Accepted 5 November 1999
 |
ABSTRACT |
Retinoic acid receptor
(RAR
) plays a critical role in
mediating the anticancer effects of retinoids. Expression of RAR
is
highly induced by retinoic acid (RA) through a RA response element
(
RARE) that is activated by heterodimers of RARs and retinoid X
receptors (RXRs). However, RAR
induction is often lost in cancer
cells despite expression of RARs and RXRs. In this study, we provide
evidence that orphan receptor COUP-TF is required for induction of
RAR
expression, growth inhibition, and apoptosis by RA in cancer
cells. Expression of COUP-TF correlates with RAR
induction in a
variety of cancer cell lines. In addition, stable expression of COUP-TF
in COUP-TF-negative cancer cells restores induction of RAR
expression, growth inhibition, and apoptosis by RA, whereas inhibition
of COUP-TF by expression of COUP-TF antisense RNA represses the RA
effects. In a transient transfection assay, COUP-TF strongly induced
transcriptional activity of the RAR
promoter in a RA- and
RAR
-dependent manner. By mutation analysis, we demonstrate that the
effect of COUP-TF requires its binding to a DR-8 element present in the
RAR
promoter. The binding of COUP-TF to the DR-8 element
synergistically increases the RA-dependent RAR
transactivation
function by enhancing the interaction of RAR
with its coactivator
CREB binding protein. These results demonstrate that COUP-TF, by
serving as an accessory protein for RAR
to induce RAR
expression,
plays a critical role in regulating the anticancer activities of retinoids.
 |
INTRODUCTION |
Retinoids, a class of natural and
synthetic vitamin A analogs, exert profound effects on many biological
processes, including cell proliferation and differentiation, vision,
reproduction, morphogenesis, and pattern formation, both in normal and
transformed cells (9, 30). They have been well recognized as
promising agents for the prevention of human cancers (9, 13, 30, 58). Their therapeutic potential has also received a great amount of attention, since all-trans-retinoic acid (RA) showed
dramatic antitumor effects in patients with acute promyelocytic
leukemia (58). However, retinoid resistance associated with
many different types of cancer has prevented the further application of
retinoids (13, 58).
The effects of retinoids are mainly mediated by two classes of nuclear
receptors, the RA receptors (RARs) and retinoid X receptors (RXRs)
(18, 34, 67). 9-cis-RA is a high-affinity ligand for both RARs and RXRs, whereas all-trans-RA is a ligand for
only RARs. RARs and RXRs are encoded by three distinct genes (
,
, and
) and are members of the steroid/thyroid hormone receptor superfamily, which function as ligand-activated transcription factors
(18, 34, 67). RARs and RXRs primarily function as RXR-RAR
heterodimers that bind to a variety of RA response elements (RAREs) and
regulate their transactivation function (18, 34, 67).
Transcriptional activation by retinoid receptors requires a
carboxy-terminal helical region, termed activation function-2, that
forms part of the ligand-binding pocket and that undergoes a
conformational change required for the recruitment of coactivator proteins, such as CREB binding protein (CBP) (17). This
appears to provide a direct link to the core transcriptional machinery and modulates chromatin structure (62).
In addition to retinoid receptors, a number of orphan receptors whose
ligands are unknown have been implicated in the regulation of the
retinoid response (25, 47). One of the factors is COUP-TF. COUP-TF is encoded by two distinct genes, COUP-TFI (ear-3) (36, 56) and COUP-TFII (ARP-1) (22). Both genes show an
exceptionally high degree of homology, and their expression patterns
often overlap, suggesting that they may serve redundant functions
(47). However, each factor possesses its own distinct
expression profile during development (47). A null mutation
of COUP-TFI resulted in defects in neurogenesis, axon guidance, and
arborization (46), whereas deletion of COUP-TFII resulted in
striking defects in angiogenesis, vascular remodeling, and fetal heart
development (41). COUP-TF was originally shown to stimulate
gene transcription (40). However, subsequent work has
demonstrated that COUP-TF can repress the transcription induced by a
number of nuclear receptors including RARs, thyroid hormone receptors,
and vitamin D receptor (3, 20, 24, 53, 59). It has been
recently reported that COUP-TFs can function as positive regulators for
many different genes. In the arrestin gene promoter, a DR-7 element
mediates the positive transcriptional effect of COUP-TF
(32), while in the other genes, such as the trout estrogen
receptor (23), the phosphoenolpyruvate carboxykinase
(10), the vHNF1 (45), the human immunodeficiency virus long terminal repeat (49), and the NGFI-A
(44) genes, the positive-transcription function of COUP-TF
is mediated through its interaction with other transcriptional factors.
For the NGFI-A gene, COUP-TF enhances transcription by recruiting
coactivator SRC-1 through its interaction with SP-1 (44).
Retinoids exert their anticancer activities mainly through their
abilities to modulate the growth, differentiation, and apoptosis of
cancer cells. Recent studies have indicated that RAR
plays a
critical role in mediating the growth-inhibitory effect of retinoids in
many different types of cancer cells, including those of breast cancer
(27, 29), lung cancer (28), ovarian cancer
(42), prostate cancer (2), neuroblastoma
(6), renal cell carcinoma (11), pancreatic cancer
(16), liver cancer (26), and head and neck cancer
(70). Expression of RAR
in RAR
-negative cancer cells restored
RA-induced growth inhibition and apoptosis, whereas inhibition of
RAR
expression in RAR
-positive cancer cells abolished RA effects
(27-29). In addition, transgenic mice expressing RAR
antisense sequences showed increased incidence of lung tumor
(1), whereas suppression of RAR
expression was
responsible for diminished anticancer activities of retinoids in
animals (57). Moreover, up-regulation of RAR
is
associated with a positive clinical response to retinoids in patients
with premalignant oral lesions (31, 50).
The finding that a deletion of the short arm of chromosome 3p24, close
to where the RAR
gene maps, occurs with high frequency in human
tumors (21, 38) led to studies on abnormalities of the
RAR
gene and its expression. These studies revealed a high frequency
of abnormal expression of the RAR
gene, but not of genes of the
other RAR subtypes, in human cancer cell lines and primary human cancer
tissues (8, 14, 15, 39, 55, 68, 69). Thus, the loss of
RAR
may be a key mechanism by which cancer cells escape normal
growth control and a contributing factor in cancer development
(35, 63). Indeed, it has been shown that loss of RAR
is
an early event in carcinogenesis (43, 60, 63, 64) and may be
involved in liver cancer development (4).
How RAR
expression is regulated and how its expression is lost in
cancer cells remain largely unknown and are subjects of intensive
study. Expression of RAR
is highly induced by RA through a RARE
(
RARE) present in its promoter (5, 12, 51) that is
activated by RAR-RXR heterodimers (54, 65). However, we and
others have recently demonstrated that expression of RARs and RXRs is
not sufficient to render RAR
expression responsive to RA (19,
37, 55, 68). In the majority of lung cancer cell lines, RAR
expression could not be induced by RA, despite expression of RARs and
RXRs (68). Similarly, retinoid refractoriness occurs during
lung carcinogenesis despite the expression of functional retinoid
receptors (19). Thus, factors other than RARs and RXRs are
required for RA to induce RAR
expression.
We have previously demonstrated that expression of COUP-TF is
positively correlated with RAR
induction and growth inhibition by RA
in lung cancer cell lines (61). In this study, we further investigated the effect of COUP-TF in the regulation of RA-dependent RAR
induction and the underlying molecular mechanism. Our results demonstrate that COUP-TF is required for RA to induce RAR
expression, growth inhibition, and apoptosis in cancer cells. In
addition, our studies showed that COUP-TF could strongly induce
transcriptional activity of the RAR
promoter in a RA- and
RAR
-dependent manner through its binding to a DR-8 element present
in the promoter. Furthermore, we observed that COUP-TF, through its
interaction with RAR
, strongly enhanced the interaction of RAR
with its coactivator CBP, demonstrating that COUP-TF induces RAR
promoter transcription by acting as an accessory protein for RAR
to
recruit its coactivator.
 |
MATERIALS AND METHODS |
Cell culture.
CV-1, HeLa, MDA-MB231, and MDA-MB468 cells
were grown in Dulbecco modified Eagle medium supplemented with 10%
fetal calf serum (FCS). Calu-6, HT-1376, J82, SK-MES-1, and 5637 cells
were maintained in minimal essential medium supplemented with 10% FCS.
H292, H520, H460, H596, H441, and H661 cells were grown in RPMI 1640 supplemented with 10% FCS. A-549 cells were maintained in F12 medium
supplemented with 10% FCS.
Plasmid constructions.
The RAR
promoter reporter
(
745RAR
CAT) has been described previously (12). The
coding sequence of RAR
was inserted into the multiple cloning sites
of the eukaryotic expression vector pECE (65). The insertion
of COUP-TFI cDNA into pRC/CMV vector (Invitrogen, San Diego, Calif.) in
sense and antisense orientations followed the procedure described
previously (29). The RAR
promoter deletion mutants were
created by cloning BamHI-flanked PCR products derived from
745RAR
promoter into the pBluescript chloramphenicol acetyltransferase (CAT) plasmid (12). The forward primers
were as follows: for the
516RAR
promoter,
CATGGATCCTAGCCATTCTCGTTCTACAGT; for the
300RAR
promoter, CATGGATCCAGAAGTTGGTGCTCAACGTGA; for the
126RAR
promoter, CATGGATCCAGCTCTGTGAGAATCCTGGG. The
oligonucleotide CATGGATCCTACCCCGACGGTGCCCAGA was used as the
reverse primer for the above mutants. The
60RAR
promoter mutant
was constructed by subcloning a
SmaI/BamHI-flanked fragment from the RAR
promoter into the pBluescript CAT plasmid. The COUP-TF-RE and
RARE
mutant constructs were generated by ligating the mutated RAR
promoter PCR products into the pBluescript CAT vector. The following
primers were used to incorporate the appropriate mutations:
TCCCCCGGGCTGCTAACCTTCAAATGACCCAAGTGACATCACCAA for COUP-TF-RE/M1,
TCCCCCGGGCTGCTAACCTTCAAATGACCCAACTAGTCGAGCATCACCAA for
COUP-TF-RE/M2, TCCCCCGGGTAGAACTCACCGAAAGTTCAC for
RARE/M1, and TCCCGGGTAGGGTTCACCGAGTTCAC for
RARE/M2.
The COUP-TF-RE-tk-CAT reporter was obtained by inserting the DR-8
synthetic oligonucleotide into the BamHI site of
pBL-CAT2 (65). For COUP-TFII receptor mutations,
pBSCOUP-TFII deletion mutants were obtained by cloning PCR products
from COUP-TFII into pBluescript (Stratagene). The oligonucleotide
CATCGAGTGCGTGAGACGGGAAGCGGTG was used as the forward primer, while the reverse primers were as follows:
GCCATGTCGACTCAGTTAAAACTGCTGCC for pBS-COUP-TFII/
7,
TGCTGGTCGACTATAACATATCCCGGATG for pBS-COUP-TFII/
14, and
ACCTGTCGACTAGACGAAAAACAATTGC for pBS COUP-TFII/
30.
pBS-COUP-TFII/
80 was obtained by digesting pBS-COUP-TFII with
HindIII, whereas pBS-COUP-TFII/
108 was obtained by
digesting pBS-COUP-TFII with HindII.
pBS-COUP-TFII/
179 was generated by subcloning an
EcoRI/PstI COUP-TFII fragment into
EcoRI/PstI-digested pBluescript. The orientations and sequences of all mutants were confirmed by DNA sequencing. To
generate COUP-TFII
DBD, the N terminus coding sequence of COUP-TFII was amplified by PCR with a primer (CCGCTTCCCGTCTCACGCACTCGATGTG) corresponding to COUP-TFII cDNA sequences that preceded the DNA binding domain, whereas the C terminus coding sequence of COUP-TFII was
amplified with a primer (CATCGAGTGCGTGAGACGGGAAGCGGTG)
corresponding to COUP-TFII cDNA sequences right after the DNA
binding domain. The resulting PCR products were then ligated to
generate a COUP-TFII mutant with the DNA binding domain deleted. The
COUP-TFII cDNA deletion mutants were also cloned into
pCDNA3 (Invitrogen) for a transient transfection assay.
Preparation of COUP-TF proteins.
Receptor proteins for
COUP-TFI and COUP-TFII were synthesized by an in vitro transcription
and translation system using rabbit reticulocyte lysate (Promega) as
described previously (65). The relative amounts of the
translated proteins were determined by using
[35S]methionine-labeled protein in sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), quantitating the
amount of incorporated radioactivity and normalizing it relative to the
content of methionine in each protein.
Transient and stable transfection assay.
CV-1 cells were
plated at 105 cells per well in a 24-well plate 16 to
24 h before transfection, as described previously (66). For cancer cells, 5 × 105 cells were seeded in a
six-well plate. A modified calcium phosphate precipitation procedure
was used for transient transfection and is described elsewhere
(66). Briefly, 700 ng of reporter plasmid, 100 ng of
-galactosidase (
-Gal) expression vector (pCH 110; Pharmacia), and
various amounts of COUP-TF expression vector and RAR
were mixed with
carrier DNA (pBluescript) to 1,000 ng of total DNA per well. CAT
activity was normalized for transfection efficiency to the
corresponding
-Gal activity. For stable transfection, the
pRc/CMV-COUP-TFI recombinant plasmid was stably transfected into
MDA-MB231 cells, and pRC/CMV-antisense-COUP-TFI was stably transfected
into J82 cells by the calcium phosphate precipitation method, and
stable clones were screened with G418 (GIBCO BRL, Grand Island, N.Y.)
as described previously (29). Southern blotting and Northern
blotting were used to determine the integration and expression of
transfected cDNA, respectively.
Gel retardation assay.
Oligonucleotides used for the gel
retardation assay are described in the text. For the protein-DNA
binding assay, in vitro-translated protein (1 to 4 µl, depending on
the translation efficiency) was incubated with the
32P-labeled oligonucleotides in a 20-µl reaction mixture
containing 10 mM HEPES buffer, pH 7.9, 50 mM KCl, 1 mM dithiothreitol,
2.5 mM MgCl2, 10% glycerol, and 1 µg of poly(dI-dC) at
25°C for 20 min. Unprogrammed reticulocyte lysate was used to
maintain equal protein concentrations in all reaction mixtures. Each
reaction mixture was then loaded on a 5% nondenaturing polyacrylamide
gel containing 0.5× TBE (1× TBE is 0.089 M Tris-borate, 0.088 M boric acid, and 0.002 M EDTA).
GST pull-down assay.
To prepare the glutathione
S-transferase (GST)-receptor fusion protein, the receptor
cDNA (COUP-TFI or RAR
) was cloned in frame into the expression
vector pGEX-2T (Pharmacia). The fusion protein was expressed in
bacteria by the procedure provided by the manufacturer and was analyzed
by a gel retardation assay and Western blotting (data not shown). To
analyze the interaction between RAR
and COUP-TFI and between
COUP-TFI and CBP, the fusion protein was immobilized to
glutathione-Sepharose beads. For a control, the vector protein (GST),
prepared under the same conditions, was also immobilized. The beads
were preincubated with bovine serum albumin (1 mg/ml) at room
temperature for 5 min. 35S-labeled, in vitro-synthesized
receptor proteins (2 to 5 µl, depending on translation efficiency)
were then added to the beads. The beads were then continuously rocked
for 1 h at 4°C in a final volume of 200 µl in EBC buffer (140 mM NaCl, 0.5% NP-40, 100 mM NaF, 200 µM sodium orthovanadate, and 50 mM Tris, pH 8.0). After being washed five times with NETN buffer (100 mM NaCl, 1 mM EDTA, 20 mM Tris [pH 8.0], 0.5% NP-40), the bound
proteins were analyzed by SDS-PAGE.
Growth inhibition assays.
To determine the effect of
all-trans-RA on the viability of the stable transfectants,
cells were seeded at 1,000 per well in a 96-well plate and treated with
various concentrations of all-trans-RA for 6 days. Media
were changed every 48 h. The number of viable cells was determined
by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assay as
described previously (29). For the anchorage-independent growth assay, 30,000 cells/60-mm-diameter dish in culture medium containing 10% FCS, 0.3% agar (Difco, Detroit, Mich.), and
10
7 M RA were plated onto an already-hardened 0.6% agar
underlayer in medium supplemented with 10% FCS. The plates were
incubated for 21 days in a 5% CO2 incubator. Colonies with
more than 40 cells were counted with a microscope.
Apoptosis assay.
Cells were treated with or without
all-trans-RA (10
6 M). Forty-eight hours later,
cells were trypsinized, washed with phosphate-buffered saline (PBS; pH
7.4), and fixed in 1% formaldehyde in PBS. After being washed in PBS,
cells were resuspended in 70% ice-cold ethyl alcohol and immediately
stored at
20°C overnight. Cells were then labeled with
biotin-16-dUTP by terminal deoxynucleotidyltransferase (TdT) and
stained with avidin-fluorescein isothiocyanate (Boehringer, Mannheim,
Germany). Fluorescently labeled cells were analyzed with a
FACScater-plus as described previously (29). Representative histograms are shown.
Northern blotting.
For Northern blot analysis, total RNAs
were prepared with an RNeasy Mini Kit (Qiagen, Hilden, Germany). Thirty
micrograms of total RNA from different cell lines treated with or
without all-trans-RA (10
6 M) was analyzed by
Northern blotting. An EcoRI fragment in the ligand binding
domain of RAR
or a PstI fragment in the ligand binding
domain of COUP-TFI cDNA was used as a probe to study the expression of
RAR
or COUP-TFII, respectively. The PstI fragment could
detect the expression of COUP-TFI and COUP-TFII due to the high degree
of homology of both receptor genes in the region. To determine that
equal amounts of RNA were used, the expression of
-actin was studied.
 |
RESULTS |
Correlation between COUP-TF expression and RAR
induction by
RA.
We recently showed that expression of COUP-TF is required for
RA sensitivity in certain lung cancer cell lines (61). To examine to what degree COUP-TF is involved in the regulation of RAR
expression, we analyzed the expression of COUP-TF in various cancer
cell lines, including breast cancer cell lines ZR-75-1, MDA-MB468,
MDA-MB231, and T-47D, bladder cancer cell lines J82, HT-1376, 5637, and
SCaBER, and lung cancer cell lines H520, H292, Calu-6, H460, H596,
A-549, H441, SK-MES-1, and H661. A PstI fragment in the
ligand binding domain of COUP-TF was used as a probe. The probe could
detect transcripts for COUP-TFI and COUP-TFII. When the expression of
COUP-TFs was compared with RA-induced RAR
expression, we found a
perfect correlation between COUP-TFI expression and the ability of RA
to induce RAR
in breast cancer cell lines (Fig. 1). COUP-TFI was expressed in ZR-75-1 and
T-47D cell lines, in which RAR
expression was highly induced by RA.
In contrast, COUP-TF transcripts were not detected in MDA-MB468 and
MDA-MB231 cell lines that did not show a clear induction of RAR
by
RA. In bladder cancer cell lines, RAR
was highly induced by RA in
COUP-TFI-positive J82 cells but not in COUP-TFI-negative 5637 and
SCaBER cells. Although HT-1376 cells expressed COUP-TFI, we did not
observe any RAR
expression. This is due to lack of RAR
expression
in these cells (see Discussion). A correlation was also observed in
lung cancer cell lines, except SK-MES-1 and H661 lines. COUP-TFI and
COUP-TFII were highly expressed in RAR
-inducible cell lines Calu-6,
H460, and H596 but not in RAR
-noninducible H520, H292, A549, and
H441 cell lines. These observations suggest that expression of COUP-TF
may be required for RA to induce RAR
expression in different types
of cancer cells.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
Correlation between COUP-TF expression and RAR
induction by RA in human breast cancer (A), bladder cancer (B), and
lung cancer (C) lines. Total RNAs were prepared from the indicated
cancer cell lines treated with or without all-trans-RA
(10 6 M) for 24 h and analyzed for the expression of
COUP-TFI and RAR . For a control, the expression of -actin is
shown.
|
|
Levels of COUP-TFI expression modulate RA-dependent RAR
expression, growth inhibition, and apoptosis.
To further determine
the requirement of COUP-TF for RA-dependent activation of RAR
gene
expression, we stably expressed COUP-TFI in COUP-TF-negative MDA-MB231
breast cancer cells. Two stable clones (MB231/COUP#10 and
MB231/COUP#16) that expressed a high level of transfected COUP-TFI
(Fig. 2A) were subjected to an analysis of RAR
gene expression in the absence or presence of RA. Under the
conditions used, we did not detect any expression of the RAR
transcript in the parental MDA-MB231 cells in either the absence or
presence of RA (Fig. 2B), consistent with our previous observation (29). However, RA treatment strongly induced RAR
expression in the COUP-TFI-stable clones, not in the MDA-MB231 cells
transfected with the empty vector (MB231/vector) (Fig. 2B). This
suggests that expression of COUP-TFI confers on MDA-MB231 cells
sensitivity to RA regulation of RAR
expression. When the effect of
the stable transfection of COUP-TFI on growth of MDA-MB231 cells was
analyzed, we observed that RA, which was unable to regulate the growth
of the parental MDA-MB231 cells, could strongly inhibit the growth of
the clones carrying stably transfected COUP-TFI, with about 41 and 54%
inhibition in MB231/COUP#16 and MB231/COUP#10 cells, respectively, when
they were treated with 10
6 M RA for 6 days (Fig. 2C). The
growth-inhibitory effect of RA is specific to COUP-TFI expression since
RA had no effect on the growth of MB231/vector cells. We also examined
the effect of COUP-TFI expression on apoptosis induction by RA. The TdT
assay showed extensive DNA fragmentation in MB231/COUP#10 and
MB231/COUP#16 cells but not in MDA-MB231 and MB231/vector cells. About
2% apoptotic cells were detected in cultures of MDA-MB231 and
MB231/vector cells when they were treated with 10
6 M RA
for 2 days. However, the same RA treatment resulted in about 36 and
24% apoptotic cells in cultures of MB231/COUP#10 and MB231/COUP#16 cells, respectively (Fig. 2D), suggesting that expression of COUP-TFI could allow RA to induce apoptosis of MDA-MB231 cells. Thus, expression of COUP-TFI in COUP-TF-negative cancer cells can restore their response
to RA effects on RAR
expression, growth inhibition, and apoptosis.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Stable expression of COUP-TF in COUP-TF-negative,
RA-resistant MDA-MB231 cells enhances the effect of RA on RAR
induction, growth inhibition, and apoptosis induction. (A) Expression
of transfected COUP-TFI in MDA-MB231 cells. COUP-TFI was stably
transfected into MDA-MB231 cells, and expression of transfected
COUP-TFI was determined by Northern blotting. For comparison, cells
transfected with the empty vector (MB231/vector) were used. (B)
Expression of RAR gene in MDA-MB231 cells and MDA-MB231/COUP-TF
stable clones. Total RNAs were prepared from MDA-MB231, its COUP-TFI
stable clones (MB231/COUP#16 and MB231/COUP#10), and MDA-MB231
transfected with the empty vector (MB231/vector). Cells were treated
with or without all-trans-RA (10 6 M) for
24 h and analyzed for the expression of RAR by Northern
blotting. In the control, the expression of -actin is shown. (C)
Growth-inhibitory effect of RA in MDA-MB231 and MDA-MB231/COUP-TF
stable clones. Cells were seeded at 1,000 cells per well in a 96-well
plate and treated with the indicated concentrations of
all-trans-RA for 6 days. The numbers of viable cells were
determined by the MTT assay. (D) Effect of RA on apoptosis of MDA-MB231
cells and MDA-MB231/COUP-TF stable clones. Cells were treated with or
without all-trans-RA (10 6 M) for 48 h,
and DNA fragmentations were then determined by the TdT assay.
Representative histograms show relative apoptotic cell numbers.
|
|
To further study the role of COUP-TF, we stably expressed COUP-TFI
antisense cDNA in COUP-TF-positive J82 bladder cancer cells. A stable
clone that expressed a high level of COUP-TFI antisense RNA
(J82/A-COUP) (Fig. 3A) was analyzed for
the effect of RA on RAR
expression (Fig. 3B), growth inhibition
(Fig. 3C), and apoptosis induction (Fig. 3D). RAR
expression was
highly induced by RA in J82 cells. However, the ability of RA to induce
RAR
expression was significantly reduced in J82/A-COUP cells but not
in J82 cells expressing the empty vector (J82/vector) (Fig. 3B). Thus,
inhibition of COUP-TF expression reduced the ability of RA to induce
RAR
expression. When the effect of RA on growth inhibition was
analyzed, we observed that RA could effectively inhibit the growth of
J82 cells, with 55% inhibition when they were treated with
10
6 M RA for 6 days. A similar growth-inhibitory effect
of RA (46% inhibition) was also observed in J82/vector cells. However,
the effect of RA was dramatically reduced in J82/A-COUP cells, with only 12% inhibition upon RA treatment (Fig. 3C). Consistent with the
role of RAR
in apoptosis induction, we observed that RA strongly induced apoptosis of J82 and J82/vector cells, with 43.8 and 36.2% apoptotic cells, respectively, as determined by the TdT assay (Fig.
3D). However, the apoptosis-inducing effect of RA was significantly repressed by COUP-TFI antisense RNA expression, as only 13.8% apoptotic cells were detected among J82/A-COUP cells. Together, these
data demonstrate that inhibition of COUP-TFI expression by COUP-TFI
antisense RNA represses the ability of RA to induce RAR
expression,
growth inhibition, and apoptosis in COUP-TF-positive cancer cells.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Inhibition of COUP-TF expression by stable expression of
COUP-TF anti-sense RNA in COUP-TF-positive J82 cells represses effect
of RA on RAR expression, growth inhibition, and apoptosis induction.
(A) Expression of transfected COUP-TFI antisense RNA in J82 cells.
COUP-TFI cDNA was stably transfected into J82 cells, and expression of
transfected COUP-TFI antisense RNA in a selected stable clone
(J82/A-COUP) was analyzed by Northern blotting. For comparison, the
parental J82 cells and J82 cells stably transfected with the empty
vector (J82/vector) were used. (B) Inhibition of RAR induction by RA
by stable expression of COUP-TFI antisense RNA in J82 cells. Total RNAs
were prepared from J82, J82/vector, and J82/A-COUP cells treated with
or without all-trans-RA (10 6 M) for 24 h
and analyzed for the expression of RAR by Northern blotting. The
expression of -actin is shown for the control. (C) Inhibition of
RA-induced growth inhibition by stable expression of COUP-TF antisense
RNA in J82 cells. Cells were seeded at 1,000 cells per well in a
96-well plate and treated with the indicated concentrations of
all-trans-RA for 6 days. The numbers of viable cells were
determined by the MTT assay. (D) Inhibition of RA-induced apoptosis of
J82 cells by COUP-TF antisense RNA. Cells were treated with or without
all-trans-RA (10 6 M) for 48 h, and DNA
fragmentations were then determined by the TdT assay. Representative
histograms show relative apoptotic cell numbers.
|
|
To further characterize the effect of the transfected COUP-TFI gene,
the COUP-TFI-transfected MDA-MB231 cells were analyzed for their
anchorage-independent growth in soft agar. As shown in Fig.
4, the growth of MDA-MB231 and
MB231/vector cells in soft agar was not clearly affected by RA
treatment. However, RA dramatically inhibited the growth of
MB231/COUP#10 and MB231/COUP#16 cells. These data suggest that
expression of COUP-TFI could confer on RA the ability to inhibit the
transforming activity of cancer cells.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of anchorage-independent growth of MDA-MB231
cells by COUP-TF gene expression. (A) Visualization of colonies formed
in the soft agar by parental MDA-MB231, MB231/COUP#10, MB231/COUP#16,
and MB231/vector cells in the presence or absence of RA
(10 7 M). (B) Quantitation of colonies formed by parental
MDA-MB231, MB231/COUP#10, MB231/COUP#16, and MB231/vector cells.
Colonies formed by MB231/COUP#10, MB231/COUP#16, MB231/vector, and
parental MDA-MB231 cells in the presence or absence of
all-trans-RA (10 7 M) were scored and expressed
as percentages of colonies formed by cells treated with control
solvent.
|
|
COUP-TF enhances RAR
promoter activity in a RAR
- and
RA-dependent manner.
To investigate the possibility that COUP-TFI
induced RAR
expression by activating RAR
promoter transcription,
a reporter construct that contains the RAR
promoter sequences from
745 to +162 linked to the CAT reporter gene (
745RAR
CAT)
(12) was transiently transfected into CV-1 cells.
Cotransfection of the RAR
expression vector induced RAR
promoter
activity in response to RA (Fig. 5A),
while cotransfection of the COUP-TFII expression vector slightly
enhanced the reporter gene activity. However, when both COUP-TFII and
RAR
were cotransfected, a synergistic induction of RAR
promoter
activity in response to RA was observed. Induction of RAR
promoter
activity by RAR
was enhanced from 16-fold to 44-fold when 20 ng of
COUP-TFII was cotransfected, while a 56-fold induction was observed
when 50 ng of COUP-TFII was cotransfected. A similar observation was
also made with COUP-TFI (data not shown). We also investigated the
effect of COUP-TFII in HT-1376 bladder cancer cells, which express a
low level of COUP-TF (Fig. 1) and an undetectable level of RAR
(our
unpublished result). Cotransfection of the RAR
expression vector
slightly induced RAR
promoter activity in response to RA in these
cells, while cotransfection of COUP-TFII did not show any effect on
RAR
promoter activity (Fig. 5B). The lack of COUP-TFII activity is likely due to loss of RAR
expression in these cells (see
Discussion). When COUP-TFII was cotransfected with RAR
, the
RAR
-induced RAR
activity was strongly increased, compared to a
5-fold induction of RAR
promoter activity by RAR
alone and a
24-fold induction when both RAR
and COUP-TFII were present. Similar
results were also obtained when COUP-TFI was used and in other cancer
cell lines, such as HeLa cells and MDA-MB231 cells (data not shown). Together, our data demonstrate that expression of COUP-TF is required for efficient induction of RAR
promoter activity by RA in a
RAR
-dependent manner.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
COUP-TF enhances RAR promoter activity in a RAR -
and RA-dependent manner. (A) Activation of RAR promoter activity by
COUP-TF in CV-1 cells. RAR promoter reporter ( 745RAR CAT; 700 ng) was cotransfected with the indicated amounts of expression vector
for COUP-TFII and RAR into CV-1 cells. Cells were treated with or
without all-trans-RA (10 6 M) for 24 h and
assayed for CAT activity. (B) Activation of RAR promoter in HT-1376
bladder cancer cells by COUP-TF. Cells were transfected with 1,500 ng
of 745RAR CAT reporter gene together with expression vectors for
RAR (300 ng) and/or COUP-TFII (300 ng). Cells were treated with or
without all-trans-RA (10 6 M) and 24 h
later were assayed for CAT activity. Data shown represent the means of
three independent experiments.
|
|
A DR-8 element in the RAR
promoter mediates the COUP-TF
effect.
To identify DNA sequences responsible for the COUP-TF
effect in the RAR
promoter, we generated a series of 5' deletion
mutants of the RAR
promoter (Fig. 6A).
The resulting RAR
promoter fragments were fused to the CAT reporter
gene and analyzed for the effect of COUP-TFII in enhancing RA-induced
RAR
activity in CV-1 cells (Fig. 6B). Deletion of 229 bp from the 5'
end of the RAR
promoter (
516RAR
CAT) did not have any effect on
the ability of COUP-TFII to enhance RAR
activity. Recently, it was
shown that COUP-TF could positively regulate gene transcription through
an SP-1 site (44, 49). There is an SP-1 site (from
378 to
370) in the RAR
promoter that could bind the SP-1 protein (data
not shown). However, COUP-TFII retained its ability to induce RAR
activity in
300RAR
CAT and
126RAR
CAT reporters in spite of
deletion of the SP-1 binding site. This suggests that the effect of
COUP-TFII on the RAR
promoter is not mediated through the SP-1
binding site. Further deletion of 66 bp from
126RAR
CAT, however,
completely abolished the COUP-TFII effect (Fig. 6B). This suggests that
position
126 to
60 of the RAR
promoter contains a COUP-TF
response element (COUP-TF-RE). Inspection of the fragment between
positions
126 and
60 revealed a direct repeat of AGGTCA-like motifs
with 8-bp spacing (DR-8) located from
99 to
78 (Fig.
7A). COUP-TF is known to bind to a
variety of nuclear receptor response elements containing AGGTCA-like
motifs arranged in different orientations with different spacings
(53). We therefore examined whether the DR-8 element in the
RAR
promoter could bind to COUP-TF. An oligonucleotide containing
the sequence was synthesized and analyzed by gel retardation assay for
its COUP-TF binding activity. As shown in Fig. 7B, in vitro-synthesized
COUP-TFI or COUP-TFII formed a strong complex with the sequence. For
comparison, RAR
, RXR
, or the RAR
-RXR
heterodimer did not
exhibit any binding. The complex formed by COUP-TFI could be abolished
by a 50-fold-excess amount of TREpal or CRBPII-RARE, which are known to
bind with high affinity to COUP-TFs (53), while the same
amount of SP-1 oligonucleotide did not show any effect on the binding.
Thus, COUP-TF may exert its effect on the RAR
promoter through its
binding to the DR-8 element.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
Identification of COUP-TF response element in the RAR
promoter. (A) Schematic representation of the RAR promoter deletion
mutants. The Sp-1 binding site, RARE, and the TATA box are
indicated. (B) Effect of COUP-TFII on RA-induced RAR transactivation
activity of various RAR promoter deletion mutants. CV-1 cells were
transfected with 700 ng of CAT reporter gene containing the indicated
RAR promoter fragment together with expression vectors for COUP-TFII
(50 ng) and RAR (20 ng). Cells were then treated with or without
all-trans-RA (10 6 M) and 24 h later were
assayed for CAT activity. , without receptor cotransfection. Data
shown represent the means of three independent experiments.
|
|

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 7.
Analysis of COUP-TF binding on the COUP-TF-RE in the
RAR promoter. (A) Sequence of the COUP-TF-RE. Arrows indicate the
AGGTCA-like core motifs. (B) Binding of COUP-TF on the COUP-TF-RE. In
vitro-synthesized COUP-TFI or COUP-TFII was incubated with
32P-labeled oligonucleotide containing the COUP-TF-RE and
analyzed by a gel retardation assay. For comparison, the binding of
RAR , RXR , and the RAR -RXR heterodimer was analyzed. For the
competition assay, a 50-fold excess amount of the indicated
oligonucleotide was used. , without competitor; solid arrowheads,
specific COUP-TF binding complex; open arrowheads, nonspecific binding
complex.
|
|
To study the role of the COUP-TF binding sequence, we investigated the
effect of COUP-TF-RE mutations on COUP-TF activity in a RAR
promoter. The COUP-TF-RE was mutated by changing either the spacing
between two core motifs (COUP-TF-RE/M1) or the core motif sequences
(COUP-TF-RE/M2) (Fig. 8A). The mutated
COUP-TF-REs were first analyzed for their binding to COUP-TF proteins.
Unlike their binding to the wild-type COUP-TF-RE, the binding of
COUP-TFI or COUP-TFII to the mutated COUP-TF-REs was largely impaired
(Fig. 8B). We then introduced the same mutations into the
745RAR
CAT reporter by PCR. The resulting RAR
promoter reporter
mutants,
745RAR
/COUP-TF-RE/M1/CAT and
745RAR
/COUP-TF-RE/M2/CAT, were then analyzed by transient
transfection assay for the effect of COUP-TF-RE mutations on COUP-TFII
activity. As shown in Fig. 8C, mutations of COUP-TF-RE did not affect
the ability of RAR
to induce reporter transcription since
cotransfection of RAR
showed similar degrees of induction of
transcription of both the mutated RAR
promoter and the wild-type
promoter (compare with Fig. 5). However, the enhancing effect of
COUP-TFII on RAR
activity was largely reduced in the mutated RAR
promoter reporters. These results demonstrate that the DR-8 element is
required for COUP-TF to enhance RA- and RAR
-dependent activation of
RAR
promoter transcription.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 8.
COUP-TF-RE is required for positive regulation of RAR
promoter activity by COUP-TF. (A) Mutations of the COUP-TF-RE. Depicted
are the COUP-TF-RE sequence and its mutations (boldfaced). (B) The
mutated COUP-TF-REs failed to bind to the COUP-TF protein. The
indicated COUP-TF-RE mutant was synthesized and analyzed for its
binding to COUP-TF by the gel retardation assay. In vitro-synthesized
COUP-TF protein was incubated with 32P-labeled COUP-TF-RE
or the mutated COUP-TF-RE and analyzed by a gel retardation assay.
Solid arrowhead, specific COUP-TAF binding complex; open arrowhead,
nonspecific binding. (C) Mutations of COUP-TF-RE abolished the effect
of COUP-TF on the RAR transactivation function in the RAR
promoter. The COUP-TF-RE in the RAR promoter was mutated by PCR. The
resulting RAR promoter mutants ( 745RAR CAT/COUP-TF-RE/M1 and
745RAR CAT/COUP-TF-RE/M2) were analyzed by transient transfection
assay in CV-1 cells for their effect on COUP-TF activity. CV-1 cells
were transfected with the 700-ng reporter gene together with the
indicated amounts of expression vectors for RAR and COUP-TFII. Cells
were treated with or without all-trans-RA (10 6
M) and 24 h later were assayed for CAT activity. CAT activity was
normalized for transfection efficiency to the corresponding -Gal
activity. Data shown represent the means of three independent
experiments.
|
|
DNA binding of COUP-TF is required for its transactivation
function.
To determine which region of COUP-TF is required for the
binding of the DR-8 element and the activation of the RAR
promoter, a number of COUP-TFII mutants were generated (Fig.
9A) and analyzed for their binding to the
element (Fig. 9B) and their enhancing effect on RAR
activity in the
745RAR
CAT reporter (Fig. 9C). Deletion of seven amino acids from
the C-terminal end of the COUP-TFII protein did not affect the binding
of COUP-TF-RE (Fig. 9B). The same mutant also bound strongly to TREpal
as the wild-type receptor. However, removal of an additional seven
amino acid residues resulted in a mutant (COUP-TFII/
14) that could
not bind either to COUP-TF-RE or to TREpal. As expected, other mutants
analyzed, including COUP-TFII/
30, COUP-TFII/
80, COUP-TFII/
108,
and COUP-TFII/
179 (Fig. 9A), did not exhibit any detectable binding
on both elements (Fig. 9B). When the effect of these mutants on RAR
transactivation function in
745RAR
CAT was analyzed, we observed
that removal of as few as 14 amino acid residues from the C-terminal
end of the COUP-TFII protein completely abolished the enhancing effect
of COUP-TFII (Fig. 9C). Other C-terminal deletion mutants, which could
not bind to the DR-8 element, also failed to enhance RAR
activity (data not shown). A mutant with the DNA binding domain deleted (COUP-TF/
DBD) was also unable to enhance RAR
activity (Fig. 9C).
Thus, the DNA binding of COUP-TF is essential for its enhancing effect
on RAR
activity.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 9.
DNA binding of COUP-TF is required for its enhancing
effect on RAR activity in the RAR promoter. (A) Schematic
representation of COUP-TF mutants. The DNA binding domain and the
ligand domain of COUP-TFII as well as the A/B, C, D, and E/F domains
are indicated. (B) Binding of the COUP-TFII mutants to COUP-TF-RE and
TREpal. In vitro-synthesized COUP-TFII or the indicated COUP-TFII
deletion mutant was incubated with 32P-labeled COUP-TF-RE
or TREpal as indicated and analyzed by a gel retardation assay. The
arrowheads indicate the specific COUP-TF binding complexes. (C) Effect
of the COUP-TFII mutants on RAR activity in the RAR promoter.
CV-1 cells were transfected with 700 ng of 745RAR CAT reporter gene
together with the expression receptor for RAR (20 ng) and the
indicated amount of COUP-TFII or COUP-TFII deletion mutants. Cells were
treated with or without all-trans-RA (10 6 M)
for 24 h and were assayed for CAT activity. Data shown represent
the means of three independent experiments.
|
|
RARE is required for the DR-8 element to confer the RA- and
RAR
-dependent transactivation function of COUP-TF.
To further
determine the role of the DR-8 element in mediating the COUP-TF
transactivation function, we cloned the sequence into the
pBLCAT2 plasmid, which contains the thymidine kinase (TK)
promoter linked with the CAT reporter gene (65). The
resulting construct, COUP-TF-RE-tk-CAT, was transiently transfected
into CV-1 cells. Surprisingly, we did not see any effect of COUP-TFII on reporter transcription either in the absence or presence of RA,
indicating that the binding of COUP-TFII could not transactivate the
reporter (Fig. 10). Cotransfection of
the RAR
expression vector did not have any effect on the reporter
activity, either in the absence or presence of RA, consistent with our
gel retardation assay showing lack of RAR
binding to the DR-8
element (Fig. 7B). Furthermore, cotransfection of COUP-TFII and RAR
expression vectors failed to activate reporter transcription. These
data demonstrate that the DR-8 element alone is not sufficient to
confer the RA- and RAR
-dependent transactivation function of COUP-TF
observed in the RAR
promoter.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 10.
COUP-TF-RE alone is not sufficient to confer the
activation function of COUP-TF. COUP-TF-RE was cloned into
pBLCAT2, which contained the TK promoter linked with the
CAT gene. The resulting reporter construct (COUP-TF-RE-tk-CAT) was
analyzed for its response to the COUP-TF effect by transient
transfection assay. The reporter gene (100 ng) was cotransfected with
the indicated amounts of expression receptor for RAR and COUP-TFII
into CV-1 cells. After transfection, cells were treated with or without
all-trans-RA (10 6 M) and 24 h later were
assayed for CAT activity. Data shown represent the means of three
independent experiments.
|
|
The above data suggest that sequences other than the DR-8 element in
the RAR
promoter are required for the RA- and RAR
-dependent transactivation function of COUP-TFs. We therefore analyzed the involvement of
RARE by mutational analysis since it is the only known sequence in the RAR
promoter that mediates the RA effect (12). Two
RARE mutations were made by changing either the
core motif sequences (
RARE/M1) or the spacing between two core
motifs (
RARE/M2) (Fig. 11A). Both
RARE mutants failed to bind to RAR
, RXR
, or RAR
-RXR
heterodimers in the gel retardation assay (Fig. 11B). The RAR
promoter reporter constructs with mutated
RARE,
745RAR
CAT/
RARE/M1 and
745RAR
CAT/
RARE/M2, were then
generated by PCR and analyzed by a transient transfection assay (Fig.
11C). We first examined the effect of RAR
on the mutated RAR
promoter. Compared to that of the parental RAR
promoter
(
745RAR
CAT), the transactivation function of RAR
was
significantly reduced in the mutated RAR
promoters. Interestingly,
RAR
could still induce transcriptional activities of both RAR
promoter mutants, although its binding on the mutated
RAREs was
completely abolished (Fig. 11B). Since we did not observe any effect of
RAR
on the mutated
RAREs when they were fused to the TK promoter
(data not shown), the observed effect of RAR
is likely due to the
presence of another RARE in the RAR
promoter (our unpublished
observation). Nevertheless, when the effect of COUP-TFII on both
promoter mutants was analyzed, we did not observe any enhancement of
RAR
activity, suggesting that intact
RARE, capable of binding
with the RAR
-RXR
heterodimer, is essential for the
transactivation function of COUP-TF. Thus, both
RARE and the DR-8
element are required for the RA- and RAR
-dependent transactivational
function of COUP-TF in the RAR
promoter.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 11.
RARE in the RAR promoter is required for the
enhancing effect of COUP-TF on RAR activity in the RAR promoter.
(A) Schematic representation of the RARE mutations. Depicted are
wild-type RARE in the RAR promoter and its mutations (boldface).
Arrows indicate the care motifs of the RARE. (B) Effect of RARE
mutations on retinoid receptor binding. In vitro-synthesized RAR and
RXR were incubated with 32P-labeled RARE or the
mutated RARE and analyzed by a gel retardation assay. The arrowhead
indicates specific RAR-RXR heterodimer binding. (C) Mutations of the
RARE impair the enhancing effect of COUP-TF on RAR activity in
the RAR promoter. Mutations in the RARE of the RAR promoter
were introduced by PCR as described in Materials and Methods. The
resulting RAR promoter mutants ( 745RAR CAT/ RARE/M1 and
745RAR CAT/ RARE/M2) were analyzed by transient transfection
assay for the effect of COUP-TF. CV-1 cells were transfected with 700 ng of reporter gene together with the indicated amounts of expression
vectors for COUP-TFII and RAR . Cells were then treated with or
without all-trans-RA (10 6 M) and 24 h
later were assayed for CAT activity. Data shown represent the means of
three independent experiments.
|
|
COUP-TF enhances recruitment of CBP by RAR
.
The
transactivation function of nuclear receptors requires their
interaction with receptor coactivators (62), such as CBP (17). The transactivation function of COUP-TF could be due
to its interaction with CBP. We therefore investigated whether COUP-TFI could interact with CBP by the GST pull-down assay. Under the conditions used, we did not observe a clear interaction between COUP-TFI and CBP (Fig. 12A), consistent
with a previous report (44). This demonstrates that the
transactivation function of COUP-TFI is unlikely to be mediated through
its direct interaction with CBP. The facts that the transactivation
function of COUP-TF is RAR
and RA dependent and requires
RARE
suggest that the effect of COUP-TF may be mediated by RAR
, which is
known to interact with CBP (17). We then incubated
GST-COUP-TFI with CBP in the presence of in vitro-synthesized RAR
.
As shown in Fig. 12A, a significant amount of CBP was pulled down by
the GST-COUP-TFI fusion protein when RAR
was present. We also
determined whether COUP-TF could enhance the interaction between RAR
and CBP. As shown in Fig. 12A, CBP was slightly pulled down by the
GST-RAR
fusion protein. However, when GST-RAR
was mixed with in
vitro-synthesized COUP-TFI protein, a significant amount of CBP was
pulled down. The observation that both RAR
and COUP-TFI are required
for their maximum interaction with CBP suggests that COUP-TFI may
interact with RAR
. Indeed, in vitro-synthesized RAR
was
efficiently pulled down by GST-COUP-TFI, but not by the GST control
protein (Fig. 12B), demonstrating that COUP-TFI could directly interact
with RAR
. Thus, COUP-TF may facilitate the RAR
-CBP interaction by interacting with RAR
, resulting in a RAR
conformation favorable for CBP interaction.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 12.
COUP-TF enhances recruitment of CBP by RAR . (A)
COUP-TF enhances interaction of RAR and CBP. COUP-TFI or RAR protein
was synthesized in bacteria with pGEX-2T (Pharmacia). The GST-COUP-TFI
or GST-RAR fusion protein was immobilized on glutathione-Sepharose
beads, while the same amount of GST was also immobilized on beads as a
control. 35S-labeled CBP was then mixed with beads and in
vitro-synthesized RAR (for GST-COUP-TFI) or in vitro-synthesized
COUP-TFI (for GST-RAR ) in the presence of 10 6 M
all-trans-RA. After extensive washing, the bound proteins
were analyzed by SDS-PAGE. The input proteins are shown for comparison.
(B) COUP-TFI interacts with RAR . To analyze the interaction between
COUP-TF and RAR , 35S-labeled RAR was mixed with
GST-COUP-TFI fusion protein on beads. After extensive washing, the
bound proteins were analyzed by SDS-PAGE. As a comparison, the input
proteins are shown. (C) COUP-TF increases the effect of CBP on RAR
activity. The indicated amounts of expression vector for RAR ,
COUP-TFII, and CBP were cotransfected with RAR promoter into CV-1
cells. Cells were treated with or without all-trans-RA
(10 6 M) for 24 h and then were assayed for CAT
activity. The corresponding -Gal activity was normalized as a
control.
|
|
We next analyzed whether COUP-TF could influence the transcriptional
effect of CBP on RAR
activity in CV-1 cells. Cotransfection of the
CBP expression vector slightly enhanced RAR
transcriptional activity
in the RAR
promoter. However, when COUP-TFII and RAR
were
cotransfected, the effect of CBP on RAR
promoter activity was
greatly increased (Fig. 12C). Such an effect of COUP-TF on CBP
activity, together with our GST pull-down results, strongly suggests
that COUP-TF, through its binding to the DR-8 element and interacting
with RAR
, may function as a bridge protein to facilitate the
interaction between
RARE binding receptors and CBP, resulting in an
enhanced RA-dependent transcription of the RAR
promoter.
 |
DISCUSSION |
RAR
plays a crucial role in the mediating growth-inhibitory
effect of retinoids, and lack of its expression contributes to retinoid
resistance in many different types of cancer cells. Expression of
RAR
is induced by RA through binding of RAR-RXR heterodimers to the
RARE in the RAR
promoter. However, expression of RAR and RXR in
cancer cells is not sufficient to account for induction of RAR
by
RA. Here, we provide convincing evidence that orphan receptor COUP-TF
is required for RA to induce RAR
expression, growth inhibition, and
apoptosis in cancer cells and that loss of COUP-TF expression is the
main factor contributing to the lack of RAR
expression in cancer
cells. In addition, we show that COUP-TF synergistically increases the
RA-dependent RAR
transactivation function in the RAR
promoter
through its binding to a DR-8 element in the promoter, which enhances
the interaction of RAR
with its coactivator CBP.
Expression of COUP-TF is required for efficient RAR
induction by
RA in cancer cells.
Several lines of evidence provided in this
study demonstrate that expression of COUP-TF is required for efficient
RAR
induction by RA in cancer cells. First, expression of COUP-TF is
positively correlated with induction of RAR
by RA in breast cancer,
lung cancer, and bladder cancer cell lines (Fig. 1). A perfect
correlation was observed in breast cancer cell lines, while a close
correlation was found in lung cancer and bladder cancer cell lines.
This observation is consistent with previous studies (33, 47,
48) demonstrating that RAR
and COUP-TFII are coexpressed in
motor neurons. In addition, our stable expression of COUP-TFI in
COUP-TF-negative MDA-MB-231 breast cancer cells (Fig. 2) showed that
expression of COUP-TFI could restore the ability of RA to induce RAR
expression. Furthermore, inhibition of COUP-TF expression by stable
expression of COUP-TFI antisense RNA in COUP-TF-positive J82 cancer
cells reduced the ability of RA to induce RAR
expression (Fig. 3).
Finally, our transient transfection assays clearly demonstrated that
COUP-TF could activate the RAR
promoter in response to RA when
RAR
was expressed (Fig. 5). Thus expression of COUP-TF is required
for RA to effectively induce RAR
expression, and loss of COUP-TF in
cancer cells may be one of the important mechanisms responsible for the
lack of RAR
expression in cancer cells.
Effect of COUP-TF on growth inhibition and apoptosis induction by
RA.
RA is known to inhibit the growth of and induce apoptosis in
cancer cells, in part due to its induction of RAR
(27-29). Our observation that COUP-TF expression is
required for RAR
induction by RA implies that COUP-TF is also
involved in RA-induced growth inhibition and apoptosis signaling. This
is clearly shown by our stable transfection of COUP-TFI in
COUP-TF-negative MDA-MB231 cells (Fig. 2). MDA-MB231 breast cancer
cells are RA resistant due to lack of RAR
induction by RA
(29). When COUP-TFI was stably expressed in these cells,
their growth was strongly inhibited by RA (Fig. 2C). Furthermore, the
cells underwent extensive apoptosis in response to RA treatment
(Fig. 2D). The observation that RAR
was strongly induced in the
COUP-TFI stable clones (Fig. 2B) suggests that the observed growth
inhibition and apoptosis induction are likely mediated by the induced
RAR
expression. The involvement of COUP-TF in the regulation of
RA-dependent growth inhibition and apoptosis induction is further
supported by our stable expression of COUP-TFI antisense RNA in
COUP-TF-positive J82 bladder cancer cells (Fig. 3). Expression of
COUP-TFI antisense RNA in this RA-sensitive cell line dramatically
reduced the ability of RA to induce growth inhibition (Fig. 3C) and
apoptosis of the cells (Fig. 3D), which was accompanied by a reduced
level of RAR
expression (Fig. 3B). Together, our results demonstrate
that COUP-TF may play a critical role in the regulation of the
growth-inhibitory effect of retinoids in cancer cells.
Transactivation function of COUP-TF requires both COUP-TF-RE and
RARE in the RAR
promoter.
By mutation analysis, we
demonstrated that a DNA sequence comprising two AGGTCA-like core motifs
arranged as a direct repeat with 8-bp spacing (the DR-8 element) is
required for the COUP-TF effect. The DR-8 element bound strongly with
COUP-TF (Fig. 7). Interestingly, the binding of COUP-TF did not repress
the RAR
promoter. Instead, it is essential for the transactivation
function of COUP-TF. Deletion of the sequence from the RAR
promoter
completely abolished the effect of COUP-TF on RAR
promoter activity
(Fig. 6). In addition, mutations in the DR-8 element that impaired the binding of COUP-TF reduced the COUP-TF effect on the enhancement of
RAR