Previous Article | Next Article 
Molecular and Cellular Biology, February 2000, p. 1219-1226, Vol. 20, No. 4
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Target Specificity of the Endonuclease from the
Xenopus laevis Non-Long Terminal Repeat
Retrotransposon, Tx1L
Shawn
Christensen,
Geneviève
Pont-Kingdon,
and
Dana
Carroll*
Department of Biochemistry, University of
Utah School of Medicine, Salt Lake City, Utah 84132
Received 14 September 1999/Returned for modification 2 November
1999/Accepted 15 November 1999
 |
ABSTRACT |
Elements of the Tx1L family are non-long terminal repeat
retrotransposons (NLRs) that are dispersed in the genome of
Xenopus laevis. Essentially all genomic copies of Tx1L are
found inserted at a specific site within another family of transposable
elements (Tx1D). This suggests that Tx1L is a site-specific
retrotransposon. Like many (but not all) other NLRs, the
Xenopus element encodes an apparent endonuclease that is
related in sequence to the apurinic-apyrimidinic endonucleases that
participate in DNA repair. This enzyme is thought to introduce the
single-strand break in target DNA that initiates transposition by the
target-primed reverse transcription (TPRT) mechanism. To explore the
issue of target specificity more fully, we expressed the polypeptide
encoded by the endonuclease domain of open reading frame 2 from Tx1L
(Tx1L EN) and characterized its cleavage capabilities. This
endonuclease makes a specific nick in the bottom strand precisely at
one end of the presumed Tx1L target duplication. Because this activity
leaves a 5'-phosphate and 3'-hydroxyl at the nick, it has the location
and chemistry required to initiate new insertion events by TPRT. Tx1L
EN does not make a specific cut at a preferred target site for Tx1D
elements, ruling out the alternative possibility that the composite
Tx1L-Tx1D element moves as a unit under the control of functions
encoded by Tx1L. Further characterization revealed that the
endonuclease remains active for many hours at room temperature and that
it is capable of enzymatic turnover. Scanning substitution mutagenesis located the recognition site for Tx1L EN within 10 bp surrounding the
primary nick site. Implications of these features for natural transposition events are discussed.
| |
INTRODUCTION |
Transposons are ubiquitous mobile
genetic elements found in the genomes of most, if not all, organisms.
They can be grouped into two main categories based on sequence
organization and mode (or presumed mode) of transposition
(3). The first group of transposons consists of the
cut-and-paste elements, which move strictly through DNA intermediates.
Examples of this type of transposon include the bacterial insertion
sequences, the eukaryotic Tc1/Mariner elements, maize Ac/Ds elements,
and Drosophila P elements (8, 20, 24, 29, 32).
The second group, the retrotransposons, transpose through an RNA intermediate.
The retrotransposons can be further subdivided into two subgroups that
differ in sequence organization and mechanisms of retrotransposition. The retrovirus-like long terminal repeat (LTR) retrotransposons reverse
transcribe their RNA genome in the cytoplasm, producing a
double-stranded DNA copy with terminal direct repeats. This species is
transported to the cell nucleus, where it is integrated into
chromosomal DNA courtesy of an element-encoded integrase. Examples of
this type of retrotransposon are Ty1 and Ty3 of
Saccharomyces cerevisiae, Copia and 412 from
Drosophila, and Tf1 from Schizosaccharomyces pombe (3).
Although they also rely on reverse transcription, the non-LTR
retrotransposons (NLRs) transpose through a fundamentally different mechanism than the retrovirus-like elements (7). This
process, target-primed reverse transcription or TPRT, is diagrammed in Fig. 1 (23). Element RNA is
packaged in a cytoplasmic ribonucleoprotein particle (RNP) that
includes element-encoded proteins (14, 15, 19, 33, 38). This
RNP moves to the cell nucleus, where it finds and nicks one strand of
its DNA target (9, 10, 37). The free 3'-OH at the nick site
is used by reverse transcriptase to prime first-strand cDNA synthesis
with element RNA as the template (23). This step links the
element DNA to the target as an inherent feature of reverse
transcription, so there is no need for a separate integrase function.
Ultimately the second target strand is cut, the second cDNA strand is
synthesized, and the integration junctions are sealed, but the
orchestration of these later steps remains obscure. Other examples of
NLR retrotransposons are L1 elements in mammals (e.g., L1Hs in humans),
the Drosophila I factor, and the R1 and R2 elements in
insects (3, 6, 17).
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
TPRT model. Several of the steps in this reaction remain
hypothetical. DNA strands are depicted as black lines; the target
sequence that is duplicated upon insertion is shown by thick black
lines; the element RNA is shown as a gray line. Half arrowheads
represent 3' ends. (a) The element RNA, with associated element-encoded
proteins, is transported to the nucleus, and the target sequenced is
located. (b) The element-encoded endonuclease nicks the bottom strand
at the left end of the target. (c) The exposed 3'-OH at the nick is
used to prime first-strand cDNA synthesis, using the element RNA as the
template. (d) The second strand is cleaved, perhaps by the same
endonuclease. (e) The exposed 3'-OH primes synthesis of second-strand
cDNA. Element RNA is degraded by an RNase H activity or is displaced
during second-strand synthesis. (f) After completion of the second
strand, both junctions are sealed, presumably by cellular repair
enzymes. Modified from reference 23.
|
|
Typical NLR elements have two open reading frames (ORFs), although the
arthropod R2 elements have only one. The product of the first ORF
(ORF1p) has affinity for single-stranded nucleic acid and binds to
element RNA (14, 15, 19, 25, 33). The product of the second
ORF (ORF2p) has homology to reverse transcriptase, and this activity
has been demonstrated for L1Hs, R2Bm, Jockey, CRE1, and Tx1L (4,
11, 16, 23, 26). The second ORF also contains an endonuclease
domain (9, 10, 37), which is responsible for generating the
target nick that initiates TPRT (23, 38). By mutating
crucial residues in the endonuclease of L1Hs, Feng et al.
(9) demonstrated that its activity is required for active
transposition in cultured cells.
To date, two types of NLR endonucleases have been characterized
(9, 37). The endonucleases of the arthropod R2 elements represent one type and are thought to be similar to type IIS
restriction endonucleases with separate DNA cleavage and DNA-binding
domains (39). The endonuclease domain of the L1Hs element
(L1Hs EN) is representative of the second type in that it has weak
homology to apurinic-apyrimidinic (AP) endonuclease and DNase I
(9). Within this second category, only the endonuclease of
the L1Tc element from a trypanosome has been shown to cut apurinic
sites (31); most others probably lack genuine AP
endonuclease activity (5). All AP endonucleases borne by NLR
elements are more closely related to each other than to any other AP
endonuclease or DNase I-like sequences. To emphasize their role in
transposition, we will refer to these element-encoded endonucleases as
ADR (AP- and DNase I-like retrotransposon) endonucleases.
Interestingly, both nonspecific and site-specific NLR elements exist.
It is presumed that target site selection is a property of the
element-encoded endonuclease, and this has been supported for the
relatively nonspecific L1Hs (9) and for the highly specific
insect elements, R2Bm (23, 37) and R1Bm (10).
The Tx1L family consists of 6.9-kb sequences that are present in about
150 dispersed copies in the Xenopus laevis genome
(13). They have sequence features very similar to those of
transposable elements of the NLR family, including ORFs that encode an
RNA-binding protein (ORF1p) (33) and a reverse transcriptase
(ORF2p) (4) (Fig. 2B). A
curious feature of the Tx1L elements is that they are always found
inserted in specific sequences within a family of apparent
cut-and-paste transposons, Tx1D (Fig. 2A). There are approximately
1,500 Tx1D elements in the genome, each of which has 19-bp inverted
terminal repeats and is flanked by a 4-bp target duplication
(12). About 10% of the Tx1D's are interrupted by a Tx1L
insertion (13). All Tx1L elements are found at a specific site within an internal tandem repeat (PTR-1) of Tx1D, and each insertion is flanked by a 23-bp duplication of PTR-1 sequence.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Tx1 element structures. (A) Tx1D elements are composed
of left common flank (LCF), several 400-bp PTR-1 repeats, several
400-bp PTR-2 repeats, and right common flank (RCF) (12).
Short inverted terminal repeats are indicated with triangles, and the
target site duplication, TTAA, that surrounds each element has also
been included. The composite Tx1C elements differ from Tx1D by the
insertion of a 6.9-kb Tx1L sequence into one of the PTR-1 repeats. (B)
Expanded view of the structure of Tx1L. The 775-amino-acid (775aa) ORF1
and the 1,304-amino-acid (1304aa) ORF2 are depicted by thick arrows.
Untranslated regions (UTR) are shown as thin lines. The flanking 23-bp
target site duplication is shown as small black arrowheads. Locations
of salient features of the two ORFs are indicated. Sequence from
reference 13.
|
|
These structural features support the presumption that Tx1L is an
independent retrotransposon with site specificity for the Tx1D target.
In the absence of direct evidence for this interpretation, we also
considered the possibility that the composite element, Tx1D-Tx1L (also
called Tx1C), is the mobile unit (13). This hypothesis was
motivated in part by the absence of an obvious ORF in the Tx1D sequence
and led to the suggestion, albeit unprecedented, that the Tx1L ORF
products might act at the Tx1D ends to mobilize both the simple
cut-and-paste and the composite elements. A further possibility is that
the Tx1L proteins participate in both types of reaction, cut-and-paste
and retrotransposition.
In their compilation of NLR sequences, Feng et al. (9) noted
the homology of the N terminus of ORF2p of Tx1L to the endonuclease domains of L1Hs and related elements (see also reference
31). Given the apparent role of this endonuclease in
determining the transposition target, this has made it possible for us
to test the alternatives described above. If Tx1L is an independent
NLR, its endonuclease (Tx1L EN) should recognize the target sequence within Tx1D, while recognition of a chromosomal target for Tx1D would
indicate a role in catalyzing mobility of the composite elements. The
experiments described here clearly show that the Tx1L target, and not
the Tx1D target, is cleaved. This cleavage occurs at precisely the
expected location for TPRT of the Tx1L element. Nucleotide sequences
flanking the nick are demonstrated to be important for target
recognition by the endonuclease.
| |
MATERIALS AND METHODS |
Cloning of Tx1L EN.
The first 717 bp of ORF2, corresponding
to the first 239 amino acids, were amplified by PCR from the clone
pBORF2b, which contains the complete ORF2 sequence of the Tx1L element
from lambda clone B10 (13), using the DNA oligonucleotides
GTAATACGACTCACTATAGGGC and
GGCGGATCCTTAGTGGTGATGGTGATGGTGAGATCCTCTGATTGACATTCTCAGGGATAC as primers. The first primer was complementary to vector
sequences just upstream of the N terminus of ORF2. The second primer
was complementary to codons 232 through 239 of ORF2 and also included nucleotides encoding an RGSHHHHHH tag on the C terminus of
Tx1L EN, as well as a BamHI restriction site for cloning
purposes. The amplified DNA fragment was treated with NcoI,
which cuts at the junction of vector sequence and the first ATG codon
of Tx1L ORF2, and BamHI, and the resulting fragment was
ligated into the NcoI and BamHI sites of pET16b
(Novagen) by T4 DNA ligase (New England Biolabs), using conditions
recommended by the supplier. The ligation products were electroporated
into Escherichia coli XL1-Blue (Stratagene) by using a Gene
Pulser (Bio-Rad). Transformed bacteria were plated on
ampicillin-containing Luria-Bertani (LB) plates (1). The
inserts of candidate clones were sequenced by the University of Utah
Core Sequencing Facility, using oligonucleotide primers specific for
the pET16b vector. The clone chosen for use in these experiments has
been given the name pE1EN.
Expression and purification of Tx1L EN.
pE1EN DNA was
transformed into competent E. coli BL21(DE3)-pLysS cells
(Novagen) and plated on carbenicillin-containing LB plates. A single
colony was used to inoculate a 5-ml culture (LB with 100 µg of
ampicillin or carbenicillin per ml and 20 µg of chloramphenicol per
ml) which was grown to an optical density at 600 nm of 0.6 at 37°C.
The 5-ml culture was used to seed a 500-ml culture in the same medium,
which was grown to an optical density at 600 nm of 0.6 at 37°C prior
being induced with 1 mM isopropyl-
-D-thiogalactopyranoside (IPTG) and incubated
for a further 2 h at room temperature. The bacteria from the
500-ml culture were collected by centrifugation (2,200 × g for 14 min). The cell pellet from each 100 ml of culture was
washed with 30 ml of cold H2O and frozen in liquid
nitrogen. To initiate purification, each frozen pellet was resuspended
in 0.5 ml of binding buffer (10 mM -mercaptoethanol [BME], 0.1%
Triton X-100, 50 mM sodium phosphate [pH 8.0], 300 mM NaCl, 10%
glycerol, 10 mM imidazole). The resuspended bacteria were combined and
disrupted with a Branson Sonifier 450, using three sets of 16 pulses at
50% power and 50% duty cycle. The sonicated bacterial lysate was spun
in an Eppendorf centrifuge (14,000 rpm) for 30 min. The resulting
supernatant was removed, forced through a 0.2-µm-pore-size syringe
filter, and then loaded onto a 0.5-ml Talon resin column (Clontech)
equilibrated in binding buffer. The column was washed twice with 1.5 ml
of binding buffer, followed by two washes with 10 mM BME-0.1% Triton X-100-50 mM sodium phosphate (pH 8.0)-300 mM NaCl-10% glycerol and
two washes with 10 mM BME-0.1% Triton X-100-50 mM sodium phosphate (pH 8.0)-700 mM NaCl-30% glycerol. Two final washes with 10 mM BME-0.1% Triton X-100-50 mM sodium phosphate (pH 8.0)-300 mM
NaCl-10% glycerol-30 mM imidazole were followed by elution of the
bound protein with 1.5 ml of elution buffer (10 mM BME, 0.1% Triton X-100, 50 mM sodium phosphate [pH 8.0], 300 mM NaCl, 10% glycerol, 250 mM imidazole). The eluted protein was frozen in liquid nitrogen in
20- to 40-µl aliquots. The same process was performed in parallel for
E. coli BL21(DE3)-pLysS containing the pET16b vector
(control eluate) and again for a mock purification without any
bacterial extract (blank eluate). The concentration of Tx1L EN was
determined by analysis of a Coomassie blue-stained gel after sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in
comparison with known amounts of bovine serum albumin on the same gel
as a mass standard. The concentration of Tx1L EN used for most of the
experiments described here was 2.2 pmol/µl.
Endonuclease assays.
Complementary oligonucleotides
corresponding to the Tx1L target (70 bp) and the Tx1D target (71 bp)
were made by Integrated DNA Technologies. Sequencing primers for the
Tx1L target (CGCATACAAACAGTCCCGTGG and
CCCCGCAAAAATGCAGTCAATG) and the Tx1D target
(GCAATAATACACAGAATCCC and GTTCAAAAGG TCAGATTTATTAT)
were made by the DNA-Peptide Core Facility at the University of
Utah. The complementary 42-bp Tx1L target oligonucleotides used in the
experiments shown in Fig. 7 and 8 were made by the Core Facility (see
Fig. 8 for sequences). All oligonucleotides were gel purified.
Fifty picomoles of top-strand oligonucleotide and 50 pmol of
bottom-strand oligonucleotide were end labeled with
32P in
separate 10-µl reactions using 450 µCi of
[
-
32P]ATP (Amersham) and T4 polynucleotide kinase (New
England Biolabs).
The kinase reaction was stopped by heat inactivation;
40 µl of
10 mM Tris-HCl (pH 8.0)-50 mM NaCl-1 mM EDTA was added
prior to
loading the reaction mixture onto 0.8-ml-bed-volume Sephadex
G-25
(medium grade) spin columns equilibrated with the same buffer
(
1). Equal amounts of cold top and bottom strands were also
run over spin columns. Double-stranded substrates labeled on one
strand
were generated by combining in 50 µl 25 pmol of labeled
strand and 25 pmol of cold complementary strand. Annealing was
accomplished by
boiling for 1 min followed by slow cooling to
room temperature. Salt
was removed from the annealed oligonucleotides
on a G-25 spin column
equilibrated in 10 mM Tris-HCl (pH 8.0).
Each standard 40-µl endonuclease reaction contained 1 µl (0.5 pmol)
of labeled template DNA and 2 µl of eluate in reaction
buffer (50 mM
HEPES [pH 7.0], 1.5 mM MgCl
2, 0.1% Triton X-100,
100 µg of bovine serum albumin per µl, 1 mM dithiothreitol, 10%
glycerol, 5 ng sheared salmon sperm DNA per µl. Blank eluate was
used
to bring the total eluate volume to 2 µl when necessary.
The reaction
mix was incubated at 22°C before the reaction was
terminated with 4.5 µl of stop buffer (2% SDS, 50 mM EDTA). Terminated
reactions were
run over H
2O-equilibrated Sephadex G-25 spin columns
into
15 µl of 95% formamide stop-buffer (GibcoBRL) and either
4.5 µl of
10× Taq buffer (GibcoBRL) or 4.5 µl of 10× PFU buffer
(Stratagene),
so that the reactions would be in the same buffer
as the sequencing
ladder being used to map the positions of the
nick sites. The samples
were boiled for 2 min and quickly cooled
in an ice-water bath, and the
equal counts from each sample were
loaded onto a 6% polyacrylamide
sequencing gel. The sequencing
ladders were generated using a cycle
sequencing kit (GibcoBRL),
the sequencing primers listed above, and
either the long oligonucleotides
or the relevant parent plasmids as
templates.
The endonuclease reactions used to demonstrate enzymatic turnover were
similar to those described above except that the salmon
sperm DNA was
replaced with 83 pmol of unlabeled target (the 70-bp
Tx1L target
oligonucleotide). Instead of the final spin columns,
the reactions were
ethanol precipitated and resuspended in 50%
formamide.
For the ligation reaction, three standard endonuclease reactions were
incubated for 30 min, combined, extracted with
phenol-chloroform-isoamyl
alcohol (25:24:1), ethanol precipitated, and
dissolved in 10 mM
Tris-HCl (pH 8.0)-1 mM EDTA. One-fourth of the
dissolved DNA was
treated with approximately 1,000 U of T4 ligase (New
England Biolabs)
in a 100-µl reaction, and one-fourth of the
resuspended DNA was
mock ligated (no T4 ligase). All quantitations of
cutting efficiency
were performed with ImageQuant software on a
Molecular Dynamics
model 400E
PhosphorImager.
| |
RESULTS |
Enrichment and activity of Tx1L EN.
The endonuclease domain of
Tx1L, represented by the first 239 amino acids of ORF2, was expressed
in E. coli from a pET16b construct. A C-terminal
His6 tag was added to enable enrichment of the resulting
protein by passing the bacterial lysate over a cobalt chelate column
and eluting Tx1L EN with imidazole (Fig. 3). This same purification procedure was
performed on bacteria carrying only the pET16b vector. In addition to
the expected polypeptide (predicted molecular mass of 28.4 kDa), a few
faint contaminating bands in the Tx1L EN preparation were present in
the control eluate. We estimate that the Tx1L EN was approximately 70%
pure.
View larger version (82K):
[in this window]
[in a new window]
|
FIG. 3.
Expression and enrichment of Tx1L EN. Tx1L EN was
expressed in bacteria from the pET16b vector and purified on a cobalt
chelate column. Various fractions were analyzed by PAGE and stained
with Coomassie blue. Lane 1, Tx1L EN-expressing bacterial extract
before the nickel column; lane 2, imidazole eluate from the cobalt
column; lane 3, control eluate from bacteria carrying the vector only.
The unlabeled lane has molecular weight standards of the sizes (in
kilodaltons) indicated at the left. The expected location of Tx1L EN is
indicated with an arrow.
|
|
The activity of Tx1L EN was tested initially on a 70-bp oligonucleotide
substrate that represented the Tx1L insertion site
within Tx1D and
encompassed the 23-bp target sequence that is
duplicated around the
element (boxed in Fig.
4). This substrate
was end labeled with
32P on either the top strand or the
bottom strand and exposed to
increasing amounts of Tx1L EN eluate. At
the end of the incubation,
equal counts from each reaction were loaded
onto a denaturing
polyacrylamide gel for analysis. The positions of the
nicks introduced
by the enzyme were then precisely mapped by comparing
the positions
of the bands to a set of dideoxynucleotide sequencing
reactions
generated from a primer having the same 5' end as the
corresponding
labeled strand.
View larger version (83K):
[in this window]
[in a new window]
|
FIG. 4.
Target cleavage by Tx1L EN. The double-stranded DNA
oligonucleotide shown at the bottom was the substrate for cleavage by
the endonuclease. It is composed of 70 bp of PTR-1 sequence from a Tx1D
element. The 23 bp found duplicated around all Tx1L insertions are
boxed. This DNA was end labeled on the top or bottom strand and treated
with three different amounts (0.5, 1.5, and 5 µl) of Tx1L EN (ENDO)
or control (CTRL) eluate. The products were analyzed by electrophoresis
next to lanes with sequencing reactions initiated from the
corresponding primers (indicated as arrows above and below the sequence
at the bottom). Locations of the most prominent nicks on each strand
are indicated by a bold arrowhead (bottom strand) and fine arrow (top
strand) in both sections of the figure. The cut in the bottom strand
corresponds to the location expected based on the TPRT mechanism.
|
|
As seen in Fig.
4, Tx1L EN creates only one major nick in the Tx1L
substrate. This nick is on the bottom strand at the left
extremity of
the 23-bp target duplication, at precisely the position
required to
initiate transposition of Tx1L into this site by TPRT.
No nicks of
comparable intensity were made in the top
strand.
To confirm that Tx1L EN is responsible for the observed nicking
activity, protein extract from bacteria containing the pET16b
vector
was subjected to the same enrichment procedure as the Tx1L
EN-containing eluate. This control eluate, which contains many
of the
contaminants present in the Tx1L EN eluate (Fig.
3), was
devoid of the
nicking activity seen in the endonuclease eluate
(Fig.
4). Furthermore,
boiling the endonuclease eluate prior to
addition to the reaction
destroyed the nicking activity, as did
treatment with proteinase K
(data not
shown).
Target of Tx1L EN.
The activity shown in Fig. 4 indicates
strongly that Tx1L ORF2p can catalyze the transposition of the Tx1L
element into the PTR-1 sequence of Tx1D. As stated in the introduction,
we were also interested in determining whether this protein could
participate in the mobilization of Tx1D and composite elements. To
resolve this question, we tested the activity of Tx1L EN on a genomic sequence that serves as a target for Tx1D. We showed previously that
this site is polymorphic for the presence or absence of a Tx1D element
(12).
A 71-bp oligonucleotide corresponding to this Tx1D target was prepared,
with the insertion site located centrally (boxed in
Fig.
5). Its top and bottom strands were
labeled independently,
and the resulting duplexes were treated with
Tx1L EN under conditions
identical to those used for the reactions with
the Tx1L target.
As seen in Fig.
5, much less significant cuts were
made in either
strand of the Tx1D target. Because the amounts of
substrate and
enzyme were carefully matched between the samples shown
in Fig.
4 and
5, we conclude that Tx1L EN has a strong preference for
the Tx1L target sequence and, therefore, that Tx1L ORF2p very
likely
catalyzes the transposition of the retroelement by TPRT
but does not
participate in transposition of Tx1D.
View larger version (84K):
[in this window]
[in a new window]
|
FIG. 5.
Treatment of a Tx1D target with Tx1L EN. An
oligonucleotide corresponding to an unoccupied Tx1D target
(12) was the substrate in this experiment. The 4-bp target
duplication found flanking all Tx1D elements is boxed. The experiment
was performed just like that in Fig. 4. The positions of the weak but
most prominent nicks on the two strands are indicated with hash
marks.
|
|
Properties of the Tx1L EN reaction.
To serve as a first step
in TPRT, the nick made by Tx1L EN must have not only the proper
location but also the appropriate chemistry (23, 37). This
was tested by subjecting a partially nicked Tx1L target to reaction
with T4 DNA ligase, which requires a 3'-hydroxyl and 5'-phosphate to
join DNA segments. The sample shown in Fig.
6 was initially nicked in 22% of the
target molecules. Following ligase treatment, nicks remained in only
4%. Conversion of 80% of the nicked bottom strands back to full
length demonstrates that the nicks created by Tx1L EN leave a free
3'-OH, as required to prime first-strand DNA synthesis during
transposition. The faint bands in Fig. 6 appear to have similar
intensities before and after ligase treatment, which suggests that they
may not be products of Tx1L EN cutting, although no attempt has been
made to quantitate them.
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 6.
Chemistry of the nick. The Tx1L target oligonucleotide,
labeled on the bottom strand, was incubated with Tx1L EN as in Fig. 4.
One portion of the sample was treated with T4 DNA ligase, and another
portion was mock ligated. After electrophoresis, the percentages of
total radioactivity found in the bands corresponding to full-length and
nicked substrate were determined.
|
|
Two aspects of the kinetics of the Tx1L EN reaction were examined.
First, an extensive time course (Fig.
7)
showed that the
major bottom-strand nick remained predominant
throughout the reaction.
There were no prominent nicks more distant
from the labeled end
that might have been obscured by cleavage at the
TPRT site and
no nicks with unusual kinetics that might have been
missed in
earlier experiments. A similar time course with the
top-strand
labeled revealed no strong bands and no additional cut sites
beyond
those documented in Fig.
4 (not shown). As can be seen in Fig.
7, Tx1L EN is capable of converting the vast majority of the Tx1L
target DNA to product. This differs from the experience with the
endonuclease of R1Bm, which nicked only a minority of its target
substrates (
10). Averaging the last two time points in Fig.
7, about 22% of the substrate remained uncut, 65% was converted
to
the major product, and 10% appeared in the principal minor
band
(indicated with an arrow). As expected, there was a gradual
increase in
the proportion of this minor band as time progressed,
because a
substrate with both the major and minor cuts would appear
only in the
band representing the cut closer to the labeled end.
View larger version (102K):
[in this window]
[in a new window]
|
FIG. 7.
Time course of nicking by Tx1L EN. Bottom strand-labeled
(noted as an asterisk) target DNA was incubated with the endonuclease
(ENDO) or control (CTRL) eluate just as in Fig. 4 but for longer
periods of time. Incubation times in minutes are given above the lanes,
and corresponding sequencing lanes are shown at the left. In addition
to the major nick site (bold arrowhead), the location of a minor site
is indicated (thin arrow) both in the gel and on the substrate
sequence.
|
|
Second, we tested whether Tx1L EN was capable of enzymatic turnover.
The earlier experiments were performed with a slight
molar excess of
enzyme over target DNA. By adding a large amount
of unlabeled target
molecules, we increased the target/enzyme
ratio to 38:1 (84 pmol of
target:2.2 pmol of enzyme). Tx1L EN
converted essentially all of the
labeled target to nicked product
within about 8-10 h of incubation
(Fig.
8). This provides clear
evidence
that a single enzyme molecule can nick multiple targets.
This is
different from what has been seen for the R2 class of
endonucleases
(
38).
View larger version (72K):
[in this window]
[in a new window]
|
FIG. 8.
Enzymatic turnover. Tx1L EN was incubated with the Tx1L
target DNA at an enzyme/target ratio of 1:38. Conditions were as in
previous experiments except that a 42-bp target duplex was used.
Incubation times in hours are given above the lanes.
|
|
Recognition site of Tx1L EN.
Tx1L EN makes a specific nick in
the Tx1L target and fails to make significant cuts in the Tx1D target.
What sequence features are important for recognition by the enzyme?
Initial attempts to demonstrate an electrophoretic mobility shift for a
complex between the endonuclease and its substrate were unsuccessful. Therefore, this question was addressed by substitution scanning mutagenesis of the Tx1L target sequence.
A series of substrate oligonucleotides was prepared, each 42 bp in
length. One corresponds precisely to a shorter version
of the Tx1L
target sequence described earlier. This was readily
nicked by Tx1L EN
(Fig.
9, lane 2). Each of the other
substrates
in the series contained a 6-bp substitution, GATCGA (boxed
in
Fig.
9), that was moved progressively through the sequence in
steps
of approximately 4 bp. Treatment of the mutant substrates
gave an
indication of which positions in the sequence are important
for
recognition by Tx1L EN. Two of the substrates were essentially
not cut
at all (Fig.
9, lanes 5 and 6), and two others were nicked
much less
efficiently than the wild-type sequence (lanes 4 and
7). This defines
the critical sequences as lying within 10 consecutive
base pairs that
flank the cut site on both sides (underlined in
the top sequence in
Fig.
9).
View larger version (54K):
[in this window]
[in a new window]
|
FIG. 9.
Substitution scanning mutagenesis of the Tx1L target
site. The initial substrate (lanes 1 and 2) was a 42-bp oligonucleotide
corresponding to the 23-bp target duplication and surrounding
sequences. The target site duplication segment is flanked by spaces in
the sequences shown, and the position of the prominent TPRT nick is
indicated with an arrowhead. Each mutant target carried a 6-bp
substitution (boxed) that was placed at successive locations in the
substrates, as shown. Each DNA was labeled on the bottom strand (*)
and treated with Tx1L EN as before. The sample in lane 1 was incubated
without enzyme. The fraction of radioactivity in the band corresponding
to the TPRT nick was determined and reported for each substrate as a
percentage of that found with the nonmutant sequence. The line between
the strands in the initial substrate shows the region in which
substitutions caused a substantial reduction ( 65%) in the nicking
activity.
|
|
| |
DISCUSSION |
Activity of Tx1L EN.
The ADR endonuclease domain of Tx1L ORF2p
is active when expressed independently in a truncated form. This enzyme
makes a specific cut in the bottom strand of the target for
site-specific insertion of Tx1L elements at precisely the location
required for priming of first-strand cDNA synthesis by the TPRT
mechanism. Not only is the nick located at the end of the 23-bp target
duplication, but the product has the expected chemical attributes
(i.e., a free 3'-OH). This fact, combined with the observation that the endonuclease does not recognize and nick the target sequence for insertion of Tx1D elements, strongly supports the idea that Tx1L is an
independent non-LTR retrotransposon that has target specificity for a
sequence within Tx1D. Based both on these data and on mechanistic grounds, it seems unlikely that the proteins encoded by Tx1L
participate directly in Tx1D mobility.
This conclusion leaves open the question of what protein(s) catalyzes
Tx1D transposition, since the elements sequenced to
date have no
obvious ORFs (
12). Whatever the catalysts of Tx1D
transposition, it seems probable that a Tx1L insertion could be
carried
along passively to the new target site without a requirement
for the
activities of its own gene products. Thus, Tx1L can integrate
at new
chromosomal locations either by moving independently or
by piggybacking
on
Tx1D.
Tx1L effectively maximizes its chances for survival by (i) choosing a
preexisting high-copy-number element as its target;
(ii) minimizing
potential damage by selecting safe insertion sites
already scouted by
Tx1D; and (iii) taking advantage of the possibility
of being
transported to new sites by Tx1D, as well as by its own
independent
mechanism. This strategy also has its drawbacks, in
that a particular
Tx1L element may be eliminated along with Tx1D,
either by selection
against a disadvantageous insertion or by
attrition. Furthermore, if
the Tx1D family should disappear from
the
X. laevis genome,
no targets for Tx1L insertion would remain.
This hazard is no greater,
however, than that experienced by the
abundant short interspersed
repetitive sequences, which are dependent
for their transposition on
functions provided by long interspersed
repetitive sequences or other
independent retrotransposons (
2,
30,
34,
35). In addition,
the site specificity of Tx1L elements
is capable of coevolving with the
sequence of its DNA target.
We have identified a second family in the
X. laevis genome, called
Tx2, that is comprised of
homologues of the L, D, and composite
(C) elements found in the Tx1
family (
13). Both the target sequence
within PTR-1 repeats
of Tx2D and the cleavage specificity of the
Tx2L endonuclease are
different from those in the Tx1 family,
and no hybrid elements (e.g.,
Tx1L in Tx2D) are observed, suggesting
independent coevolution in the
two families (S. Christensen, G.
Pont-Kingdon, and D. Carroll,
unpublished
data).
Top-strand cleavage.
The bottom-strand nick made by Tx1L EN
produces a 3' end that could prime first-strand cDNA synthesis at the
target site. To complete the integration process, a nick must
ultimately be made in the top strand to prime second-strand synthesis.
The isolated endonuclease domain does not make a strong cut in the top
strand at the other end of the duplicated target sequence. We offer
several possible explanations for the absence of an obvious top-strand cut. (i) Top-strand cleavage may be inefficient in our reaction conditions, perhaps because no element RNA was added (23,
38) (see below). (ii) Top-strand cleavage may not occur precisely at the end of the apparent target duplication, perhaps because we have
defined it incorrectly (it is difficult to know which sequences to
assign to the target and which to the element, since they may be
identical). Alternatively, if the donor RNA carries on its 5' end all
or part of the target duplication from its previous integration site,
this could serve as the source of those sequences at the new site. In
either case, the very weak nicks seen on the top strand near the end of
the target duplication (Fig. 4 and 10) could represent inefficient
versions of the top-strand cut. (iii) The top-strand cut may not be
made by the N-terminal endonuclease domain alone. The full-length ORF2p
or a host factor may be necessary to alter the specificity of the
endonuclease to recognize the top-strand site, or it may be cleaved by
a completely different activity.
Cleavage sites for the three ADR endonucleases characterized to date
are shown in Fig.
10. The human L1Hs EN
is rather nonspecific,
in agreement with the wide range of target
sequences these elements
are seen to occupy. Nonetheless, there is a
weak consensus among
observed target duplications (
18), and
cleavage by the endonuclease
is consistent with this consensus
(
9).
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 10.
Target sequences of NLRs whose ADR endonuclease has
been characterized. Spaces in the target sequence demarcate the target
duplication. The observed bottom strand nicks made by the purified
endonucleases are marked with bold arrowheads. Experimentally observed
top-strand nicks that have been proposed as top-strand cleavages are
marked with an arrow. The simple hash marks in the case of Tx1L
represent very minor cut sites (Fig. 4). The data for L1Hs are from
references 9 and 18), those for
R1Bm are from reference 10, and those for Tx1L are
from this work.
|
|
The other site-specific ADR endonuclease that has been examined is that
from the silkmoth ribosomal insertion, R1Bm (
10).
Like Tx1L
EN, the R1Bm endonuclease cuts the bottom strand of
its target
precisely at the expected location, at the left end
of the target
sequence that will be duplicated. In this case,
Feng et al.
(
10) also observed a nick on the top strand at the
right end
of the duplicated sequence; however, this was not the
only nick made on
the top strand of the proffered substrate, nor
was it the most
prominent. It is not known whether this corresponds
to the
mechanistically relevant top-strand
cut.
The other NLR endonuclease that has been studied in detail is that from
the silkmoth ribosomal insertion R2Bm (
22,
23,
37,
38). In
this case, the full-length protein encoded by
the single ORF of the
element both makes the first-strand nick
and primes DNA synthesis from
it. Further, the R2Bm protein makes
a specific cut in the top strand of
the target, and this reaction
requires the presence of RNA
(
38). The R2Bm endonuclease is
not related in sequence to
the ADR family, and it appears to have
two essential domains in distant
portions of the polypeptide sequence
(
39). After the first
strand nick is made by the R2Bm endonuclease,
the protein remains
associated with the target DNA (
38). This
is thought to be
important for coordinating first-strand cleavage
with reverse
transcription, with top-strand cleavage, and with
initiation of
top-strand synthesis. In contrast, the Tx1L EN clearly
releases after
making a nick, and a single molecule of the truncated
protein can
process multiple DNA substrates. This is perhaps not
surprising given
the homology of the ADR family to DNase I and
AP endonuclease, which
also exhibit enzymatic turnover (
9,
27,
28). In the context
of the full-length ORF2p sequence,
however, the endonuclease may be
constrained to remain at the
target; and, as speculated above, its
specificity may be modified
to effect top-strand
cleavage.
Recognition site of Tx1L EN.
The recognition site for Tx1L EN
consists of sequences flanking the TPRT nick site. The minimum
recognition site appears to be about 10 bp and is approximately
centered around the cut site. These features correspond well to similar
observations made for DNase I, although Tx1L EN has an added level of
sequence specificity. Based on the crystal structure and DNA
footprinting experiments, it is known that DNase I contacts
approximately one helical turn of DNA and that the protein is roughly
centered around the phosphodiester cut site (21, 36).
We suggest that, in the context of the full-length ORF2 protein, the
endonuclease has additional determinants of its sequence
specificity.
First, the isolated endonuclease domain makes weak
cuts in noncanonical
sequences in the substrates we have studied
here and in some other
sequences that we have utilized (
4).
(If enough such
secondary sites were analyzed, it might be possible
to derive a
consensus recognition sequence for Tx1L EN.) Second,
a 10-bp
recognition site is not large enough to explain the fact
that Tx1L
elements are found only within Tx1D elements in the
X. laevis genome. On statistical grounds, multiple additional
copies
of a sequence of this length are expected to exist. Either
the
full-length ORF2p recognizes a longer sequence, or there are
additional
structural determinants of cleavage specificity, perhaps
in the form of
an organized chromatin structure or a specific
local DNA geometry
(
5,
21).
| |
ACKNOWLEDGMENTS |
This work was supported in part by research grant NP-803 from the
American Cancer Society. Assistance was also provided by the Markey
Center for Protein Biophysics and the Huntsman Cancer Institute at the
University of Utah.
We are grateful to Tom Eickbush and Harmit Malik for thoughtful and
helpful comments and to an editor for a useful suggestion on
interpreting the strategic aspects of Tx1L transposition.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department
of Biochemistry, University of Utah School of Medicine, Salt Lake City, UT 84132. Phone: (801) 581-5977. Fax: (801) 581-7959. E-mail: carroll{at}medschool.med.utah.edu.
Present address: Department of Biology, University of Rochester,
Rochester, NY 14627.
Present address: Huntsman Cancer Institute, University of Utah
School of Medicine, Salt Lake City, UT 84132.
| |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1998.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Boeke, J. D.
1997.
LINEs and Alus the polyA connection.
Nat. Genet.
16:6-7[CrossRef][Medline].
|
| 3.
|
Capy, P.,
C. Bazin,
D. Higuet, and T. Langin.
1998.
Dynamics and evolution of transposable elements.
Landes Bioscience, Austin, Tex.
|
| 4.
|
Christensen, S.
1999.
Ph.D. thesis.
University of Utah, Salt Lake City.
|
| 5.
|
Cost, G. J., and J. D. Boeke.
1998.
Targeting of human retrotransposon integration is directed by the specificity of the L1 endonuclease for regions of unusual DNA structure.
Biochemistry
37:18081-18093[CrossRef][Medline].
|
| 6.
|
Dombroski, B. A.,
S. L. Mathias,
E. Nanthakumar,
A. F. Scott, and H. H. Kazazian, Jr.
1991.
Isolation of an active human transposable element.
Science
254:1805-1808[Abstract/Free Full Text].
|
| 7.
|
Eickbush, T. H.
1992.
Transposing without ends: the non-LTR retrotransposable elements.
New Biol.
4:430-440[Medline].
|
| 8.
|
Engels, W. R.
1996.
P elements in Drosophila.
Curr. Top. Microbiol. Immunol.
204:103-123[Medline].
|
| 9.
|
Feng, Q.,
J. V. Moran,
H. H. Kazazian, Jr., and J. D. Boeke.
1996.
Human L1 retrotransposon encodes a conserved endonuclease required for retrotransposition.
Cell
87:905-916[CrossRef][Medline].
|
| 10.
|
Feng, Q.,
G. Schumann, and J. D. Boeke.
1998.
Retrotransposon R1Bm endonuclease cleaves the target sequence.
Proc. Natl. Acad. Sci. USA
95:2083-2088[Abstract/Free Full Text].
|
| 11.
|
Gabriel, A., and J. D. Boeke.
1991.
Reverse transcriptase encoded by a retrotransposon from the trypanosomatid Crithidia fasciculata.
Proc. Natl. Acad. Sci. USA
88:9794-9798[Abstract/Free Full Text].
|
| 12.
|
Garrett, J. E., and D. Carroll.
1986.
Tx1: a transposable element from Xenopus laevis with some unusual properties.
Mol. Cell. Biol.
6:933-941[Abstract/Free Full Text].
|
| 13.
|
Garrett, J. E.,
D. S. Knutzon, and D. Carroll.
1989.
Composite transposable elements in the Xenopus laevis genome.
Mol. Cell. Biol.
9:3018-3027[Abstract/Free Full Text].
|
| 14.
|
Hohjoh, H., and M. F. Singer.
1996.
Cytoplasmic ribonucleoprotein complexes containing human LINE-1 protein and RNA.
EMBO J.
15:630-639[Medline].
|
| 15.
|
Hohjoh, H., and M. F. Singer.
1997.
Sequence-specific single-strand RNA binding protein encoded by the human LINE-1 retrotransposon.
EMBO J.
16:6034-6043[CrossRef][Medline].
|
| 16.
|
Ivanov, V. A.,
A. A. Melnikov,
A. V. Siunov,
I. I. Fodor, and Y. V. Ilyin.
1991.
Authentic reverse transcriptase is coded by jockey, a mobile Drosophila element related to mammalian LINEs.
EMBO J.
10:2489-2495[Medline].
|
| 17.
|
Jakubczak, J. L.,
W. D. Burke, and T. H. Eickbush.
1991.
Retrotransposable elements R1 and R2 interrupt the rRNA genes of most insects.
Proc. Natl. Acad. Sci. USA
88:3295-3299[Abstract/Free Full Text].
|
| 18.
|
Jurka, J.
1997.
Sequence patterns indicate an enzymatic involvement in integration of mammalian retroposons.
Proc. Natl. Acad. Sci. USA
94:1872-1877[Abstract/Free Full Text].
|
| 19.
|
Kolosha, V. O., and S. L. Martin.
1997.
In vitro properties of the first ORF protein from mouse LINE-1 support its role in ribonucleoprotein particle formation during retrotransposition.
Proc. Natl. Acad. Sci. USA
94:10155-10160[Abstract/Free Full Text].
|
| 20.
|
Kunze, R.
1996.
The maize transposable element activator (Ac).
Curr. Top. Microbiol. Immunol.
204:161-194[Medline].
|
| 21.
|
Lahm, A., and D. Suck.
1991.
DNase I-induced DNA conformation. 2 Å structure of a DNase I-octamer complex.
J. Mol. Biol.
222:645-667[CrossRef][Medline].
|
| 22.
|
Luan, D. D., and T. H. Eickbush.
1996.
Downstream 28S gene sequences on the RNA template affect the choice of primer and the accuracy of initiation by the R2 reverse transcriptase.
Mol. Cell. Biol.
16:4726-4734[Abstract].
|
| 23.
|
Luan, D. D.,
M. H. Korman,
J. L. Jakubczak, and T. H. Eickbush.
1993.
Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition.
Cell
72:595-605[CrossRef][Medline].
|
| 24.
|
Mahillon, J., and M. Chandler.
1998.
Insertion sequences.
Microbiol. Mol. Biol. Rev.
62:725-774[Abstract/Free Full Text].
|
| 25.
|
Mathews, D. H.,
A. R. Banerjee,
D. D. Luan,
T. H. Eickbush, and D. H. Turner.
1997.
Secondary structure model of the RNA recognized by the reverse transcriptase from the R2 retrotransposable element.
RNA
3:1-16[Abstract].
|
| 26.
|
Mathias, S. L.,
A. F. Scott,
H. H. Kazazian, Jr.,
J. D. Boeke, and A. Gabriel.
1991.
Reverse transcriptase encoded by a human transposable element.
Science
254:1808-1810[Abstract/Free Full Text].
|
| 27.
|
Mol, C. D.,
C.-F. Kuo,
M. M. Thayer,
R. P. Cunningham, and J. A. Tainer.
1995.
Structure and function of the multifunctional DNA-repair enzyme exonuclease III.
Nature
374:381-386[CrossRef][Medline].
|
| 28.
|
Oefner, C., and D. Suck.
1986.
Crystallographic refinement and structure of DNase I at 2Å resolution.
J. Mol. Biol.
192:605-632[CrossRef][Medline].
|
| 29.
|
Ohtsubo, F., and Y. Sekine.
1996.
Bacterial insertion sequences.
Curr. Top. Microbiol. Immunol.
204:1-26[Medline].
|
| 30.
|
Okada, N.,
M. Hamada,
I. Ogiwara, and K. Ohshima.
1997.
SINEs and LINEs share common 3' sequences: a review.
Gene
205:229-243[CrossRef][Medline].
|
| 31.
|
Olivares, M.,
C. Alonso, and M. C. Lopez.
1997.
The open reading frame 1 of the L1Tc retrotransposon of Trypanosoma cruzi codes for a protein with apurinic-apyrimidinic nuclease activity.
J. Biol. Chem.
272:25224-25228[Abstract/Free Full Text].
|
| 32.
|
Plasterk, R. H.
1996.
The Tc1/mariner transposon family.
Curr. Top. Microbiol. Immunol.
204:125-143[Medline].
|
| 33.
|
Pont-Kingdon, G.,
E. Chi,
S. Christensen, and D. Carroll.
1997.
Ribonucleoprotein formation by the ORF1 protein of the non-LTR retrotransposon Tx1L in Xenopus oocytes.
Nucleic Acids Res.
25:3088-3094[Abstract/Free Full Text].
|
| 34.
|
Smit, A. F. A.
1996.
The origin of interspersed repeats in the human genome.
Curr. Opin. Genet. Dev.
6:743-748[CrossRef][Medline].
|
| 35.
|
Tchénio, T.,
E. Segal-Bendirdjian, and T. Heidmann.
1993.
Generation of processed pseudogenes in murine cells.
EMBO J.
12:1487-1497[Medline].
|
| 36.
|
Weston, S. A.,
A. Lahm, and D. Suck.
1992.
X-ray structure of the DNase I-d(GGTATACC)2 complex at 2.3 Å resolution.
J. Mol. Biol.
226:1237-1256[CrossRef][Medline].
|
| 37.
|
Xiong, Y., and T. H. Eickbush.
1988.
Functional expression of a sequence-specific endonuclease encoded by the retrotransposon R2Bm.
Cell
55:235-246[CrossRef][Medline].
|
| 38.
|
Yang, J., and T. H. Eickbush.
1998.
RNA-induced changes in the activity of the endonuclease encoded by the R2 retrotransposable element.
Mol. Cell. Biol.
18:3455-3465[Abstract/Free Full Text].
|
| 39.
|
Yang, J.,
H. S. Malik, and T. H. Eickbush.
1999.
Identification of the endonuclease domain encoded by R2 and other site-specific, non-long terminal repeat retrotransposable elements.
Proc. Natl. Acad. Sci. USA
96:7847-7852[Abstract/Free Full Text].
|
Molecular and Cellular Biology, February 2000, p. 1219-1226, Vol. 20, No. 4
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Repanas, K., Zingler, N., Layer, L. E., Schumann, G. G., Perrakis, A., Weichenrieder, O.
(2007). Determinants for DNA target structure selectivity of the human LINE-1 retrotransposon endonuclease. Nucleic Acids Res
0: gkm516v1-13
[Abstract]
[Full Text]
-
Maita, N., Aoyagi, H., Osanai, M., Shirakawa, M., Fujiwara, H.
(2007). Characterization of the sequence specificity of the R1Bm endonuclease domain by structural and biochemical studies. Nucleic Acids Res
35: 3918-3927
[Abstract]
[Full Text]
-
Mandal, P. K., Rawal, K., Ramaswamy, R., Bhattacharya, A., Bhattacharya, S.
(2006). Identification of insertion hot spots for non-LTR retrotransposons: computational and biochemical application to Entamoeba histolytica. Nucleic Acids Res
34: 5752-5763
[Abstract]
[Full Text]
-
Kojima, K. K., Fujiwara, H.
(2005). Long-Term Inheritance of the 28S rDNA-Specific Retrotransposon R2. Mol Biol Evol
22: 2157-2165
[Abstract]
[Full Text]
-
Christensen, S. M., Eickbush, T. H.
(2005). R2 Target-Primed Reverse Transcription: Ordered Cleavage and Polymerization Steps by Protein Subunits Asymmetrically Bound to the Target DNA. Mol. Cell. Biol.
25: 6617-6628
[Abstract]
[Full Text]
-
Fujimoto, H., Hirukawa, Y., Tani, H., Matsuura, Y., Hashido, K., Tsuchida, K., Takada, N., Kobayashi, M., Maekawa, H.
(2004). Integration of the 5' end of the retrotransposon, R2Bm, can be complemented by homologous recombination. Nucleic Acids Res
32: 1555-1565
[Abstract]
[Full Text]
-
Bringaud, F., Biteau, N., Zuiderwijk, E., Berriman, M., El-Sayed, N. M., Ghedin, E., Melville, S. E., Hall, N., Baltz, T.
(2004). The ingi and RIME non-LTR Retrotransposons Are Not Randomly Distributed in the Genome of Trypanosoma brucei. Mol Biol Evol
21: 520-528
[Abstract]
[Full Text]
-
Mandal, P. K., Bagchi, A., Bhattacharya, A., Bhattacharya, S.
(2004). An Entamoeba histolytica LINE/SINE Pair Inserts at Common Target Sites Cleaved by the Restriction Enzyme-Like LINE-Encoded Endonuclease. Eukaryot Cell
3: 170-179
[Abstract]
[Full Text]
-
Matsumoto, T., Takahashi, H., Fujiwara, H.
(2004). Targeted Nuclear Import of Open Reading Frame 1 Protein Is Required for In Vivo Retrotransposition of a Telomere-Specific Non-Long Terminal Repeat Retrotransposon, SART1. Mol. Cell. Biol.
24: 105-122
[Abstract]
[Full Text]
-
Burke, W. D., Singh, D., Eickbush, T. H.
(2003). R5 Retrotransposons Insert into a Family of Infrequently Transcribed 28S rRNA Genes of Planaria. Mol Biol Evol
20: 1260-1270
[Abstract]
[Full Text]
-
Kojima, K. K., Fujiwara, H.
(2003). Evolution of Target Specificity in R1 Clade Non-LTR Retrotransposons. Mol Biol Evol
20: 351-361
[Abstract]
[Full Text]
-
Jiang, N., Bao, Z., Temnykh, S., Cheng, Z., Jiang, J., Wing, R. A., McCouch, S. R., Wessler, S. R.
(2002). Dasheng: A Recently Amplified Nonautonomous Long Terminal Repeat Element That Is a Major Component of Pericentromeric Regions in Rice. Genetics
161: 1293-1305
[Abstract]
[Full Text]
-
Kubo, Y., Okazaki, S., Anzai, T., Fujiwara, H.
(2001). Structural and Phylogenetic Analysis of TRAS, Telomeric Repeat-Specific Non-LTR Retrotransposon Families in Lepidopteran Insects. Mol Biol Evol
18: 848-857
[Abstract]
[Full Text]
-
Wei, W., Gilbert, N., Ooi, S. L., Lawler, J. F., Ostertag, E. M., Kazazian, H. H., Boeke, J. D., Moran, J. V.
(2001). Human L1 Retrotransposition: cis Preference versus trans Complementation. Mol. Cell. Biol.
21: 1429-1439
[Abstract]
[Full Text]
-
Anzai, T., Takahashi, H., Fujiwara, H.
(2001). Sequence-Specific Recognition and Cleavage of Telomeric Repeat (TTAGG)n by Endonuclease of Non-Long Terminal Repeat Retrotransposon TRAS1. Mol. Cell. Biol.
21: 100-108
[Abstract]
[Full Text]
Top
Abstract
Introduction
