Previous Article | Next Article ![]()
Molecular and Cellular Biology, March 2000, p. 1489-1496, Vol. 20, No. 5
Division of Medical Oncology, Department of
Medicine, University of Texas Health Science Center, San Antonio, Texas
78284-7884
Received 6 May 1999/Returned for modification 11 July 1999/Accepted 24 November 1999
Insulin receptor substrate 1 (IRS-1) is a critical adapter protein
involved in both insulin and insulin-like growth factor (IGF)
signaling. Due to the fact that alteration of IRS-1 levels can affect
the sensitivity and response to both insulin and IGF-I, we examined the
ability of each of these ligands to affect IRS-1 expression. IGF-I (10 nM) stimulation of MCF-7 breast cancer cells caused a transient
tyrosine phosphorylation of IRS-1 that was maximal at 15 min and
decreased thereafter. The decrease in tyrosine phosphorylation of IRS-1
was paralleled by an apparent decrease in IRS-1 levels. The
IGF-mediated decrease in IRS-1 expression was posttranscriptional and
due to a decrease in the half-life of the IRS-1 protein. Insulin (10 nM) caused tyrosine phosphorylation of IRS-1 but not degradation,
whereas high concentrations of insulin (10 µM) resulted in
degradation of IRS-1. IGF-I (10 nM) stimulation resulted in transient
IRS-1 phosphorylation and extracellular signal-related kinase (ERK)
activation. In contrast, insulin (10 nM) caused sustained IRS-1
phosphorylation and ERK activation. Inhibition of 26S proteasome
activity by the use of lactacystin or MG132 completely blocked
IGF-mediated degradation of IRS-1. Furthermore, coimmunoprecipitation
experiments showed an association between ubiquitin and IRS-1 that was
increased by treatment of cells with IGF-I. Finally, IGF-mediated
degradation of IRS-1 was blocked by inhibition of phosphatidylinositol
3'-kinase activity but was not affected by inhibition of ERK,
suggesting that this may represent a direct negative-feedback mechanism
resulting from downstream IRS-1 signaling. We conclude that IGF-I can
cause ligand-mediated degradation of IRS-1 via the ubiquitin-mediated
26S proteasome and a phosphatidylinositol 3'-kinase-dependent mechanism
and that control of degradation may have profound effects on downstream activation of signaling pathways.
Insulin receptor substrate 1 (IRS-1)
was originally identified downstream of the insulin receptor (IR) but
can also be phosphorylated in response to insulin-like growth factor I
(IGF-I) (57). IRS-1 can also be activated by a number of
diverse ligands, including growth hormone, prolactin, oncostatin,
interleukin-2 (IL-2), IL-4, IL-7, IL-9, IL-13, IL-15, and Although there has been abundant research concerning activation of
IRS-1, the mechanisms controlling the duration and strength of the
signal remain unclear. Two general mechanisms have been described:
regulation of IRS-1 expression and regulation of IRS-1 phosphorylation.
IRS-1 expression can be transcriptionally regulated by glucocorticoids
(3, 46, 63). We have recently shown that estrogen can induce
IRS-1 mRNA and protein expression in breast cancer cell lines and
xenografts (32). Increased IRS-1 expression resulted in
enhanced tyrosine phosphorylation of IRS-1 in response to IGF-I and
increased activation of extracellular signal-related kinase (ERK).
Conversely, decreased IRS-1 expression, achieved by antiestrogen
treatment, inhibited IGF-I signaling through IRS-1. In a number of cell
systems it has been shown that high concentrations of insulin can cause
posttranscriptional downregulation of IRS-1 expression (23,
47), a potential mechanism being proteolytic degradation of IRS-1
protein by the calpain pathway (54).
IRS-1 phosphorylation is regulated by receptor tyrosine kinases,
protein tyrosine phosphatases, and serine/threonine kinases. Receptor
tyrosine kinases phosphorylate IRS-1 on tyrosine residues and activate
downstream signaling pathways (66). Following tyrosine phosphorylation, protein tyrosine phosphatases such as SRC homology domain protein tyrosine phophatase (SHP2) are activated and can dephosphorylate IRS-1 (38). In addition, several other
phosphatases have been shown to inhibit the action of insulin (2,
18). It has been shown that phosphorylation of the serine or
threonine residues of IRS-1, in contrast with dephosphorylation of
tyrosines, can inhibit further tyrosine phosphorylation of IRS-1. The
kinases involved and the mechanisms of inhibition are poorly
understood; however, the serine residues of IRS-1 are phosphorylated by
mitogen-activated protein kinase (MAPK) (9), protein kinase
C (PKC) (10), Akt/PKB (42), casein kinase II
(59), and phosphatidylinositol 3'-kinase (PI3K) (17,
29, 60) following activation of IRS-1 by ligands such as
angiotensin II (16) and tumor necrosis factor alpha (22). Okadaic acid, a serine/threonine phosphatase
inhibitor, increases phosphorylation of serine residues on IRS-1 and
inhibits the action of insulin (25).
In studies aimed at examining factors regulating the action of IRS-1,
we have shown that stimulation of IRS-1 tyrosine phosphorylation by
IGF-I results in IRS-1 degradation. Low concentrations of insulin (10 nM) that are known to activate only the IR induced sustained IRS-1
activation and downstream ERK phosphorylation. In contrast, high
concentrations of insulin (10 µM), which can activate the IGF-I
receptor (IGF-IR), were able to degrade IRS-1. IGF-I increased the
level of association of IRS-1 with ubiquitin, and 26S proteasome inhibitors blocked degradation of IRS-1. Finally, IGF-I degradation of
IRS-1 was blocked by inhibition of PI3K activity, suggesting that this
may be a direct negative-feedback mechanism resulting from IRS-1
activation of PI3K. In conclusion, we have revealed a novel mechanism
for degradation of IRS-1 that might represent a negative-feedback
mechanism important in controlling the activity of this critical signal
transduction molecule.
Materials.
All materials and chemicals were purchased from
Sigma (St. Louis, Mo.) unless otherwise noted. IGF-I was purchased from
GROPEP (Adelaide, Australia). ICI 182780 was a kind gift from Zeneca Pharmaceuticals (Macclesfield, England). The inhibitors lactacystin, MG132, LY294002, and PD098059 were from Calbiochem (La Jolla, Calif.).
All tissue culture reagents were purchased from Life Technologies
(Grand Island, N.Y.) unless otherwise stated.
[35S]methionine-[35S]cysteine (37 TBq/mmol)
was purchased from NEN (Boston, Mass.).
Cell lines.
MCF-7 cells have been maintained in our
laboratory for many years (40). Cells were routinely
maintained in improved minimal essential medium (IMEM) plus 5% fetal
bovine serum (Summit, Ft. Collins, Colo.), 2 mM glutamine, 50 IU of
penicillin/ml, and 50 µg of streptomycin/ml. Serum-free medium (SFM)
consisted of IMEM plus 10 mM HEPES (pH 7.4), 1 µg of transferrin/ml,
1 µg of fibronectin/ml, 2 mM glutamine, 50 IU of penicillin/ml, 50 µg of streptomycin/ml, and trace elements (Biofluids, Rockville,
Md.).
Cell stimulation and lysis.
Cells were plated at a density
of 5 × 105 per 6-cm-diameter dish (Becton Dickinson,
Lincoln Park, N.J.) and allowed to adhere to the dishes overnight. The
next day, the medium was changed to SFM, and 24 h later, the cells
were stimulated with various ligands for different periods of time. For
experiments using protease inhibitors, cells were first preincubated
with the inhibitors (lactacystin [final concentration, 10 µM] and
MG132 [final concentration, 50 µM], both in dimethyl sulfoxide
[DMSO]) for 30 min prior to stimulation in the presence of an
inhibitor. For experiments using PD098059 (25 µM), LY294002 (25 µM), or wortmannin (250 nM), cells were again first preincubated for
30 min with an inhibitor and then stimulated in the presence of the
inhibitor as described previously (24). Control cells were
incubated with a similar concentration of DMSO alone. After
stimulation, cells were washed twice with cold phosphate-buffered
saline and then lysed in 150 µl of TNESV buffer, which included fresh
protease inhibitors (50 mM Tris-HCl [pH 7.4], 1% NP-40, 3 mM EDTA,
100 mM NaCl, 10 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl
fluoride, 20 µg of leupeptin/ml, and 20 µg of aprotinin/ml).
Lysates were clarified by centrifugation at 14,000 × g
for 15 min at 4°C and stored at Immunoblotting.
Total protein (50 µg) was resuspended in
denaturing sample loading buffer (3% dithiothreitol, 0.1 M Tris-HCl
[pH 6.8], 4% sodium dodecyl sulfate [SDS], 0.2% bromophenol blue,
20% glycerol), separated by SDS-8% polyacrylamide gel
electrophoresis (PAGE), and electrophoretically transferred to a
nitrocellulose membrane overnight at 4°C. The remaining steps were
all performed at room temperature. The membrane was blocked with 5%
milk-TBST (0.15 M NaCl, 0.01 M Tris-HCl [pH 7.4], 0.05% Tween 20)
for 1 h. For antiphosphotyrosine immunoblotting, the membrane was
washed six times, for 5 min each time, with TBST and then incubated
with a 1:1,000 dilution of a horseradish peroxidase (HRP)-linked
primary antibody (RC20; Transduction Laboratories, Lexington, Ky.) in TBST. After the membrane was washed six times (5 min each time) with
TBST, bands were visualized by enhanced chemiluminescence (ECL) in
accordance with the manufacturer's instructions (Pierce). For
phosphorylated-ERK immunoblotting (New England Biolabs, Beverly, Mass.), the membrane was washed six times (5 min each time) with TBST
and incubated with a 1:1,000 dilution of primary antibody in TBST.
After 1 h, the membrane was again washed six times (5 min each
time) with TBST and then incubated with an HRP-linked donkey
anti-rabbit antibody (Amersham) at a dilution of 1:1,000 in TBST-5%
milk. After the membrane was washed six times (5 min each time) with
TBST, bands were visualized by ECL according to the
manufacturer's instructions (Pierce). IRS-1 (Upstate Biotechnology, Lake Placid, N.Y. [UBI]) antibodies were used at a final
concentration of 0.35 µg/ml, and IRS-2 (UBI) and total MAPK (UBI)
antibodies were used at 1 µg/ml. For these blots, the membrane
was not washed after the blocking step but was immediately incubated
with a 1:1,000 dilution of the primary antibody in TBST-5%
milk. After 1 h, the membrane was washed six times (5 min each
time) with TBST and then incubated with an HRP-linked donkey
anti-rabbit antibody diluted 1:1,000 in TBST-5% milk. After the
membrane was washed six times (5 min each time) with TBST, bands were
visualized by ECL according to the manufacturer's suggestions (Pierce).
Plasmids and transient transfection.
An expression plasmid
for hemagglutinin (HA)-tagged ubiquitin (HA-Ub) was constructed by
removing HA-Ub (a 330-bp fragment) from YEp112 (21) by
EcoRI and KpnI digestion. This fragment was
cloned into pSP72, then excised by EcoRI and XbaI
digestion, and subcloned into pcDNA3.1 to generate pcDNA-HAUb.
flag-IRS-1 was constructed by first performing genomic PCR on an
N-terminal fragment of human IRS-1 from MCF-7 cells, using the primers
5'CAAGTTGAATTCGCCGCCACCATGGACTACAAGGACGACGATGACAAGGCGAGCCCTCCGGAGAGCGAT (EcoRI site, Kozak consensus sequence, flag epitope,
and IRS-1) and 3'GCCGACTCTAGACTACTTGCTGGTCAGGCAAAGGCGGTAGAT,
which inserted an N-terminal flag epitope. The 1.3-kb fragment
was cut with EcoRI (in the 5' primer) and an internal
XhoI. A C-terminal fragment of IRS-1 was digested from IRS-1
cDNA by XhoI and HindIII digestion, the two
fragments were ligated together with the XhoI sites, and then the full-length flag-IRS-1 was cloned into EcoRI and
HindIII sites in pcDNA3.1. The construct was sequenced
to confirm its identity. COS-7 cells were transiently transfected by
using Lipofectin in accordance with the manufacturer's instructions.
Cells were transfected with 0.5 µg of pcDNA-HAUb plus pflagIRS-1,
pcDNA-HAUb alone, pflagIRS-1 alone, or pCDNA3.1 (as a control). After
8 h of transfection, the medium was changed to SFM, and 16 h
later, cells transfected with pcDNA-HAUb and pflagIRS-1 were
stimulated, or not, with IGF-I (5 nM) for 2 h. All cells were
lysed in TNESV buffer, and 500 µg of protein was precleared with 25 µl of a protein A-agarose solution for 30 min at 4°C and then
immunoprecipitated with 2 µg of antiflag antibody (Sigma) overnight
at 4°C. The next day, 25 µl of protein A-agarose (Pierce) was
added, and the suspension was incubated for a further 4 h with
rocking at 4°C. The beads were washed three times with TNESV,
resuspended in 40 µl of 1× sample loading buffer, and boiled, and
polypeptides were separated by SDS-8% PAGE. After transfer of
polypeptides to a nitrocellulose membrane, immunoblotting was performed
with a 1:1,000 dilution of an antibody against HA (Babco).
Pulse-chase labeling of MCF-7 cells and immunoprecipitation of
IRS-1.
MCF-7 cells were plated at a density of 106 per
10-cm-diameter dish, allowed to adhere overnight, and then incubated in
SFM for 24 h. Cells were incubated in depletion medium (minimal
essential medium) lacking methionine and cysteine but supplemented with 2 mM glutamine) for 1 h and then in labeling medium (depletion medium plus 300 µCi of
[35S]methionine-[35S]cysteine/dish) for
1 h. Labeling medium was removed, the dishes were washed five
times with chase medium (depletion medium plus 2 mM methionine, 2 mM
cysteine, 2 mM glutamine), and then cells were incubated with chase
medium with or without IGF-I (10 nM). Cells were lysed in 400 µl of
TNESV and then precleared with 25 µl of protein A-agarose for 30 min
at 4°C, and IRS-1 was immunoprecipitated with 5 µl of IRS-1
antibodies (UBI) overnight at 4°C. A 25-µl volume of protein
A-agarose was added, and after 4 h, the cells were washed five
times with TNESV buffer. The beads were resuspended in 40 µl of 1×
sample loading buffer, and polypeptides were separated by SDS-6%
PAGE. The gel was treated with a fluorography reagent (EnHance; NEN)
and dried. Densitometry was performed with a Molecular Dynamics PhosphorImager.
IGF-I stimulation decreases IRS-1 expression in a time- and
dose-responsive manner.
MCF-7 breast cancer cells were stimulated
with IGF-I (10 nM), lysed, and immunoblotted for
phosphotyrosine-containing proteins. After 15 min of IGF-I stimulation,
a single protein of ~170 kDa (the molecular mass of IRS-1) was
readily detectable by immunoblotting with antiphosphotyrosine (Fig.
1A, top panel). A longer incubation with
IGF-I (2 h) caused an increase in the molecular mass of this protein
and a decrease in phosphorylation of tyrosines. Immunoblotting for
IRS-1 revealed a similar migration pattern with a decrease in IRS-1
levels after 2 h of IGF-I stimulation (Fig. 1A, bottom panel).
Immunoprecipitation with IRS-1 antibodies followed by immunoblotting
with antiphosphotyrosine detected the tyrosine-phosphorylated band,
indicating that this is tyrosine-phosphorylated IRS-1. However, upon
immunoblotting for IRS-1, we again noted that 2 h of incubation with IGF-I resulted in a shift in the size of IRS-1 and also a significant decrease in IRS-1 expression. Stimulation of cells for
8 h with IGF-I (Fig. 1B) resulted in a dramatic decrease in the
electromobility of IRS-1, seen on both IRS-1 and antiphosphotyrosine immunoblots, suggesting that this represents a hyperphosphorylated form. Furthermore, there was a dramatic decrease in the level of IRS-1
protein. A longer incubation with IGF-I (24 h) resulted in a doublet of
the hyperphosphorylated form and a less phosphorylated form. At 48 h, most of the IRS-1 migrated at the same molecular mass as IRS-1 under
SFM conditions. It should be noted that in SFM, IRS-1 levels did not
alter over time course of the experiment, indicating that the decrease
in IRS-1 expression was a ligand-mediated event. The apparent decrease
in IRS-1 expression was not a result of an inability of the IRS-1
antibody to recognize phosphorylated IRS-1, since a different
IRS-1 antibody, which recognizes a different epitope (pleckstrin
homology [PH] domain), gave identical results (data not shown).
Furthermore, the decrease in IRS-1 was not due to a differential
intracellular localization that resulted in a poor extraction by TNESV
lysis buffer, since identical results were obtained with 5% SDS lysis
buffer (data not shown).
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Insulin-Like Growth Factor I-Induced Degradation of
Insulin Receptor Substrate 1 Is Mediated by the 26S Proteasome and
Blocked by Phosphatidylinositol 3'-Kinase Inhibition


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
/
interferon (for a review, see reference 66).
Following activation, IRS-1 binds a diverse set of downstream signaling
molecules including p85, Grb2, Nck/Crk, Syp/Fyn, and SHP2
(66). Through a poorly defined mechanism, IRS-1 can also
bind other proteins, including simian virus 40 large T antigen
(8), 14-3-3 (27, 39), and
v
3 integrin (64). The
complexity of IRS-1 upstream and downstream signaling reflects an
emerging concept of complex cross-talk between extracellular and
intracellular signaling pathways and may place IRS molecules in a
central position to coordinate multiple signaling pathways (41). The discovery of IRS-2 (58), IRS-3
(31, 50, 55), and IRS-4 (30) has expanded the
potential number of divergent signaling pathways.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
20°C. Protein concentrations were
determined by the bicinchoninic acid method in accordance with the
manufacturer's (Pierce, Rockford, Ill.) instructions.
![]()
RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

View larger version (23K):
[in a new window]
FIG. 1.
IRS-1 is tyrosine phosphorylated and then degraded after
IGF-I stimulation. (A) MCF-7 cells were incubated in SFM for 24 h
and then stimulated with IGF-I (10 nM) for 15 min and 2 h. Cells
were lysed in TNESV buffer, and 300 µg of the resultant protein was
used for immunoprecipitation experiments with antibodies to IRS-1.
Total cell lysate (lanes 1 to 3 from left) and immunoprecipitated
proteins (IP:IRS-1) (lane 4 to 6 from left) were separated by SDS-8%
PAGE and immunoblotted with antiphosphotyrosine (PY) or anti-IRS-1
(IRS-1) antibodies. (B) MCF-7 cells were treated as described for panel
A, but no immunoprecipitation was performed. (C) MCF-7 cells were
incubated with IGF-I (0, 0.1, 1, and 10 nM) for 8 h and lysed, and
the resulting lysate was treated as described for panel A. All
immunoblots are representative of at least four independent
experiments. (D) MCF-7 cells were labeled with
[35S]methionine-[35S]cysteine for 1 h,
incubated in chase medium with or without IGF-I (5 nM), and then lysed
at the indicated time points. Lysates were immunoprecipitated with
anti-IRS-1 antibodies and separated by SDS-PAGE, and the gel was then
dried. Densitometry was performed with a PhosphorImager. Results are
expressed as percentages of the densitometric reading at 0 h. This
figure is representative of two independent experiments.
Increased insulin concentrations result in decreased IRS-1
expression.
It has previously been shown that insulin at high
(micromolar) concentrations causes a decrease in IRS-1 expression
(23, 47). We therefore tested the ability of insulin, at low
(nanomolar) and at high (micromolar) concentrations, to decrease IRS-1
expression in MCF-7 cells (Fig. 2).
Short-term (10-min) stimulation of MCF-7 cells with IGF-I (10 nM) or a
nanomolar (0.01 µM) or micromolar (10 µM) concentration of insulin
resulted in phosphorylation of IRS-1 tyrosine residues but did not
affect IRS-1 expression (compare lanes 1, 4, 7, and 10). Longer
incubations (2 and 8 h) with a low concentration of insulin (0.01 µM) resulted in a sustained increase in phosphorylation of IRS-1
(compare lanes 4 to 6 with lanes 1 to 3). At this concentration,
insulin had no effect on total IRS-1 expression. In contrast,
stimulation of cells with 10 µM insulin, a concentration previously
shown to cause a decrease in IRS-1 expression (47), resulted
in greater tyrosine phosphorylation of IRS-1 than did a nanomolar
concentration of insulin (compare lane 7 with lane 4) and also caused a
decrease in IRS-1 expression after 2 and 8 h (lanes 8 and 9). The
pattern of phosphorylation and expression of IRS-1 with 10 µM insulin
was similar to that seen when cells were treated with IGF-I at 10 nM
(lanes 10 to 12).
|
IGF-I and insulin differ in duration of activation of ERK.
To
examine whether the differential length of activation of IRS-1 by
insulin and IGF-I affected downstream signaling events, we measured
activation of ERK. MCF-7 breast cancer cells were stimulated with IGF-I
(10 nM) or insulin (10 nM) for various periods of time. IGF-I
stimulation resulted in a time-dependent phosphorylation of IRS-1
tyrosines (Fig. 3). Insulin stimulation
resulted in phosphorylation of IRS-1 tyrosine residues, but in contrast
to IGF-I, phosphorylation was maintained throughout the length of the
stimulation. Immunoblotting for phosphorylated ERK1/2 revealed that
IGF-I caused a rapid increase in phosphorylation of ERK after 15 min,
after which phosphorylation decreased, whereas insulin caused a
sustained activation of ERK over the 24-h period. Immunoblots were
probed with antibodies to ERK, and equal levels were observed in all
lanes, suggesting that IGF-I does not affect ERK levels in a manner
similar to IRS-1 (data not shown).
|
IGF-I-stimulated degradation of IRS-1 results in a decreased amount
of tyrosine-phosphorylated IRS-1 when cells are restimulated with
IGF-I.
Evidence suggests that phosphorylation of IRS-1 tyrosines
is a rate-limiting step in IGF-I-mediated signal transduction. Our group and others have shown that IRS-1 expression can be regulated by
the estrogen receptor (32, 48). Estrogen treatment of MCF-7 cells increased IRS-1 expression, and antiestrogen treatment decreased it. The reduced level of IRS-1 expression after antiestrogen treatment resulted in a decreased amount of total tyrosine-phosphorylated IRS-1
following IGF stimulation and reduced downstream signaling through
ERK1/2. Therefore, we next tested whether the decrease in IRS-1
expression after IGF treatment would also result in a decreased total
amount of tyrosine-phosphorylated IRS-1 if cells were restimulated with
IGF-I. As a control, we also decreased IRS-1 expression by the use of
the antiestrogen ICI 182780. MCF-7 cells were stimulated with IGF-I (10 nM) or ICI 182780 (1 µM) for 24 h and then were or were not
restimulated with IGF-I (10 nM) for 10 min. As expected, compared to
treatment with SFM, both IGF-I and ICI 182780 resulted in decreased
IRS-1 expression (Fig. 4A, bottom panel).
Cells that were incubated in SFM for 24 h and then stimulated with
IGF-I for 10 min showed a rapid increase in tyrosine phosphorylation of
IRS-1 (Fig. 4A, top panel). Cells that had been prestimulated with
IGF-I for 24 h showed weak tyrosine phosphorylation of IRS-1
remaining from that preincubation. IGF-I stimulation now resulted in
lower levels of tyrosine-phosphorylated IRS-1 than were found in cells
incubated in SFM. However, the reduction in tyrosine-phosphorylated
IRS-1 directly paralleled the decrease in total IRS-1 expression (Fig.
4B), suggesting that there had been no change in the ability to
phosphorylate IRS-1 but simply a decrease in the total amount of
tyrosine-phosphorylated IRS-1. Reduction of IRS-1 expression by ICI
182780 resulted in a reduced amount of tyrosine-phosphorylated IRS-1
compared to cells incubated with SFM and mimicked exactly the effect of
IGF-I pretreatment. We have shown previously that this type of
reduction affects downstream IGF signaling, such as ERK activation
(32).
|
IRS-1 is degraded by the 26S proteasome in response to IGF-I.
An important mechanism for degradation of a number of critical
signaling molecules is the ubiquitin-mediated 26S proteasome activity
(20, 43). We used the 26S proteasome inhibitors MG132 and
lactacystin (11, 12) to investigate the effect of 26S proteasome activity on IGF-I-mediated degradation of IRS-1. MCF-7 cells
were preincubated for 30 min with or without MG132 (50 µM) or
lactacystin (10 µM) and then stimulated with IGF-I for 24 h in
the absence or presence of the inhibitor. In the absence of the
inhibitor, IGF-I caused phosphorylation of IRS-1 tyrosines (Fig.
5A, top panel), which was associated with
a decrease in IRS-1 expression (Fig. 5A, bottom panel). In the presence
of MG132 or lactacystin, IGF-I treatment resulted in a sustained
tyrosine phosphorylation of IRS-1 resulting from a failure to cause
degradation of IRS-1. The inhibition of IRS-1 degradation by
lactacystin also resulted in an increase in the phosphorylation of
IRS-1 tyrosine residues following IGF stimulation. Lactacystin was also
able to efficiently block the dose-responsive, IGF-mediated degradation of IRS-1 compared to that evident in DMSO-treated cells (Fig. 5B), and
this again resulted in sustained tyrosine phosphorylation of IRS-1.
|
IRS-1-ubiquitin association is increased by IGF-I.
Proteins
are targeted for 26S proteasome degradation by covalent attachment of a
76-amino-acid polypeptide termed ubiquitin (43). We next
sought to establish whether ubiquitin binds directly to IRS-1. COS-7
cells were transiently transfected with expression plasmids for
flag-IRS-1 and HA-Ub. Cells transfected with both expression plasmids
were stimulated with 10 nM IGF-I (lane 2) for 2 h; after the cells
were lysed, the lysate was immunoprecipitated with antiflag antibodies
and immunoblotted with anti-HA antibodies (Fig.
6). Expression of a control plasmid
(pcDNA3), flag-IRS-1, or HA-Ub alone resulted in no detectable bands
upon HA immunoblotting (lanes 3 to 5). When both flag-IRS-1 and HA-Ub
were coexpressed, their association was revealed by flag
immunoprecipitation and HA immunoblotting (lane 1), giving a band at
the position corresponding to the molecular mass of IRS-1 (~170 kDa).
Furthermore, IGF-I stimulation of cells increased the association of
flag-IRS-1 and HA-Ub (lane 2).
|
IGF-I-mediated degradation of IRS-1 is blocked by inhibitors of
PI3K.
To determine if IGF-I-induced degradation of IRS-1 was a
negative-feedback mechanism that resulted from downstream signals that
might be elicited through IRS-1, we inhibited two well-characterized pathways activated by IRS-1, the ERK and PI3K pathways. Duplicate plates of MCF-7 cells were preincubated with PD098059 (an ERK inhibitor) or LY294002 (a PI3K inhibitor) for 30 min and then either
were or were not stimulated with IGF-I in the presence of the inhibitor
for a further 6 or 24 h (Fig. 7).
IGF-I treatment (6 h) caused phosphorylation of IRS-1 tyrosines and a
decrease in IRS-1 expression. A longer IGF-I treatment (24 h) resulted in a further decrease in IRS-1 phosphorylation that was associated with
a decrease in IRS-1 expression. Cotreatment of cells with PD098059 did
not affect the ability of IGF to phosphorylate or degrade IRS-1. In
contrast, blockade of PI3K with LY294002 completely inhibited
IGF-I-mediated IRS-1 degradation at both 6 and 24 h. The result of
inhibition of degradation was an increase in tyrosine phosphorylation
of IRS-1, similar to the results seen with blockade of the proteasome
by lactacystin (Fig. 5). Interestingly, LY blocked the supershift that
was caused by IGF-I, which presumably represents the serine
phosphorylation of IRS-1 shown by others previously (25). A
similar inhibition of IRS-1 degradation was seen with wortmannin (250 nM), another PI3K inhibitor (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
IRS-1 is an important downstream signaling molecule for a number of divergent signaling pathways (66). In particular, IRS-1 seems to play a critical role in the proliferative response to insulin and IGF-I. In vitro observations implicating IRS-1 in cell proliferation are substantiated by the fact that at birth, IRS-1 knockout mice (4) are smaller than their wild-type littermates, similar to IGF ligand and IGF receptor knockouts (6, 33). Because most important growth-regulatory genes are under strict regulatory control, we examined the feedback mechanisms controlling IRS-1 action.
Long-term (8- to 48-h) incubation of MCF-7 cells with IGF-I resulted in
a decrease in IRS-1 protein expression. We have shown here that this
degradation is a posttranscriptional event that can be blocked by
inhibitors of the 26S proteasome, implicating ubiquitin activity as a
signal for IRS-1 degradation. In confirming this, we have shown that
IRS-1 and ubiquitin associate in vivo and that this association is
increased by IGF treatment. IRS-1 was degraded in all cell types that
exhibited phosphorylation of IRS-1 tyrosine residues in response to
IGF-I, but it was not degraded in cells that failed to cause
phosphorylation of IRS-1 tyrosines. Furthermore, the level of IRS-1
expression did not change when cells were incubated in SFM alone, and
basal IRS-1 expression was not affected by lactacystin, indicating that
proteasome degradation of IRS-1 is an IGF-mediated,
phosphorylation-dependent event. Insulin-dependent proteasome-mediated
degradation of IRS-1 has recently been shown to occur in CHO cells that
overexpress the insulin receptor and IRS-1 (56). In these
cells, insulin caused degradation of IRS-1, but the degradation was
blocked by proteasome inhibitors. Interestingly, insulin did not cause
degradation of IRS-2, suggesting that a motif in IRS-1 is responsible
for ligand-dependent degradation. Proteasome-mediated degradation of
several proteins, including Stat1 (26), c-jun
(35), bcl-6 (37), and
-catenin,
(1), is regulated by phosphorylation. A recent genetic
analysis of yeasts has revealed a potential mechanism for
phosphorylation is a signal for ubiquitin degradation; this is termed
the F-box hypothesis. In this model, after a protein is phosphorylated,
it is recognized by a protein (the F-box receptor) containing a protein
recognition domain termed the F box (5, 52). A growing
family of proteins contain F-box domains but also have several other
protein-protein interaction domains (WD40, LRR, etc.). The F-box
receptor can then recruit E1 and E2 ubiquitin-activating and
-conjugating enzymes, which leads to polyubiquitination and degradation
of the protein. This model is extremely attractive for explaining part
of the specificity of ubiquitin degradation and may reveal in part the
importance of ubiquitin in such processes as the cell cycle
(28).
IRS-1 is a PEST (44)-containing protein with 11 potential repeats rich in proline, serine, and threonine residues (53). Recently, phosphorylation of PEST sequences has been implicated in ubiquitin degradation of a number of cell cycle-regulatory proteins, including cyclin D1 (13), cyclin E (65), and p27 (51). Indeed, it has been proposed that PEST sequences may be accountable in part for the F-box proteolysis pathway (14). However, PEST sequences do not completely identify proteins that will be degraded, since nearly one-third of all proteins contain PEST sequences and, often, deletion of the PEST sequence does not stabilize the protein's half-life.
Several reports have shown that high (micromolar) concentrations of insulin can desensitize cells to further insulin action in animals and in culture. Part of this desensitization may be a result of negative feedback in insulin signaling by degradation of IRS-1 (3, 7, 47). We have shown that in MCF-7 cells, nanomolar concentrations of IGF-I phosphorylate IRS-1 and cause a time- and dose-dependent decrease in IRS-1 expression. The same concentration of insulin weakly phosphorylates IRS-1 and fails to decrease IRS-1 expression. In contrast, insulin at chronically high (micromolar) doses phosphorylates IRS-1 to the same extent as IGF-I (10 nM) and is able to degrade IRS-1. Why is IRS-1 degraded in the presence of chronically high levels of insulin but not with nanomolar concentrations? First, high concentrations of insulin may simply increase insulin receptor-mediated phosphorylation of IRS-1 above a value threshold needed for IRS-1 degradation. Second, it is known that high concentrations of insulin can act through the IGF-IR (15). If the IGF-IR can mediate degradation of IRS-1 by activating different signal transduction pathways to insulin, then insulin acting through the IGF-IR would then be able to degrade IRS-1. Finally, it could be a combination of the two: insulin acts through the IGF-IR, which simply allows increased phosphorylation of IRS-1, which is then degraded. Recent data of Sun et al. (56) indicate that insulin can degrade IRS-1 in CHO cells only when IR is overexpressed. The increased level of IR causes increased phosphorylation of IRS-1 compared to insulin stimulation of cells with endogenous levels of IR and, thus, may again suggest that it is the level of IRS-1 phosphorylation that is the determining factor in its degradation.
The demonstrated inability of insulin at low concentrations to degrade IRS-1 is in contrast to data recently obtained in studies using 3T3-L1 adipocytes (45). In these cells, the scenario is the exact opposite of the situation we observed in MCF-7 cells. In 3T3-L1 adipocytes, insulin at low concentrations can degrade IRS-1. IGF-I at low concentrations fails to degrade IRS-1 and even causes a small transient increase (~140% of the control value) in IRS-1 expression. Interestingly, IGF-I at high concentrations was able to degrade IRS-1, possibly by acting through the IR. It will be important to compare the levels of activation of IRS-1 by insulin and IGF-I in MCF-7 cells and 3T3-L1 adipocytes to determine if the differences observed are simply a result of a cell-specific ability to phosphorylate IRS-1 or if there are actual receptor-specific signaling pathways. Although the ligands that degrade IRS-1 differ between our cell lines, data from studies of 3T3-L1 adipocytes have also shown that the ligand-mediated degradation of IRS-1 can be specifically blocked with inhibitors of PI3K. Interestingly, calpain activity has been implicated as a mechanism for degradation in 3T3-L1 adipocytes. However, this has been shown mainly in studies using a cell-free system and purified exogenous calpain (53, 54), and more studies are required to determine the potential mechanisms for degradation of IRS-1 in vivo.
The difference in the levels of IRS-1 activation and degradation by insulin and IGF-I may have important physiological consequences. For instance, due to the inability of insulin to degrade IRS-1, no decrease in IRS-1 phosphorylation over time was seen. This was reflected downstream by sustained activation of ERK. In contrast, IGF-I caused a transient phosphorylation of IRS-1 which resulted in a transient activation of ERK. In several different systems the difference between sustained and transient ERK activation has been shown to mediate differential signaling effects (62). The best characterized of these is the ability of nerve growth factor to cause sustained ERK phosphorylation, leading to differentiation in PC12 cells, whereas in the same cell line, epidermal growth factor causes a transient ERK activation that leads to proliferation (34).
Our data indicate that IGF-induced degradation of IRS-1 is mediated by PI3K signaling. This is consistent with data of Sun et al. (56) indicating that insulin-mediated degradation of IRS-1 in CHO cells is blocked by wortmannin. It is possible that the PI3K-mediated degradation of IRS-1 is the result of direct feedback from PI3K activated by IRS-1. Treatment of MCF-7 cells results in a rapid association of the p85 subunit of PI3K with IRS-1 (data not shown). While IGF-IR can also bind and activate PI3K after IGF treatment (61), the majority of PI3K signaling has been shown to occur via insulin receptor substrate molecules (36). It is known that PI3K can phosphorylate IRS-1 on serine residues (17, 29, 60); however, downstream targets of PI3K (e.g., Akt/PKB) are also able to phosphorylate IRS-1 (42). Two recent reports also suggest that PI3K may be involved in negative feedback of IGF signaling. Data from studies using bovine fibroblasts have also shown that pretreatment with insulin desensitizes cells to IGF-mediated proliferation (19). This is associated with decreased phosphorylation of IRS-2 after pretreatment with insulin. PI3K inhibitors can block the insulin pretreatment effect. Additionally, it has recently been shown that degradation of IRS-1 is needed for myoblast differentiation and that the degradation of IRS-1 can be blocked by PI3K inhibitors (49).
In summary, we have shown here that phosphorylation of IRS-1 by IGF-I results in IRS-1 degradation by the 26S proteasome. The degradation of IRS-1 is specifically blocked by two different inhibitors of PI3K but not by an inhibitor of MAPK kinase. This raises the possibility that IRS-1 activation of PI3K results in a direct negative-feedback mechanism that targets IRS-1 for degradation and thus blocks further IGF signaling. This may be an important mechanism for determining the response of a cell to stimuli that can activate IRS-1.
| |
ACKNOWLEDGMENTS |
|---|
We thank M. Hochstrasser for the HA-Ub construct (Yep112), E. Araki for the human IRS-1 cDNA (pblue-IRS-1), L. R. Dick for technical comments on lactacystin, and J. G. Jackson for helpful comments and suggestions.
This work was supported by Public Health Service (PHS) grants P50CA58183, R01CA74285 (D.Y.), and K01CA77674 (S.O.) and Cancer Center Support grant P30CA54174 from the National Cancer Institute, National Institutes of Health. A.V.L. is a recipient of a Susan G. Komen Breast Cancer Foundation award. This research was supported in part by an award to the University of Texas Health Science Center at San Antonio for the Research Resources Program for Medical Schools of the Howard Hughes Medical Institute (A.V.L.).
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Baylor College of Medicine, One Baylor Plaza MS:600, Houston, TX 77030. Phone: (713) 798-1624. Fax: (713) 798-1642. E-mail: avlee{at}bcm.tmc.edu.
Present address: Division of Nephrology, Department of Medicine,
University of Texas Health Science Center, San Antonio, TX 78284-7884.
Present address: Baylor College of Medicine, Houston, TX 77030.
§ Present address: University of Minnesota Cancer Center, Minneapolis, MN 55455.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Aberle, H.,
A. Bauer,
J. Stappert,
A. Kispert, and R. Kemler.
1997.
-Catenin is a target for the ubiquitin-proteasome pathway.
EMBO J.
16:3797-3804[CrossRef][Medline].
|
| 2. | Ahmad, F., and B. J. Goldstein. 1997. Effect of tumor necrosis factor-alpha on the phosphorylation of tyrosine kinase receptors is associated with dynamic alterations in specific protein-tyrosine phosphatases. J. Cell. Biochem. 64:117-127[CrossRef][Medline]. |
| 3. |
Araki, E.,
B. L. Haag III,
K. Matsuda,
M. Shichiri, and C. R. Kahn.
1995.
Characterization and regulation of the mouse insulin receptor substrate gene promoter.
Mol. Endocrinol.
9:1367-1379 |
| 4. | Araki, E., M. A. Lipes, M. Patti, J. C. Bruning, B. Haag III, R. S. Johnson, and C. R. Kahn. 1994. Alternative pathway of insulin-signaling in mice with targeted disruption of the IRS-1 gene. Nature 372:186-190[CrossRef][Medline]. |
| 5. | Bai, C., P. Sen, K. Hofmann, L. Ma, M. Goebl, J. W. Harper, and S. J. Elledge. 1996. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86:263-274[CrossRef][Medline]. |
| 6. | Baker, J., J. P. Liu, E. J. Robertson, and A. Efstratiadis. 1993. Role of insulin-like growth factors in embryonic and postnatal growth. Cell 75:73-82[CrossRef][Medline]. |
| 7. |
Cheatham, B.,
S. E. Shoelson,
K. Yamada,
E. Goncalves, and C. R. Kahn.
1993.
Substitution of the erbB-2 oncoprotein transmembrane domain activates the insulin receptor and modulates the action of insulin and insulin-receptor substrate 1.
Proc. Natl. Acad. Sci. USA
90:7336-7340 |
| 8. | D'Ambrosio, C., S. R. Keller, A. Morrione, G. E. Lienhard, R. Baserga, and E. Surmacz. 1995. Transforming potential of the insulin receptor substrate 1. Cell Growth Differ. 6:557-562[Abstract]. |
| 9. |
De Fea, K., and R. A. Roth.
1997.
Modulation of insulin receptor substrate-1 tyrosine phosphorylation and function by mitogen-activated protein kinase.
J. Biol. Chem.
272:31400-31406 |
| 10. | De Fea, K., and R. A. Roth. 1997. Protein kinase C modulation of insulin receptor substrate-1 tyrosine phosphorylation requires serine 612. Biochemistry 36:12939-12947[CrossRef][Medline]. |
| 11. |
Dick, L. R.,
A. A. Cruikshank,
A. T. Destree,
L. Grenier,
T. A. McCormack,
F. D. Melandri,
S. L. Nunes,
V. J. Palombella,
L. A. Parent,
L. Plamondon, and R. L. Stein.
1997.
Mechanistic studies on the inactivation of the proteasome by lactacystin in cultured cells.
J. Biol. Chem.
272:182-188 |
| 12. |
Dick, L. R.,
A. A. Cruikshank,
L. Grenier,
F. D. Melandri,
S. L. Nunes, and R. L. Stein.
1996.
Mechanistic studies on the inactivation of the proteasome by lactacystin: a central role for clasto-lactacystin beta-lactone.
J. Biol. Chem.
271:7273-7276 |
| 13. |
Diehl, J. A.,
F. Zindy, and C. J. Sherr.
1997.
Inhibition of cyclin D1 phosphorylation on threonine-286 prevents its rapid degradation via the ubiquitin-proteasome pathway.
Genes Dev.
11:957-972 |
| 14. | Elledge, S. J., and J. W. Harper. 1998. The role of protein stability in the cell cycle and cancer. Biochim. Biophys. Acta 1377:M61-M70[Medline]. |
| 15. |
Flier, J. S.,
P. Usher, and A. C. Moses.
1986.
Monoclonal antibody to the type I insulin-like growth factor (IGF-I) receptor blocks IGF-I receptor-mediated DNA synthesis: clarification of the mitogenic mechanisms of IGF-I and insulin in human skin fibroblasts.
Proc. Natl. Acad. Sci. USA
83:664-668 |
| 16. | Folli, F., C. R. Kahn, H. Hansen, J. L. Bouchie, and E. P. Feener. 1997. Angiotensin II inhibits insulin signaling in aortic smooth muscle cells at multiple levels. A potential role for serine phosphorylation in insulin/angiotensin II crosstalk. J. Clin. Investig. 100:2158-2169[Medline]. |
| 17. | Freund, G. G., J. G. Wittig, and R. A. Mooney. 1995. The PI3-kinase serine kinase phosphorylates its p85 subunit and IRS-1 in PI3-kinase/IRS-1 complexes. Biochem. Biophys. Res. Commun. 206:272-278[CrossRef][Medline]. |
| 18. | Goldstein, B. J. 1993. Regulation of insulin receptor signaling by protein-tyrosine dephosphorylation. Receptor 3:1-15[Medline]. |
| 19. |
Haddad, T. C., and C. A. Conover.
1997.
Insulin and interleukin-4 induce desensitization to the mitogenic effects of insulin-like growth factor-I. Pivotal role for insulin receptor substrate-2.
J. Biol. Chem.
272:19525-19531 |
| 20. | Hochstrasser, M. 1996. Ubiquitin-dependent protein degradation. Annu. Rev. Genet. 30:405-439[CrossRef][Medline]. |
| 21. |
Hochstrasser, M.,
M. J. Ellison,
V. Chau, and A. Varshavsky.
1991.
The short-lived MAT alpha 2 transcriptional regulator is ubiquitinated in vivo.
Proc. Natl. Acad. Sci. USA
88:4606-4610 |
| 22. | Hotamisligil, G. S., P. Peraldi, A. Budavari, R. Ellis, M. F. White, and B. M. Spiegelman. 1996. IRS-1-mediated inhibition of insulin receptor tyrosine kinase activity in TNF-alpha- and obesity-induced insulin resistance. Science 271:665-668[Abstract]. |
| 23. |
Inoue, G.,
B. Cheatham, and C. R. Kahn.
1996.
Different pathways of postreceptor desensitization following chronic insulin treatment and in cells overexpressing constitutively active insulin receptors.
J. Biol. Chem.
271:28206-28211 |
| 24. |
Jackson, J. G.,
M. F. White, and D. Yee.
1998.
Insulin receptor substrate-1 (IRS-1) is the predominant signaling molecule activated by insulin-like growth factor-I (IGF-I), insulin, and interleukin-4 (IL-4) in estrogen receptor-positive human breast cancer cells.
J. Biol. Chem.
273:9994-10003 |
| 25. |
Kanety, H.,
R. Feinstein,
M. Z. Papa,
R. Hemi, and A. Karasik.
1995.
Tumor necrosis factor alpha-induced phosphorylation of insulin receptor substrate-1 (IRS-1). Possible mechanism for suppression of insulin-stimulated tyrosine phosphorylation of IRS-1.
J. Biol. Chem.
270:23780-23784 |
| 26. |
Kim, T. K., and T. Maniatis.
1996.
Regulation of interferon-gamma-activated STAT1 by the ubiquitin-proteasome pathway.
Science
273:1717-1719 |
| 27. |
Kosaki, A.,
K. Yamada,
J. Suga,
A. Otaka, and H. Kuzuya.
1998.
14-3-3 protein associates with insulin receptor substrate 1 and decreases insulin-stimulated phosphatidylinositol 3'-kinase activity in 3T3L1 adipocytes.
J. Biol. Chem.
273:940-944 |
| 28. | Krek, W. 1998. Proteolysis and the G1-S transition: the SCF connection. Curr. Opin. Genet. Dev. 8:36-42[CrossRef][Medline]. |
| 29. |
Lam, K.,
C. L. Carpenter,
N. B. Ruderman,
J. C. Friel, and K. L. Kelly.
1994.
the phosphatidylinositol 3-kinase serine kinase phosphorylates IRS-1. Stimulation by insulin and inhibition by wortmannin.
J. Biol. Chem.
269:20648-20652 |
| 30. |
Lavan, B. E.,
V. R. Fantin,
E. T. Chang,
W. S. Lane,
S. R. Keller, and G. E. Lienhard.
1997.
A novel 160-kDa phosphotyrosine protein in insulin-treated embryonic kidney cells is a new member of the insulin receptor substrate family.
J. Biol. Chem.
272:21403-21407 |
| 31. |
Lavan, B. E.,
W. S. Lane, and G. E. Lienhard.
1997.
The 60-kDa phosphotyrosine protein in insulin-treated adipocytes is a new member of the insulin receptor substrate family.
J. Biol. Chem.
272:11439-11443 |
| 32. |
Lee, A. V.,
J. G. Jackson,
J. L. Gooch,
S. G. Hilsenbeck,
E. Coronado-Heinsohn,
C. K. Osborne, and D. Yee.
1999.
Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo.
Mol. Endocrinol.
13:787-796 |
| 33. | Liu, J. P., J. Baker, A. S. Perkins, E. J. Robertson, and A. Efstratiadis. 1993. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 75:59-72[Medline]. |
| 34. | Marshall, C. J. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80:179-185[CrossRef][Medline]. |
| 35. |
Musti, A. M.,
M. Treier, and D. Bohmann.
1997.
Reduced ubiquitin-dependent degradation of c-Jun after phosphorylation by MAP kinases.
Science
275:400-402 |
| 36. |
Myers, M. G., Jr.,
T. C. Grammer,
L. M. Wang,
X. J. Sun,
J. H. Pierce,
J. Blenis, and M. F. White.
1994.
Insulin receptor substrate-1 mediates phosphatidylinositol 3'-kinase and p70S6k signaling during insulin, insulin-like growth factor-1, and interleukin-4 stimulation.
J. Biol. Chem.
269:28783-28789 |
| 37. |
Niu, H.,
B. H. Ye, and R. Dalla-Favera.
1998.
Antigen receptor signaling induces MAP kinase-mediated phosphorylation and degradation of the BCL-6 transcription factor.
Genes Dev.
12:1953-1961 |
| 38. |
Noguchi, T.,
T. Matozaki,
K. Horita,
Y. Fujioka, and M. Kasuga.
1994.
Role of SH-PTP2, a protein-tyrosine phosphatase with Src homology 2 domains, in insulin-stimulated Ras activation.
Mol. Cell. Biol.
14:6674-6682 |
| 39. |
Ogihara, T.,
T. Isobe,
T. Ichimura,
M. Taoka,
M. Funaki,
H. Sakoda,
Y. Onishi,
K. Inukai,
M. Anai,
Y. Fukushima,
M. Kikuchi,
Y. Yazaki,
Y. Oka, and T. Asano.
1997.
14-3-3 protein binds to insulin receptor substrate-1, one of the binding sites of which is in the phosphotyrosine binding domain.
J. Biol. Chem.
272:25267-25274 |
| 40. | Osborne, C. K., K. Hobbs, and J. M. Trent. 1987. Biological differences among MCF-7 human breast cancer cell lines from different laboratories. Breast Cancer Res. Treat. 9:111-121[CrossRef][Medline]. |
| 41. |
Pawson, T., and J. P. Scott.
1997.
Signaling through scaffold, anchoring, and adaptor proteins.
Science
278:2075-2080 |
| 42. | Paz, K., R. Hemi, D. LeRoith, H. Kanety, and Y. Zick. 1998. The p-tyr binding (PTB) domain of insulin receptor substrate (IRS) proteins serves as a substrate for protein kinase B (PKB). Possible involvement of PKB in insulin resistance induced by hyperinsulinemia. Proc. Endocr. Soc. OR17-2:75. |
| 43. | Pickart, C. M. 1997. Targeting of substrates to the 26S proteasome. FASEB J. 11:1055-1066[Abstract]. |
| 44. | Rechsteiner, M., and S. W. Rogers. 1996. PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 21:267-271[CrossRef][Medline]. |
| 45. | Rice, K. M., and C. W. Garner. 1999. IGF-I regulates IRS-1 expression in 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun. 255:614-617[CrossRef][Medline]. |
| 46. |
Rice, K. M.,
G. E. Lienhard, and C. W. Garner.
1992.
Regulation of the expression of pp160, a putative insulin receptor signal protein, by insulin, dexamethasone, and 1-methyl-3-isobutylxanthine in 3T3-L1 adipocytes.
J. Biol. Chem.
267:10163-10167 |
| 47. | Rice, K. M., M. A. Turnbow, and C. W. Garner. 1993. Insulin stimulates the degradation of IRS-1 in 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun. 190:961-967[CrossRef][Medline]. |
| 48. | Salerno, M., D. Sisci, L. Mauro, M. A. Guvakova, S. Ando, and E. Surmacz. 1999. Insulin receptor substrate 1 is a target for the pure antiestrogen ICI 182,780 in breast cancer cells. Int. J. Cancer 81:299-304[CrossRef][Medline]. |
| 49. |
Sarbassov, D. D., and C. A. Peterson.
1998.
Insulin receptor substrate-1 and phosphatidylinositol 3-kinase regulate extracellular signal-regulated kinase-dependent and -independent signaling pathways during myogenic differentiation.
Mol. Endocrinol.
12:1870-1878 |
| 50. |
Sciacchitano, S., and S. I. Taylor.
1997.
Cloning, tissue expression, and chromosomal localization of the mouse IRS-3 gene.
Endocrinology
138:4931-4940 |
| 51. |
Sheaff, R. J.,
M. Groudine,
M. Gordon,
J. M. Roberts, and B. E. Clurman.
1997.
Cyclin E-CDK2 is a regulator of p27Kip1.
Genes Dev.
11:1464-1478 |
| 52. | Skowyra, D., K. L. Craig, M. Tyers, S. J. Elledge, and J. W. Harper. 1997. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91:209-219[CrossRef][Medline]. |
| 53. | Smith, L. K., M. Bradshaw, D. E. Croall, and C. W. Garner. 1993. The insulin receptor substrate (IRS-1) is a PEST protein that is susceptible to calpain degradation in vitro. Biochem. Biophys. Res. Commun. 196:767-772[CrossRef][Medline]. |
| 54. | Smith, L. K., K. M. Rice, and C. W. Garner. 1996. The insulin-induced down-regulation of IRS-1 in 3T3-L1 adipocytes is mediated by a calcium-dependent thiol protease. Mol. Cell. Endocrinol. 122:81-92[CrossRef][Medline]. |
| 55. | Smith-Hall, J., S. Pons, M. E. Patti, D. J. Burks, L. Yenush, X. J. Sun, C. R. Kahn, and M. F. White. 1997. The 60 kDa insulin receptor substrate functions like an IRS protein (pp60IRS3) in adipose cells. Biochemistry 36:8304-8310[CrossRef][Medline]. |
| 56. | Sun, X. J., J. L. Goldberg, L. Y. Qiao, and J. J. Mitchell. 1999. Insulin-induced insulin receptor substrate-1 degradation is mediated by the proteasome degradation pathway. Diabetes 48:1359-1364[Abstract]. |
| 57. | Sun, X. J., P. Rothenberg, C. R. Kahn, J. M. Backer, E. Araki, P. A. Wilden, D. A. Cahill, B. J. Goldstein, and M. F. White. 1991. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 352:73-77[CrossRef][Medline]. |
| 58. | Sun, X. J., L. M. Wang, Y. Zhang, L. Yenush, M. G. Myers, Jr., E. Glasheen, W. S. Lane, J. H. Pierce, and M. F. White. 1995. Role of IRS-2 in insulin and cytokine signalling. Nature 377:173-177[CrossRef][Medline]. |
| 59. |
Tanasijevic, M. J.,
M. G. Myers, Jr.,
R. S. Thoma,
D. L. Crimmins,
M. F. White, and D. B. Sacks.
1993.
Phosphorylation of the insulin receptor substrate IRS-1 by casein kinase II.
J. Biol. Chem.
268:18157-18166 |
| 60. | Tanti, J. F., T. Gremeaux, E. Van Obberghen, and Y. Le Marchand-Brustel. 1994. Insulin receptor substrate 1 is phosphorylated by the serine kinase activity of phosphatidylinositol 3-kinase. Biochem. J. 304:17-21. |
| 61. | Tartare-Deckert, S., J. Murdaca, D. Sawka-Verhelle, K. H. Holt, J. E. Pessin, and E. Van Obberghen. 1996. Interaction of the molecular weight 85K regulatory subunit of the phosphatidylinositol 3-kinase with the insulin receptor and the insulin-like growth factor-1 (IGF-I) receptor: comparative study using the yeast two-hybrid system. Endocrinology 137:1019-1024[Abstract]. |
| 62. | Tombes, R. M., K. L. Auer, R. Mikkelsen, K. Valerie, M. P. Wymann, C. J. Marshall, M. McMahon, and P. Dent. 1998. The mitogen-activated protein (MAP) kinase cascade can either stimulate or inhibit DNA synthesis in primary cultures of rat hepatocytes depending upon whether its activation is acute/phasic or chronic. Biochem. J. 330:1451-1460. |
| 63. |
Turnbow, M. A.,
S. R. Keller,
K. M. Rice, and C. W. Garner.
1994.
Dexamethasone down-regulation of insulin receptor substrate-1 in 3T3-L1 adipocytes.
J. Biol. Chem.
269:2516-2520 |
| 64. |
Vuori, K., and E. Ruoslahti.
1994.
Association of insulin receptor substrate-1 with integrins.
Science
266:1576-1578 |
| 65. | Won, K. A., and S. I. Reed. 1996. Activation of cyclin E/CDK2 is coupled to site-specific autophosphorylation and ubiquitin-dependent degradation of cyclin E. EMBO J. 15:4182-4193[Medline]. |
| 66. | Yenush, L., and M. F. White. 1997. The IRS-signalling system during insulin and cytokine action. Bioessays 19:491-500[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»