Previous Article | Next Article 
Molecular and Cellular Biology, March 2000, p. 1546-1552, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Recruitment of CREB Binding Protein Is
Sufficient for CREB-Mediated Gene Activation
Jean-Rene
Cardinaux,1
John C.
Notis,1
Qinghong
Zhang,1
Ngan
Vo,1
Johanna C.
Craig,1
Daniel M.
Fass,1
Richard G.
Brennan,2 and
Richard H.
Goodman1,*
Vollum Institute1 and
Department of Biochemistry,2 Oregon
Health Sciences University, Portland, Oregon 97201
Received 14 September 1999/Returned for modification 21 October
1999/Accepted 16 November 1999
 |
ABSTRACT |
Phosphorylation of the transcription factor CREB leads to the
recruitment of the coactivator, CREB binding protein (CBP). Recent
studies have suggested that CBP recruitment is not sufficient for CREB
function, however. We have identified a conserved protein-protein interaction motif within the CBP-binding domains of CREB and another transcription factor, SREBP (sterol-responsive element binding protein). In contrast to CREB, SREBP interacts with CBP in the absence
of phosphorylation. We have exploited the conservation of this
interaction motif to test whether CBP recruitment to CREB is sufficient
for transcriptional activation. Substitution of six nonconserved amino
acids from SREBP into the activation domain of CREB confers
high-affinity, phosphorylation-independent CBP binding. The mutated
CREB molecule, CREBDIEDML, activates transcription in F9
teratocarcinoma and PC12 cells even in the absence of protein kinase A
(PKA). Addition of exogenous CBP augments the level of transcription
mediated by CREBDIEDML, and adenovirus 12S E1A blocks transcription, implicating CBP in the activation process. Thus, recruitment of CBP to CREB is sufficient for transcriptional
activation. Addition of PKA stimulates transcription induced by
CREBDIEDML further, suggesting that a phosphorylation event
downstream from CBP recruitment augments CREB signaling.
 |
INTRODUCTION |
The signaling mechanism that
activates genes through the cyclic AMP (cAMP)-regulated enhancer (CRE)
(23) represents one of the most intensively studied
transcriptional pathways. This pathway consists of protein kinase A
(PKA), the transcription factor CREB, and the coactivator CREB binding
protein (CBP) (3, 7, 18). CBP has been shown to participate
in many additional transcriptional pathways as well (11),
but the mechanism by which it activates gene expression remains
uncertain. CBP and its homologue p300 interact with the basal
transcription factors TFIID and TFIIB, as well as with the RNA
polymerase II holoenzyme component, RNA helicase A (9, 24,
34), suggesting that one function of this coactivator is to
stabilize the preinitiation complex. Other studies have argued that
transcriptional activation through CBP/p300 occurs only in the context
of chromatin, however (17). The involvement of chromatin in
CBP function is consistent with the finding that CBP, and several
associated proteins including P/CAF, steroid receptor coactivator 1, and p/CIP, have the ability to acetylate the amino-terminal tails of
histone proteins (6, 31, 36, 38). These and other
posttranslational modifications of chromatin components induced by the
cAMP signaling cascade may stimulate transcription through nucleosome remodeling.
Of all transcription factor-CBP associations, only the interaction with
phosphorylated CREB has been characterized in detail. Our lab has
studied this association by using a fluorescence polarization binding assay and a genetic interaction assay in yeast (18, 30). These studies indicated that CREB phosphorylated at
Ser133 binds to CBP with an affinity of approximately 350 nM and that this interaction depends on the phosphorylated Ser residue
and several adjacent hydrophobic residues. Other laboratories have reached similar conclusions (26). Recently, the structure of the phosphorylated CREB-CBP complex has been solved by nuclear magnetic
resonance spectroscopy (28). These studies demonstrated the
importance of the phosphorylated serine in the CREB activation domain
and showed that the interaction of phosphorylated CREB with CBP
introduces structure into both components of the complex. Surprisingly, other transcription factors can interact with the CREB
binding domain of CBP in the absence of phosphorylation. How this CBP
domain participates in both phosphorylation-dependent and -independent
interactions is unknown.
Although it was once believed that CREB phosphorylation was sufficient
for gene activation, several studies have shown that these two events
can be dissociated. The first indication that CREB phosphorylation
might be insufficient for gene induction came from studies of the
c-fos promoter (10). In both PC12 cells and
primary neurons, depolarization activates the c-fos CRE in a
manner that is blocked by inhibitors of PKA, despite the fact that CREB
phosphorylation is maintained (16, 35). Precisely how PKA
contributes to depolarization-induced gene activation is unknown,
however. It is possible that PKA phosphorylates components of the
transcriptional machinery downstream from CREB; conceivably, these
other phosphorylation events could augment, or even be required for,
the transcriptional response. Xu et al. (37) have suggested that PKA phosphorylates CBP directly, while Zanger et al.
(39) have argued that PKA might affect a step downstream
from CBP. Calcium-activated kinases, such as
Ca2+/calmodulin kinase IV (CaMKIV), have also been proposed
to augment transcription via CBP phosphorylation (5, 13,
14). Many of these experiments are problematic, however, because
they are based on the analysis of GAL-CBP fusion proteins, several of
which appear to activate transcription more potently than the
full-length native protein (34). Thus, it is likely that the
transcriptional activation function of these fragments is masked by the
conformation of native CBP. Moreover, this conformation might not be
recapitulated precisely in a molecule that is targeted to a promoter
through a heterologous DNA binding domain at its amino terminus. Thus, how various kinases such as PKA contribute to CBP signaling remains uncertain.
By comparing the activation domain sequences of CREB and other
transcription factors, we hoped to elucidate whether
phosphorylation-dependent and -independent factors interact with CBP in
a similar manner. We identified a region of homology between CREB and
the sterol-responsive element binding protein (SREBP), a transcription
factor that also interacts with the CREB-binding domain of CBP
(25). SREBP is responsible for the transcriptional
regulation of several key enzymes involved in cholesterol metabolism,
including HMG-coenzyme A reductase, HMG coenzyme A synthase, and the
low-density lipoprotein receptor (25).
By substituting amino acids from the activation domain of SREBP into
CREB, we sought to develop a CREB molecule that could interact with CBP
in the absence of phosphorylation. We then used this mutated CREB
molecule to determine whether CBP recruitment alone was sufficient for
gene activation. Studies from our lab and others have shown that PKA
augments GAL-CBP function, but as indicated above, these experiments
are problematic. We used the constitutively active CREB mutant to test
whether PKA can facilitate transcription through a step downstream from
CBP recruitment.
 |
MATERIALS AND METHODS |
Plasmids.
pGEX-3T4-SREBP1a1-50 was kindly
provided by R. Tjian (University of California, Berkeley). Mutants mt1
to mt18 were derived directly from this vector by site-directed
mutagenesis. pGEX-KG-CREB1-290 was constructed by inserting
a PCR-generated fragment of rat CREB341 encoding amino
acids 1 to 290 into the BamHI/HindIII sites
of pGEX-KG. pRc/RSV-FLAG-CREB was constructed by inserting a synthetic, oligonucleotide-derived fragment encoding the FLAG epitope (DYKDDDDK) into the first NcoI site (amino acid position 3) of
pRc/RSV-CREB341 (20).
pRc/RSV-FLAG-CREBDIEDML was generated by site-directed mutagenesis of pRc/RSV-FLAG-CREB. The CRE-chloramphenicol
acetyltransferase (CAT) reporter is the somatostatin-CAT fusion gene
(
71) described in Montminy et al. (23).
pRc/RSV-GAL4-CREB was constructed by cloning GAL4-CREB4-283
(33) into pRc/RSV. GAL4-CREB4-283 encodes amino
acids (aa) 1 to 147 of GAL4 fused to the N terminus of the CREB
activation domain (aa 4 to 283). pRc/RSV-GAL4-CREBDIEDML was constructed as described above after site-directed mutagenesis. The
GAL4-LUC (luciferase) reporter is 5XGAL4-TATA-Luciferase described by
Sun et al. (32). pRSV-
-GAL contains the
-galactosidase gene driven by the Rous sarcoma virus (RSV) long terminal repeat. pRc/RSV-E1A-12S was described by Lundblad et al. (21), and
pRc/RSV-CREB-M1 was described by Loriaux et al. (20).
RSV-PKA was obtained from R. Maurer (Oregon Health Sciences
University). Mutagenesis was performed using a QuikChange site-directed
mutagenesis kit (Stratagene) according to the manufacturer's protocols.
CBP binding assay.
HeLa cell nuclear extract was prepared as
described elsewhere (4) from HeLa-S3 cells provided by the
National Cell Culture Center, Minneapolis, Minn. Glutathione
S-transferase (GST)-CREB1-290 was
phosphorylated with PKA for 1 h at 30°C as described by Laurance et al. (19). Five micromolar GST, GST-CREB1-290,
or GST-SREBP1a1-50 was incubated with 10 µl of
glutathione-Sepharose beads (Pharmacia) in 150 µl of buffer A (50 mM
HEPES [pH 7.6], 1 M NaCl, 0.2% NP-40, 0.1 mM EDTA, 1 mM
dithiothreitol [DTT]) for 1 h at 4°C. The beads were washed
twice with 1 ml of buffer A and twice with 1 ml of HEG100 (20 mM HEPES
[pH 7.6], 10% glycerol, 100 mM KCl, 0.2 mM EDTA, 1 mM DTT). The
GST-CREB bound beads were incubated with 900 µg of HeLa nuclear
extract in 400 µl of HEG100 plus protease inhibitors (Complete;
Boehringer Mannheim), 10 µM NaF, and 0.4 µM microcystin for 2 h at 4°C. The GST-SREBP-bound beads were incubated with 150 µg of
HeLa nuclear extract in 400 µl of HEG100 plus protease inhibitors for
2 h at 25°C. The beads were washed three times with 1 ml of
HEGN300 (20 mM HEPES [pH 7.6], 10% glycerol, 300 mM KCl, 0.1 mM
EDTA, 0.1% NP-40, 1 mM DTT), resuspended in 15 µl of sodium dodecyl
sulfate (SDS) loading buffer, heated to 95°C for 5 min, and
electrophoresed on an SDS-6% polyacrylamide gel. After transfer to a
polyvinylidene difluoride membrane, CBP was detected by Western
blotting using a polyclonal antibody directed against
CBP451-682. PKA was a gift from R. Maurer.
Protein expression and purification.
The CREB proteins used
in the fluorescence polarization binding assays contain three Cys-Ser
mutations (Cys300, Cys310, and Cys337) in the DNA-binding domain. Construction and
expression of this vector (CREB/Ser) are described by Richards et al.
(29). The serine mutations in CREB/Ser improve protein
solubility but do not alter DNA binding, as demonstrated by the similar
affinities of CREB/Ser and wild-type CREB to the CRE (29).
CREB/Ser was phosphorylated stoichiometrically using the purified
catalytic subunit of PKA in 50 mM morpholinepropanesulfonic acid (pH
6.8)-50 mM NaCl-2 mM MgCl2-1 mM DTT-1 mM ATP. The
reaction mixture was incubated at 30°C for 20 min. Residual ATP was
removed by dialysis against 10 mM Tris buffer (pH 8.0). Expression of
the CBP fragment was as described previously (18).
Fluorescence polarization measurements.
Fluorescence
polarization measurements were determined using a PanVera 2000 fluorescence polarization system. Samples were excited at 490 nm, and
emission was measured at 510 nm. A 5'-fluoresceinated oligonucleotide
corresponding to the top strand of the somatostatin CRE (5'
CCTGACGTCAGCCCCCTGACGTCAGG 3') was
purchased from Gibco BRL. This oligonucleotide was constructed to form
a double-stranded CRE site (boldface) with a five-nucleotide hairpin loop. The binding reaction mixtures contained 1 nM fluoresceinated oligonucleotide in 25 mM Tris-HCl (pH 7.6)-50 mM NaCl-5 mM
MgCl2-0.1 mM EDTA-1 mM DTT-5% glycerol-10 µg of
poly(dI-dC)/ml-60 nM CREB. The reaction mixtures were titrated with
successive additions of CBP (aa 451 to 682) from 0 to 2 µM. The stock
concentration of CBP used for these titrations was high enough that the
total volume did not have to be increased by more than 10%. Binding reactions were performed at 25°C, and samples were incubated for 2 min to achieve equilibrium of the complex formation. The binding curves
were fit with a nonlinear least squares regression analysis. In
addition to the rectangular hyperbolic binding function, the equation
utilized for curve fit determination included a nonspecific component
to account for the linear increase in polarization at higher protein concentrations.
Cell culture and transfection assays.
F9 teratocarcinoma
cells were cultured on gelatin-coated plates in Dulbecco's modified
Eagle's medium supplemented with 10% heat-inactivated fetal calf
serum, penicillin G (100 IU/ml), and streptomycin sulfate (100 mg/ml).
PC12 cells were cultured on poly-L-lysine-coated plates in
Dulbecco's modified Eagle's medium supplemented with 10%
heat-inactivated horse serum, 5% heat-inactivated fetal calf serum,
penicillin G (100 IU/ml), and streptomycin sulfate (100 mg/ml). F9
cells were seeded at 4 × 105 per 100-mm-diameter
plate, and PC12 cells were seeded onto eight 60-mm-diameter plates per
confluent 75-mm2 flask 24 h prior to transfection.
Supercoiled plasmid DNA was prepared by CsCl gradient centrifugation,
and transfections were carried out using the Gibco BRL calcium
phosphate transfection system (F9 cells) or the Qiagen SuperFect
reagent (PC12 cells). Cells were washed and fed after 24 h (F9
cells) or 3 h (PC12 cells) and allowed to grow for an additional
24 h (F9 cells) or 45 h (PC12 cells) before harvesting.
CRE-CAT and GAL4-LUC reporter activities were determined by CAT assay
(20) or luciferase assay, respectively, and normalized to
either total cellular protein (Bio-Rad protein assay) or
-galactosidase activity. All experiments were performed at least in triplicate.
 |
RESULTS |
Nuclear magnetic resonance analysis of the phosphorylated CREB-CBP
complex showed that after binding to CBP, CREB adopts a bihelical
conformation with the helical axes approximately perpendicular to one
another (28). The portion of SREBP1a that interacts with CBP
resides within its amino-terminal 50 aa (25). Only a region of 25 residues within this portion is conserved in the functionally related protein SREBP2 (15), suggesting that this smaller
domain is sufficient for CBP binding. Comparison of the primary
sequences of CREB and the 25-aa domain of SREBP1a revealed some
unexpected similarities, despite the fact that the two factors bind to
CBP through phosphorylation-dependent and -independent mechanisms. Figure 1a aligns the phosphorylated
Ser133 in CREB with an Asp in SREBP. Substitution of an Asp
for Ser133 in CREB is not sufficient for CBP binding
(8). A second Asp residue, which corresponds to
Ser142 in CREB, may represent a conservative change,
however. Mutation of CREB Ser142 to Asp has been shown to
have no effect on binding of phosphorylated CREB to CBP
(33). More importantly, the secondary structures of the CREB
and SREBP regions are also likely to be conserved, as both the amino-
and carboxy-terminal portions of the SREBP domain contain residues
typically found in
helices. We hypothesized, therefore, that CREB
and SREBP might contact CBP through related mechanisms.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Comparison of CBP interaction domains of CREB and
SREBP1a. Dots and numerals refer to residues in CREB known to be
critical for CBP binding; shading denotes homologous residues, with
identical positions in boldface. Underlined S and D residues represent
possible additional conservative substitutions. -Helical regions of
CREB in the complex with CBP extend from aa 120 to 129 and aa 134 to
144 (28). (b) Comparison of CBP-interacting domains of
SREBP1a, SREBP2, and Drosophila ci. Identical and conserved
residues are indicated as above.
|
|
To test this hypothesis, we mutated residues in SREBP that corresponded
to critical residues in CREB and measured the effects of these
substitutions on CBP binding. These assays were performed by incubating
HeLa cell nuclear extracts with GST or GST-SREBP1-50 fusion
proteins immobilized on glutathione beads. The bound proteins were
electrophoresed on SDS-polyacrylamide gels and immunoblotted using an
antibody that recognizes the CREB binding domains of CBP and its
homologue p300. Bacterially expressed fragments of CBP were also
tested. These studies confirmed that the first 50 residues of SREBP1a
bind to full-length CBP through a region previously identified as the
CREB-binding domain (data not shown).
Hydrophobic residues Leu128, Ile137,
Leu138, and Leu141 in CREB have been shown to
be essential for CBP binding (26, 28, 30). These residues
are represented by Leu, Leu, Ile, and Gln in SREBP1a (Fig. 1a).
Molecular modeling suggested that each of the substitutions should be
tolerated (unpublished observations), and alanine mutagenesis indicated
that these residues all contribute to SREBP-CBP binding (Fig.
2). The combination of all four mutations (mt10) blocked binding by 90%, and mutation of the residue
corresponding to CREB Leu128 was almost as effective (mt9).
On the other hand, some interactions known to be important for
phosphorylated CREB-CBP binding were not required for the SREBP
interaction. Perhaps most unexpected was the relative unimportance of
the Glu-Asp residues (mt1 and mt2), which were predicted to serve the
same function in SREBP as the phosphorylated Ser in CREB. To our
surprise, the negatively charged central portion of the SREBP
interaction domain was not essential. In fact, change of these residues
to Gln-Asn (mt1) or Ala-Ala (mt2) modestly increased the level of
binding.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Binding of full-length CBP to GST-SREBP mutants. The
schematic depicts mutants analyzed at the top. Numbers refer to amino
acid positions in CREB; dots refer to retained SREBP residues. (For
example, in mt1, the ED in SREBP is replaced by QN.) Percent binding
(compared to wild-type SREBP) is indicated on the right. NE, nuclear
extract.
|
|
Alignment of the CBP interaction domains of SREBP1a, SREBP2, and the
Drosophila cubitus interruptus (ci) provided
further insight into the determinants of coactivator binding (Fig. 1b). Drosophila ci is a particularly informative model because,
in addition to the standard biochemical analyses, we have shown in genetic studies that the mutant phenotype caused by ectopic
ci expression is suppressed by mutations in
Drosophila CBP (1). Moreover, point mutations in
ci that block association with Drosophila CBP
also block the ability of the transcription factor to activate its
endogenous target gene wingless (6a). As shown in
Fig. 2, mutation of the Met-Leu-Gln residues in SREBP to Ala (mt11)
completely blocks CBP binding. These residues are shared by SREBP1a,
SREBP2, and ci.
Having determined which residues in SREBP were required for CBP
binding, we next tested whether amino acid sequences from CREB could be
introduced into SREBP without disrupting the
phosphorylation-independent CBP interaction (Fig.
3a). For these studies, we introduced
blocks of amino acids from CREB into GST-SREBP1-50 and
monitored binding of full-length CBP in HeLa nuclear extracts.
Substitution of the Arg-Arg-Glu from CREB for the Asp-Ala-Ala of SREBP
(mt4) reduced binding by about 40%. This result was somewhat
unexpected because Arg124 of CREB contributes to CBP
binding through an electrostatic interaction with Glu655 of
CBP (28) and suggests that the binding mechanisms of
phosphorylated CREB and SREBP to CBP are not identical. Other
substitutions of CREB sequences into GST-SREBP had minimal effect, with
the exception of mutations involving the midportion of the SREBP
domain, Asp-Ile-Glu-Asp-Met-Leu (DIEDML; mt15 and mt8), which
completely blocked binding. These studies indicated that only the
central core of the SREBP sequence was required for
phosphorylation-independent CBP binding. Therefore, a CREB protein
containing this six-residue substitution might be expected to interact
with CBP in a phosphorylation-independent manner.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 3.
Binding of full-length CBP to mutants of GST-SREBP1 (a)
and GST-CREB (b). GST-CREB(1-290) phos. refers to GST fusion protein
containing the CREB activation domain phosphorylated by PKA. Other
mutations in panel b refer to substitutions of CREB residues with
residues from SREBP. Only the DIEDML substitution conferred
phosphorylation-independent binding. The schematic depicts substitution
of CREB sequences into SREBP. Dots refer to SREBP residues left
unchanged. Percent binding is indicated on the right. NE, nuclear
extract.
|
|
To test this hypothesis, we constructed a GST-CREB fusion protein
lacking the carboxy-terminal basic leucine zipper region. GST-CREB1-290 interacted with full-length CBP in a
phosphorylation-dependent manner, as shown in Fig. 3b. These
experiments were performed in the presence of phosphatase inhibitors to
maintain phosphorylation of the Ser133 site. Western blots
indicated that the PKA-treated GST-CREB1-290 remained
phosphorylated despite the incubation with HeLa nuclear extracts (data
not shown). CBP binding to phosphorylated GST-CREB1-290 was
significantly weaker than to GST-SREBP, however. We next tested whether
the sequential replacement of the central portion of the CREB
activation domain containing the PKA recognition site
(Arg-Arg-Pro-Ser-Tyr-Arg) with residues from SREBP would allow
constitutive CBP binding. Substitution of the Pro-Ser sequence of CREB
with Glu-Asp, the Arg-Arg-Pro-Ser with Asp-Ile-Glu-Asp, or the
Pro-Ser-Tyr-Arg with Glu-Asp-Met-Leu did not allow
phosphorylation-independent binding. However, when the entire
Arg-Arg-Pro-Ser-Tyr-Arg of CREB was replaced with the DIEDML sequence
of SREBP, binding was equivalent to that of phosphorylated
GST-CREB1-290 (Fig. 3b). This mutant, designated
CREBDIEDML, cannot be phosphorylated by PKA (data not shown).
We used a fluorescence polarization binding assay to quantify the
relative affinities of CBP for phosphorylated CREB and
CREBDIEDML. Unlike the GST pull-down assays, this procedure
can provide true equilibrium measurements of protein-DNA and
protein-protein interactions. These experiments utilized a
5'-fluoresceinated oligonucleotide derived from the somatostatin CRE
promoter sequence that was saturated with either
CREBDIEDML, phosphorylated CREB, or unphosphorylated CREB.
The affinities of the three CREB preparations for the CRE were
identical (2 nM [data not shown]). CBP binding was assessed by
measuring the association of a CBP fragment (aa 451 to 682) representing the CREB-binding domain. Complete binding to this preformed CREB-CRE complex was ascertained by monitoring the increases in fluorescence polarization values upon addition of CBP (Fig. 4). The average equilibrium dissociation
constants for CBP binding were calculated to be 444 ± 27 nM in
the presence of phosphorylated CREB and 96 ± 4 nM in the presence
of CREBDIEDML. We detected no binding of CBP to
nonphosphorylated CREB. These data demonstrate a significant increase
in the affinity of CBP for CREBDIEDML compared to
phosphorylated CREB and support the results of the
GST-CREB1-290 binding studies presented above.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Fluorescence polarization binding curves of CBP (aa 451 to 682) for nonphosphorylated CREB-CRE (a), phosphorylated CREB-CRE
(b), and CREBDIEDML-CRE (c) complexes. The change in
anisotropy is plotted against the CBP protein concentration. The
symbols represent the individual data points collected from successive
additions of CBP to saturated CREB-CRE complexes. Each assay condition
was performed in triplicate, and a representative binding curve is
shown for each. No binding of CBP was detected to the complex
containing nonphosphorylated CREB.
|
|
To test the functional consequences of the CREB mutations, plasmids
encoding wild-type CREB and CREBDIEDML were introduced into
F9 teratocarcinoma cells along with a CRE reporter. These cells contain
low levels of CBP but normally require the addition of CREB and PKA to
activate a CRE reporter (8). As shown in Fig.
5a, CREBDIEDML was
approximately eightfold more active than the wild-type protein. To
confirm that the activation mediated by CREBDIEDML is
dependent on CBP, we cotransfected a CBP expression vector. We have
shown previously that expression of exogenous CBP increases the
transcriptional response to PKA-phosphorylated CREB but not to a mutant
(CREB-M1) (8) that cannot be phosphorylated by PKA
(18). Similarly, exogenous CBP augmented the response to
CREBDIEDML but not to CREB-M1 (Fig. 5b) or wild-type CREB
in the absence of PKA (data not shown). Activity mediated by
CREBDIEDML alone is presumably due to the low level of
endogenous CBP present in F9 teratocarcinoma cells. To confirm the
involvement of endogenous CBP in CREBDIEDML function, we
introduced an expression vector encoding 12S E1A along with wild-type
or mutant CREB (Fig. 5c). Adenovirus 12S E1A blocks the activity of
transcription factor pathways by interfering with CBP function (2,
21). 12S E1A blocked the activities of CREBDIEDML and
wild-type CREB plus PKA but had no effect on CREB-M1. These data also
support the hypothesis that CREBDIEDML activates
transcription through CBP.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
(a) Activation of CRE reporter in F9 teratocarcinoma
cells as directed by wild-type (WT) CREB or CREBDIEDML.
Values (mean ± standard error) are normalized for protein levels.
(b) Effect of CBP on CREB-M1 and CREBDIEDML function. Cells
were transfected with 6 µg of CREB plasmid and various amounts of
CBP. (c) Effect of adenovirus 12S E1A on CREB function. DIEDML, M1, and
WT refer to CREBDIEDML, CREB-M1, and wild-type CREB,
respectively. Cells were transfected with 6 µg of CREB, 1 µg of
E1A, and 4 µg of PKA, as indicated. The apparent increased activity
of wild-type CREB in the presence of PKA, compared to
CREBDIEDML, is due to PKA stimulation of the RSV
promoter.
|
|
To test whether CREBDIEDML is active in other cell types,
we introduced plasmids containing GAL4-CREB or
GAL4-CREBDIEDML fusion genes, along with a GAL4-LUC
reporter, into PC12 cells. GAL4-CREBDIEDML was almost five
times more active than the GAL4-wild-type CREB fusion protein (Fig.
6). These data indicate that the
transcriptional activity of CREBDIEDML is not limited to F9
cells. Rather, the DIEDML mutation may render CREB constitutively
active in all cells that express CBP.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Activation of GAL4-LUC reporter by GAL4-wild-type (WT)
CREB and GAL4-CREBDIEDML in PC12 cells. Cells were
transfected with the indicated amounts of GAL4-CREB plasmids along with
4 µg each of GAL4-LUC reporter and pRSV- -GAL. Relative luciferase
(Luc) values were normalized to -galactosidase activity.
|
|
Addition of PKA to F9 teratocarcinoma cells expressing wild-type CREB
increased reporter activity about fivefold, as previously reported
(8) (Fig. 7). Surprisingly,
PKA also increased activity of CREBDIEDML, despite the fact
that CREBDIEDML is not a PKA target (Fig. 7 and data not
shown). The activity of wild-type CREB plus PKA was about the same as
that of CREBDIEDML minus PKA when the assays were
normalized for
-galactosidase activity, although the mutant CREB
binds to CBP somewhat better. On the other hand, activity of wild-type
CREB was less than that seen with the mutant in the presence of PKA.
These experiments indicate that the recruitment of CBP is sufficient
for a significant portion of CREB activity, but full activation of the
reporter requires the addition of PKA. Presumably, PKA also activates a
component of the CREB-CBP cascade at a point downstream from CREB
phosphorylation and CBP recruitment.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
Activation of CRE reporter by CREB and
CREBDIEDML in F9 teratocarcinoma cells in the presence and
absence of PKA. WT designates wild-type CREB. Cells were transfected
with 8 µg of CREB, 4 µg of PKA, and 6 µg of pRSV- -GAL, as
indicated. CAT activity was normalized for -galactosidase
activity.
|
|
 |
DISCUSSION |
Whether recruitment of CBP to CREB is sufficient for gene
activation has been controversial. For example, recent studies have suggested that CBP cannot activate transcription in the absence of a
calcium-dependent phosphorylation signal (13, 14).
Characterization of these phosphorylation mechanisms in the context of
the CREB-CBP pathway has been difficult, because CREB activation is
also phosphorylation dependent. Thus, it has not been possible to
separate kinases involved in CREB activation from those involved in CBP
function. To address this issue, investigators have made use of GAL-CBP fusion genes, which target the coactivator to synthetic promoter sequences through a DNA-binding domain attached to the CBP amino terminus. Unfortunately, many of these GAL-CBP fusion proteins confer
artifactually high or low levels of transcription.
We have used a different approach to address this question. By
comparing the primary sequences of SREBP and other factors, we
identified residues that have been conserved with the CBP interaction domain of CREB. Moreover, secondary structure predictions suggest that
the CBP-binding region of SREBP is
helical, like that in the
phosphorylated CREB-CBP complex. We showed by mutagenesis studies that
the
-helical regions of the CBP interaction domains of
phosphorylated CREB and SREBP are conserved functionally. On the other
hand, the central, negatively charged portion of SREBP, which we
initially hypothesized might correspond to the phosphoserine of CREB,
was relatively unimportant. Replacing these residues with uncharged or
smaller amino acids had no effect on binding, and replacing the PKA
site in CREB with the negatively charged residues from SREBP did not
promote phosphorylation-independent binding. Similarly, substitution of
a single negatively charged residue for Ser133 fails to
confer phosphorylation-independent CREB activation (12).
Surprisingly, introduction of the 6-aa DIEDML sequence of SREBP was
sufficient to allow phosphorylation-independent binding of CREB to CBP.
Moreover, this sequence is conserved in SREBP2 and Drosophila
ci, two other factors that interact with the CREB-binding domain
of CBP.
While this paper was being prepared, a report by Parker et al.
(27) described the properties of a CREB-Myb chimera which contained a 21-aa segment of c-Myb inserted into the activation domain
of CREB. These workers found that the CREB-Myb chimera did not activate
transcription significantly in the absence of PKA. Notably, the binding
of c-Myb to CBP was determined to be 26-fold weaker than that of
phosphorylated CREB. Thus, the chimeric CREB-Myb protein likely also
interacts with CBP fairly weakly. It is also possible that the large
c-Myb insert disrupts critical aspects of the native CREB structure.
There are no obvious sequence similarities between the CBP interaction
domains of c-Myb and SREBP. Our study indicates that the DIEDML
mutation increases the affinity of CREB for CBP, compared to the
phosphorylated wild-type protein. We propose that this difference in
CBP binding contributes to the functional differences between the
CREB-Myb and CREBDIEDML mutants. The DIEDML sequence, by
itself, is not sufficient for the CBP interaction, however, as shown by
the failure of the GST-SREBP mutants mt3, mt9, and mt10 (Fig. 2) to
mediate wild-type binding.
The transcriptional activity of CREBDIEDML is consistent
with the idea that CBP recruitment is sufficient for activation of CRE-containing promoters. Our data do not support the recent study by
Hu et al. (14), however, who found that CBP was inactive in
the absence of a supplemental Ca2+ signal. The differences
between our results and those of Hu et al. could relate to their use of
GAL-CBP fusion genes or the particular cell types that were examined.
Hu et al. used primary E18 cortical neurons, while we utilized F9
teratocarcinoma cells. Endogenous PKA, CaMKII, and CaMKIV levels in F9
cells are insufficient for CREB-mediated gene activation
(22), and so it is unlikely that the activation that we
detect is due to the unrecognized stimulation of kinase pathways.
While CBP recruitment is sufficient to activate CREB-mediated
transcription, PKA augments the response somewhat further. The lower
activity of wild-type CREB than CREBDIEDML in the presence of PKA might relate to dynamic aspects of their interactions with CBP.
Wild-type CREB probably binds to CBP only transiently, due to
dephosphorylation, while the interaction of CBP with
CREBDIEDML may be more sustained. Additionally, the
moderately higher affinity of CREBDIEDML for CBP might
contribute to its enhanced level of transcriptional activity. The
modest stimulation of CREBDIEDML by PKA is also consistent
with previous reports that CREB activation through
Ca2+-stimulated kinase pathways can be blocked by PKA
inhibitors. Whether PKA contributes to gene activation by
phosphorylating CBP, as proposed by Xu et al. (37), or by
modifying targets downstream from CBP is unknown.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from the Swiss National Science
Foundation Fellowship, the McKnight Foundation, and the National
Institutes of Health.
We thank James Lundblad and Gail Mandel for thoughtful comments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Vollum
Institute, Oregon Health Sciences University, 3181 S.W. Sam Jackson
Park Road, Portland, OR 97201. Phone: (503) 494-5078. Fax: (503)
494-4353. E-mail: goodmanr{at}ohsu.edu.
 |
REFERENCES |
| 1.
|
Akimaru, H.,
Y. Chen,
P. Dai,
D. X. Hou,
M. Nonaka,
S. M. Smolik,
S. Armstrong,
R. H. Goodman, and S. Ishii.
1997.
Drosophila CBP is a co-activator of cubitus interruptus in hedgehog signaling.
Nature
386:735-738[CrossRef][Medline].
|
| 2.
|
Arany, Z.,
D. Newson,
E. Oldread,
D. M. Livingston, and R. Eckner.
1995.
A family of transcriptional adaptor proteins targeted by the E1A oncoprotein.
Nature
374:81-84[CrossRef][Medline].
|
| 3.
|
Arias, J.,
A. S. Alberts,
P. Brindle,
F. X. Claret,
T. Smeal,
M. Karin,
J. Feramisco, and M. Montminy.
1994.
Activation of cAMP and mitogen responsive genes relies on a common nuclear factor.
Nature
370:226-229[CrossRef][Medline].
|
| 4.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. A. Smith,
J. G. Seidman, and K. Struhl (ed.).
1990.
Current protocols in molecular biology, p. 12.1.1-12.1.9.
John Wiley & Sons, Inc., New York, N.Y.
|
| 5.
|
Chawla, S.,
G. E. Hardingham,
D. R. Quinn, and H. Bading.
1998.
CBP: a signal-regulated transcriptional coactivator controlled by nuclear calcium and CaM kinase IV.
Science
281:1505-1509[Abstract/Free Full Text].
|
| 6.
|
Chen, H.,
R. J. Lin,
R. L. Schiltz,
D. Chakravarti,
A. Nash,
L. Nagy,
M. L. Privalsky,
Y. Nakatani, and R. M. Evans.
1997.
Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300.
Cell
90:569-580[CrossRef][Medline].
|
| 6a.
|
Chen, Y.,
R. H. Goodman, and S. M. Smolik.
2000.
Cabitus interruptus requires Drosophila CREB-binding protein to activate wingless expression in the Drosophila embryo.
Mol. Cell. Biol.
20:1616-1625[Abstract/Free Full Text].
|
| 7.
|
Chrivia, J. D.,
R. P. Kwok,
N. Lamb,
M. Hagiwara,
M. R. Montminy, and R. H. Goodman.
1993.
Phosphorylated CREB binds specifically to the nuclear protein CBP.
Nature
365:855-859[CrossRef][Medline].
|
| 8.
|
Dwarki, V. J.,
M. Montminy, and I. M. Verma.
1990.
Both the basic region and the `leucine zipper' domain of the cyclic AMP response element binding (CREB) protein are essential for transcriptional activation.
EMBO J.
9:225-232[Medline].
|
| 9.
|
Felzien, L. K.,
S. Farrell,
J. C. Betts,
R. Mosavin, and G. J. Nabel.
1999.
Specificity of cyclin E-Cdk2, TFIIB, and E1A interactions with a common domain of the p300 coactivator.
Mol. Cell. Biol.
19:4241-4246[Abstract/Free Full Text].
|
| 10.
|
Ginty, D. D.,
D. Glowacka,
D. S. Bader,
H. Hidaka, and J. A. Wagner.
1991.
Induction of immediate early genes by Ca2+ influx requires cAMP-dependent protein kinase in PC12 cells.
J. Biol. Chem.
266:17454-17458[Abstract/Free Full Text].
|
| 11.
|
Goldman, P. S.,
V. K. Tran, and R. H. Goodman.
1996.
The multifunctional role of the co-activator CBP in transcriptional regulation.
Recent Prog. Horm. Res.
52:103-119.
|
| 12.
|
Gonzalez, G. A., and M. R. Montminy.
1989.
Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133.
Cell
59:675-680[CrossRef][Medline].
|
| 13.
|
Hardingham, G. E.,
S. Chawla,
F. H. Cruzalegui, and H. Bading.
1999.
Control of recruitment and transcription-activating function of CBP determines gene regulation by NMDA receptors and L-type calcium channels.
Neuron
22:789-798[CrossRef][Medline].
|
| 14.
|
Hu, S. C.,
J. Chrivia, and A. Ghosh.
1999.
Regulation of CBP-mediated transcription by neuronal calcium signaling.
Neuron
22:799-808[CrossRef][Medline].
|
| 15.
|
Hua, X.,
C. Yokoyama,
J. Wu,
M. R. Briggs,
M. S. Brown,
J. L. Goldstein, and X. Wang.
1993.
SREBP-2, a second basic helix-loop-helix-leucine zipper protein that stimulates transcription by binding to a sterol regulatory element.
Proc. Natl. Acad. Sci. USA
90:11603-11607[Abstract/Free Full Text].
|
| 16.
|
Impey, S.,
G. Wayman,
Z. Wu, and D. R. Storm.
1994.
Type I adenylyl cyclase functions as a coincidence detector for control of cyclic AMP response element-mediated transcription: synergistic regulation of transcription by Ca2+ and isoproterenol.
Mol. Cell. Biol.
14:8272-8281[Abstract/Free Full Text].
|
| 17.
|
Kraus, W. L., and J. T. Kadonaga.
1998.
p300 and estrogen receptor cooperatively activate transcriptional via differential enhancement of initiation and reinitiation.
Genes Dev.
12:331-342[Abstract/Free Full Text].
|
| 18.
|
Kwok, R. P.,
J. R. Lundblad,
J. C. Chrivia,
J. P. Richards,
H. P. Bächinger,
R. G. Brennan,
S. G. Roberts,
M. R. Green, and R. H. Goodman.
1994.
Nuclear protein CBP is a coactivator for the transcription factor CREB.
Nature
370:223-236[CrossRef][Medline].
|
| 19.
|
Laurance, M. E.,
R. P. S. Kwok,
M. S. Huang,
J. P. Richards,
J. R. Lundblad, and R. H. Goodman.
1997.
Differential activation of viral and cellular promoters by human T-cell lymphotropic virus-1 Tax and cAMP-responsive element modulator isoforms.
J. Biol. Chem.
272:2646-2651[Abstract/Free Full Text].
|
| 20.
|
Loriaux, M. M.,
R. P. Rehfuss,
R. G. Brennan, and R. H. Goodman.
1993.
Engineered leucine zippers show that hemiphosphorylated CREB complexes are transcriptionally active.
Proc. Natl. Acad. Sci. USA
90:9046-9050[Abstract/Free Full Text].
|
| 21.
|
Lundblad, J. R.,
R. P. Kwok,
M. E. Laurance,
M. L. Harter, and R. H. Goodman.
1995.
Adenoviral E1A-associated protein p300 as a functional homologue of the transcriptional co-activator CBP.
Nature
374:85-88[CrossRef][Medline].
|
| 22.
|
Masson, N.,
M. Ellis,
S. Goodbourn, and K. A. W. Lee.
1992.
Cyclic AMP response element-binding protein and the catalytic subunit of protein kinase A are present in F9 embryonal carcinoma cells but are unable to activate the somatostatin promoter.
Mol. Cell. Biol.
12:1096-1106[Abstract/Free Full Text].
|
| 23.
|
Montminy, M. R.,
K. A. Sevarino,
J. A. Wagner,
G. Mandel, and R. H. Goodman.
1986.
Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.
Proc. Natl. Acad. Sci. USA
83:6682-6686[Abstract/Free Full Text].
|
| 24.
|
Nakajima, T.,
C. Uchida,
S. F. Anderson,
C. G. Lee,
J. Hurwitz,
J. D. Parvin, and M. Montminy.
1997.
RNA helicase A mediates association of CBP with RNA polymerase II.
Cell
90:1107-1112[CrossRef][Medline].
|
| 25.
|
Oliner, J. D.,
J. M. Andresen,
S. K. Hansen,
S. Zhou, and R. Tjian.
1996.
SREBP transcriptional activity is mediated through an interaction with the CREB binding protein.
Genes Dev.
10:2903-2911[Abstract/Free Full Text].
|
| 26.
|
Parker, D.,
K. Ferreri,
T. Nakajima,
V. J. LaMorte,
R. Evans,
S. C. Koerber,
C. Hoeger, and M. R. Montminy.
1996.
Phosphorylation of CREB at Ser-133 induces complex formation with CREB binding protein via a direct mechanism.
Mol. Cell. Biol.
16:694-703[Abstract].
|
| 27.
|
Parker, D.,
M. River,
T. Zor,
A. Henrion-Caude,
I. Radhakrishnan,
A. Kumar,
L. H. Shapiro,
P. E. Wright,
M. Montminy, and P. K. Brindle.
1999.
Role of secondary structure in discrimination between constitutive and inducible activators.
Mol. Cell. Biol.
19:5601-5607[Abstract/Free Full Text].
|
| 28.
|
Radhakrishnan, I.,
G. C. Perez-Alvarado,
D. Parker,
H. J. Dyson,
M. R. Montminy, and P. E. Wright.
1997.
Solution structure of the KIX domain of CBP bound to the transactivation domain of CREB: a model for activator:coactivator interactions.
Cell
91:741-752[CrossRef][Medline].
|
| 29.
|
Richards, J. P.,
H. P. Bachinger,
R. H. Goodman, and R. G. Brennan.
1996.
Analysis of the structural properties of cAMP-responsive element binding protein (CREB) and phosphorylated CREB.
J. Biol. Chem.
271:13716-13723[Abstract/Free Full Text].
|
| 30.
|
Shih, H. M.,
P. S. Goldman,
A. J. DeMaggio,
S. M. Hollenberg,
R. H. Goodman, and M. F. Hoekstra.
1996.
A positive genetic selection for disrupting protein-protein interactions: identification of CREB mutations that prevent association with the coactivator CBP.
Proc. Natl. Acad. Sci. USA
93:13896-13901[Abstract/Free Full Text].
|
| 31.
|
Spencer, T. E.,
G. Jenster,
M. M. Burcin,
C. D. Allis,
J. Zhou,
C. A. Mizzen,
N. J. McKenna,
S. A. Onate,
S. Y. Tsai,
M. J. Tsai, and B. W. O'Malley.
1997.
Steroid receptor coactivator-1 is a histone acetyltransferase.
Nature
389:194-198[CrossRef][Medline].
|
| 32.
|
Sun, P.,
H. Enslen,
P. Myung, and R. A. Maurer.
1994.
Differential activation of CREB by Ca2+/calmodulin-dependent protein kinases type II and type IV involves phosphorylation of a site that negatively regulates activity.
Genes Dev.
8:2527-2539[Abstract/Free Full Text].
|
| 33.
|
Sun, P., and R. A. Maurer.
1995.
An inactivating point mutation demonstrates that interaction of cAMP response element binding protein (CREB) with the CREB binding protein is not sufficient for transcriptional activation.
J. Biol. Chem.
270:7041-7044[Abstract/Free Full Text].
|
| 34.
|
Swope, D. L.,
C. L. Mueller, and J. C. Chrivia.
1996.
CREB binding protein activates transcription through multiple domains.
J. Biol. Chem.
21:28138-28145.
|
| 35.
|
Thompson, M. A.,
D. D. Ginty,
A. Bonni, and M. E. Greenberg.
1995.
L-type voltage-sensitive Ca2+ channel activation regulates c-fos transcription at multiple levels.
J. Biol. Chem.
270:4224-4235[Abstract/Free Full Text].
|
| 36.
|
Torchia, J.,
D. W. Rose,
J. Inostroza,
Y. Kamei,
S. Westin,
C. K. Glass, and M. G. Rosenfeld.
1997.
The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function.
Nature
387:677-684[CrossRef][Medline].
|
| 37.
|
Xu, L.,
R. M. Lavinsky,
J. S. Dasen,
S. E. Flynn,
E. M. McInerney,
T. M. Mullen,
T. Heinzel,
D. Szeto,
E. Korzus,
R. Kurokawa,
A. K. Aggarwal,
D. W. Rose,
C. K. Glass, and M. G. Rosenfeld.
1998.
Signal-specific co-activator domain requirements for Pit-1 activation.
Nature
395:301-306[CrossRef][Medline].
|
| 38.
|
Yang, X. J.,
V. V. Ogryzko,
J. Nishikawa,
B. H. Howard, and Y. Nakatani.
1996.
A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A.
Nature
382:319-324[CrossRef][Medline].
|
| 39.
|
Zanger, K.,
L. E. Cohen,
K. Hashimoto,
S. Radovick, and F. E. Wondisford.
1999.
A novel mechanism for cyclic adenosine 3',5'-monophosphate regulation of gene expression by CREB binding protein.
Mol. Endocrinol.
13:268-275[Abstract/Free Full Text].
|
Molecular and Cellular Biology, March 2000, p. 1546-1552, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shukla, A., Bosenberg, M. W., MacPherson, M. B., Butnor, K. J., Heintz, N. H., Pass, H. I., Carbone, M., Testa, J. R., Mossman, B. T.
(2009). Activated cAMP Response Element Binding Protein Is Overexpressed in Human Mesotheliomas and Inhibits Apoptosis. Am. J. Pathol.
175: 2197-2206
[Abstract]
[Full Text]
-
Almeida, L. E. F., Murray, P. D., Zielke, H. R., Roby, C. D., Kingsbury, T. J., Krueger, B. K.
(2009). Autocrine Activation of Neuronal NMDA Receptors by Aspartate Mediates Dopamine- and cAMP-Induced CREB-Dependent Gene Transcription. J. Neurosci.
29: 12702-12710
[Abstract]
[Full Text]
-
Fox, K. E., Colton, L. A., Erickson, P. F., Friedman, J. E., Cha, H. C., Keller, P., MacDougald, O. A., Klemm, D. J.
(2008). Regulation of Cyclin D1 and Wnt10b Gene Expression by cAMP-responsive Element-binding Protein during Early Adipogenesis Involves Differential Promoter Methylation. J. Biol. Chem.
283: 35096-35105
[Abstract]
[Full Text]
-
Gavala, M. L., Pfeiffer, Z. A., Bertics, P. J.
(2008). The nucleotide receptor P2RX7 mediates ATP-induced CREB activation in human and murine monocytic cells. J. Leukoc. Biol.
84: 1159-1171
[Abstract]
[Full Text]
-
Wayman, G. A., Davare, M., Ando, H., Fortin, D., Varlamova, O., Cheng, H.-Y. M., Marks, D., Obrietan, K., Soderling, T. R., Goodman, R. H., Impey, S.
(2008). An activity-regulated microRNA controls dendritic plasticity by down-regulating p250GAP. Proc. Natl. Acad. Sci. USA
105: 9093-9098
[Abstract]
[Full Text]
-
Yao, M., Stenzel-Poore, M., Denver, R. J.
(2007). Structural and Functional Conservation of Vertebrate Corticotropin-Releasing Factor Genes: Evidence for a Critical Role for a Conserved Cyclic AMP Response Element. Endocrinology
148: 2518-2531
[Abstract]
[Full Text]
-
Shen, B., Harrison-Bernard, L. M., Fuller, A. J., Vanderpool, V., Saifudeen, Z., El-Dahr, S. S.
(2007). The Bradykinin B2 Receptor Gene Is a Target of Angiotensin II Type 1 Receptor Signaling. J. Am. Soc. Nephrol.
18: 1140-1149
[Abstract]
[Full Text]
-
Kovacs, K. A., Steullet, P., Steinmann, M., Do, K. Q., Magistretti, P. J., Halfon, O., Cardinaux, J.-R.
(2007). TORC1 is a calcium- and cAMP-sensitive coincidence detector involved in hippocampal long-term synaptic plasticity. Proc. Natl. Acad. Sci. USA
104: 4700-4705
[Abstract]
[Full Text]
-
Fox, K. E., Fankell, D. M., Erickson, P. F., Majka, S. M., Crossno, J. T. Jr., Klemm, D. J.
(2006). Depletion of cAMP-response Element-binding Protein/ATF1 Inhibits Adipogenic Conversion of 3T3-L1 Cells Ectopically Expressing CCAAT/Enhancer-binding Protein (C/EBP) {alpha}, C/EBP beta, or PPAR{gamma}2. J. Biol. Chem.
281: 40341-40353
[Abstract]
[Full Text]
-
Ohmae, S., Takemoto-Kimura, S., Okamura, M., Adachi-Morishima, A., Nonaka, M., Fuse, T., Kida, S., Tanji, M., Furuyashiki, T., Arakawa, Y., Narumiya, S., Okuno, H., Bito, H.
(2006). Molecular Identification and Characterization of a Family of Kinases with Homology to Ca2+/Calmodulin-dependent Protein Kinases I/IV. J. Biol. Chem.
281: 20427-20439
[Abstract]
[Full Text]
-
Kwon, M.-J., Soh, J.-W., Chang, C.-H.
(2006). Protein Kinase C{delta} Is Essential to Maintain CIITA Gene Expression in B Cells. J. Immunol.
177: 950-956
[Abstract]
[Full Text]
-
Deb, S., Zhou, J., Amin, S. A., Imir, A. G., Yilmaz, M. B., Lin, Z., Bulun, S. E.
(2006). A Novel Role of Sodium Butyrate in the Regulation of Cancer-associated Aromatase Promoters I.3 and II by Disrupting a Transcriptional Complex in Breast Adipose Fibroblasts. J. Biol. Chem.
281: 2585-2597
[Abstract]
[Full Text]
-
Chen, S., Ji, M., Paris, M., Hullinger, R. L., Andrisani, O. M.
(2005). The cAMP Pathway Regulates Both Transcription and Activity of the Paired Homeobox Transcription Factor Phox2a Required for Development of Neural Crest-derived and Central Nervous System-derived Catecholaminergic Neurons. J. Biol. Chem.
280: 41025-41036
[Abstract]
[Full Text]
-
Ji, M., Andrisani, O. M.
(2005). High-Level Activation of Cyclic AMP Signaling Attenuates Bone Morphogenetic Protein 2-Induced Sympathoadrenal Lineage Development and Promotes Melanogenesis in Neural Crest Cultures. Mol. Cell. Biol.
25: 5134-5145
[Abstract]
[Full Text]
-
Saifudeen, Z., Dipp, S., Fan, H., El-Dahr, S. S.
(2005). Combinatorial control of the bradykinin B2 receptor promoter by p53, CREB, KLF-4, and CBP: implications for terminal nephron differentiation. Am. J. Physiol. Renal Physiol.
288: F899-F909
[Abstract]
[Full Text]
-
Zhang, X., Odom, D. T., Koo, S.-H., Conkright, M. D., Canettieri, G., Best, J., Chen, H., Jenner, R., Herbolsheimer, E., Jacobsen, E., Kadam, S., Ecker, J. R., Emerson, B., Hogenesch, J. B., Unterman, T., Young, R. A., Montminy, M.
(2005). Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc. Natl. Acad. Sci. USA
102: 4459-4464
[Abstract]
[Full Text]
-
Constantinescu, A., Wu, M., Asher, O., Diamond, I.
(2004). cAMP-dependent Protein Kinase Type I Regulates Ethanol-induced cAMP Response Element-mediated Gene Expression via Activation of CREB-binding Protein and Inhibition of MAPK. J. Biol. Chem.
279: 43321-43329
[Abstract]
[Full Text]
-
Toth, J. I., Datta, S., Athanikar, J. N., Freedman, L. P., Osborne, T. F.
(2004). Selective Coactivator Interactions in Gene Activation by SREBP-1a and -1c. Mol. Cell. Biol.
24: 8288-8300
[Abstract]
[Full Text]
-
Sawka-Verhelle, D., Escoubet-Lozach, L., Fong, A. L., Hester, K. D., Herzig, S., Lebrun, P., Glass, C. K.
(2004). PE-1/METS, an Antiproliferative Ets Repressor Factor, Is Induced by CREB-1/CREM-1 during Macrophage Differentiation. J. Biol. Chem.
279: 17772-17784
[Abstract]
[Full Text]
-
Nie, M., Pang, L., Inoue, H., Knox, A. J
(2003). Transcriptional Regulation of Cyclooxygenase 2 by Bradykinin and Interleukin-1{beta} in Human Airway Smooth Muscle Cells: Involvement of Different Promoter Elements, Transcription Factors, and Histone H4 Acetylation. Mol. Cell. Biol.
23: 9233-9244
[Abstract]
[Full Text]
-
Chang, J. H., Mellon, E., Schanen, N. C., Twiss, J. L.
(2003). Persistent TrkA Activity Is Necessary to Maintain Transcription in Neuronally Differentiated PC12 Cells. J. Biol. Chem.
278: 42877-42885
[Abstract]
[Full Text]
-
Kovacs, K. A., Steinmann, M., Magistretti, P. J., Halfon, O., Cardinaux, J.-R.
(2003). CCAAT/Enhancer-binding Protein Family Members Recruit the Coactivator CREB-binding Protein and Trigger Its Phosphorylation. J. Biol. Chem.
278: 36959-36965
[Abstract]
[Full Text]
-
Lu, Q., Hutchins, A. E., Doyle, C. M., Lundblad, J. R., Kwok, R. P. S.
(2003). Acetylation of cAMP-responsive Element-binding Protein (CREB) by CREB-binding Protein Enhances CREB-dependent Transcription. J. Biol. Chem.
278: 15727-15734
[Abstract]
[Full Text]
-
Zhang, Z., Teng, C. T.
(2003). Phosphorylation of Kruppel-like factor 5 (KLF5/IKLF) at the CBP interaction region enhances its transactivation function. Nucleic Acids Res
31: 2196-2208
[Abstract]
[Full Text]
-
Giandomenico, V., Simonsson, M., Gronroos, E., Ericsson, J.
(2003). Coactivator-Dependent Acetylation Stabilizes Members of the SREBP Family of Transcription Factors. Mol. Cell. Biol.
23: 2587-2599
[Abstract]
[Full Text]
-
Walters, M. J., Wayman, G. A., Notis, J. C., Goodman, R. H., Soderling, T. R., Christian, J. L.
(2003). Calmodulin-dependent protein kinase IV mediated antagonism of BMP signaling regulates lineage and survival of hematopoietic progenitors. Development
129: 1455-1466
[Abstract]
[Full Text]
-
Bok, J., Zha, X.-M., Cho, Y.-S., Green, S. H.
(2003). An Extranuclear Locus of cAMP-Dependent Protein Kinase Action Is Necessary and Sufficient for Promotion of Spiral Ganglion Neuronal Survival by cAMP. J. Neurosci.
23: 777-787
[Abstract]
[Full Text]
-
Goto, N. K., Zor, T., Martinez-Yamout, M., Dyson, H. J., Wright, P. E.
(2002). Cooperativity in Transcription Factor Binding to the Coactivator CREB-binding Protein (CBP). THE MIXED LINEAGE LEUKEMIA PROTEIN (MLL) ACTIVATION DOMAIN BINDS TO AN ALLOSTERIC SITE ON THE KIX DOMAIN. J. Biol. Chem.
277: 43168-43174
[Abstract]
[Full Text]
-
Zor, T., Mayr, B. M., Dyson, H. J., Montminy, M. R., Wright, P. E.
(2002). Roles of Phosphorylation and Helix Propensity in the Binding of the KIX Domain of CREB-binding Protein by Constitutive (c-Myb) and Inducible (CREB) Activators. J. Biol. Chem.
277: 42241-42248
[Abstract]
[Full Text]
-
Halder, S. K., Fink, M., Waterman, M. R., Rozman, D.
(2002). A cAMP-Responsive Element Binding Site Is Essential for Sterol Regulation of the Human Lanosterol 14{alpha}-Demethylase Gene (CYP51). Mol. Endocrinol.
16: 1853-1863
[Abstract]
[Full Text]
-
Boer, A.-K., Drayer, A. L., Rui, H., Vellenga, E.
(2002). Prostaglandin-E2 enhances EPO-mediated STAT5 transcriptional activity by serine phosphorylation of CREB. Blood
100: 467-473
[Abstract]
[Full Text]
-
Constantinescu, A., Gordon, A. S., Diamond, I.
(2002). cAMP-dependent Protein Kinase Types I and II Differentially Regulate cAMP Response Element-mediated Gene Expression. IMPLICATIONS FOR NEURONAL RESPONSES TO ETHANOL. J. Biol. Chem.
277: 18810-18816
[Abstract]
[Full Text]
-
Doi, J., Takemori, H., Lin, X.-z., Horike, N., Katoh, Y., Okamoto, M.
(2002). Salt-inducible Kinase Represses cAMP-dependent Protein Kinase-mediated Activation of Human Cholesterol Side Chain Cleavage Cytochrome P450 Promoter through the CREB Basic Leucine Zipper Domain. J. Biol. Chem.
277: 15629-15637
[Abstract]
[Full Text]
-
Asher, O., Cunningham, T. D., Yao, L., Gordon, A. S., Diamond, I.
(2002). Ethanol Stimulates cAMP-Responsive Element (CRE)-Mediated Transcription via CRE-Binding Protein and cAMP-Dependent Protein Kinase. J. Pharmacol. Exp. Ther.
301: 66-70
[Abstract]
[Full Text]
-
Klemm, D. J., Watson, P. A., Frid, M. G., Dempsey, E. C., Schaack, J., Colton, L. A., Nesterova, A., Stenmark, K. R., Reusch, J. E.-B.
(2001). cAMP Response Element-binding Protein Content Is a Molecular Determinant of Smooth Muscle Cell Proliferation and Migration. J. Biol. Chem.
276: 46132-46141
[Abstract]
[Full Text]
-
West, A. E., Chen, W. G., Dalva, M. B., Dolmetsch, R. E., Kornhauser, J. M., Shaywitz, A. J., Takasu, M. A., Tao, X., Greenberg, M. E.
(2001). Calcium regulation of neuronal gene expression. Proc. Natl. Acad. Sci. USA
98: 11024-11031
[Abstract]
[Full Text]
-
Ernst, P., Wang, J., Huang, M., Goodman, R. H., Korsmeyer, S. J.
(2001). MLL and CREB Bind Cooperatively to the Nuclear Coactivator CREB-Binding Protein. Mol. Cell. Biol.
21: 2249-2258
[Abstract]
[Full Text]
-
Yu, C.-T., Shih, H.-m., Lai, M.-Z.
(2001). Multiple Signals Required for Cyclic AMP-Responsive Element Binding Protein (CREB) Binding Protein Interaction Induced by CD3/CD28 Costimulation. J. Immunol.
166: 284-292
[Abstract]
[Full Text]
-
Shaywitz, A. J., Dove, S. L., Kornhauser, J. M., Hochschild, A., Greenberg, M. E.
(2000). Magnitude of the CREB-Dependent Transcriptional Response Is Determined by the Strength of the Interaction between the Kinase-Inducible Domain of CREB and the KIX Domain of CREB-Binding Protein. Mol. Cell. Biol.
20: 9409-9422
[Abstract]
[Full Text]
-
York, R. D., Molliver, D. C., Grewal, S. S., Stenberg, P. E., McCleskey, E. W., Stork, P. J. S.
(2000). Role of Phosphoinositide 3-Kinase and Endocytosis in Nerve Growth Factor-Induced Extracellular Signal-Regulated Kinase Activation via Ras and Rap1. Mol. Cell. Biol.
20: 8069-8083
[Abstract]
[Full Text]
-
Zhang, Q., Vo, N., Goodman, R. H.
(2000). Histone Binding Protein RbAp48 Interacts with a Complex of CREB Binding Protein and Phosphorylated CREB. Mol. Cell. Biol.
20: 4970-4978
[Abstract]
[Full Text]
-
Goodman, R. H., Smolik, S.
(2000). CBP/p300 in cell growth, transformation, and development. Genes Dev.
14: 1553-1577
[Full Text]
-
Du, K., Asahara, H., Jhala, U. S., Wagner, B. L., Montminy, M.
(2000). Characterization of a CREB Gain-of-Function Mutant with Constitutive Transcriptional Activity In Vivo. Mol. Cell. Biol.
20: 4320-4327
[Abstract]
[Full Text]
-
Grewal, S. S., Fass, D. M., Yao, H., Ellig, C. L., Goodman, R. H., Stork, P. J. S.
(2000). Calcium and cAMP Signals Differentially Regulate cAMP-responsive Element-binding Protein Function via a Rap1-Extracellular Signal-regulated Kinase Pathway. J. Biol. Chem.
275: 34433-34441
[Abstract]
[Full Text]
-
Fass, D. M., Craig, J. C., Impey, S., Goodman, R. H.
(2001). Cooperative Mechanism of Transcriptional Activation by a Cyclic AMP-response Element Modulator alpha Mutant Containing a Motif for Constitutive Binding to CREB-binding Protein. J. Biol. Chem.
276: 2992-2997
[Abstract]
[Full Text]
-
Chakravarty, K., Leahy, P., Becard, D., Hakimi, P., Foretz, M., Ferre, P., Foufelle, F., Hanson, R. W.
(2001). Sterol Regulatory Element-binding Protein-1c Mimics the Negative Effect of Insulin on Phosphoenolpyruvate Carboxykinase (GTP) Gene Transcription. J. Biol. Chem.
276: 34816-34823
[Abstract]
[Full Text]
-
Klemm, D. J., Leitner, J. W., Watson, P., Nesterova, A., Reusch, J. E.-B., Goalstone, M. L., Draznin, B.
(2001). Insulin-induced Adipocyte Differentiation. ACTIVATION OF CREB RESCUES ADIPOGENESIS FROM THE ARREST CAUSED BY INHIBITION OF PRENYLATION. J. Biol. Chem.
276: 28430-28435
[Abstract]
[Full Text]
-
Monroy, M. A., Ruhl, D. D., Xu, X., Granner, D. K., Yaciuk, P., Chrivia, J. C.
(2001). Regulation of cAMP-responsive Element-binding Protein-mediated Transcription by the SNF2/SWI-related Protein, SRCAP. J. Biol. Chem.
276: 40721-40726
[Abstract]
[Full Text]
-
Gusterson, R., Brar, B., Faulkes, D., Giordano, A., Chrivia, J., Latchman, D.
(2002). The Transcriptional Co-activators CBP and p300 Are Activated via Phenylephrine through the p42/p44 MAPK Cascade. J. Biol. Chem.
277: 2517-2524
[Abstract]
[Full Text]
-
Reusch, J. E. B., Klemm, D. J.
(2002). Inhibition of cAMP-response Element-binding Protein Activity Decreases Protein Kinase B/Akt Expression in 3T3-L1 Adipocytes and Induces Apoptosis. J. Biol. Chem.
277: 1426-1432
[Abstract]
[Full Text]
-
Yi, M., Tong, G.-X., Murry, B., Mendelson, C. R.
(2002). Role of CBP/p300 and SRC-1 in Transcriptional Regulation of the Pulmonary Surfactant Protein-A (SP-A) Gene by Thyroid Transcription Factor-1 (TTF-1). J. Biol. Chem.
277: 2997-3005
[Abstract]
[Full Text]
-
Vo, N., Goodman, R. H.
(2001). CREB-binding Protein and p300 in Transcriptional Regulation. J. Biol. Chem.
276: 13505-13508
[Full Text]