This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castrillo, A.
Right arrow Articles by Boscá, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castrillo, A.
Right arrow Articles by Boscá, L.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, March 2000, p. 1692-1698, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Inhibition of Ikappa B Kinase and Ikappa B Phosphorylation by 15-Deoxy-Delta 12,14-Prostaglandin J2 in Activated Murine Macrophages

Antonio Castrillo, María J. M. Díaz-Guerra, Sonsoles Hortelano, Paloma Martín-Sanz, and Lisardo Boscá*

Instituto de Bioquímica (Centro Mixto CSIC-UCM), Facultad de Farmacia, Universidad Complutense, 28040 Madrid, Spain

Received 3 June 1999/Returned for modification 23 July 1999/Accepted 24 November 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Activation of the macrophage cell line RAW 264.7 with lipopolysaccharide (LPS) and gamma interferon (IFN-gamma ) induces the expression of gene products involved in host defense, among them type 2 nitric oxide synthase. Treatment of cells with 15-deoxy-Delta 12,14-prostaglandin J2 (15dPGJ2) inhibited the LPS- and IFN-gamma -dependent synthesis of NO, a process that was not antagonized by similar concentrations of prostaglandin J2, prostaglandin E2, or rosiglitazone, a peroxisomal proliferator-activated receptor gamma  ligand. Incubation of activated macrophages with 15dPGJ2 inhibited the degradation of Ikappa Balpha and Ikappa Bbeta and increased their levels in the nuclei. NF-kappa B activity, as well as the transcription of NF-kappa B-dependent genes, such as those encoding type 2 nitric oxide synthase and cyclooxygenase 2, was impaired under these conditions. Analysis of the steps leading to Ikappa B phosphorylation showed an inhibition of Ikappa B kinase by 15dPGJ2 in cells treated with LPS and IFN-gamma , resulting in an impaired phosphorylation of Ikappa Balpha , at least in the serine 32 residue required for targeting and degradation of this protein. Incubation of partially purified activated Ikappa B kinase with 2 µM 15dPGJ2 reduced by 83% the phosphorylation in serine 32 of Ikappa Balpha , suggesting that this prostaglandin exerts direct inhibitory effects on the activity of the Ikappa B kinase complex. These results show rapid actions of 15dPGJ2, independent of peroxisomal proliferator receptor gamma  activation, in macrophages challenged with low doses of LPS and IFN-gamma .


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Macrophage activation in response to proinflammatory cytokines and bacterial cell wall products constitutes a key component of the immune response (23, 31, 50). Resolution of the process occurs after removal of the proinflammatory stimuli and through the action of negative regulators of the activation-signaling pathways, among them interleukin-10 (IL-10), IL-13, alpha/beta interferons (IFN-alpha /beta ), and more recently several cyclopentenone prostaglandins (PGs) (8, 21, 35, 36, 49). In particular, 15-deoxy-Delta 12,14-prostaglandin J2 (15dPGJ2) has been shown to exert important anti-inflammatory effects on several cell types such as monocytes/macrophages and microglia (4, 16, 35, 36). Controversy exists about the identification of intracellular targets involved in the mechanism of action of cyclopentenone PGs: some of these effects have been explained through the transcriptional inhibition exerted by 15dPGJ2-activated peroxisome proliferator receptor gamma (PPARgamma ) (12, 14, 36, 39); however, other data suggest a main contribution of PPARgamma -independent mechanisms on the anti-inflammatory action of this PG, in view of the lack of effect of synthetic PPARgamma ligands such as thiazolidinediones (17, 35).

It has been shown that 15dPGJ2 inhibits the expression of genes requiring the activation of the transcription factors NF-kappa B, AP-1, and Stat1 (17, 35, 36), which are involved in the induction of several enzymes participating in the development of the inflammatory process, such as type 2 nitric oxide synthase (NOS-2) and cyclooxygenase 2 (COX-2) (7, 42, 51). In macrophages, activated NF-kappa B complexes are composed mainly of p50 and p65 subunits that translocate to the nucleus in response to cell stimulation with lipopolysaccharide (LPS) and proinflammatory cytokines (13, 45, 48). This activation of NF-kappa B requires phosphorylation by Ikappa B kinase (IKK) of Ikappa B proteins in specific serine residues that target these proteins for ubiquitin conjugation and degradation by the 26S proteasome (26, 45). The IKK complex contains two catalytic subunits, IKK1 and IKK2, and a regulatory subunit termed NF-kappa B essential modulator (10, 54, 56). In turn, activation of IKK is mediated by phosphorylation through NF-kappa B-inducing kinase, which acts preferentially over IKK1, and MEK kinase 1 (MEKK1), which phosphorylates IKK2 (6, 30). Biochemical and genetic data indicate that IKK1 and IKK2, despite the sequence similarity, have different functions (15, 55). IKK1 participates in differentiation of various cell types (20), whereas IKK2 is involved in LPS signaling in monocytes/macrophages and in general the response to proinflammatory stimuli (34, 55). IKK2 is rapidly activated after cell challenge with LPS, IL-1beta , or tumor necrosis factor alpha (TNF-alpha ) and progressively undergoes phosphorylation at multiple serine residues that decreases the kinase activity and therefore contributes to the transient activation of this enzyme (6). In this regard, we have investigated the possibility of early effects of 15dPGJ2 on LPS and IFN-gamma (collectively termed LPS/IFN-gamma ) cooperative signaling in RAW 264.7 macrophages. Our data show that treatment of macrophages with 15dPGJ2 results in a significant inhibition of IKK2 activity. As a result, the phosphorylation of Ikappa Balpha and the degradation of Ikappa Balpha and Ikappa Bbeta are inhibited, causing a partial inhibition of NF-kappa B activity. Accordingly, the expression of genes requiring NF-kappa B activation is significantly impaired by this mechanism.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Chemicals. Reagents were from Sigma (St. Louis, Mo.), Boehringer (Mannheim, Germany), and Merck (Darmstadt, Germany). Antibodies and glutathione S-transferase (GST) fusion proteins were from Santa Cruz Biotechnology (Santa Cruz, Calif.). Anti-phospho-(Ser32)kappa Balpha antibody (Ab) was from New England Biolabs (Beverly, Mass.). Electrophoresis equipment and reagents were from Bio-Rad (Richmond, Calif.) and Amersham (Little Chalfont, United Kingdom). PGs were from Cayman (Ann Arbor, Mich.). Serum and media were from BioWhittaker (Walkersville, Md.).

Cell culture. RAW 264.7 cells were seeded at 6 × 104 to 8 × 104/cm2 in RPMI 1640 medium supplemented with 2 mM glutamine, 10% fetal calf serum (FCS), and antibiotics (50 µg each of penicillin, streptomycin, and gentamicin per ml). After 2 days, the cell layers were washed with phosphate-buffered saline (PBS) and the culture medium was replaced by phenol red-free RPMI 1640 medium containing 0.5 mM arginine and 0.5% FCS, followed by the addition of the indicated stimuli. PGs and rosiglitazone were added 5 min prior to activation with LPS and IFN-gamma .

Plasmid constructs and preparation. The (kappa B)3ConA.CAT plasmid construct, which contains three copies of the kappa B motif from the human immunodeficiency virus long-terminal repeat enhancer with the conalbumin A promoter, was used to measure kappa B transactivation capacity (8, 9, 48). The ConA.CAT vector, lacking the kappa B tandem, was used as a control. A 1-kb fragment corresponding to the 5'-flanking region of the NOS-2 gene fused to a chloramphenicol acetyltransferase (CAT) reporter [p2iNOS(+,+).CAT vector] and the same vector with mutated kappa B sequences corresponding to nucleotides -971 to -961 and -85 to -75 [p2iNOS(-,-).CAT] were also used. Plasmid kSV2.CAT was used as a reference for efficiency of the transfection (42, 48). Plasmids were purified using EndoFree columns (Qiagen, Hilden, Germany).

Bacterial expression and purification of GST fusion proteins. GST-Ikappa Balpha (1-317) was from Santa Cruz. GST-Ikappa Balpha (1-54) and GST-Ikappa Balpha (1-54) mutated from Ser32/36 to Ala32/36 (GST-Ikappa Balpha S/A) were expressed in the DH5alpha F' strain of Escherichia coli as described elsewhere (19, 44), and the fusion proteins were purified on a glutathione-Sepharose 4B column (Pharmacia Biotech).

Preparation of cytosolic and nuclear extracts. Cells (1.5 × 106) were washed with PBS and collected by centrifugation. Cell pellets were homogenized with 100 µl of buffer A (10 mM HEPES [pH 7.9], 1 mM EDTA, 1 mM EGTA, 100 mM KCl, 1 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride, aprotinin [2 µg/ml], leupeptin [10 µg/ml], Nalpha -p-tosyl-L-lysine chloromethyl ketone [TLCK; 2 µg/ml], 5 mM NaF, 1 mM NaVO4, 10 mM Na2MoO4). After 10 min at 4°C, Nonidet P-40 was added to reach a 0.5% concentration. The tubes were gently vortexed for 15 s, and nuclei were collected by centrifugation at 8,000 × g for 15 min (9, 40). The supernatants were stored at -80°C (cytosolic extracts); the pellets were resuspended in 50 µl of buffer A supplemented with 20% glycerol-0.4 M KCl and gently shaken for 30 min at 4°C. Nuclear protein extracts were obtained by centrifugation at 13,000 × g for 15 min, and the supernatant was stored at -80°C. Protein content was assayed using the Bio-Rad protein reagent. All cell fractionation steps were carried out at 4°C.

EMSA. The sequences 5'TGCTAGGGGGATTTTCCCTCTCTCTGT3', corresponding to the consensus NF-kappa B binding site (nucleotides -978 to -952) of the murine NOS-2 promoter (8, 51, 52), and 5'CGAACGTGACCTTTGTCCTCCCCTTTTGCTCGATC3', corresponding to the PPARalpha binding site of the promoter of acyl coenzyme A (acyl-CoA) oxidase (11), were used. Oligonucleotides were annealed with their complementary sequence by incubation for 5 min at 85°C in 10 mM Tris-HCl (pH 8.0)-50 mM NaCl-10 mM MgCl2-1 mM DTT. Aliquots of 50 ng of these annealed oligonucleotides were end labeled with Klenow enzyme fragment in the presence of 50 µCi of [alpha -32P]dCTP and the other unlabeled deoxynucleoside triphosphates in a final volume of 50 µl. A total of 5 × 104 dpm of the DNA probe was used for each binding assay of nuclear extracts as follows. Three micrograms of nuclear protein was incubated for 15 min at 4°C with the DNA and 2 µg of poly(dI-dC)-5% glycerol-1 mM EDTA-100 mM KCl-5 mM MgCl2-1 mM DTT-10 mM Tris-HCl (pH 7.8) in a final volume of 20 µl. The DNA-protein complexes were separated on native 6% polyacrylamide gels in 0.5% Tris-borate-EDTA buffer (9). Supershift assays were carried out after incubation of the nuclear extracts with 2 µg of Ab (anti-p50, anti-c-Rel, anti-p65, and anti-PPARalpha ) for 1 h at 4°C, followed by electrophoretic mobility shift assay (EMSA) (not shown).

Transfection of RAW 264.7 cells and assay of CAT activity. The cells were washed twice with PBS and incubated with 1.5 ml of RPMI 1640 medium without FCS (6-cm-diameter dishes). Cells were transfected for 6 h by lipofection with DOTAP as instructed by the supplier (Boehringer Mannheim). After transfection, the cells were maintained for 24 h prior to stimulation in RPMI 1640 medium containing 5% FCS. Equal amounts of DNA were used in the transfection experiments, and CAT activity was determined after 18 h of treatment of the cells with the indicated stimuli following a previous protocol based on thin-layer chromatography separation of the acetylated chloramphenicol (9). The amount of acetylated substrate was quantified in a Fuji BAS1000 radioactivity detection system.

Characterization of gene expression by Northern blotting. Total RNA (2 × 106 to 4 × 106 cells) was extracted by the guanidinium thiocyanate method (2, 9, 24, 48). After electrophoresis in a 0.9% agarose gel containing 2% formaldehyde, the RNA was transferred to a Nytran membrane (NY 13-N; Schleicher & Schuell, Dassel, Germany), and the levels of NOS-2, COX-2, Ikappa Balpha , and Ikappa Bbeta mRNAs were determined using an EcoRI-HindII fragment from the NOS-2 cDNA, or the cDNA of the other genes (48), labeled with [alpha -32P]dCTP by using a Rediprime labeling kit (Amersham). The membranes were exposed to X-ray films (Hyperfilm; Amersham), and the intensity of the bands was measured by laser densitometry (Molecular Dynamics). The lane charge was normalized by hybridization with an 18S rRNA probe.

Determination of NO synthesis. NO was measured as the accumulation of nitrite and nitrate in the incubation medium. Nitrate was reduced to nitrite with nitrate reductase and determined spectrophotometrically with Griess reagent (9).

Characterization of proteins by Western blotting. Cytosolic protein extracts were size separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 10% gels. The gels were blotted onto a polyvinylidene difluoride membrane (Millipore) and incubated with several anti-NOS-2, anti-Ikappa Balpha , anti-Ikappa Bbeta , anti-p85alpha (phosphatidylinositol 3-kinase subunit), and anti-IKK2 Abs (Santa Cruz). In experiments using anti-phospho-(Ser32) Ikappa Balpha Ab, the blot incubation solution contained GST-Ikappa Balpha (1-317) (50 ng/ml) treated previously with alkaline phosphatase-agarose (47). The blots were submitted to sequential reprobing with Abs after treatment with 100 mM beta -mercaptoethanol and 2% SDS in Tris-buffered saline and were heated at 60°C for 30 min. The blots were revealed by enhanced chemiluminescence as instructed by the manufacturer (Amersham).

Confocal microscopy. RAW cells were grown on coverslips and incubated for 45 min with the indicated stimuli. After the disks were washed twice with ice-cold PBS, the cells were fixed with methanol at -20°C for 2 min, blocked with 3% bovine serum albumin for 30 min at room temperature, and incubated for 30 min with 1:100 anti-Ikappa Balpha or anti-Ikappa Bbeta Ab. After three washes with ice-cold PBS, the cells were revealed using a secondary Ab (1:300) against rabbit immunoglobulin (Ig) conjugated with Cy3 (Amersham). The cells were visualized using an MRC-1024 confocal microscope (Bio-Rad), and fluorescence was measured and electronically evaluated. Laser Sharp software (Bio-Rad) was used to determine the relative intensity of the fluorescence per pixel and the percentage of cytosolic and nuclear localization.

Measurement of IKK2 activity. Cells (107) were homogenized in buffer A and centrifuged for 10 min in a microcentrifuge. The supernatant (1 ml) was precleared, and IKK2 was immunoprecipitated with 1 µg of anti-IKK2 Ab (10, 29). After extensive washing of the immunoprecipitate with buffer A, the pellet was resuspended in kinase buffer (20 mM HEPES [pH 7.4], 0.1 mM EDTA, 100 mM NaCl, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, aprotinin [2 µg/ml], leupeptin [10 µg/ml], TLCK [2 µg/ml], 5 mM NaF, 1 mM NaVO4, 10 mM Na2MoO4, 10 nM okadaic acid). Kinase activity was assayed in 100 µl of buffer A containing 100 ng of immunoprecipitate, 50 µM [gamma -32P]ATP (0.5 µCi), and as substrate 100 ng of GST-Ikappa Balpha (1-317) or GST-Ikappa Balpha (1-54) and the corresponding Ala32/36-mutated protein. Aliquots of the reaction mixture were stopped at various times in 1 ml of ice-cold buffer A supplemented with 5 mM EDTA. The same protocol was used when the activity of IKK2 was followed by Western blotting using anti-phospho-(Ser32)Ikappa Balpha Ab, except for the use of 1 mM MgATP instead of [gamma -32P]ATP. GST-Ikappa Balpha was purified by glutathione-agarose chromatography and analyzed by SDS-PAGE (10% gel). The linearity of the kinase reaction was confirmed over a period of 30 min.

Data analysis. The number of experiments analyzed is indicated in the corresponding figure legend. Statistical differences (P < 0.05) between mean values (presented with standard errors of the means [SEM]) were determined by one-way analysis of variance followed by Student's t test. In experiments using X-ray films (Hyperfilm), different exposure times were used to ensure that bands were not saturated.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

15dPGJ2 inhibits the activation of NF-kappa B. Incubation of cultured RAW 264.7 cells with 2 µM 15dPGJ2 inhibited significantly (79% after densitometry of the p50-p65 band) the activation of NF-kappa B elicited after LPS/IFN-gamma challenge, as measured by EMSA (Fig. 1A). However, PGJ2 (2 µM) and rosiglitazone (10 µM) failed to exert a significant inhibition. A dose-dependent effect of 15dPGJ2 on NF-kappa B activity in LPS/IFNgamma -stimulated cells is shown in Fig. 1B. The half-maximal inhibition was obtained at ca. 0.5 µM, as judged from the intensity of the p50-p65 band as assessed by supershift assays (not shown). The binding of nuclear proteins to the PPARalpha response element of the acyl-CoA oxidase promoter (11) was used as an internal control to ensure that 15dPGJ2 did not influence the extraction of nuclear proteins and as a control of lane charge.


View larger version (46K):
[in this window]
[in a new window]
  		FIG. 1.   NF-kappa B binding is inhibited in activated RAW 264.7 cells treated with 15dPGJ2. (A) Macrophages were incubated for 1 h with different combinations of 15dPGJ2 (2 µM), PGJ2 (2 µM), rosiglitazone (10 µM), LPS (500 ng/ml), and IFN-gamma (10 U/ml). After homogenization of the cells, nuclear extracts were prepared and the binding of nuclear proteins to the distal kappa B motif of the NOS-2 promoter was determined by EMSA. Supershift assays with Abs against proteins of the c-Rel family (not shown) identified p50-p50 and p50-p65 as the complexes present in the lower and upper bands, respectively. (B) Dose-dependent effect of 15dPGJ2 on NF-kappa B activity. The binding of nuclear proteins to the PPARalpha R response element of the acyl-CoA oxidase promoter was used as control of extraction of nuclear proteins and lane load. The intensity of the bands was determined, and the corresponding values are expressed as mean ± SEM of three experiments (A). *, P < 0.005 with respect to the LPS/IFN-gamma condition. a.u., arbitrary units.

To evaluate whether 15dPGJ2 could influence the turnover and subcellular distribution of Ikappa B proteins, and therefore NF-kappa B activation, the amounts of Ikappa Balpha and Ikappa Bbeta were determined in the cytosol and nucleus by confocal microscopy and by immunoblot analysis. As Fig. 2A shows, 15dPGJ2 did not modify significantly the levels and subcellular distribution of either Ikappa Balpha or Ikappa Bbeta ; however, the marked decrease of Ikappa B proteins elicited by LPS was notably impaired in the presence of 15dPGJ2. Moreover, an important nuclear accumulation of Ikappa Bbeta (7-fold greater than in the LPS condition) and, to a lesser extent, of Ikappa Balpha (3.1-fold greater than in the LPS condition) was observed in cells treated with LPS and 15dPGJ2. These results were confirmed when the amounts of Ikappa Balpha and Ikappa Bbeta were determined by Western blotting using nuclear and cytosolic extracts prepared from these cells (Fig. 2B).


View larger version (44K):
[in this window]
[in a new window]
  		FIG. 2.   Subcellular distribution of Ikappa Balpha and Ikappa Bbeta in cells treated with 15dPGJ2. Macrophages were incubated for 45 min with LPS (500 ng/ml) and 15dPGJ2 (1 µM). After the cells were fixed, Ikappa B proteins were detected with specific Abs and revealed using Cy3-labeled anti-rabbit Ig. (A) The intensity of the fluorescence in the cytosolic and nuclear compartments was digitalized and quantified (n = 14 to 21 cells per condition). (B) The corresponding amount of Ikappa Balpha and Ikappa Bbeta present in cytosolic and nuclear extracts was determined also by Western blotting. Results show the mean ± SEM of three experiments. *, P < 0.05 with respect to the corresponding LPS condition.

The inhibitory effect of 15dPGJ2 on NF-kappa B activity was further analyzed in cells transfected with the (kappa B)3ConA.CAT vector, by monitoring the reporter activity in response to LPS challenge. Incubation with 1 and 2 µM 15dPGJ2 decreased the LPS-dependent activation of the reporter by 69 and 85%, respectively. Treatment of cells with PGJ2, and rosiglitazone did not affect significantly the reporter activity (Fig. 3A). Transfection with ConA.CAT and kSV2.CAT vectors was used to ensure that the stimuli used did not influence transcription of the reporter gene. In addition to the kappa B-responsive vector, cells were transfected with the p2iNOS(+,+).CAT vector, a construct strictly dependent on NF-kappa B activation. As Fig. 3B shows, 15dPGJ2 decreased (75%) the CAT activity induced by LPS/IFN-gamma , whereas 10 µM rosiglitazone inhibited only 27% of the expression of the reporter gene under identical experimental conditions. Interestingly, the use of a fragment of the NOS-2 promoter deleted in the kappa B sites [p2iNOS(-,-).CAT] completely abolished the activity of the promoter, reflecting the necessity of this motif for expression of the reporter gene in response to LPS/IFN-gamma stimulation. To better assess the relevance of the changes of NF-kappa B activity on the expression of genes regulated by this transcription factor, we stimulated cells with different PGs and measured the activity and expression of NOS-2. As Fig. 4A shows, the synthesis of nitrite plus nitrate in LPS/IFN-gamma -activated macrophages was inhibited (73%) in cells incubated with 2 µM 15dPGJ2, whereas PGJ2 exerted a moderate inhibition (27%) and rosiglitazone and other bioactive PGs had no significant effect. The dose-dependent effect of 15dPGJ2 on NOS-2 protein levels showed a half-maximal inhibition at ca. 0.2 to 0.5 µM PG (Fig. 4B).


View larger version (25K):
[in this window]
[in a new window]
  		FIG. 3.   15dPGJ2 inhibits CAT expression in cells transfected with (kappa B)3ConA.CAT and p2iNOS.CAT vectors. Macrophages were transfected with DOTAP, and cells were incubated with the indicated stimuli followed by activation with LPS (500 ng/ml) (A) or LPS (500 ng/ml) plus IFN-gamma (10 U/ml) (B). After 14 h of incubation with the indicated stimuli, CAT activity was determined. Transfection with ConA.CAT and kSV2.CAT was used to ensure that the ligands did not affect the basal activity of the promoters and the efficiency of the transfection. Results show the mean ± SEM of three experiments. *, P < 0.01 with respect to the LPS or LPS/IFN-gamma condition.


View larger version (22K):
[in this window]
[in a new window]
  		FIG. 4.   Inhibition of NOS-2 expression by 15dPGJ2 in RAW 264.7 cells activated with LPS/IFN-gamma . Cells were treated for 5 min with the indicated concentrations of PGs, rosiglitazone and hydroxyoctadecadienoic acid (9-HODE), followed by activation with LPS (200 ng/ml) and IFN-gamma (10 U/ml). (A) After 18 h of incubation,the amount of nitrite and nitrate in the culture medium was measured. (B) The dose-dependent effect of 15dPGJ2 on NOS-2 levels was determined by Western blotting, using the levels of the phosphatidylinositol 3-kinase subunit p85alpha as a control of lane charge. Results show the mean of three experiments (A) and a representative blot out of two (B).

To better evaluate the biological effects of 15dPGJ2 on the transcription of genes that require NF-kappa B activation, the RNA levels of NOS-2 and COX-2 (both dependent on NF-kappa B activity in response to LPS/IFNgamma challenge [24, 48]) and those of Ikappa Balpha and Ikappa Bbeta (involved in the resynthesis of these inhibitory proteins) were determined after 4 h of stimulation. Incubation with 1 µM 15dPGJ2 decreased by more than 90% the levels of NOS-2 and COX-2 mRNAs in activated macrophages. However, the effects were less remarkable for Ikappa Balpha and Ikappa Bbeta , due probably to the different kinetics of the steady-state levels of these RNAs (Fig. 5). Indeed, the levels of Ikappa B mRNA measured in these cells may account for the accumulation of Ikappa B observed at 2 to 3 h in LPS-activated cells treated with 15dPGJ2 (not shown).


View larger version (36K):
[in this window]
[in a new window]
  		FIG. 5.   15dPGJ2 decreases the mRNA levels of COX-2 and NOS-2. Cells were incubated with the indicated concentrations of PG and activated with LPS (200 ng/ml) and IFN-gamma (10 U/ml). After 4 h of treatment, the cells were homogenized and the RNA was extracted and analyzed by Northern blotting using probes specific for the indicated genes. Results show the mean band intensity expressed as a percentage of that in the absence of PG and after normalization for the content of 18S rRNA (n = 3).

Inhibition of IKK activity by 15dPGJ2. The preceding results show an inhibition of NF-kappa B activity, likely due to an impaired Ikappa B targeting in LPS-activated RAW 264.7 cells treated with 15dPGJ2. To investigate the possibility of a reduced phosphorylation of Ikappa B under these conditions, cells were incubated with 15dPGJ2 and stimulated with LPS/IFN-gamma . The IKK complex was immunoprecipitated at various times using an anti-IKK2 Ab, and its kinase activity was evaluated with GST-Ikappa Balpha as the substrate. As Fig. 6A shows, phosphorylation of GST-Ikappa Balpha by IKK following the incorporation of [32P]phosphate at 20 and 30 min of reaction decreased by 70 and 75% with respect to the corresponding LPS/IFN-gamma controls when cells were treated with 2 µM 15dPGJ2. Moreover, in a parallel experiment using cells incubated with 10 µM MG132 (Z-Leu-Leu-Leu-CHO) to inhibit Ikappa B degradation, the specific phosphorylation in vivo of Ikappa Balpha in Ser32 was inhibited in response to 15dPGJ2 (Fig. 6B). These results support the occurrence of a reduced activity of IKK2 in cells treated with 15dPGJ2.


View larger version (28K):
[in this window]
[in a new window]
  		FIG. 6.   Inhibition of Ikappa Balpha phosphorylation in activated RAW 264.7 cells treated with 15dPGJ2. Macrophages were incubated with 2 µM 15dPGJ2 5 min prior to stimulation with LPS (200 ng/ml) and IFN-gamma (10 U/ml). At the indicated times, cell extracts were prepared, IKK was immunoprecipitated, and the in vitro kinase activity of 100 ng of IP protein was assayed using GST-Ikappa Balpha (1-317) and [gamma -32P]ATP as substrates. (A) After 10 min of incubation, GST-Ikappa Balpha was purified with glutathione-agarose and analyzed by SDS-PAGE (10% gel). Aliquots (5 µl) of the kinase reaction mixture were analyzed by Western blotting to determine the amount of IKK2 present in each assay. (B) Cells treated with 10 µM MG132 were stimulated as described previously; at the indicated times, cytosolic extracts were prepared and the amount of endogenous P(Ser32)Ikappa Balpha was determined using a specific Ab. The blot was reprobed with anti-Ikappa Balpha Ab. The intensity of the bands of phosphorylated Ikappa Balpha (A) and the ratio between the band intensities of P(Ser32)Ikappa Balpha and Ikappa Balpha (B) are given. Results show the mean ± SEM of three experiments. *, P < 0.005 with respect to the corresponding LPS/IFN-gamma condition.

The mechanism by which 15dPGJ2 affects IKK activity appears to include a direct effect of this PG on the kinase activity of the complex. When IKK was immunoprecipitated from LPS/IFN-gamma -treated cells and activity was assayed by monitoring GST-(Ser32)Ikappa Balpha phosphorylation by Western blotting, a dose-dependent inhibition by 15dPGJ2 was observed; however, PGJ2 assayed at 2 µM failed to inhibit significantly the activity, suggesting a specific effect of 15dPGJ2 on the complex (Fig. 7A). Moreover, when kinase activity was assayed following the incorporation of [32P]phosphate into GST-Ikappa Balpha or GST-Ikappa Balpha S/A, the inhibitory effect of 15dPGJ2 was abolished after removal of the Ser32 and Ser36 phosphorylation sites. These results suggest that the direct effects of 15dPGJ2 on IKK activity are preferentially due to the inhibition of the phosphorylation of these residues (Fig. 7B).


View larger version (31K):
[in this window]
[in a new window]
  		FIG. 7.   Inhibition of IKK activity by 15dPGJ2. Macrophages were incubated for 20 min with LPS (200 ng/ml) and IFN-gamma (10 U/ml); after homogenization, the IKK complex was immunoprecipitated with anti-IKK2 Ab. Kinase activity was monitored in vitro for 10 min, using GST-Ikappa Balpha (1-317) as the substrate and in the presence of the indicated concentrations of PGs and rosiglitazone. P(Ser32)Ikappa Balpha was detected using a specific anti-P(Ser32)Ikappa Balpha Ab. The membrane was reprobed with anti-Ikappa Balpha Ab (A). The incorporation of [32P]phosphate into GST-Ikappa Balpha (1-54) or Ikappa Balpha S/A was determined as previously described (B). Results show the mean ± SEM of the band intensities, expressed with respect to the condition in the absence of PG and rosiglitazone. *, P < 0.01 with respect to the condition in the absence of addition.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The biological effects of cyclopentenone PGs have been the subject of intense research in recent years, and multiple targets mediating their actions have been proposed, ranging from specific interactions with PPARgamma , in which case they act as transcriptional regulators (14, 18, 36, 41), to effects on early signaling in response to a wide range of extracellular stimuli (5, 14, 38). In monocytes/macrophages, 15dPGJ2 exerts an anti-inflammatory action due to the attenuation of the expression of genes recognized classically as activators and mediators of different steps of the host defense response: first, it inhibits the synthesis and release of proinflammatory cytokines, such as IL-1beta and TNF-alpha that amplify the activation process (14); second, this PG inhibits the expression of effector proteins such as COX-2, NOS-2 (end products of which exert cytotoxic effects), and matrix metalloproteinases (4, 25, 36); third, it contributes to the resolution of the inflammatory process by promoting apoptosis of activated macrophages (1). This variety of effects produced by 15dPGJ2 and related cyclopentenone PGs is compatible with the existence of multiple sites of actions for these molecules (28, 33).

The anti-inflammatory actions of 15dPGJ2 have been considered to be mediated through the interaction with PPARgamma . Ricote et al. (36) reported the absence in RAW 264.7 cells of such a transcription factor, and most of the effects observed in these cells were obtained after transient expression of PPARgamma . However, PPARgamma was present in elicited peritoneal macrophages, and exogenous expression of this factor was not required to observe 15dPGJ2-dependent actions. In agreement with previous results, specific PPARgamma ligands, such as rosiglitazone assayed up to 10 µM (apparent dissociation constant [Kd], <100 nM), had no effect on NO synthesis or NF-kappa B inhibition in RAW cells (18, 36). The Kd of 15dPGJ2 for murine PPARgamma was estimated to be between 1 and 10 µM. Moreover, portions of the experiments from this work were repeated using primary cultures of peritoneal macrophages, and the effects of 15dPGJ2 were very similar to those observed in RAW cells at short periods of times (up to 4 h). However, the effects were more pronounced when some parameters (for example, the synthesis of NO and the levels of NOS-2 protein) were measured at longer periods of times (18 to 24 h). These observations suggest the concurrence of other mechanisms, mediated possibly via PPARgamma , that are also triggered by 15dPGJ2.

In this work, our attention was focused on the effects of 15dPGJ2 on the initial steps of macrophage activation after challenge with low doses of LPS and IFN-gamma acting in a synergistic way (22, 32, 52). The observation of a decreased LPS/IFN-gamma -dependent NF-kappa B activation by this PG precludes the expression of a large number of genes that require the engagement of this transcription factor (13, 23). 15dPGJ2 not only inhibited significantly the degradation of Ikappa Balpha and Ikappa Bbeta in these cells but also exerted marked effects on the nuclear distribution of these proteins. Moreover, the presence of Ikappa B in the nucleus contributes to the inhibition of the binding of the active NF-kappa B complexes to the kappa B sites located in regulatory sequences of various genes (3, 46, 48). Indeed, the studies of the traffic of Ikappa Balpha through the nuclear membrane suggest a physiological inhibitory role for the Ikappa B proteins that are retained in the nucleus (37, 38). These data are in agreement with the observation of an important decrease in the binding of nuclear proteins to the kappa B sequences as determined by EMSA, as well as a very efficient repression of the transcription of genes requiring NF-kappa B activity, such as NOS-2 and COX-2 (mRNA levels were determined at 4 h), or in cells transfected with a kappa B reporter gene. However, when synthesis of nitrites was measured after 18 to 24 h of culture, the inhibitory action of 1 µM 15dPGJ2 was not as effective as that reflected by the action on mRNA levels (4 h). This might be due to the degradation of 15dPGJ2 in the cell, a process for which, to our knowledge, no kinetic control has been established. In contrast to this high efficiency in the repression of NOS-2 and COX-2 at 4 h, in experiments monitoring the mRNA levels of Ikappa Balpha and Ikappa Bbeta we observed the prevalence of an important upregulation of both RNAs, probably because of a higher sensitivity of these genes to NF-kappa B activation. Indeed, this particular regulation of Ikappa B proteins might help to turn off NF-kappa B activity, precluding a persistent activation of this transcription factor (13, 46, 48).

In view of the rapid effects of 15dPGJ2 inhibiting Ikappa B degradation, we investigated the action of this PG upstream of this step. In human monocytes, triggering with LPS activates IKK2, and this kinase is responsible for the specific phosphorylation of Ikappa Bs that targets these proteins for ubiquitination and degradation (27, 34, 43). In RAW 264.7 cells, we observed that 15dPGJ2 inhibits in vivo the specific phosphorylation of Ikappa Balpha at Ser32. Moreover, when IKK activity was immunoprecipitated from activated cells, those treated with 15dPGJ2 showed a lower kinase activity with GST-Ikappa Balpha as substrate, assayed by either monitoring [32P]phosphate incorporation or detecting phosphorylation of Ser32. The effect of 15dPGJ2 on other kinases was assayed; it failed to inhibit the activity of protein kinase A and the classic and new isotypes of protein kinase C assayed as Ca2+ and diacylglycerol-dependent activities, as well as the Jak activity associated with the IFN-gamma receptor and followed by the specific phosphorylation of Stat1alpha in these cells (not shown). Moreover, the inhibition of IKK activity observed in cells treated with 15dPGJ2 can be explained through a direct and specific effect mediated by this PG, as confirmed by in vitro experiments. However, because the loss of activity persisted even when the IKK complex was immunoprecipitated and assayed in vitro, it is possible that 15dPGJ2 alters the structure of the IKK complex or favors an accelerated hyperphosphorylation state of IKK2 that has been described as impairing the kinase activity (6). In this regard, a positive and negative regulation of IKK through the phosphorylation of IKK2 has been described (6). In HeLa cells stimulated with TNF-alpha , IKK activity decreased faster than its phosphorylation. This is because phosphorylation of two loops of IKK is essential for the activation in response to proinflammatory stimuli, whereas autophosphorylation at the carboxyl terminus of a serine cluster contributes to the reduction of the activity. Preliminary experiments performed in cells labeled with [33P]phosphate showed an impairment in the phosphorylation state of IKK2 analyzed over a 30-min period, suggesting that 15dPGJ2 inhibits the activation of IKK2 rather than enhances its time-dependent phosphorylation (unpublished data). Taken together, the effects of 15dPGJ2 on the inhibition of IKK activity are reminiscent of those observed for other anti-inflammatory drugs such as aspirin and salicylate (53), suggesting an important role for IKK as a physiological and pharmacological target to mediate anti-inflammatory actions.

In conclusion, our data show a specific action of 15dPGJ2 on the activity of the IKK complex, an inhibitory effect that can be observed directly when the kinase is assayed in vitro. In addition, 15dPGJ2 redistributes Ikappa Balpha and in particular Ikappa Bbeta in the nuclei of activated macrophages, a process that may contribute to the impairment of NF-kappa B activation. Unraveling the presumably sequential targets for 15dPGJ2 and related PGs might contribute to a better understanding of the mechanism of action of physiologically occurring anti-inflammatory PGs as well as those pertaining to the process of resolution of inflammation.


    ACKNOWLEDGMENTS

We thank Q.-W. Xie and C. Nathan for the generous gift of the NOS-2 promoter, T. J. Evans for the gift of the mutated kappa B sequences of the NOS-2 promoter, J. Moscat for the mutated GST-Ikappa Balpha constructs, and A. Alvarez from the Centro de Citometría de Flujo and Microspopía Confocal for the immunofluorescence analysis. The technical support of O. G. Bodelón and the help of E. Lundin in preparing the manuscript are acknowledged.

This work was supported by DGESIC (PM98-0120) and Comunidad de Madrid (08.3/004/97).


    FOOTNOTES

* Corresponding author. Mailing address: Instituto de Bioquímica, Facultad de Farmacia, 28040 Madrid, Spain. Fax: 3491 543 8649 or 3491 394 1782. E-mail: boscal{at}eucmax.sim.ucm.es.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Chinetti, G., S. Griglio, M. Antonucci, I. P. Torra, P. Delerive, Z. Majd, J. C. Fruchart, J. Chapman, J. Najib, and B. Staels. 1998. Activation of proliferator-activated receptors alpha  and gamma  induces apoptosis of human monocyte-derived macrophages. J. Biol. Chem. 273:25573-25580[Abstract/Free Full Text].
2. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline].
3. Chu, Z. L., T. A. McKinsey, L. Liu, X. Qi, and D. W. Ballard. 1996. Basal phosphorylation of the PEST domain in the Ikappa Bbeta regulates its functional interaction with the c-rel proto-oncogene product. Mol. Cell. Biol. 16:5974-5984[Abstract].
4. Colville-Nash, P. R., S. S. Qureshi, D. Willis, and D. A. Willoughby. 1998. Inhibition of inducible nitric oxide synthase by peroxisome proliferator-activated receptor agonists: correlation with induction of heme oxygenase 1. J. Immunol. 161:978-984[Abstract/Free Full Text].
5. D'Acquisto, F., L. Sautebin, T. Iuvone, M. Di Rosa, and R. Carnuccio. 1998. Prostaglandins prevent inducible nitric oxide synthase protein expression by inhibiting nuclear factor-kappa B activation in J774 macrophages. FEBS Lett. 440:76-80[CrossRef][Medline].
6. Delhase, M., M. Hayakawa, Y. Chen, and M. Karin. 1999. Positive and negative regulation of Ikappa B kinase activity through IKKbeta subunit phosphorylation. Science 284:309-313[Abstract/Free Full Text].
7. DeWitt, D. L. 1991. Prostaglandin endoperoxide synthase: regulation of enzyme expression. Biochim. Biophys. Acta 1083:121-134[Medline].
8. Diaz-Guerra, M. J. M., A. Castrillo, P. Martin-Sanz, and L. Bosca. 1999. Negative regulation by protein tyrosine phosphatase of IFN-gamma -dependent expression of inducible nitric oxide synthase. J. Immunol. 162:6776-6783[Abstract/Free Full Text].
9. Diaz-Guerra, M. J. M., M. Velasco, P. Martin-Sanz, and L. Bosca. 1996. Evidence for common mechanisms in the transcriptional control of type II nitric oxide synthase in isolated hepatocytes. Requirement of NF-kappa B activation after stimulation with bacterial cell wall products and phorbol esters. J. Biol. Chem. 271:30114-30120[Abstract/Free Full Text].
10. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, and M. Karin. 1997. A cytokine-responsive Ikappa B kinase that activates the transcription factor NF-kappa B. Nature 388:548-554[CrossRef][Medline].
11. Dowell, P., V. J. Peterson, T. M. Zabriskie, and M. Leid. 1997. Ligand-induced peroxisome proliferator-activated receptor alpha  conformational change. J. Biol. Chem. 272:2013-2020[Abstract/Free Full Text].
12. Forman, B. M., P. Tontonoz, J. Chen, R. P. Brun, B. M. Spiegelman, and R. M. Evans. 1995. 15-Deoxy-Delta 12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPARgamma . Cell 83:803-812[CrossRef][Medline].
13. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225-260[CrossRef][Medline].
14. Jiang, C., A. T. Ting, and B. Seed. 1998. PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature 391:82-86[CrossRef][Medline].
15. Karin, M. 1999. The beginning of the end: Ikappa B kinase (IKK) and NF-kappa B activation. J. Biol. Chem. 274:27339-27342[Free Full Text].
16. Kitamura, Y., J. Kakimura, Y. Matsuoka, Y. Nomura, P. J. Gebicke-Haerter, and T. Taniguchi. 1999. Activators of peroxisome proliferator-activated receptor-gamma (PPAR gamma ) inhibit inducible nitric oxide synthase expression but increase heme oxygenase-1 expression in rat glial cells. Neurosci. Lett. 262:129-132[CrossRef][Medline].
17. Kliewer, S. A., J. M. Lenhard, T. M. Willson, I. Patel, D. C. Morris, and J. M. Lehmann. 1995. A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma  and promotes adipocyte differentiation. Cell 83:813-819[CrossRef][Medline].
18. Krey, G., O. Braissant, F. L'Horset, E. Kalkhoven, M. Perroud, M. G. Parker, and W. Wahli. 1997. Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Mol. Endocrinol. 11:779-791[Abstract/Free Full Text].
19. Lallena, M. J., M. T. Diaz-Meco, G. Bren, C. V. Paya, and J. Moscat. 1999. Activation of Ikappa B kinase beta  by protein kinase C isoforms. Mol. Cell. Biol. 19:2180-2188[Abstract/Free Full Text].
20. Li, Q., D. Van Antwerp, F. Mercurio, K. F. Lee, and I. M. Verma. 1999. Severe liver degeneration in mice lacking the Ikappa B kinase 2 gene. Science 284:321-325[Abstract/Free Full Text].
21. Lopez-Collazo, E., S. Hortelano, A. Rojas, and L. Bosca. 1998. Triggering of peritoneal macrophages with IFN-alpha /beta attenuates the expression of inducible nitric oxide synthase through a decrease in NF-kappa B activation. J. Immunol. 160:2889-2895[Abstract/Free Full Text].
22. Lowenstein, C. J., E. W. Alley, P. Raval, A. M. Snowman, S. H. Snyder, S. W. Russell, and W. J. Murphy. 1993. Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma  and lipopolysaccharide. Proc. Natl. Acad. Sci. USA 90:9730-9734[Abstract/Free Full Text].
23. MacMicking, J., Q. W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage function. Annu. Rev. Immunol. 15:323-350[CrossRef][Medline].
24. Martin-Sanz, P., N. A. Callejas, M. Casado, M. J. Diaz-Guerra, and L. Bosca. 1998. Expression of cyclooxygenase-2 in foetal rat hepatocytes stimulated with lipopolysaccharide and pro-inflammatory cytokines. Br. J. Pharmacol. 125:1313-1319[CrossRef][Medline].
25. Marx, N., G. Sukhova, C. Murphy, P. Libby, and J. Plutzky. 1998. Macrophages in human atheroma contain PPARgamma : differentiation-dependent peroxisomal proliferator-activated receptorgamma (PPARgamma ) expression and reduction of MMP-9 activity through PPARgamma activation in mononuclear phagocytes in vitro. Am. J. Pathol. 153:17-23[Abstract/Free Full Text].
26. May, M. J., and S. Ghosh. 1998. Signal transduction through NF-kappa B. Immunol. Today 19:80-88[CrossRef][Medline].
27. May, M. J., and S. Ghosh. 1999. Ikappa B kinases: kinsmen with different crafts. Science 284:271-273[Free Full Text].
28. McGeer, P. L., M. Schulzer, and E. G. McGeer. 1996. Arthritis and anti-inflammatory agents as possible protective factors for Alzheimer's disease: a review of 17 epidemiologic studies. Neurology 47:425-432[Abstract/Free Full Text].
29. Mercurio, F., H. Zhu, B. W. Murray, A. Shevchenko, B. L. Bennett, J. Li, D. B. Young, M. Barbosa, M. Mann, A. Manning, and A. Rao. 1997. IKK-1 and IKK-2: cytokine-activated Ikappa B kinases essential for NF-kappa B activation. Science 278:860-866[Abstract/Free Full Text].
30. Nakano, H., M. Shindo, S. Sakon, S. Nishinaka, M. Mihara, H. Yagita, and K. Okumura. 1998. Differential regulation of Ikappa B kinase alpha  and beta  by two upstream kinases, NF-kappa B-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1. Proc. Natl. Acad. Sci. USA 5:3537-3542.
31. Nathan, C. 1997. Inducible nitric oxide synthase: what difference does it make? J. Clin. Investig. 100:2417-2423[Medline].
32. Nathan, C., and Q. W. Xie. 1994. Nitric oxide synthases: roles, tolls, and controls. Cell 78:915-918[CrossRef][Medline].
33. Negishi, M., T. Koizumi, and A. Ichikawa. 1995. Biological actions of delta 12-prostaglandin J2. J. Lipid Mediat. Cell Signal. 12:443-448[CrossRef][Medline].
34. O'Connell, M. A., B. L. Bennett, F. Mercurio, A. M. Manning, and N. Mackman. 1998. Role of IKK1 and IKK2 in lipopolysaccharide signaling in human monocytic cells. J. Biol. Chem. 273:30410-30414[Abstract/Free Full Text].
35. Petrova, T. V., K. T. Akama, and L. J. Van Eldik. 1999. Cyclopentenone prostaglandins suppress activation of microglia: down-regulation of inducible nitric-oxide synthase by 15-deoxy-Delta 12,14-prostaglandin J2. Proc. Natl. Acad. Sci. USA 96:4668-4673[Abstract/Free Full Text].
36. Ricote, M., A. C. Li, T. M. Willson, C. J. Kelly, and C. K. Glass. 1998. The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature 391:79-82[CrossRef][Medline].
37. Rodriguez, M. S., J. Thompson, R. T. Hay, and C. Dargemont. 1999. Nuclear retention of Ikappa Balpha protects it from signal-induced degradation and inhibits nuclear factor kappa B transcriptional activation. J. Biol. Chem. 274:9108-9115[Abstract/Free Full Text].
38. Rossi, A., G. Elia, and M. G. Santoro. 1997. Inhibition of nuclear factor kappa B by prostaglandin A1: an effect associated with heat shock transcription factor activation. Proc. Natl. Acad. Sci. USA 94:746-750[Abstract/Free Full Text].
39. Rozera, C., A. Carattoli, A. De Marco, C. Amici, C. Giorgi, and M. G. Santoro. 1996. Inhibition of HIV-1 replication by cyclopentenone prostaglandins in acutely infected human cells. Evidence for a transcriptional block. J. Clin. Investig. 97:1795-1803[Medline].
40. Schreiber, E., P. Matthias, M. M. Muller, and W. Schaffner. 1989. Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells. Nucleic Acids Res. 17:6419[Free Full Text].
41. Spiegelman, B. M. 1998. PPAR-gamma : adipogenic regulator and thiazolidinedione receptor. Diabetes 47:507-514[Abstract].
42. Spink, J., J. Cohen, and T. J. Evans. 1995. The cytokine responsive vascular smooth muscle cell enhancer of inducible nitric oxide synthase. Activation by nuclear factor-kappa B. J. Biol. Chem. 270:29541-29547[Abstract/Free Full Text].
43. Stancovski, I., and D. Baltimore. 1997. NF-kappa B activation: the Ikappa B kinase revealed? Cell 91:299-302[CrossRef][Medline].
44. Taylor, J. A., G. D. Bren, K. N. Pennington, S. A. Trushin, S. Asin, and C. V. Paya. 1999. Serine 32 and serine 36 of Ikappa Balpha are directly phosphorylated by protein kinase CKII in vitro. J. Mol. Biol. 290:839-850[CrossRef][Medline].
45. Thanos, D., and T. Maniatis. 1995. NF-kappa B: a lesson in family values. Cell 80:529-532[CrossRef][Medline].
46. Thompson, J. E., R. J. Phillips, H. Erdjument-Bromage, P. Tempst, and S. Ghosh. 1995. Ikappa B-beta regulates the persistent response in a biphasic activation of NF-kappa B. Cell 80:573-582[CrossRef][Medline].
47. Tsai, S. H., S. Y. Lin-Shiau, and J. K. Lin. 1999. Suppression of nitric oxide synthase and the down-regulation of the activation of NFkappa B in macrophages by resveratrol. Br. J. Pharmacol. 126:673-680[CrossRef][Medline].
48. Velasco, M., M. J. Diaz-Guerra, P. Martin-Sanz, A. Alvarez, and L. Bosca. 1997. Rapid up-regulation of Ikappa Bbeta and abrogation of NF-kappa B activity in peritoneal macrophages stimulated with lipopolysaccharide. J. Biol. Chem. 272:23025-23030[Abstract/Free Full Text].
49. Wright, K., S. G. Ward, G. Kolios, and J. Westwick. 1997. Activation of phosphatidylinositol 3-kinase by interleukin-13. An inhibitory signal for inducible nitric-oxide synthase expression in epithelial cell line HT-29. J. Biol. Chem. 272:12626-12633[Abstract/Free Full Text].
50. Xie, Q., and C. Nathan. 1994. The high-output nitric oxide pathway: role and regulation. J. Leukoc. Biol. 56:576-582[Abstract].
51. Xie, Q. W., Y. Kashiwabara, and C. Nathan. 1994. Role of transcription factor NF-kappa B/Rel in induction of nitric oxide synthase. J. Biol. Chem. 269:4705-4708[Abstract/Free Full Text].
52. Xie, Q. W., R. Whisnant, and C. Nathan. 1993. Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon gamma  and bacterial lipopolysaccharide. J. Exp. Med. 177:1779-1784[Abstract/Free Full Text].
53. Yin, M. J., Y. Yamamoto, and R. B. Gaynor. 1998. The anti-inflammatory agents aspirin and salicylate inhibit the activity of Ikappa B kinase-beta . Nature 396:77-80[CrossRef][Medline].
54. Zandi, E., Y. Chen, and M. Karin. 1998. Direct phosphorylation of Ikappa B by IKKalpha and IKKbeta : discrimination between free and NF-kappa B-bound substrate. Science 281:1360-1363[Abstract/Free Full Text].
55. Zandi, E., and M. Karin. 1999. Bridging the gap: composition, regulation, and physiological function of the Ikappa B kinase complex. Mol. Cell. Biol. 19:4547-4551[Free Full Text].
56. Zandi, E., D. M. Rothwarf, M. Delhase, M. Hayakawa, and M. Karin. 1997. The Ikappa B kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta , necessary for Ikappa B phosphorylation and NF-kappa B activation. Cell 91:243-252[CrossRef][Medline].

Molecular and Cellular Biology, March 2000, p. 1692-1698, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Alvarez-Castelao, B., Martin-Guerrero, I., Garcia-Orad, A., Castano, J. G. (2009). Cytomegalovirus Promoter Up-regulation Is the Major Cause of Increased Protein Levels of Unstable Reporter Proteins after Treatment of Living Cells with Proteasome Inhibitors. J. Biol. Chem. 284: 28253-28262 [Abstract] [Full Text]  
  • Remels, A. H. V., Langen, R. C. J., Gosker, H. R., Russell, A. P., Spaapen, F., Voncken, J. W., Schrauwen, P., Schols, A. M. W. J. (2009). PPAR{gamma} inhibits NF-{kappa}B-dependent transcriptional activation in skeletal muscle. Am. J. Physiol. Endocrinol. Metab. 297: E174-E183 [Abstract] [Full Text]  
  • Scazzocchio, B., Vari, R., D'Archivio, M., Santangelo, C., Filesi, C., Giovannini, C., Masella, R. (2009). Oxidized LDL impair adipocyte response to insulin by activating serine/threonine kinases. J. Lipid Res. 50: 832-845 [Abstract] [Full Text]  
  • Doublier, S., Riganti, C., Voena, C., Costamagna, C., Aldieri, E., Pescarmona, G., Ghigo, D., Bosia, A. (2008). RhoA Silencing Reverts the Resistance to Doxorubicin in Human Colon Cancer Cells. Mol Cancer Res 6: 1607-1620 [Abstract] [Full Text]  
  • Jahoor, A., Patel, R., Bryan, A., Do, C., Krier, J., Watters, C., Wahli, W., Li, G., Williams, S. C., Rumbaugh, K. P. (2008). Peroxisome Proliferator-Activated Receptors Mediate Host Cell Proinflammatory Responses to Pseudomonas aeruginosa Autoinducer. J. Bacteriol. 190: 4408-4415 [Abstract] [Full Text]  
  • Remels, A. H., Gosker, H. R., Schrauwen, P., Langen, R. C., Schols, A. M. (2008). Peroxisome proliferator-activated receptors: a therapeutic target in COPD?. Eur Respir J 31: 502-508 [Abstract] [Full Text]  
  • Linard, C., Gremy, O., Benderitter, M. (2008). Reduction of Peroxisome Proliferation-Activated Receptor {gamma} Expression by {gamma}-Irradiation as a Mechanism Contributing to Inflammatory Response in Rat Colon: Modulation by the 5-Aminosalicylic Acid Agonist. J. Pharmacol. Exp. Ther. 324: 911-920 [Abstract] [Full Text]  
  • Wang, L. H., Yang, X. Y., Zhang, X., Farrar, W. L. (2007). Inhibition of adhesive interaction between multiple myeloma and bone marrow stromal cells by PPAR{gamma} cross talk with NF-{kappa}B and C/EBP. Blood 110: 4373-4384 [Abstract] [Full Text]  
  • Riganti, C., Orecchia, S., Silvagno, F., Pescarmona, G., Betta, P. G., Gazzano, E., Aldieri, E., Ghigo, D., Bosia, A. (2007). Asbestos Induces Nitric Oxide Synthesis in Mesothelioma Cells via Rho Signaling Inhibition. Am. J. Respir. Cell Mol. Bio. 36: 746-756 [Abstract] [Full Text]  
  • Traves, P. G., Hortelano, S., Zeini, M., Chao, T.-H., Lam, T., Neuteboom, S. T., Theodorakis, E. A., Palladino, M. A., Castrillo, A., Bosca, L. (2007). Selective Activation of Liver X Receptors by Acanthoic Acid-Related Diterpenes. Mol. Pharmacol. 71: 1545-1553 [Abstract] [Full Text]  
  • Marathe, C., Bradley, M. N., Hong, C., Lopez, F., de Galarreta, C. M. R., Tontonoz, P., Castrillo, A. (2006). The Arginase II Gene Is an Anti-inflammatory Target of Liver X Receptor in Macrophages. J. Biol. Chem. 281: 32197-32206 [Abstract] [Full Text]  
  • Kobayashi, M., Ono, H., Mihara, K., Tauchi, H., Komatsu, K., Shibata, T., Shimizu, H., Uchida, K., Yamamoto, K.-i. (2006). ATM activation by a sulfhydryl-reactive inflammatory cyclopentenone prostaglandin.. GENES CELLS 11: 779-789 [Abstract] [Full Text]  
  • Hummasti, S., Tontonoz, P. (2006). The Peroxisome Proliferator-Activated Receptor N-Terminal Domain Controls Isotype-Selective Gene Expression and Adipogenesis. Mol. Endocrinol. 20: 1261-1275 [Abstract] [Full Text]  
  • Monsalve, E., Perez, M. A., Rubio, A., Ruiz-Hidalgo, M. J., Baladron, V., Garcia-Ramirez, J. J., Gomez, J. C., Laborda, J., Diaz-Guerra, M. J. M. (2006). Notch-1 Up-Regulation and Signaling following Macrophage Activation Modulates Gene Expression Patterns Known to Affect Antigen-Presenting Capacity and Cytotoxic Activity. J. Immunol. 176: 5362-5373 [Abstract] [Full Text]  
  • Stamatakis, K., Sanchez-Gomez, F. J., Perez-Sala, D. (2006). Identification of Novel Protein Targets for Modification by 15-Deoxy-{Delta}12,14-Prostaglandin J2 in Mesangial Cells Reveals Multiple Interactions with the Cytoskeleton. J. Am. Soc. Nephrol. 17: 89-98 [Abstract] [Full Text]  
  • Musiek, E. S., Gao, L., Milne, G. L., Han, W., Everhart, M. B., Wang, D., Backlund, M. G., DuBois, R. N., Zanoni, G., Vidari, G., Blackwell, T. S., Morrow, J. D. (2005). Cyclopentenone Isoprostanes Inhibit the Inflammatory Response in Macrophages. J. Biol. Chem. 280: 35562-35570 [Abstract] [Full Text]  
  • Ackerman, W. E. IV, Zhang, X. L., Rovin, B. H., Kniss, D. A. (2005). Modulation of Cytokine-Induced Cyclooxygenase 2 Expression by PPARG Ligands Through NF{kappa}B Signal Disruption in Human WISH and Amnion Cells. Biol. Reprod. 73: 527-535 [Abstract] [Full Text]  
  • Banerjee, A. G., Bhattacharyya, I., Vishwanatha, J. K. (2005). Identification of genes and molecular pathways involved in the progression of premalignant oral epithelia. Molecular Cancer Therapeutics 4: 865-875 [Abstract] [Full Text]  
  • Blanco, M., Moro, M. A., Davalos, A., Leira, R., Castellanos, M., Serena, J., Vivancos, J., Rodriguez-Yanez, M., Lizasoain, I., Castillo, J. (2005). Increased Plasma Levels of 15-Deoxy {Delta} Prostaglandin J2 Are Associated With Good Outcome in Acute Atherothrombotic Ischemic Stroke. Stroke 36: 1189-1194 [Abstract] [Full Text]  
  • Mayoral, R., Fernandez-Martinez, A., Bosca, L., Martin-Sanz, P. (2005). Prostaglandin E2 promotes migration and adhesion in hepatocellular carcinoma cells. Carcinogenesis 26: 753-761 [Abstract] [Full Text]  
  • Ray, D. M., Akbiyik, F., Bernstein, S. H., Phipps, R. P. (2005). CD40 Engagement Prevents Peroxisome Proliferator-Activated Receptor {gamma} Agonist-Induced Apoptosis of B Lymphocytes and B Lymphoma Cells by an NF-{kappa}B-Dependent Mechanism. J. Immunol. 174: 4060-4069 [Abstract] [Full Text]  
  • Pignatelli, M., Sanchez-Rodriguez, J., Santos, A., Perez-Castillo, A. (2005). 15-Deoxy-{Delta}-12,14-prostaglandin J2 induces programmed cell death of breast cancer cells by a pleiotropic mechanism. Carcinogenesis 26: 81-92 [Abstract] [Full Text]  
  • Chen, F. (2004). Endogenous Inhibitors of Nuclear Factor-{kappa}B, An Opportunity for Cancer Control. Cancer Res. 64: 8135-8138 [Abstract] [Full Text]  
  • Sanchez-Gomez, F. J., Cernuda-Morollon, E., Stamatakis, K., Perez-Sala, D. (2004). Protein Thiol Modification by 15-deoxy-{Delta}12,14-Prostaglandin J2 Addition in Mesangial Cells: Role in the Inhibition of Pro-inflammatory Genes. Mol. Pharmacol. 66: 1349-1358 [Abstract] [Full Text]  
  • Goren, N., Cuenca, J., Martin-Sanz, P., Bosca, L. (2004). Attenuation of NF-{kappa}B signalling in rat cardiomyocytes at birth restricts the induction of inflammatory genes. Cardiovasc Res 64: 289-297 [Abstract] [Full Text]  
  • Giri, S., Rattan, R., Singh, A. K., Singh, I. (2004). The 15-Deoxy-{delta}12,14-Prostaglandin J2 Inhibits the Inflammatory Response in Primary Rat Astrocytes via Down-Regulating Multiple Steps in Phosphatidylinositol 3-Kinase-Akt-NF-{kappa}B-p300 Pathway Independent of Peroxisome Proliferator-Activated Receptor {gamma}. J. Immunol. 173: 5196-5208 [Abstract] [Full Text]  
  • Grau, R., Iniguez, M. A., Fresno, M. (2004). Inhibition of Activator Protein 1 Activation, Vascular Endothelial Growth Factor, and Cyclooxygenase-2 Expression by 15-Deoxy-{Delta}12,14-Prostaglandin J2 in Colon Carcinoma Cells: Evidence for a Redox-Sensitive Peroxisome Proliferator-Activated Receptor-{gamma}-Independent Mechanism. Cancer Res. 64: 5162-5171 [Abstract] [Full Text]  
  • Francois, M., Richette, P., Tsagris, L., Raymondjean, M., Fulchignoni-Lataud, M.-C., Forest, C., Savouret, J.-F., Corvol, M.-T. (2004). Peroxisome Proliferator-activated Receptor-{gamma} Down-regulates Chondrocyte Matrix Metalloproteinase-1 via a Novel Composite Element. J. Biol. Chem. 279: 28411-28418 [Abstract] [Full Text]  
  • Perez-Ortiz, J. M., Tranque, P., Vaquero, C. F., Domingo, B., Molina, F., Calvo, S., Jordan, J., Cena, V., Llopis, J. (2004). Glitazones Differentially Regulate Primary Astrocyte and Glioma Cell Survival: INVOLVEMENT OF REACTIVE OXYGEN SPECIES AND PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR-{gamma}. J. Biol. Chem. 279: 8976-8985 [Abstract] [Full Text]  
  • Reddy, R. C., Keshamouni, V. G., Jaigirdar, S. H., Zeng, X., Leff, T., Thannickal, V. J., Standiford, T. J. (2004). Deactivation of murine alveolar macrophages by peroxisome proliferator-activated receptor-{gamma} ligands. Am. J. Physiol. Lung Cell. Mol. Physiol. 286: L613-L619 [Abstract] [Full Text]  
  • Maddox, J. F., Domzalski, A. C., Roth, R. A., Ganey, P. E. (2004). 15-Deoxy Prostaglandin J2 Enhances Allyl Alcohol-Induced Toxicity in Rat Hepatocytes. Toxicol Sci 77: 290-298 [Abstract] [Full Text]  
  • Perez-Sala, D., Cernuda-Morollon, E., Canada, F. J. (2003). Molecular Basis for the Direct Inhibition of AP-1 DNA Binding by 15-Deoxy-{Delta}12,14-prostaglandin J2. J. Biol. Chem. 278: 51251-51260 [Abstract] [Full Text]  
  • Yue, T.-l., Bao, W., Jucker, B. M., Gu, J.-l., Romanic, A. M., Brown, P. J., Cui, J., Thudium, D. T., Boyce, R., Burns-Kurtis, C. L., Mirabile, R. C., Aravindhan, K., Ohlstein, E. H. (2003). Activation of Peroxisome Proliferator-Activated Receptor-{alpha} Protects the Heart From Ischemia/Reperfusion Injury. Circulation 108: 2393-2399 [Abstract] [Full Text]  
  • Mendez, M., LaPointe, M. C. (2003). PPAR{gamma} Inhibition of Cyclooxygenase-2, PGE2 Synthase, and Inducible Nitric Oxide Synthase in Cardiac Myocytes. Hypertension 42: 844-850 [Abstract] [Full Text]  
  • Yuan, Z., Liu, Y., Liu, Y., Zhang, J., Kishimoto, C., Wang, Y., Ma, A., Liu, Z. (2003). Peroxisome proliferation-activated receptor-{gamma} ligands ameliorate experimental autoimmune myocarditis. Cardiovasc Res 59: 685-694 [Abstract] [Full Text]  
  • Chen, C.-W., Chang, Y.-H., Tsi, C.-J., Lin, W.-W. (2003). Inhibition of IFN-{gamma}-Mediated Inducible Nitric Oxide Synthase Induction by the Peroxisome Proliferator-Activated Receptor {gamma} Agonist, 15-Deoxy-{Delta}12,14-Prostaglandin J2, Involves Inhibition of the Upstream Janus Kinase/STAT1 Signaling Pathway. J. Immunol. 171: 979-988 [Abstract] [Full Text]  
  • Shibata, T., Yamada, T., Ishii, T., Kumazawa, S., Nakamura, H., Masutani, H., Yodoi, J., Uchida, K. (2003). Thioredoxin as a Molecular Target of Cyclopentenone Prostaglandins. J. Biol. Chem. 278: 26046-26054 [Abstract] [Full Text]  
  • Lee, T.-S., Tsai, H.-L., Chau, L.-Y. (2003). Induction of Heme Oxygenase-1 Expression in Murine Macrophages Is Essential for the Anti-inflammatory Effect of Low Dose 15-Deoxy-{Delta}12,14-prostaglandin J2. J. Biol. Chem. 278: 19325-19330 [Abstract] [Full Text]  
  • Oliva, J. L., Perez-Sala, D., Castrillo, A., Martinez, N., Canada, F. J., Bosca, L., Rojas, J. M. (2003). The cyclopentenone 15-deoxy-Delta 12,14-prostaglandin J2 binds to and activates H-Ras. Proc. Natl. Acad. Sci. USA 100: 4772-4777 [Abstract] [Full Text]  
  • Gilde, A. J., van der Lee, K. A.J.M., Willemsen, P. H.M., Chinetti, G., van der Leij, F. R., van der Vusse, G. J., Staels, B., van Bilsen, M. (2003). Peroxisome Proliferator-Activated Receptor (PPAR) {alpha} and PPAR{beta}/{delta}, but not PPAR{gamma}, Modulate the Expression of Genes Involved in Cardiac Lipid Metabolism. Circ. Res. 92: 518-524 [Abstract] [Full Text]  
  • Castrillo, A., Joseph, S. B., Marathe, C., Mangelsdorf, D. J., Tontonoz, P. (2003). Liver X Receptor-dependent Repression of Matrix Metalloproteinase-9 Expression in Macrophages. J. Biol. Chem. 278: 10443-10449 [Abstract] [Full Text]  
  • Callejas, N. A., Fernandez-Martinez, A., Castrillo, A., Bosca, L., Martin-Sanz, P. (2003). Selective Inhibitors of Cyclooxygenase-2 Delay the Activation of Nuclear Factor kappa B and Attenuate the Expression of Inflammatory Genes in Murine Macrophages Treated with Lipopolysaccharide. Mol. Pharmacol. 63: 671-677 [Abstract] [Full Text]  
  • Castrillo, A., Traves, P. G., Martin-Sanz, P., Parkinson, S., Parker, P. J., Bosca, L. (2003). Potentiation of Protein Kinase C {zeta} Activity by 15-Deoxy-{Delta}12,14-Prostaglandin J2 Induces an Imbalance between Mitogen-Activated Protein Kinases and NF-{kappa}B That Promotes Apoptosis in Macrophages. Mol. Cell. Biol. 23: 1196-1208 [Abstract] [Full Text]  
  • Clay, C. E., Monjazeb, A., Thorburn, J., Chilton, F. H., High, K. P. (2002). 15-Deoxy-{Delta}12,14-prostaglandin J2-induced apoptosis does not require PPAR{gamma} in breast cancer cells. J. Lipid Res. 43: 1818-1828 [Abstract] [Full Text]  
  • Kluft, C., Kleemann, R., de Maat, M.P.M. (2002). How best to counteract the enemies? By controlling inflammation in the coronary circulation. Eur Heart J Suppl 4: G53-G65 [Abstract]  
  • Fernandez, N., Renedo, M., Garcia-Rodriguez, C., Sanchez Crespo, M. (2002). Activation of Monocytic Cells Through Fc{gamma} Receptors Induces the Expression of Macrophage-Inflammatory Protein (MIP)-1{alpha}, MIP-1{beta}, and RANTES. J. Immunol. 169: 3321-3328 [Abstract] [Full Text]  
  • Eligini, S., Brambilla, M., Banfi, C., Camera, M., Sironi, L., Barbieri, S. S., Auwerx, J., Tremoli, E., Colli, S. (2002). Oxidized phospholipids inhibit cyclooxygenase-2 in human macrophages via nuclear factor-{kappa}B/I{kappa}B- and ERK2-dependent mechanisms. Cardiovasc Res 55: 406-415 [Abstract] [Full Text]  
  • Bureau, F., Desmet, C., Melotte, D., Jaspar, F., Volanti, C., Vanderplasschen, A., Pastoret, P.-P., Piette, J., Lekeux, P. (2002). A Proinflammatory Role for the Cyclopentenone Prostaglandins at Low Micromolar Concentrations: Oxidative Stress-Induced Extracellular Signal-Regulated Kinase Activation Without NF-{kappa}B Inhibition. J. Immunol. 168: 5318-5325 [Abstract] [Full Text]  
  • Alleva, D. G., Johnson, E. B, Lio, F. M, Boehme, S. A, Conlon, P. J, Crowe, P. D. (2002). Regulation of murine macrophage proinflammatory and anti-inflammatory cytokines by ligands for peroxisome proliferator-activated receptor-{gamma}: counter-regulatory activity by IFN-{gamma}. J. Leukoc. Biol. 71: 677-685 [Abstract] [Full Text]  
  • Cunard, R., Ricote, M., DiCampli, D., Archer, D. C., Kahn, D. A., Glass, C. K., Kelly, C. J. (2002). Regulation of Cytokine Expression by Ligands of Peroxisome Proliferator Activated Receptors. J. Immunol. 168: 2795-2802 [Abstract] [Full Text]  
  • Clark, R. B. (2002). The role of PPARs in inflammation and immunity. J. Leukoc. Biol. 71: 388-400 [Abstract] [Full Text]  
  • Diab, A., Deng, C., Smith, J. D., Hussain, R. Z., Phanavanh, B., Lovett-Racke, A. E., Drew, P. D., Racke, M. K. (2002). Peroxisome Proliferator-Activated Receptor-{gamma} Agonist 15-Deoxy-{Delta}12,1412,14-Prostaglandin J2 Ameliorates Experimental Autoimmune Encephalomyelitis. J. Immunol. 168: 2508-2515 [Abstract] [Full Text]  
  • Harris, S. G., Smith, R. S., Phipps, R. P. (2002). 15-Deoxy-{Delta}12,1412,14-PGJ2 Induces IL-8 Production in Human T Cells by a Mitogen-Activated Protein Kinase Pathway. J. Immunol. 168: 1372-1379 [Abstract] [Full Text]  
  • Masamune, A., Kikuta, K., Satoh, M., Sakai, Y., Satoh, A., Shimosegawa, T. (2002). Ligands of Peroxisome Proliferator-activated Receptor-gamma Block Activation of Pancreatic Stellate Cells. J. Biol. Chem. 277: 141-147 [Abstract] [Full Text]  
  • Simonin, M.-A., Bordji, K., Boyault, S., Bianchi, A., Gouze, E., Becuwe, P., Dauca, M., Netter, P., Terlain, B. (2002). PPAR-gamma ligands modulate effects of LPS in stimulated rat synovial fibroblasts. Am. J. Physiol. Cell Physiol. 282: C125-C133 [Abstract] [Full Text]  
  • Clay, C. E., Atsumi, G.-i., High, K. P., Chilton, F. H. (2001). Early de Novo Gene Expression Is Required for 15-Deoxy-Delta 12,14-prostaglandin J2-induced Apoptosis in Breast Cancer Cells. J. Biol. Chem. 276: 47131-47135 [Abstract] [Full Text]  
  • Castrillo, A., Pennington, D. J., Otto, F., Parker, P. J., Owen, M. J., Bosca, L. (2001). Protein Kinase C{epsilon} Is Required for Macrophage Activation and Defense Against Bacterial Infection. JEM 194: 1231-1242 [Abstract] [Full Text]  
  • Poligone, B., Baldwin, A. S. (2001). Positive and Negative Regulation of NF-kappa B by COX-2. ROLES OF DIFFERENT PROSTAGLANDINS. J. Biol. Chem. 276: 38658-38664 [Abstract] [Full Text]  
  • Sidhu, J S, Kaski, J C (2001). Peroxisome proliferator activated receptor {gamma}: a potential therapeutic target in the management of ischaemic heart disease. Heart 86: 255-258 [Full Text]  
  • ROVIN, B. H., LU, L., COSIO, A. (2001). Cyclopentenone Prostaglandins Inhibit Cytokine-Induced NF-{kappa}B Activation and Chemokine Production by Human Mesangial Cells. J. Am. Soc. Nephrol. 12: 1659-1667 [Abstract] [Full Text]  
  • Zhang, X., Wang, J. M., Gong, W. H., Mukaida, N., Young, H. A. (2001). Differential Regulation of Chemokine Gene Expression by 15-Deoxy-{{Delta}}12,1412,14 Prostaglandin J2. J. Immunol. 166: 7104-7111 [Abstract] [Full Text]  
  • Wang, C., Fu, M., D'Amico, M., Albanese, C., Zhou, J.-N., Brownlee, M., Lisanti, M. P., Chatterjee, V. K. K., Lazar, M. A., Pestell, R. G. (2001). Inhibition of Cellular Proliferation through I{kappa}B Kinase-Independent and Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Repression of Cyclin D1. Mol. Cell. Biol. 21: 3057-3070 [Abstract] [Full Text]  
  • Equils, O., Faure, E., Thomas, L., Bulut, Y., Trushin, S., Arditi, M. (2001). Bacterial Lipopolysaccharide Activates HIV Long Terminal Repeat Through Toll-Like Receptor 4. J. Immunol. 166: 2342-2347 [Abstract] [Full Text]  
  • Hortelano, S., Castrillo, A., Alvarez, A. M., Bosca, L. (2000). Contribution of Cyclopentenone Prostaglandins to the Resolution of Inflammation Through the Potentiation of Apoptosis in Activated Macrophages. J. Immunol. 165: 6525-6531 [Abstract] [Full Text]  
  • Rosen, E. D., Walkey, C. J., Puigserver, P., Spiegelman, B. M. (2000). Transcriptional regulation of adipogenesis. Genes Dev. 14: 1293-1307 [Full Text]  
  • Miyahara, T., Schrum, L., Rippe, R., Xiong, S., Yee, H. F. Jr., Motomura, K., Anania, F. A., Willson, T. M., Tsukamoto, H. (2000). Peroxisome Proliferator-activated Receptors and Hepatic Stellate Cell Activation. J. Biol. Chem. 275: 35715-35722 [Abstract] [Full Text]  
  • Castrillo, A., de las Heras, B., Hortelano, S., Rodriguez, B., Villar, A., Bosca, L. (2001). Inhibition of the Nuclear Factor kappa B (NF-kappa B) Pathway by Tetracyclic Kaurene Diterpenes in Macrophages. SPECIFIC EFFECTS ON NF-kappa B-INDUCING KINASE ACTIVITY AND ON THE COORDINATE ACTIVATION OF ERK AND p38 MAPK. J. Biol. Chem. 276: 15854-15860 [Abstract] [Full Text]  
  • Ji, C., Kozak, K. R., Marnett, L. J. (2001). Ikappa B Kinase, a Molecular Target for Inhibition by 4-Hydroxy-2-nonenal. J. Biol. Chem. 276: 18223-18228 [Abstract] [Full Text]  
  • Li, L., Tao, J., Davaille, J., Feral, C., Mallat, A., Rieusset, J., Vidal, H., Lotersztajn, S. (2001). 15-Deoxy-Delta 12,14-prostaglandin J2 Induces Apoptosis of Human Hepatic Myofibroblasts. A PATHWAY INVOLVING OXIDATIVE STRESS INDEPENDENTLY OF PEROXISOME-PROLIFERATOR-ACTIVATED RECEPTORS. J. Biol. Chem. 276: 38152-38158 [Abstract] [Full Text]  
  • Castrillo, A., Mojena, M., Hortelano, S., Bosca, L. (2001). Peroxisome Proliferator-activated Receptor-gamma -independent Inhibition of Macrophage Activation by the Non-thiazolidinedione Agonist L-796,449. COMPARISON WITH THE EFFECTS OF 15-DEOXY-Delta 12,14-PROSTAGLANDIN J2. J. Biol. Chem. 276: 34082-34088 [Abstract] [Full Text]  
  • Cernuda-Morollon, E., Pineda-Molina, E., Canada, F. J., Perez-Sala, D. (2001). 15-Deoxy-Delta 12,14-prostaglandin J2 Inhibition of NF-kappa B-DNA Binding through Covalent Modification of the p50 Subunit. J. Biol. Chem. 276: 35530-35536 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Castrillo, A.
Right arrow Articles by Boscá, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Castrillo, A.
Right arrow Articles by Boscá, L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»