Previous Article | Next Article 
Molecular and Cellular Biology, March 2000, p. 1692-1698, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Inhibition of I
B Kinase and I
B
Phosphorylation by 15-Deoxy-
12,14-Prostaglandin
J2 in Activated Murine Macrophages
Antonio
Castrillo,
María
J. M.
Díaz-Guerra,
Sonsoles
Hortelano,
Paloma
Martín-Sanz, and
Lisardo
Boscá*
Instituto de Bioquímica (Centro Mixto
CSIC-UCM), Facultad de Farmacia, Universidad Complutense, 28040 Madrid, Spain
Received 3 June 1999/Returned for modification 23 July
1999/Accepted 24 November 1999
 |
ABSTRACT |
Activation of the macrophage cell line RAW 264.7 with
lipopolysaccharide (LPS) and gamma interferon (IFN-
) induces the
expression of gene products involved in host defense, among them type 2 nitric oxide synthase. Treatment of cells with
15-deoxy-
12,14-prostaglandin J2
(15dPGJ2) inhibited the LPS- and IFN-
-dependent synthesis of NO, a process that was not antagonized by similar concentrations of prostaglandin J2, prostaglandin
E2, or rosiglitazone, a peroxisomal proliferator-activated
receptor
ligand. Incubation of activated macrophages with
15dPGJ2 inhibited the degradation of I
B
and I
B
and increased their levels in the nuclei. NF-
B activity, as well as
the transcription of NF-
B-dependent genes, such as those encoding
type 2 nitric oxide synthase and cyclooxygenase 2, was impaired under
these conditions. Analysis of the steps leading to I
B
phosphorylation showed an inhibition of I
B kinase by
15dPGJ2 in cells treated with LPS and IFN-
, resulting in
an impaired phosphorylation of I
B
, at least in the serine 32 residue required for targeting and degradation of this protein.
Incubation of partially purified activated I
B kinase with 2 µM
15dPGJ2 reduced by 83% the phosphorylation in serine 32 of
I
B
, suggesting that this prostaglandin exerts direct inhibitory
effects on the activity of the I
B kinase complex. These results show
rapid actions of 15dPGJ2, independent of peroxisomal
proliferator receptor
activation, in macrophages challenged with
low doses of LPS and IFN-
.
 |
INTRODUCTION |
Macrophage activation in response to
proinflammatory cytokines and bacterial cell wall products constitutes
a key component of the immune response (23, 31, 50).
Resolution of the process occurs after removal of the proinflammatory
stimuli and through the action of negative regulators of the
activation-signaling pathways, among them interleukin-10 (IL-10),
IL-13, alpha/beta interferons (IFN-
/
), and more recently several
cyclopentenone prostaglandins (PGs) (8, 21, 35, 36, 49). In
particular, 15-deoxy-
12,14-prostaglandin J2
(15dPGJ2) has been shown to exert important anti-inflammatory effects on several cell types such as
monocytes/macrophages and microglia (4, 16, 35, 36).
Controversy exists about the identification of intracellular targets
involved in the mechanism of action of cyclopentenone PGs: some of
these effects have been explained through the transcriptional
inhibition exerted by 15dPGJ2-activated peroxisome
proliferator receptor gamma (PPAR
) (12, 14, 36, 39);
however, other data suggest a main contribution of PPAR
-independent mechanisms on the anti-inflammatory action of this PG, in view of the
lack of effect of synthetic PPAR
ligands such as thiazolidinediones (17, 35).
It has been shown that 15dPGJ2 inhibits the expression of
genes requiring the activation of the transcription factors
NF-
B, AP-1, and Stat1 (17, 35, 36), which are
involved in the induction of several enzymes participating in the
development of the inflammatory process, such as type 2 nitric oxide
synthase (NOS-2) and cyclooxygenase 2 (COX-2) (7, 42, 51).
In macrophages, activated NF-
B complexes are composed mainly of p50
and p65 subunits that translocate to the nucleus in response to cell
stimulation with lipopolysaccharide (LPS) and proinflammatory cytokines
(13, 45, 48). This activation of NF-
B requires
phosphorylation by I
B kinase (IKK) of I
B proteins in specific
serine residues that target these proteins for ubiquitin conjugation
and degradation by the 26S proteasome (26, 45). The IKK
complex contains two catalytic subunits, IKK1 and IKK2, and a
regulatory subunit termed NF-
B essential modulator (10, 54,
56). In turn, activation of IKK is mediated by phosphorylation
through NF-
B-inducing kinase, which acts preferentially over IKK1,
and MEK kinase 1 (MEKK1), which phosphorylates IKK2 (6, 30).
Biochemical and genetic data indicate that IKK1 and IKK2, despite the
sequence similarity, have different functions (15, 55). IKK1
participates in differentiation of various cell types (20),
whereas IKK2 is involved in LPS signaling in monocytes/macrophages and
in general the response to proinflammatory stimuli (34, 55).
IKK2 is rapidly activated after cell challenge with LPS, IL-1
, or
tumor necrosis factor alpha (TNF-
) and progressively undergoes
phosphorylation at multiple serine residues that decreases the kinase
activity and therefore contributes to the transient activation of this
enzyme (6). In this regard, we have investigated the
possibility of early effects of 15dPGJ2 on LPS and IFN-
(collectively termed LPS/IFN-
) cooperative signaling in RAW 264.7 macrophages. Our data show that treatment of macrophages with
15dPGJ2 results in a significant inhibition of IKK2
activity. As a result, the phosphorylation of I
B
and the
degradation of I
B
and I
B
are inhibited, causing a partial
inhibition of NF-
B activity. Accordingly, the expression of genes
requiring NF-
B activation is significantly impaired by this mechanism.
 |
MATERIALS AND METHODS |
Chemicals.
Reagents were from Sigma (St. Louis, Mo.),
Boehringer (Mannheim, Germany), and Merck (Darmstadt, Germany).
Antibodies and glutathione S-transferase (GST) fusion
proteins were from Santa Cruz Biotechnology (Santa Cruz, Calif.).
Anti-phospho-(Ser32)
B
antibody (Ab) was from New
England Biolabs (Beverly, Mass.). Electrophoresis equipment and
reagents were from Bio-Rad (Richmond, Calif.) and Amersham (Little
Chalfont, United Kingdom). PGs were from Cayman (Ann Arbor, Mich.).
Serum and media were from BioWhittaker (Walkersville, Md.).
Cell culture.
RAW 264.7 cells were seeded at 6 × 104 to 8 × 104/cm2 in RPMI
1640 medium supplemented with 2 mM glutamine, 10% fetal calf serum (FCS), and antibiotics (50 µg each of penicillin, streptomycin, and
gentamicin per ml). After 2 days, the cell layers were washed with
phosphate-buffered saline (PBS) and the culture medium was replaced by
phenol red-free RPMI 1640 medium containing 0.5 mM arginine and 0.5%
FCS, followed by the addition of the indicated stimuli. PGs and
rosiglitazone were added 5 min prior to activation with LPS and
IFN-
.
Plasmid constructs and preparation.
The
(
B)3ConA.CAT plasmid construct, which contains three
copies of the
B motif from the human immunodeficiency virus
long-terminal repeat enhancer with the conalbumin A promoter, was used
to measure
B transactivation capacity (8, 9, 48). The
ConA.CAT vector, lacking the
B tandem, was used as a control. A 1-kb
fragment corresponding to the 5'-flanking region of the NOS-2 gene
fused to a chloramphenicol acetyltransferase (CAT) reporter
[p2iNOS(+,+).CAT vector] and the same vector with mutated
B
sequences corresponding to nucleotides
971 to
961 and
85 to
75
[p2iNOS(
,
).CAT] were also used. Plasmid kSV2.CAT was
used as a reference for efficiency of the transfection (42,
48). Plasmids were purified using EndoFree columns (Qiagen,
Hilden, Germany).
Bacterial expression and purification of GST fusion
proteins.
GST-I
B
(1-317) was from Santa Cruz.
GST-I
B
(1-54) and GST-I
B
(1-54) mutated from
Ser32/36 to Ala32/36
(GST-I
B
S/A) were expressed in the DH5
F' strain of
Escherichia coli as described elsewhere (19, 44),
and the fusion proteins were purified on a glutathione-Sepharose 4B
column (Pharmacia Biotech).
Preparation of cytosolic and nuclear extracts.
Cells
(1.5 × 106) were washed with PBS and collected by
centrifugation. Cell pellets were homogenized with 100 µl of buffer A
(10 mM HEPES [pH 7.9], 1 mM EDTA, 1 mM EGTA, 100 mM KCl, 1 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride, aprotinin [2 µg/ml], leupeptin [10 µg/ml],
N
-p-tosyl-L-lysine chloromethyl ketone
[TLCK; 2 µg/ml], 5 mM NaF, 1 mM NaVO4, 10 mM
Na2MoO4). After 10 min at 4°C, Nonidet P-40
was added to reach a 0.5% concentration. The tubes were gently
vortexed for 15 s, and nuclei were collected by centrifugation at
8,000 × g for 15 min (9, 40). The
supernatants were stored at
80°C (cytosolic extracts); the pellets
were resuspended in 50 µl of buffer A supplemented with 20%
glycerol-0.4 M KCl and gently shaken for 30 min at 4°C. Nuclear
protein extracts were obtained by centrifugation at 13,000 × g for 15 min, and the supernatant was stored at
80°C.
Protein content was assayed using the Bio-Rad protein reagent. All cell
fractionation steps were carried out at 4°C.
EMSA.
The sequences 5'TGCTAGGGGGATTTTCCCTCTCTCTGT3',
corresponding to the consensus NF-
B binding site (nucleotides
978 to
952) of the murine NOS-2 promoter (8, 51, 52),
and 5'CGAACGTGACCTTTGTCCTCCCCTTTTGCTCGATC3', corresponding to the
PPAR
binding site of the promoter of acyl coenzyme A (acyl-CoA)
oxidase (11), were used. Oligonucleotides were annealed
with their complementary sequence by incubation for 5 min at 85°C in
10 mM Tris-HCl (pH 8.0)-50 mM NaCl-10 mM MgCl2-1 mM DTT.
Aliquots of 50 ng of these annealed oligonucleotides were end labeled
with Klenow enzyme fragment in the presence of 50 µCi of
[
-32P]dCTP and the other unlabeled deoxynucleoside
triphosphates in a final volume of 50 µl. A total of 5 × 104 dpm of the DNA probe was used for each binding assay of
nuclear extracts as follows. Three micrograms of nuclear protein was
incubated for 15 min at 4°C with the DNA and 2 µg of
poly(dI-dC)-5% glycerol-1 mM EDTA-100 mM KCl-5 mM
MgCl2-1 mM DTT-10 mM Tris-HCl (pH 7.8) in a final volume
of 20 µl. The DNA-protein complexes were separated on native 6%
polyacrylamide gels in 0.5% Tris-borate-EDTA buffer (9).
Supershift assays were carried out after incubation of the nuclear
extracts with 2 µg of Ab (anti-p50, anti-c-Rel, anti-p65, and
anti-PPAR
) for 1 h at 4°C, followed by electrophoretic
mobility shift assay (EMSA) (not shown).
Transfection of RAW 264.7 cells and assay of CAT activity.
The cells were washed twice with PBS and incubated with 1.5 ml of RPMI
1640 medium without FCS (6-cm-diameter dishes). Cells were transfected
for 6 h by lipofection with DOTAP as instructed by the supplier
(Boehringer Mannheim). After transfection, the cells were maintained
for 24 h prior to stimulation in RPMI 1640 medium containing 5%
FCS. Equal amounts of DNA were used in the transfection experiments,
and CAT activity was determined after 18 h of treatment of the
cells with the indicated stimuli following a previous protocol based on
thin-layer chromatography separation of the acetylated chloramphenicol
(9). The amount of acetylated substrate was quantified in a
Fuji BAS1000 radioactivity detection system.
Characterization of gene expression by Northern blotting.
Total RNA (2 × 106 to 4 × 106
cells) was extracted by the guanidinium thiocyanate method (2, 9,
24, 48). After electrophoresis in a 0.9% agarose gel containing
2% formaldehyde, the RNA was transferred to a Nytran membrane (NY
13-N; Schleicher & Schuell, Dassel, Germany), and the levels of NOS-2,
COX-2, I
B
, and I
B
mRNAs were determined using an
EcoRI-HindII fragment from the NOS-2 cDNA, or
the cDNA of the other genes (48), labeled with [
-32P]dCTP by using a Rediprime labeling kit
(Amersham). The membranes were exposed to X-ray films (Hyperfilm;
Amersham), and the intensity of the bands was measured by laser
densitometry (Molecular Dynamics). The lane charge was normalized by
hybridization with an 18S rRNA probe.
Determination of NO synthesis.
NO was measured as the
accumulation of nitrite and nitrate in the incubation medium. Nitrate
was reduced to nitrite with nitrate reductase and determined
spectrophotometrically with Griess reagent (9).
Characterization of proteins by Western blotting.
Cytosolic
protein extracts were size separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 10% gels. The
gels were blotted onto a polyvinylidene difluoride membrane (Millipore)
and incubated with several anti-NOS-2, anti-I
B
, anti-I
B
,
anti-p85
(phosphatidylinositol 3-kinase subunit), and anti-IKK2 Abs
(Santa Cruz). In experiments using anti-phospho-(Ser32)
I
B
Ab, the blot incubation solution contained GST-I
B
(1-317) (50 ng/ml) treated previously with alkaline phosphatase-agarose (47). The blots were submitted to sequential reprobing with Abs after treatment with 100 mM
-mercaptoethanol and 2% SDS in Tris-buffered saline and were heated at 60°C for 30 min. The blots were revealed by enhanced chemiluminescence as instructed by the manufacturer (Amersham).
Confocal microscopy.
RAW cells were grown on coverslips and
incubated for 45 min with the indicated stimuli. After the disks were
washed twice with ice-cold PBS, the cells were fixed with methanol at
20°C for 2 min, blocked with 3% bovine serum albumin for 30 min at room temperature, and incubated for 30 min with 1:100 anti-I
B
or
anti-I
B
Ab. After three washes with ice-cold PBS, the cells were
revealed using a secondary Ab (1:300) against rabbit immunoglobulin (Ig) conjugated with Cy3 (Amersham). The cells were visualized using an
MRC-1024 confocal microscope (Bio-Rad), and fluorescence was measured
and electronically evaluated. Laser Sharp software (Bio-Rad) was used
to determine the relative intensity of the fluorescence per pixel and
the percentage of cytosolic and nuclear localization.
Measurement of IKK2 activity.
Cells (107) were
homogenized in buffer A and centrifuged for 10 min in a
microcentrifuge. The supernatant (1 ml) was precleared, and IKK2 was
immunoprecipitated with 1 µg of anti-IKK2 Ab (10, 29).
After extensive washing of the immunoprecipitate with buffer A, the
pellet was resuspended in kinase buffer (20 mM HEPES [pH 7.4], 0.1 mM
EDTA, 100 mM NaCl, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride,
aprotinin [2 µg/ml], leupeptin [10 µg/ml], TLCK [2 µg/ml], 5 mM NaF, 1 mM NaVO4, 10 mM
Na2MoO4, 10 nM okadaic acid). Kinase activity
was assayed in 100 µl of buffer A containing 100 ng of immunoprecipitate, 50 µM [
-32P]ATP (0.5 µCi), and
as substrate 100 ng of GST-I
B
(1-317) or GST-I
B
(1-54) and
the corresponding Ala32/36-mutated protein. Aliquots of the
reaction mixture were stopped at various times in 1 ml of ice-cold
buffer A supplemented with 5 mM EDTA. The same protocol was used when
the activity of IKK2 was followed by Western blotting using
anti-phospho-(Ser32)I
B
Ab, except for the use of 1 mM
MgATP instead of [
-32P]ATP. GST-I
B
was purified
by glutathione-agarose chromatography and analyzed by SDS-PAGE (10%
gel). The linearity of the kinase reaction was confirmed over a period
of 30 min.
Data analysis.
The number of experiments analyzed is
indicated in the corresponding figure legend. Statistical differences
(P < 0.05) between mean values (presented with
standard errors of the means [SEM]) were determined by one-way
analysis of variance followed by Student's t test. In
experiments using X-ray films (Hyperfilm), different exposure times
were used to ensure that bands were not saturated.
 |
RESULTS |
15dPGJ2 inhibits the activation of NF-
B.
Incubation of cultured RAW 264.7 cells with 2 µM 15dPGJ2
inhibited significantly (79% after densitometry of the p50-p65 band) the activation of NF-
B elicited after LPS/IFN-
challenge, as measured by EMSA (Fig. 1A). However,
PGJ2 (2 µM) and rosiglitazone (10 µM) failed to exert a
significant inhibition. A dose-dependent effect of 15dPGJ2
on NF-
B activity in LPS/IFN
-stimulated cells is shown in Fig. 1B.
The half-maximal inhibition was obtained at ca. 0.5 µM, as judged
from the intensity of the p50-p65 band as assessed by supershift assays
(not shown). The binding of nuclear proteins to the PPAR
response
element of the acyl-CoA oxidase promoter (11) was used as an
internal control to ensure that 15dPGJ2 did not influence
the extraction of nuclear proteins and as a control of lane charge.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
NF- B binding is inhibited in activated RAW 264.7 cells treated with 15dPGJ2. (A) Macrophages were incubated
for 1 h with different combinations of 15dPGJ2 (2 µM), PGJ2 (2 µM), rosiglitazone (10 µM), LPS (500 ng/ml), and IFN- (10 U/ml). After homogenization of the cells,
nuclear extracts were prepared and the binding of nuclear proteins to
the distal B motif of the NOS-2 promoter was determined by EMSA.
Supershift assays with Abs against proteins of the c-Rel family (not
shown) identified p50-p50 and p50-p65 as the complexes present in the
lower and upper bands, respectively. (B) Dose-dependent effect of
15dPGJ2 on NF- B activity. The binding of nuclear
proteins to the PPAR R response element of the acyl-CoA oxidase
promoter was used as control of extraction of nuclear proteins and lane
load. The intensity of the bands was determined, and the corresponding
values are expressed as mean ± SEM of three experiments (A). *,
P < 0.005 with respect to the LPS/IFN- condition.
a.u., arbitrary units.
|
|
To evaluate whether 15dPGJ
2 could influence the turnover
and subcellular distribution of I

B proteins, and therefore NF-

B
activation, the amounts of I

B

and I

B

were determined in the
cytosol and nucleus by confocal microscopy and by immunoblot analysis.
As Fig.
2A shows, 15dPGJ
2 did
not modify significantly the levels
and subcellular distribution of
either I

B

or I

B

; however,
the marked decrease of I

B
proteins elicited by LPS was notably
impaired in the presence of
15dPGJ
2. Moreover, an important nuclear
accumulation of
I

B

(7-fold greater than in the LPS condition)
and, to a lesser
extent, of I

B

(3.1-fold greater than in the
LPS condition) was
observed in cells treated with LPS and 15dPGJ
2.
These
results were confirmed when the amounts of I

B

and I

B
were
determined by Western blotting using nuclear and cytosolic
extracts
prepared from these cells (Fig.
2B).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
Subcellular distribution of I B and I B in
cells treated with 15dPGJ2. Macrophages were incubated for
45 min with LPS (500 ng/ml) and 15dPGJ2 (1 µM).
After the cells were fixed, I B proteins were detected with specific
Abs and revealed using Cy3-labeled anti-rabbit Ig. (A) The intensity of
the fluorescence in the cytosolic and nuclear compartments was
digitalized and quantified (n = 14 to 21 cells per
condition). (B) The corresponding amount of I B and I B
present in cytosolic and nuclear extracts was determined also by
Western blotting. Results show the mean ± SEM of three
experiments. *, P < 0.05 with respect to the
corresponding LPS condition.
|
|
The inhibitory effect of 15dPGJ
2 on NF-

B activity was
further analyzed in cells transfected with the
(

B)
3ConA.CAT vector,
by monitoring the reporter activity
in response to LPS challenge.
Incubation with 1 and 2 µM
15dPGJ
2 decreased the LPS-dependent
activation of the
reporter by 69 and 85%, respectively. Treatment
of cells with
PGJ
2, and rosiglitazone did not affect significantly
the
reporter activity (Fig.
3A). Transfection
with ConA.CAT and
kSV
2.CAT vectors was used to ensure that
the stimuli used did
not influence transcription of the reporter gene.
In addition
to the

B-responsive vector, cells were transfected with
the p2iNOS(+,+).CAT
vector, a construct strictly dependent on NF-

B
activation. As
Fig.
3B shows, 15dPGJ
2 decreased (75%) the
CAT activity induced
by LPS/IFN-

, whereas 10 µM rosiglitazone
inhibited only 27% of
the expression of the reporter gene under
identical experimental
conditions. Interestingly, the use of a fragment
of the NOS-2
promoter deleted in the

B sites [p2iNOS(

,

).CAT]
completely
abolished the activity of the promoter, reflecting the
necessity
of this motif for expression of the reporter gene in response
to LPS/IFN-

stimulation. To better assess the relevance of the
changes of NF-

B activity on the expression of genes regulated
by
this transcription factor, we stimulated cells with different
PGs and
measured the activity and expression of NOS-2. As Fig.
4A shows, the synthesis of nitrite plus
nitrate in LPS/IFN-

-activated
macrophages was inhibited (73%) in
cells incubated with 2 µM 15dPGJ
2,
whereas
PGJ
2 exerted a moderate inhibition (27%) and rosiglitazone
and other bioactive PGs had no significant effect. The dose-dependent
effect of 15dPGJ
2 on NOS-2 protein levels showed a
half-maximal
inhibition at ca. 0.2 to 0.5 µM PG (Fig.
4B).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
15dPGJ2 inhibits CAT expression in cells
transfected with ( B)3ConA.CAT and p2iNOS.CAT vectors.
Macrophages were transfected with DOTAP, and cells were incubated with
the indicated stimuli followed by activation with LPS (500 ng/ml) (A)
or LPS (500 ng/ml) plus IFN- (10 U/ml) (B). After 14 h of
incubation with the indicated stimuli, CAT activity was determined.
Transfection with ConA.CAT and kSV2.CAT was used to ensure
that the ligands did not affect the basal activity of the promoters and
the efficiency of the transfection. Results show the mean ± SEM
of three experiments. *, P < 0.01 with respect to
the LPS or LPS/IFN- condition.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of NOS-2 expression by 15dPGJ2 in
RAW 264.7 cells activated with LPS/IFN- . Cells were treated for 5 min with the indicated concentrations of PGs, rosiglitazone and
hydroxyoctadecadienoic acid (9-HODE), followed by activation with LPS
(200 ng/ml) and IFN- (10 U/ml). (A) After 18 h of incubation,the
amount of nitrite and nitrate in the culture medium was measured. (B)
The dose-dependent effect of 15dPGJ2 on NOS-2 levels was
determined by Western blotting, using the levels of the
phosphatidylinositol 3-kinase subunit p85 as a control of lane
charge. Results show the mean of three experiments (A) and a
representative blot out of two (B).
|
|
To better evaluate the biological effects of 15dPGJ
2 on the
transcription of genes that require NF-

B activation, the RNA
levels
of NOS-2 and COX-2 (both dependent on NF-

B activity in
response to
LPS/IFN

challenge [
24,
48]) and those of I

B
and I

B

(involved in the resynthesis of these inhibitory proteins)
were determined after 4 h of stimulation. Incubation with 1 µM
15dPGJ
2 decreased by more than 90% the levels of NOS-2 and
COX-2
mRNAs in activated macrophages. However, the effects were less
remarkable for I

B

and I

B

, due probably to the different
kinetics
of the steady-state levels of these RNAs (Fig.
5). Indeed, the
levels of I

B mRNA
measured in these cells may account for the
accumulation of I

B
observed at 2 to 3 h in LPS-activated cells
treated with
15dPGJ
2 (not shown).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
15dPGJ2 decreases the mRNA levels of COX-2
and NOS-2. Cells were incubated with the indicated concentrations of PG
and activated with LPS (200 ng/ml) and IFN- (10 U/ml). After 4 h of treatment, the cells were homogenized and the RNA was extracted
and analyzed by Northern blotting using probes specific for the
indicated genes. Results show the mean band intensity expressed as a
percentage of that in the absence of PG and after normalization for the
content of 18S rRNA (n = 3).
|
|
Inhibition of IKK activity by 15dPGJ2.
The
preceding results show an inhibition of NF-
B activity, likely due to
an impaired I
B targeting in LPS-activated RAW 264.7 cells treated
with 15dPGJ2. To investigate the possibility of a reduced
phosphorylation of I
B under these conditions, cells were incubated
with 15dPGJ2 and stimulated with LPS/IFN-
. The IKK
complex was immunoprecipitated at various times using an anti-IKK2 Ab,
and its kinase activity was evaluated with GST-I
B
as the substrate. As Fig. 6A shows,
phosphorylation of GST-I
B
by IKK following the incorporation of
[32P]phosphate at 20 and 30 min of reaction decreased by
70 and 75% with respect to the corresponding LPS/IFN-
controls when
cells were treated with 2 µM 15dPGJ2. Moreover, in a
parallel experiment using cells incubated with 10 µM MG132
(Z-Leu-Leu-Leu-CHO) to inhibit I
B degradation, the specific
phosphorylation in vivo of I
B
in Ser32 was inhibited
in response to 15dPGJ2 (Fig. 6B). These results support the
occurrence of a reduced activity of IKK2 in cells treated with
15dPGJ2.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
Inhibition of I B phosphorylation in activated RAW
264.7 cells treated with 15dPGJ2. Macrophages were
incubated with 2 µM 15dPGJ2 5 min prior to stimulation
with LPS (200 ng/ml) and IFN- (10 U/ml). At the indicated times,
cell extracts were prepared, IKK was immunoprecipitated, and the in
vitro kinase activity of 100 ng of IP protein was assayed using
GST-I B (1-317) and [ -32P]ATP as substrates. (A)
After 10 min of incubation, GST-I B was purified with
glutathione-agarose and analyzed by SDS-PAGE (10% gel). Aliquots (5 µl) of the kinase reaction mixture were analyzed by Western blotting
to determine the amount of IKK2 present in each assay. (B) Cells
treated with 10 µM MG132 were stimulated as described previously; at
the indicated times, cytosolic extracts were prepared and the amount of
endogenous P(Ser32)I B was determined using a specific
Ab. The blot was reprobed with anti-I B Ab. The intensity of the
bands of phosphorylated I B (A) and the ratio between the band
intensities of P(Ser32)I B and I B (B) are given.
Results show the mean ± SEM of three experiments. *,
P < 0.005 with respect to the corresponding
LPS/IFN- condition.
|
|
The mechanism by which 15dPGJ
2 affects IKK activity appears
to include a direct effect of this PG on the kinase activity of
the
complex. When IKK was immunoprecipitated from LPS/IFN-

-treated
cells
and activity was assayed by monitoring GST-(Ser
32)I

B

phosphorylation by Western blotting, a dose-dependent inhibition
by
15dPGJ
2 was observed; however, PGJ
2 assayed at
2 µM failed
to inhibit significantly the activity, suggesting a
specific effect
of 15dPGJ
2 on the complex (Fig.
7A). Moreover, when kinase activity
was
assayed following the incorporation of [
32P]phosphate
into GST-I

B

or GST-I

B
S/A, the inhibitory effect
of 15dPGJ
2 was abolished after removal
of the
Ser
32 and Ser
36 phosphorylation sites. These
results suggest that the direct
effects of 15dPGJ
2 on IKK
activity are preferentially due to the
inhibition of the
phosphorylation of these residues (Fig.
7B).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Inhibition of IKK activity by 15dPGJ2.
Macrophages were incubated for 20 min with LPS (200 ng/ml) and IFN-
(10 U/ml); after homogenization, the IKK complex was immunoprecipitated
with anti-IKK2 Ab. Kinase activity was monitored in vitro for 10 min,
using GST-I B (1-317) as the substrate and in the presence of the
indicated concentrations of PGs and rosiglitazone.
P(Ser32)I B was detected using a specific
anti-P(Ser32)I B Ab. The membrane was reprobed with
anti-I B Ab (A). The incorporation of [32P]phosphate
into GST-I B (1-54) or I B S/A was determined as
previously described (B). Results show the mean ± SEM of the band
intensities, expressed with respect to the condition in the absence of
PG and rosiglitazone. *, P < 0.01 with respect to
the condition in the absence of addition.
|
|
 |
DISCUSSION |
The biological effects of cyclopentenone PGs have been the subject
of intense research in recent years, and multiple targets mediating
their actions have been proposed, ranging from specific interactions
with PPAR
, in which case they act as transcriptional regulators
(14, 18, 36, 41), to effects on early signaling in response
to a wide range of extracellular stimuli (5, 14, 38). In
monocytes/macrophages, 15dPGJ2 exerts an anti-inflammatory action due to the attenuation of the expression of genes recognized classically as activators and mediators of different steps of the host
defense response: first, it inhibits the synthesis and release of
proinflammatory cytokines, such as IL-1
and TNF-
that amplify the
activation process (14); second, this PG inhibits the
expression of effector proteins such as COX-2, NOS-2 (end products of
which exert cytotoxic effects), and matrix metalloproteinases (4,
25, 36); third, it contributes to the resolution of the
inflammatory process by promoting apoptosis of activated macrophages (1). This variety of effects produced by 15dPGJ2
and related cyclopentenone PGs is compatible with the existence of
multiple sites of actions for these molecules (28, 33).
The anti-inflammatory actions of 15dPGJ2 have been
considered to be mediated through the interaction with PPAR
. Ricote
et al. (36) reported the absence in RAW 264.7 cells of such
a transcription factor, and most of the effects observed in these cells
were obtained after transient expression of PPAR
. However, PPAR
was present in elicited peritoneal macrophages, and exogenous
expression of this factor was not required to observe
15dPGJ2-dependent actions. In agreement with previous
results, specific PPAR
ligands, such as rosiglitazone assayed up to
10 µM (apparent dissociation constant [Kd],
<100 nM), had no effect on NO synthesis or NF-
B inhibition in RAW
cells (18, 36). The Kd of
15dPGJ2 for murine PPAR
was estimated to be between 1 and 10 µM. Moreover, portions of the experiments from this work were
repeated using primary cultures of peritoneal macrophages, and the
effects of 15dPGJ2 were very similar to those observed in
RAW cells at short periods of times (up to 4 h). However, the
effects were more pronounced when some parameters (for example, the
synthesis of NO and the levels of NOS-2 protein) were measured at
longer periods of times (18 to 24 h). These observations suggest
the concurrence of other mechanisms, mediated possibly via PPAR
,
that are also triggered by 15dPGJ2.
In this work, our attention was focused on the effects of
15dPGJ2 on the initial steps of macrophage activation after
challenge with low doses of LPS and IFN-
acting in a synergistic way
(22, 32, 52). The observation of a decreased
LPS/IFN-
-dependent NF-
B activation by this PG precludes the
expression of a large number of genes that require the engagement of
this transcription factor (13, 23). 15dPGJ2 not
only inhibited significantly the degradation of I
B
and I
B
in these cells but also exerted marked effects on the nuclear
distribution of these proteins. Moreover, the presence of I
B in the
nucleus contributes to the inhibition of the binding of the active
NF-
B complexes to the
B sites located in regulatory sequences of
various genes (3, 46, 48). Indeed, the studies of the
traffic of I
B
through the nuclear membrane suggest a
physiological inhibitory role for the I
B proteins that are retained
in the nucleus (37, 38). These data are in agreement with
the observation of an important decrease in the binding of nuclear
proteins to the
B sequences as determined by EMSA, as well as a very
efficient repression of the transcription of genes requiring NF-
B
activity, such as NOS-2 and COX-2 (mRNA levels were determined at
4 h), or in cells transfected with a
B reporter gene. However,
when synthesis of nitrites was measured after 18 to 24 h of
culture, the inhibitory action of 1 µM 15dPGJ2 was not as
effective as that reflected by the action on mRNA levels (4 h). This
might be due to the degradation of 15dPGJ2 in the cell, a
process for which, to our knowledge, no kinetic control has been
established. In contrast to this high efficiency in the repression of
NOS-2 and COX-2 at 4 h, in experiments monitoring the mRNA levels
of I
B
and I
B
we observed the prevalence of an important
upregulation of both RNAs, probably because of a higher sensitivity of
these genes to NF-
B activation. Indeed, this particular regulation
of I
B proteins might help to turn off NF-
B activity, precluding a
persistent activation of this transcription factor (13, 46,
48).
In view of the rapid effects of 15dPGJ2 inhibiting I
B
degradation, we investigated the action of this PG upstream of this step. In human monocytes, triggering with LPS activates IKK2, and this
kinase is responsible for the specific phosphorylation of I
Bs that
targets these proteins for ubiquitination and degradation (27, 34,
43). In RAW 264.7 cells, we observed that 15dPGJ2 inhibits in vivo the specific phosphorylation of I
B
at
Ser32. Moreover, when IKK activity was immunoprecipitated
from activated cells, those treated with 15dPGJ2 showed a
lower kinase activity with GST-I
B
as substrate, assayed by either
monitoring [32P]phosphate incorporation or detecting
phosphorylation of Ser32. The effect of 15dPGJ2
on other kinases was assayed; it failed to inhibit the activity of
protein kinase A and the classic and new isotypes of protein kinase C
assayed as Ca2+ and diacylglycerol-dependent activities, as
well as the Jak activity associated with the IFN-
receptor and
followed by the specific phosphorylation of Stat1
in these cells
(not shown). Moreover, the inhibition of IKK activity observed in cells
treated with 15dPGJ2 can be explained through a direct and
specific effect mediated by this PG, as confirmed by in vitro
experiments. However, because the loss of activity persisted even when
the IKK complex was immunoprecipitated and assayed in vitro, it is
possible that 15dPGJ2 alters the structure of the IKK
complex or favors an accelerated hyperphosphorylation state of IKK2
that has been described as impairing the kinase activity
(6). In this regard, a positive and negative regulation of
IKK through the phosphorylation of IKK2 has been described
(6). In HeLa cells stimulated with TNF-
, IKK activity
decreased faster than its phosphorylation. This is because
phosphorylation of two loops of IKK is essential for the activation in
response to proinflammatory stimuli, whereas autophosphorylation at the
carboxyl terminus of a serine cluster contributes to the reduction of
the activity. Preliminary experiments performed in cells labeled with
[33P]phosphate showed an impairment in the
phosphorylation state of IKK2 analyzed over a 30-min period, suggesting
that 15dPGJ2 inhibits the activation of IKK2 rather than
enhances its time-dependent phosphorylation (unpublished data). Taken
together, the effects of 15dPGJ2 on the inhibition of IKK
activity are reminiscent of those observed for other anti-inflammatory
drugs such as aspirin and salicylate (53), suggesting an
important role for IKK as a physiological and pharmacological target to
mediate anti-inflammatory actions.
In conclusion, our data show a specific action of 15dPGJ2
on the activity of the IKK complex, an inhibitory effect that can be
observed directly when the kinase is assayed in vitro. In addition, 15dPGJ2 redistributes I
B
and in particular I
B
in the nuclei of activated macrophages, a process that may contribute
to the impairment of NF-
B activation. Unraveling the presumably
sequential targets for 15dPGJ2 and related PGs might
contribute to a better understanding of the mechanism of action of
physiologically occurring anti-inflammatory PGs as well as those
pertaining to the process of resolution of inflammation.
 |
ACKNOWLEDGMENTS |
We thank Q.-W. Xie and C. Nathan for the generous gift of the
NOS-2 promoter, T. J. Evans for the gift of the mutated
B
sequences of the NOS-2 promoter, J. Moscat for the mutated GST-I
B
constructs, and A. Alvarez from the Centro de Citometría de
Flujo and Microspopía Confocal for the immunofluorescence
analysis. The technical support of O. G. Bodelón and the
help of E. Lundin in preparing the manuscript are acknowledged.
This work was supported by DGESIC (PM98-0120) and Comunidad de Madrid
(08.3/004/97).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Instituto de
Bioquímica, Facultad de Farmacia, 28040 Madrid, Spain. Fax:
3491 543 8649 or 3491 394 1782. E-mail:
boscal{at}eucmax.sim.ucm.es.
 |
REFERENCES |
| 1.
|
Chinetti, G.,
S. Griglio,
M. Antonucci,
I. P. Torra,
P. Delerive,
Z. Majd,
J. C. Fruchart,
J. Chapman,
J. Najib, and B. Staels.
1998.
Activation of proliferator-activated receptors and induces apoptosis of human monocyte-derived macrophages.
J. Biol. Chem.
273:25573-25580[Abstract/Free Full Text].
|
| 2.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 3.
|
Chu, Z. L.,
T. A. McKinsey,
L. Liu,
X. Qi, and D. W. Ballard.
1996.
Basal phosphorylation of the PEST domain in the I B regulates its functional interaction with the c-rel proto-oncogene product.
Mol. Cell. Biol.
16:5974-5984[Abstract].
|
| 4.
|
Colville-Nash, P. R.,
S. S. Qureshi,
D. Willis, and D. A. Willoughby.
1998.
Inhibition of inducible nitric oxide synthase by peroxisome proliferator-activated receptor agonists: correlation with induction of heme oxygenase 1.
J. Immunol.
161:978-984[Abstract/Free Full Text].
|
| 5.
|
D'Acquisto, F.,
L. Sautebin,
T. Iuvone,
M. Di Rosa, and R. Carnuccio.
1998.
Prostaglandins prevent inducible nitric oxide synthase protein expression by inhibiting nuclear factor- B activation in J774 macrophages.
FEBS Lett.
440:76-80[CrossRef][Medline].
|
| 6.
|
Delhase, M.,
M. Hayakawa,
Y. Chen, and M. Karin.
1999.
Positive and negative regulation of I B kinase activity through IKK subunit phosphorylation.
Science
284:309-313[Abstract/Free Full Text].
|
| 7.
|
DeWitt, D. L.
1991.
Prostaglandin endoperoxide synthase: regulation of enzyme expression.
Biochim. Biophys. Acta
1083:121-134[Medline].
|
| 8.
|
Diaz-Guerra, M. J. M.,
A. Castrillo,
P. Martin-Sanz, and L. Bosca.
1999.
Negative regulation by protein tyrosine phosphatase of IFN- -dependent expression of inducible nitric oxide synthase.
J. Immunol.
162:6776-6783[Abstract/Free Full Text].
|
| 9.
|
Diaz-Guerra, M. J. M.,
M. Velasco,
P. Martin-Sanz, and L. Bosca.
1996.
Evidence for common mechanisms in the transcriptional control of type II nitric oxide synthase in isolated hepatocytes. Requirement of NF- B activation after stimulation with bacterial cell wall products and phorbol esters.
J. Biol. Chem.
271:30114-30120[Abstract/Free Full Text].
|
| 10.
|
DiDonato, J. A.,
M. Hayakawa,
D. M. Rothwarf,
E. Zandi, and M. Karin.
1997.
A cytokine-responsive I B kinase that activates the transcription factor NF- B.
Nature
388:548-554[CrossRef][Medline].
|
| 11.
|
Dowell, P.,
V. J. Peterson,
T. M. Zabriskie, and M. Leid.
1997.
Ligand-induced peroxisome proliferator-activated receptor conformational change.
J. Biol. Chem.
272:2013-2020[Abstract/Free Full Text].
|
| 12.
|
Forman, B. M.,
P. Tontonoz,
J. Chen,
R. P. Brun,
B. M. Spiegelman, and R. M. Evans.
1995.
15-Deoxy- 12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR .
Cell
83:803-812[CrossRef][Medline].
|
| 13.
|
Ghosh, S.,
M. J. May, and E. B. Kopp.
1998.
NF- B and Rel proteins: evolutionarily conserved mediators of immune responses.
Annu. Rev. Immunol.
16:225-260[CrossRef][Medline].
|
| 14.
|
Jiang, C.,
A. T. Ting, and B. Seed.
1998.
PPAR- agonists inhibit production of monocyte inflammatory cytokines.
Nature
391:82-86[CrossRef][Medline].
|
| 15.
|
Karin, M.
1999.
The beginning of the end: I B kinase (IKK) and NF- B activation.
J. Biol. Chem.
274:27339-27342[Free Full Text].
|
| 16.
|
Kitamura, Y.,
J. Kakimura,
Y. Matsuoka,
Y. Nomura,
P. J. Gebicke-Haerter, and T. Taniguchi.
1999.
Activators of peroxisome proliferator-activated receptor- (PPAR ) inhibit inducible nitric oxide synthase expression but increase heme oxygenase-1 expression in rat glial cells.
Neurosci. Lett.
262:129-132[CrossRef][Medline].
|
| 17.
|
Kliewer, S. A.,
J. M. Lenhard,
T. M. Willson,
I. Patel,
D. C. Morris, and J. M. Lehmann.
1995.
A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor and promotes adipocyte differentiation.
Cell
83:813-819[CrossRef][Medline].
|
| 18.
|
Krey, G.,
O. Braissant,
F. L'Horset,
E. Kalkhoven,
M. Perroud,
M. G. Parker, and W. Wahli.
1997.
Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay.
Mol. Endocrinol.
11:779-791[Abstract/Free Full Text].
|
| 19.
|
Lallena, M. J.,
M. T. Diaz-Meco,
G. Bren,
C. V. Paya, and J. Moscat.
1999.
Activation of I B kinase by protein kinase C isoforms.
Mol. Cell. Biol.
19:2180-2188[Abstract/Free Full Text].
|
| 20.
|
Li, Q.,
D. Van Antwerp,
F. Mercurio,
K. F. Lee, and I. M. Verma.
1999.
Severe liver degeneration in mice lacking the I B kinase 2 gene.
Science
284:321-325[Abstract/Free Full Text].
|
| 21.
|
Lopez-Collazo, E.,
S. Hortelano,
A. Rojas, and L. Bosca.
1998.
Triggering of peritoneal macrophages with IFN- / attenuates the expression of inducible nitric oxide synthase through a decrease in NF- B activation.
J. Immunol.
160:2889-2895[Abstract/Free Full Text].
|
| 22.
|
Lowenstein, C. J.,
E. W. Alley,
P. Raval,
A. M. Snowman,
S. H. Snyder,
S. W. Russell, and W. J. Murphy.
1993.
Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon and lipopolysaccharide.
Proc. Natl. Acad. Sci. USA
90:9730-9734[Abstract/Free Full Text].
|
| 23.
|
MacMicking, J.,
Q. W. Xie, and C. Nathan.
1997.
Nitric oxide and macrophage function.
Annu. Rev. Immunol.
15:323-350[CrossRef][Medline].
|
| 24.
|
Martin-Sanz, P.,
N. A. Callejas,
M. Casado,
M. J. Diaz-Guerra, and L. Bosca.
1998.
Expression of cyclooxygenase-2 in foetal rat hepatocytes stimulated with lipopolysaccharide and pro-inflammatory cytokines.
Br. J. Pharmacol.
125:1313-1319[CrossRef][Medline].
|
| 25.
|
Marx, N.,
G. Sukhova,
C. Murphy,
P. Libby, and J. Plutzky.
1998.
Macrophages in human atheroma contain PPAR : differentiation-dependent peroxisomal proliferator-activated receptor (PPAR ) expression and reduction of MMP-9 activity through PPAR activation in mononuclear phagocytes in vitro.
Am. J. Pathol.
153:17-23[Abstract/Free Full Text].
|
| 26.
|
May, M. J., and S. Ghosh.
1998.
Signal transduction through NF- B.
Immunol. Today
19:80-88[CrossRef][Medline].
|
| 27.
|
May, M. J., and S. Ghosh.
1999.
I B kinases: kinsmen with different crafts.
Science
284:271-273[Free Full Text].
|
| 28.
|
McGeer, P. L.,
M. Schulzer, and E. G. McGeer.
1996.
Arthritis and anti-inflammatory agents as possible protective factors for Alzheimer's disease: a review of 17 epidemiologic studies.
Neurology
47:425-432[Abstract/Free Full Text].
|
| 29.
|
Mercurio, F.,
H. Zhu,
B. W. Murray,
A. Shevchenko,
B. L. Bennett,
J. Li,
D. B. Young,
M. Barbosa,
M. Mann,
A. Manning, and A. Rao.
1997.
IKK-1 and IKK-2: cytokine-activated I B kinases essential for NF- B activation.
Science
278:860-866[Abstract/Free Full Text].
|
| 30.
|
Nakano, H.,
M. Shindo,
S. Sakon,
S. Nishinaka,
M. Mihara,
H. Yagita, and K. Okumura.
1998.
Differential regulation of I B kinase and by two upstream kinases, NF- B-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1.
Proc. Natl. Acad. Sci. USA
5:3537-3542.
|
| 31.
|
Nathan, C.
1997.
Inducible nitric oxide synthase: what difference does it make?
J. Clin. Investig.
100:2417-2423[Medline].
|
| 32.
|
Nathan, C., and Q. W. Xie.
1994.
Nitric oxide synthases: roles, tolls, and controls.
Cell
78:915-918[CrossRef][Medline].
|
| 33.
|
Negishi, M.,
T. Koizumi, and A. Ichikawa.
1995.
Biological actions of delta 12-prostaglandin J2.
J. Lipid Mediat. Cell Signal.
12:443-448[CrossRef][Medline].
|
| 34.
|
O'Connell, M. A.,
B. L. Bennett,
F. Mercurio,
A. M. Manning, and N. Mackman.
1998.
Role of IKK1 and IKK2 in lipopolysaccharide signaling in human monocytic cells.
J. Biol. Chem.
273:30410-30414[Abstract/Free Full Text].
|
| 35.
|
Petrova, T. V.,
K. T. Akama, and L. J. Van Eldik.
1999.
Cyclopentenone prostaglandins suppress activation of microglia: down-regulation of inducible nitric-oxide synthase by 15-deoxy- 12,14-prostaglandin J2.
Proc. Natl. Acad. Sci. USA
96:4668-4673[Abstract/Free Full Text].
|
| 36.
|
Ricote, M.,
A. C. Li,
T. M. Willson,
C. J. Kelly, and C. K. Glass.
1998.
The peroxisome proliferator-activated receptor- is a negative regulator of macrophage activation.
Nature
391:79-82[CrossRef][Medline].
|
| 37.
|
Rodriguez, M. S.,
J. Thompson,
R. T. Hay, and C. Dargemont.
1999.
Nuclear retention of I B protects it from signal-induced degradation and inhibits nuclear factor B transcriptional activation.
J. Biol. Chem.
274:9108-9115[Abstract/Free Full Text].
|
| 38.
|
Rossi, A.,
G. Elia, and M. G. Santoro.
1997.
Inhibition of nuclear factor B by prostaglandin A1: an effect associated with heat shock transcription factor activation.
Proc. Natl. Acad. Sci. USA
94:746-750[Abstract/Free Full Text].
|
| 39.
|
Rozera, C.,
A. Carattoli,
A. De Marco,
C. Amici,
C. Giorgi, and M. G. Santoro.
1996.
Inhibition of HIV-1 replication by cyclopentenone prostaglandins in acutely infected human cells. Evidence for a transcriptional block.
J. Clin. Investig.
97:1795-1803[Medline].
|
| 40.
|
Schreiber, E.,
P. Matthias,
M. M. Muller, and W. Schaffner.
1989.
Rapid detection of octamer binding proteins with `mini-extracts', prepared from a small number of cells.
Nucleic Acids Res.
17:6419[Free Full Text].
|
| 41.
|
Spiegelman, B. M.
1998.
PPAR- : adipogenic regulator and thiazolidinedione receptor.
Diabetes
47:507-514[Abstract].
|
| 42.
|
Spink, J.,
J. Cohen, and T. J. Evans.
1995.
The cytokine responsive vascular smooth muscle cell enhancer of inducible nitric oxide synthase. Activation by nuclear factor- B.
J. Biol. Chem.
270:29541-29547[Abstract/Free Full Text].
|
| 43.
|
Stancovski, I., and D. Baltimore.
1997.
NF- B activation: the I B kinase revealed?
Cell
91:299-302[CrossRef][Medline].
|
| 44.
|
Taylor, J. A.,
G. D. Bren,
K. N. Pennington,
S. A. Trushin,
S. Asin, and C. V. Paya.
1999.
Serine 32 and serine 36 of I B are directly phosphorylated by protein kinase CKII in vitro.
J. Mol. Biol.
290:839-850[CrossRef][Medline].
|
| 45.
|
Thanos, D., and T. Maniatis.
1995.
NF- B: a lesson in family values.
Cell
80:529-532[CrossRef][Medline].
|
| 46.
|
Thompson, J. E.,
R. J. Phillips,
H. Erdjument-Bromage,
P. Tempst, and S. Ghosh.
1995.
I B- regulates the persistent response in a biphasic activation of NF- B.
Cell
80:573-582[CrossRef][Medline].
|
| 47.
|
Tsai, S. H.,
S. Y. Lin-Shiau, and J. K. Lin.
1999.
Suppression of nitric oxide synthase and the down-regulation of the activation of NF B in macrophages by resveratrol.
Br. J. Pharmacol.
126:673-680[CrossRef][Medline].
|
| 48.
|
Velasco, M.,
M. J. Diaz-Guerra,
P. Martin-Sanz,
A. Alvarez, and L. Bosca.
1997.
Rapid up-regulation of I B and abrogation of NF- B activity in peritoneal macrophages stimulated with lipopolysaccharide.
J. Biol. Chem.
272:23025-23030[Abstract/Free Full Text].
|
| 49.
|
Wright, K.,
S. G. Ward,
G. Kolios, and J. Westwick.
1997.
Activation of phosphatidylinositol 3-kinase by interleukin-13. An inhibitory signal for inducible nitric-oxide synthase expression in epithelial cell line HT-29.
J. Biol. Chem.
272:12626-12633[Abstract/Free Full Text].
|
| 50.
|
Xie, Q., and C. Nathan.
1994.
The high-output nitric oxide pathway: role and regulation.
J. Leukoc. Biol.
56:576-582[Abstract].
|
| 51.
|
Xie, Q. W.,
Y. Kashiwabara, and C. Nathan.
1994.
Role of transcription factor NF- B/Rel in induction of nitric oxide synthase.
J. Biol. Chem.
269:4705-4708[Abstract/Free Full Text].
|
| 52.
|
Xie, Q. W.,
R. Whisnant, and C. Nathan.
1993.
Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon and bacterial lipopolysaccharide.
J. Exp. Med.
177:1779-1784[Abstract/Free Full Text].
|
| 53.
|
Yin, M. J.,
Y. Yamamoto, and R. B. Gaynor.
1998.
The anti-inflammatory agents aspirin and salicylate inhibit the activity of I B kinase- .
Nature
396:77-80[CrossRef][Medline].
|
| 54.
|
Zandi, E.,
Y. Chen, and M. Karin.
1998.
Direct phosphorylation of I B by IKK and IKK : discrimination between free and NF- B-bound substrate.
Science
281:1360-1363[Abstract/Free Full Text].
|
| 55.
|
Zandi, E., and M. Karin.
1999.
Bridging the gap: composition, regulation, and physiological function of the I B kinase complex.
Mol. Cell. Biol.
19:4547-4551[Free Full Text].
|
| 56.
|
Zandi, E.,
D. M. Rothwarf,
M. Delhase,
M. Hayakawa, and M. Karin.
1997.
The I B kinase complex (IKK) contains two kinase subunits, IKK and IKK , necessary for I B phosphorylation and NF- B activation.
Cell
91:243-252[CrossRef][Medline].
|
Molecular and Cellular Biology, March 2000, p. 1692-1698, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Remels, A. H. V., Langen, R. C. J., Gosker, H. R., Russell, A. P., Spaapen, F., Voncken, J. W., Schrauwen, P., Schols, A. M. W. J.
(2009). PPAR{gamma} inhibits NF-{kappa}B-dependent transcriptional activation in skeletal muscle. Am. J. Physiol. Endocrinol. Metab.
297: E174-E183
[Abstract]
[Full Text]
-
Scazzocchio, B., Vari, R., D'Archivio, M., Santangelo, C., Filesi, C., Giovannini, C., Masella, R.
(2009). Oxidized LDL impair adipocyte response to insulin by activating serine/threonine kinases. J. Lipid Res.
50: 832-845
[Abstract]
[Full Text]
-
Doublier, S., Riganti, C., Voena, C., Costamagna, C., Aldieri, E., Pescarmona, G., Ghigo, D., Bosia, A.
(2008). RhoA Silencing Reverts the Resistance to Doxorubicin in Human Colon Cancer Cells. Mol Cancer Res
6: 1607-1620
[Abstract]
[Full Text]
-
Jahoor, A., Patel, R., Bryan, A., Do, C., Krier, J., Watters, C., Wahli, W., Li, G., Williams, S. C., Rumbaugh, K. P.
(2008). Peroxisome Proliferator-Activated Receptors Mediate Host Cell Proinflammatory Responses to Pseudomonas aeruginosa Autoinducer. J. Bacteriol.
190: 4408-4415
[Abstract]
[Full Text]
-
Remels, A. H., Gosker, H. R., Schrauwen, P., Langen, R. C., Schols, A. M.
(2008). Peroxisome proliferator-activated receptors: a therapeutic target in COPD?. Eur Respir J
31: 502-508
[Abstract]
[Full Text]
-
Linard, C., Gremy, O., Benderitter, M.
(2008). Reduction of Peroxisome Proliferation-Activated Receptor {gamma} Expression by {gamma}-Irradiation as a Mechanism Contributing to Inflammatory Response in Rat Colon: Modulation by the 5-Aminosalicylic Acid Agonist. J. Pharmacol. Exp. Ther.
324: 911-920
[Abstract]
[Full Text]
-
Wang, L. H., Yang, X. Y., Zhang, X., Farrar, W. L.
(2007). Inhibition of adhesive interaction between multiple myeloma and bone marrow stromal cells by PPAR{gamma} cross talk with NF-{kappa}B and C/EBP. Blood
110: 4373-4384
[Abstract]
[Full Text]
-
Riganti, C., Orecchia, S., Silvagno, F., Pescarmona, G., Betta, P. G., Gazzano, E., Aldieri, E., Ghigo, D., Bosia, A.
(2007). Asbestos Induces Nitric Oxide Synthesis in Mesothelioma Cells via Rho Signaling Inhibition. Am. J. Respir. Cell Mol. Bio.
36: 746-756
[Abstract]
[Full Text]
-
Traves, P. G., Hortelano, S., Zeini, M., Chao, T.-H., Lam, T., Neuteboom, S. T., Theodorakis, E. A., Palladino, M. A., Castrillo, A., Bosca, L.
(2007). Selective Activation of Liver X Receptors by Acanthoic Acid-Related Diterpenes. Mol. Pharmacol.
71: 1545-1553
[Abstract]
[Full Text]
-
Marathe, C., Bradley, M. N., Hong, C., Lopez, F., de Galarreta, C. M. R., Tontonoz, P., Castrillo, A.
(2006). The Arginase II Gene Is an Anti-inflammatory Target of Liver X Receptor in Macrophages. J. Biol. Chem.
281: 32197-32206
[Abstract]
[Full Text]
-
Kobayashi, M., Ono, H., Mihara, K., Tauchi, H., Komatsu, K., Shibata, T., Shimizu, H., Uchida, K., Yamamoto, K.-i.
(2006). ATM activation by a sulfhydryl-reactive inflammatory cyclopentenone prostaglandin.. GENES CELLS
11: 779-789
[Abstract]
[Full Text]
-
Hummasti, S., Tontonoz, P.
(2006). The Peroxisome Proliferator-Activated Receptor N-Terminal Domain Controls Isotype-Selective Gene Expression and Adipogenesis. Mol. Endocrinol.
20: 1261-1275
[Abstract]
[Full Text]
-
Monsalve, E., Perez, M. A., Rubio, A., Ruiz-Hidalgo, M. J., Baladron, V., Garcia-Ramirez, J. J., Gomez, J. C., Laborda, J., Diaz-Guerra, M. J. M.
(2006). Notch-1 Up-Regulation and Signaling following Macrophage Activation Modulates Gene Expression Patterns Known to Affect Antigen-Presenting Capacity and Cytotoxic Activity. J. Immunol.
176: 5362-5373
[Abstract]
[Full Text]
-
Stamatakis, K., Sanchez-Gomez, F. J., Perez-Sala, D.
(2006). Identification of Novel Protein Targets for Modification by 15-Deoxy-{Delta}12,14-Prostaglandin J2 in Mesangial Cells Reveals Multiple Interactions with the Cytoskeleton. J. Am. Soc. Nephrol.
17: 89-98
[Abstract]
[Full Text]
-
Musiek, E. S., Gao, L., Milne, G. L., Han, W., Everhart, M. B., Wang, D., Backlund, M. G., DuBois, R. N., Zanoni, G., Vidari, G., Blackwell, T. S., Morrow, J. D.
(2005). Cyclopentenone Isoprostanes Inhibit the Inflammatory Response in Macrophages. J. Biol. Chem.
280: 35562-35570
[Abstract]
[Full Text]
-
Ackerman, W. E. IV, Zhang, X. L., Rovin, B. H., Kniss, D. A.
(2005). Modulation of Cytokine-Induced Cyclooxygenase 2 Expression by PPARG Ligands Through NF{kappa}B Signal Disruption in Human WISH and Amnion Cells. Biol. Reprod.
73: 527-535
[Abstract]
[Full Text]
-
Banerjee, A. G., Bhattacharyya, I., Vishwanatha, J. K.
(2005). Identification of genes and molecular pathways involved in the progression of premalignant oral epithelia. Molecular Cancer Therapeutics
4: 865-875
[Abstract]
[Full Text]
-
Blanco, M., Moro, M. A., Davalos, A., Leira, R., Castellanos, M., Serena, J., Vivancos, J., Rodriguez-Yanez, M., Lizasoain, I., Castillo, J.
(2005). Increased Plasma Levels of 15-Deoxy {Delta} Prostaglandin J2 Are Associated With Good Outcome in Acute Atherothrombotic Ischemic Stroke. Stroke
36: 1189-1194
[Abstract]
[Full Text]
-
Mayoral, R., Fernandez-Martinez, A., Bosca, L., Martin-Sanz, P.
(2005). Prostaglandin E2 promotes migration and adhesion in hepatocellular carcinoma cells. Carcinogenesis
26: 753-761
[Abstract]
[Full Text]
-
Ray, D. M., Akbiyik, F., Bernstein, S. H., Phipps, R. P.
(2005). CD40 Engagement Prevents Peroxisome Proliferator-Activated Receptor {gamma} Agonist-Induced Apoptosis of B Lymphocytes and B Lymphoma Cells by an NF-{kappa}B-Dependent Mechanism. J. Immunol.
174: 4060-4069
[Abstract]
[Full Text]
-
Pignatelli, M., Sanchez-Rodriguez, J., Santos, A., Perez-Castillo, A.
(2005). 15-Deoxy-{Delta}-12,14-prostaglandin J2 induces programmed cell death of breast cancer cells by a pleiotropic mechanism. Carcinogenesis
26: 81-92
[Abstract]
[Full Text]
-
Chen, F.
(2004). Endogenous Inhibitors of Nuclear Factor-{kappa}B, An Opportunity for Cancer Control. Cancer Res.
64: 8135-8138
[Abstract]
[Full Text]
-
Sanchez-Gomez, F. J., Cernuda-Morollon, E., Stamatakis, K., Perez-Sala, D.
(2004). Protein Thiol Modification by 15-deoxy-{Delta}12,14-Prostaglandin J2 Addition in Mesangial Cells: Role in the Inhibition of Pro-inflammatory Genes. Mol. Pharmacol.
66: 1349-1358
[Abstract]
[Full Text]
-
Goren, N., Cuenca, J., Martin-Sanz, P., Bosca, L.
(2004). Attenuation of NF-{kappa}B signalling in rat cardiomyocytes at birth restricts the induction of inflammatory genes. Cardiovasc Res
64: 289-297
[Abstract]
[Full Text]
-
Giri, S., Rattan, R., Singh, A. K., Singh, I.
(2004). The 15-Deoxy-{delta}12,14-Prostaglandin J2 Inhibits the Inflammatory Response in Primary Rat Astrocytes via Down-Regulating Multiple Steps in Phosphatidylinositol 3-Kinase-Akt-NF-{kappa}B-p300 Pathway Independent of Peroxisome Proliferator-Activated Receptor {gamma}. J. Immunol.
173: 5196-5208
[Abstract]
[Full Text]
-
Grau, R., Iniguez, M. A., Fresno, M.
(2004). Inhibition of Activator Protein 1 Activation, Vascular Endothelial Growth Factor, and Cyclooxygenase-2 Expression by 15-Deoxy-{Delta}12,14-Prostaglandin J2 in Colon Carcinoma Cells: Evidence for a Redox-Sensitive Peroxisome Proliferator-Activated Receptor-{gamma}-Independent Mechanism. Cancer Res.
64: 5162-5171
[Abstract]
[Full Text]
-
Francois, M., Richette, P., Tsagris, L., Raymondjean, M., Fulchignoni-Lataud, M.-C., Forest, C., Savouret, J.-F., Corvol, M.-T.
(2004). Peroxisome Proliferator-activated Receptor-{gamma} Down-regulates Chondrocyte Matrix Metalloproteinase-1 via a Novel Composite Element. J. Biol. Chem.
279: 28411-28418
[Abstract]
[Full Text]
-
Perez-Ortiz, J. M., Tranque, P., Vaquero, C. F., Domingo, B., Molina, F., Calvo, S., Jordan, J., Cena, V., Llopis, J.
(2004). Glitazones Differentially Regulate Primary Astrocyte and Glioma Cell Survival: INVOLVEMENT OF REACTIVE OXYGEN SPECIES AND PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR-{gamma}. J. Biol. Chem.
279: 8976-8985
[Abstract]
[Full Text]
-
Reddy, R. C., Keshamouni, V. G., Jaigirdar, S. H., Zeng, X., Leff, T., Thannickal, V. J., Standiford, T. J.
(2004). Deactivation of murine alveolar macrophages by peroxisome proliferator-activated receptor-{gamma} ligands. Am. J. Physiol. Lung Cell. Mol. Physiol.
286: L613-L619
[Abstract]
[Full Text]
-
Maddox, J. F., Domzalski, A. C., Roth, R. A., Ganey, P. E.
(2004). 15-Deoxy Prostaglandin J2 Enhances Allyl Alcohol-Induced Toxicity in Rat Hepatocytes. Toxicol Sci
77: 290-298
[Abstract]
[Full Text]
-
Perez-Sala, D., Cernuda-Morollon, E., Canada, F. J.
(2003). Molecular Basis for the Direct Inhibition of AP-1 DNA Binding by 15-Deoxy-{Delta}12,14-prostaglandin J2. J. Biol. Chem.
278: 51251-51260
[Abstract]
[Full Text]
-
Yue, T.-l., Bao, W., Jucker, B. M., Gu, J.-l., Romanic, A. M., Brown, P. J., Cui, J., Thudium, D. T., Boyce, R., Burns-Kurtis, C. L., Mirabile, R. C., Aravindhan, K., Ohlstein, E. H.
(2003). Activation of Peroxisome Proliferator-Activated Receptor-{alpha} Protects the Heart From Ischemia/Reperfusion Injury. Circulation
108: 2393-2399
[Abstract]
[Full Text]
-
Mendez, M., LaPointe, M. C.
(2003). PPAR{gamma} Inhibition of Cyclooxygenase-2, PGE2 Synthase, and Inducible Nitric Oxide Synthase in Cardiac Myocytes. Hypertension
42: 844-850
[Abstract]
[Full Text]
-
Yuan, Z., Liu, Y., Liu, Y., Zhang, J., Kishimoto, C., Wang, Y., Ma, A., Liu, Z.
(2003). Peroxisome proliferation-activated receptor-{gamma} ligands ameliorate experimental autoimmune myocarditis. Cardiovasc Res
59: 685-694
[Abstract]
[Full Text]
-
Chen, C.-W., Chang, Y.-H., Tsi, C.-J., Lin, W.-W.
(2003). Inhibition of IFN-{gamma}-Mediated Inducible Nitric Oxide Synthase Induction by the Peroxisome Proliferator-Activated Receptor {gamma} Agonist, 15-Deoxy-{Delta}12,14-Prostaglandin J2, Involves Inhibition of the Upstream Janus Kinase/STAT1 Signaling Pathway. J. Immunol.
171: 979-988
[Abstract]
[Full Text]
-
Shibata, T., Yamada, T., Ishii, T., Kumazawa, S., Nakamura, H., Masutani, H., Yodoi, J., Uchida, K.
(2003). Thioredoxin as a Molecular Target of Cyclopentenone Prostaglandins. J. Biol. Chem.
278: 26046-26054
[Abstract]
[Full Text]
-
Lee, T.-S., Tsai, H.-L., Chau, L.-Y.
(2003). Induction of Heme Oxygenase-1 Expression in Murine Macrophages Is Essential for the Anti-inflammatory Effect of Low Dose 15-Deoxy-{Delta}12,14-prostaglandin J2. J. Biol. Chem.
278: 19325-19330
[Abstract]
[Full Text]
-
Oliva, J. L., Perez-Sala, D., Castrillo, A., Martinez, N., Canada, F. J., Bosca, L., Rojas, J. M.
(2003). The cyclopentenone 15-deoxy-Delta 12,14-prostaglandin J2 binds to and activates H-Ras. Proc. Natl. Acad. Sci. USA
100: 4772-4777
[Abstract]
[Full Text]
-
Gilde, A. J., van der Lee, K. A.J.M., Willemsen, P. H.M., Chinetti, G., van der Leij, F. R., van der Vusse, G. J., Staels, B., van Bilsen, M.
(2003). Peroxisome Proliferator-Activated Receptor (PPAR) {alpha} and PPAR{beta}/{delta}, but not PPAR{gamma}, Modulate the Expression of Genes Involved in Cardiac Lipid Metabolism. Circ. Res.
92: 518-524
[Abstract]
[Full Text]
-
Castrillo, A., Joseph, S. B., Marathe, C., Mangelsdorf, D. J., Tontonoz, P.
(2003). Liver X Receptor-dependent Repression of Matrix Metalloproteinase-9 Expression in Macrophages. J. Biol. Chem.
278: 10443-10449
[Abstract]
[Full Text]
-
Callejas, N. A., Fernandez-Martinez, A., Castrillo, A., Bosca, L., Martin-Sanz, P.
(2003). Selective Inhibitors of Cyclooxygenase-2 Delay the Activation of Nuclear Factor kappa B and Attenuate the Expression of Inflammatory Genes in Murine Macrophages Treated with Lipopolysaccharide. Mol. Pharmacol.
63: 671-677
[Abstract]
[Full Text]
-
Castrillo, A., Traves, P. G., Martin-Sanz, P., Parkinson, S., Parker, P. J., Bosca, L.
(2003). Potentiation of Protein Kinase C {zeta} Activity by 15-Deoxy-{Delta}12,14-Prostaglandin J2 Induces an Imbalance between Mitogen-Activated Protein Kinases and NF-{kappa}B That Promotes Apoptosis in Macrophages. Mol. Cell. Biol.
23: 1196-1208
[Abstract]
[Full Text]
-
Clay, C. E., Monjazeb, A., Thorburn, J., Chilton, F. H., High, K. P.
(2002). 15-Deoxy-{Delta}12,14-prostaglandin J2-induced apoptosis does not require PPAR{gamma} in breast cancer cells. J. Lipid Res.
43: 1818-1828
[Abstract]
[Full Text]
-
Kluft, C., Kleemann, R., de Maat, M.P.M.
(2002). How best to counteract the enemies? By controlling inflammation in the coronary circulation. Eur Heart J Suppl
4: G53-G65
[Abstract]
-
Fernandez, N., Renedo, M., Garcia-Rodriguez, C., Sanchez Crespo, M.
(2002). Activation of Monocytic Cells Through Fc{gamma} Receptors Induces the Expression of Macrophage-Inflammatory Protein (MIP)-1{alpha}, MIP-1{beta}, and RANTES. J. Immunol.
169: 3321-3328
[Abstract]
[Full Text]
-
Eligini, S., Brambilla, M., Banfi, C., Camera, M., Sironi, L., Barbieri, S. S., Auwerx, J., Tremoli, E., Colli, S.
(2002). Oxidized phospholipids inhibit cyclooxygenase-2 in human macrophages via nuclear factor-{kappa}B/I{kappa}B- and ERK2-dependent mechanisms. Cardiovasc Res
55: 406-415
[Abstract]
[Full Text]
-
Bureau, F., Desmet, C., Melotte, D., Jaspar, F., Volanti, C., Vanderplasschen, A., Pastoret, P.-P., Piette, J., Lekeux, P.
(2002). A Proinflammatory Role for the Cyclopentenone Prostaglandins at Low Micromolar Concentrations: Oxidative Stress-Induced Extracellular Signal-Regulated Kinase Activation Without NF-{kappa}B Inhibition. J. Immunol.
168: 5318-5325
[Abstract]
[Full Text]
-
Alleva, D. G., Johnson, E. B, Lio, F. M, Boehme, S. A, Conlon, P. J, Crowe, P. D.
(2002). Regulation of murine macrophage proinflammatory and anti-inflammatory cytokines by ligands for peroxisome proliferator-activated receptor-{gamma}: counter-regulatory activity by IFN-{gamma}. J. Leukoc. Biol.
71: 677-685
[Abstract]
[Full Text]
-
Cunard, R., Ricote, M., DiCampli, D., Archer, D. C., Kahn, D. A., Glass, C. K., Kelly, C. J.
(2002). Regulation of Cytokine Expression by Ligands of Peroxisome Proliferator Activated Receptors. J. Immunol.
168: 2795-2802
[Abstract]
[Full Text]
-
Clark, R. B.
(2002). The role of PPARs in inflammation and immunity. J. Leukoc. Biol.
71: 388-400
[Abstract]
[Full Text]
-
Diab, A., Deng, C., Smith, J. D., Hussain, R. Z., Phanavanh, B., Lovett-Racke, A. E., Drew, P. D., Racke, M. K.
(2002). Peroxisome Proliferator-Activated Receptor-{gamma} Agonist 15-Deoxy-{Delta}12,1412,14-Prostaglandin J2 Ameliorates Experimental Autoimmune Encephalomyelitis. J. Immunol.
168: 2508-2515
[Abstract]
[Full Text]
-
Harris, S. G., Smith, R. S., Phipps, R. P.
(2002). 15-Deoxy-{Delta}12,1412,14-PGJ2 Induces IL-8 Production in Human T Cells by a Mitogen-Activated Protein Kinase Pathway. J. Immunol.
168: 1372-1379
[Abstract]
[Full Text]
-
Masamune, A., Kikuta, K., Satoh, M., Sakai, Y., Satoh, A., Shimosegawa, T.
(2002). Ligands of Peroxisome Proliferator-activated Receptor-gamma Block Activation of Pancreatic Stellate Cells. J. Biol. Chem.
277: 141-147
[Abstract]
[Full Text]
-
Simonin, M.-A., Bordji, K., Boyault, S., Bianchi, A., Gouze, E., Becuwe, P., Dauca, M., Netter, P., Terlain, B.
(2002). PPAR-gamma ligands modulate effects of LPS in stimulated rat synovial fibroblasts. Am. J. Physiol. Cell Physiol.
282: C125-C133
[Abstract]
[Full Text]
-
Clay, C. E., Atsumi, G.-i., High, K. P., Chilton, F. H.
(2001). Early de Novo Gene Expression Is Required for 15-Deoxy-Delta 12,14-prostaglandin J2-induced Apoptosis in Breast Cancer Cells. J. Biol. Chem.
276: 47131-47135
[Abstract]
[Full Text]
-
Castrillo, A., Pennington, D. J., Otto, F., Parker, P. J., Owen, M. J., Bosca, L.
(2001). Protein Kinase C{epsilon} Is Required for Macrophage Activation and Defense Against Bacterial Infection. JEM
194: 1231-1242
[Abstract]
[Full Text]
-
Poligone, B., Baldwin, A. S.
(2001). Positive and Negative Regulation of NF-kappa B by COX-2. ROLES OF DIFFERENT PROSTAGLANDINS. J. Biol. Chem.
276: 38658-38664
[Abstract]
[Full Text]
-
Sidhu, J S, Kaski, J C
(2001). Peroxisome proliferator activated receptor {gamma}: a potential therapeutic target in the management of ischaemic heart disease. Heart
86: 255-258
[Full Text]
-
ROVIN, B. H., LU, L., COSIO, A.
(2001). Cyclopentenone Prostaglandins Inhibit Cytokine-Induced NF-{kappa}B Activation and Chemokine Production by Human Mesangial Cells. J. Am. Soc. Nephrol.
12: 1659-1667
[Abstract]
[Full Text]
-
Zhang, X., Wang, J. M., Gong, W. H., Mukaida, N., Young, H. A.
(2001). Differential Regulation of Chemokine Gene Expression by 15-Deoxy-{{Delta}}12,1412,14 Prostaglandin J2. J. Immunol.
166: 7104-7111
[Abstract]
[Full Text]
-
Wang, C., Fu, M., D'Amico, M., Albanese, C., Zhou, J.-N., Brownlee, M., Lisanti, M. P., Chatterjee, V. K. K., Lazar, M. A., Pestell, R. G.
(2001). Inhibition of Cellular Proliferation through I{kappa}B Kinase-Independent and Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Repression of Cyclin D1. Mol. Cell. Biol.
21: 3057-3070
[Abstract]
[Full Text]
-
Equils, O., Faure, E., Thomas, L., Bulut, Y., Trushin, S., Arditi, M.
(2001). Bacterial Lipopolysaccharide Activates HIV Long Terminal Repeat Through Toll-Like Receptor 4. J. Immunol.
166: 2342-2347
[Abstract]
[Full Text]
-
Hortelano, S., Castrillo, A., Alvarez, A. M., Bosca, L.
(2000). Contribution of Cyclopentenone Prostaglandins to the Resolution of Inflammation Through the Potentiation of Apoptosis in Activated Macrophages. J. Immunol.
165: 6525-6531
[Abstract]
[Full Text]
-
Rosen, E. D., Walkey, C. J., Puigserver, P., Spiegelman, B. M.
(2000). Transcriptional regulation of adipogenesis. Genes Dev.
14: 1293-1307
[Full Text]
-
Miyahara, T., Schrum, L., Rippe, R., Xiong, S., Yee, H. F. Jr., Motomura, K., Anania, F. A., Willson, T. M., Tsukamoto, H.
(2000). Peroxisome Proliferator-activated Receptors and Hepatic Stellate Cell Activation. J. Biol. Chem.
275: 35715-35722
[Abstract]
[Full Text]
-
Castrillo, A., de las Heras, B., Hortelano, S., Rodriguez, B., Villar, A., Bosca, L.
(2001). Inhibition of the Nuclear Factor kappa B (NF-kappa B) Pathway by Tetracyclic Kaurene Diterpenes in Macrophages. SPECIFIC EFFECTS ON NF-kappa B-INDUCING KINASE ACTIVITY AND ON THE COORDINATE ACTIVATION OF ERK AND p38 MAPK. J. Biol. Chem.
276: 15854-15860
[Abstract]
[Full Text]
-
Ji, C., Kozak, K. R., Marnett, L. J.
(2001). Ikappa B Kinase, a Molecular Target for Inhibition by 4-Hydroxy-2-nonenal. J. Biol. Chem.
276: 18223-18228
[Abstract]
[Full Text]
-
Li, L., Tao, J., Davaille, J., Feral, C., Mallat, A., Rieusset, J., Vidal, H., Lotersztajn, S.
(2001). 15-Deoxy-Delta 12,14-prostaglandin J2 Induces Apoptosis of Human Hepatic Myofibroblasts. A PATHWAY INVOLVING OXIDATIVE STRESS INDEPENDENTLY OF PEROXISOME-PROLIFERATOR-ACTIVATED RECEPTORS. J. Biol. Chem.
276: 38152-38158
[Abstract]
[Full Text]
-
Castrillo, A., Mojena, M., Hortelano, S., Bosca, L.
(2001). Peroxisome Proliferator-activated Receptor-gamma -independent Inhibition of Macrophage Activation by the Non-thiazolidinedione Agonist L-796,449. COMPARISON WITH THE EFFECTS OF 15-DEOXY-Delta 12,14-PROSTAGLANDIN J2. J. Biol. Chem.
276: 34082-34088
[Abstract]
[Full Text]
-
Cernuda-Morollon, E., Pineda-Molina, E., Canada, F. J., Perez-Sala, D.
(2001). 15-Deoxy-Delta 12,14-prostaglandin J2 Inhibition of NF-kappa B-DNA Binding through Covalent Modification of the p50 Subunit. J. Biol. Chem.
276: 35530-35536
[Abstract]
[Full Text]