Previous Article | Next Article 
Molecular and Cellular Biology, March 2000, p. 1797-1815, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Arrest of G1-S Progression by the
p53-Inducible Gene PC3 Is Rb Dependent and Relies on the
Inhibition of Cyclin D1 Transcription
Daniele
Guardavaccaro,1,
Giuseppina
Corrente,1
Francesca
Covone,1
Laura
Micheli,1
Igea
D'Agnano,2
Giuseppe
Starace,3
Maurizia
Caruso,4 and
Felice
Tirone1,*
Istituto di
Neurobiologia,1 Istituto di Tecnologie
Biomediche,2 Istituto di Medicina
Sperimentale,3 and Istituto di
Biologia Cellulare,4 Consiglio Nazionale delle
Ricerche, 00137 Rome, Italy
Received 22 October 1999/Accepted 1 December 1999
 |
ABSTRACT |
The p53-inducible gene PC3 (TIS21, BTG2) is endowed
with antiproliferative activity. Here we report that expression of
PC3 in cycling cells induced accumulation of
hypophosphorylated, growth-inhibitory forms of pRb and led to
G1 arrest. This latter was not observed in cells with
genetic disruption of the Rb gene, indicating that the
PC3-mediated G1 arrest was Rb dependent.
Furthermore, (i) the arrest of G1-S transition exerted by
PC3 was completely rescued by coexpression of cyclin D1 but not by that
of cyclin A or E; (ii) expression of PC3 caused a
significant down-regulation of cyclin D1 protein levels, also in
Rb-defective cells, accompanied by inhibition of CDK4 activity in vivo;
and (iii) the removal from the PC3 molecule of residues 50 to 68, a
conserved domain of the PC3/BTG/Tob gene family, which we
term GR, led to a loss of the inhibition of proliferation as well as of
the down-regulation of cyclin D1 levels. These data point to cyclin D1
down-regulation as the main factor responsible for the growth
inhibition by PC3. Such an effect was associated with a decrease of
cyclin D1 transcript and of cyclin D1 promoter activity, whereas no
effect of PC3 was observed on cyclin D1 protein stability. Taken
together, these findings indicate that PC3 impairs G1-S
transition by inhibiting pRb function in consequence of a reduction of
cyclin D1 levels and that PC3 acts, either directly or indirectly, as a
transcriptional regulator of cyclin D1.
 |
INTRODUCTION |
The control of the cell cycle plays
an essential role in cell growth and in the activation of important
cellular processes such as differentiation and apoptosis. pRb
(retinoblastoma protein) and p53 are two molecules identified as key
regulators of the cell cycle.
pRb is a nuclear phosphoprotein whose phosphorylation state oscillates
regularly during the cell cycle. Its underphosphorylated forms
predominate in G0 and G1, while highly
phosphorylated forms exist in S, G2, and M phases (13,
16, 21). The primary biological function of underphosphorylated
pRb is to inhibit progression toward S phase by controlling a
checkpoint in late G1 (for reviews, see references
8, 22, and 51). In fact,
underphosphorylated pRb associates with members of the E2F family of
transcription factors, impairing their activity and leading to a cell
cycle block in G1. Conversely, the phosphorylation of pRb
inactivates its growth suppression activity by freeing E2F molecules,
thus enabling them to transactivate genes required for the progression of the cell into S phase and the remainder of the cell cycle (52, 97, 114).
Cyclin-dependent kinases (CDKs) are the molecules responsible for pRb
phosphorylation and its consequent inactivation (reviewed in references
70 and 102). Each CDK has its own
functional specificity, based on the period of its activity during the
cell cycle and on the specific cyclin partner. CDK4, CDK5, and CDK6 form complexes with D-type cyclins during the G1 phase
(65, 69, 116). CDK2, when bound to cyclin A or E, is instead
essential for G1-to-S transition (28, 78), while
the cdc2 kinase, associated with cyclins A and B, determines the
G2/M transition (78, 82, 90). Interestingly, the
expression of D-type cyclins and also their assembly with their CDK
partners are heavily dependent on stimulation by growth factors
(101, 102). If stimulation by growth factor(s) ceases, the
level of D-type cyclins decreases rapidly, their half-life being short,
with a consequent impairment of S-phase entry (7, 87). Since
cells lacking a functional Rb gene become independent from D-type
cyclins for G1/S progression, this clearly indicates that
pRb is the final target (61, 107).
A further level of control in the function of the pRb pathway is
exerted by the CDK inhibitors (reviewed in reference
103). These are represented by two families of
molecules, the INK4 family (comprising p16INK4a,
p15INK4b, p18INK4c, and p19INK4c),
which causes G1 arrest by directly binding and
inhibiting the activation of CDK4 and CDK6 by D-type cyclins, and the
KIP/CIP family, which includes p27Kip1 and
p21CIP1/WAF1. This latter was identified as a potent
inhibitor of all known cyclin-CDK complexes (39, 42, 115).
Besides regulating cell cycle progression, the G1
checkpoint function of pRb can mediate exit from the cell cycle in
response to growth-inhibitory signals or differentiation inducers.
These signals in fact activate the pRb growth suppression function by preventing its phosphorylation, thus allowing the cell to attain the
postmitotic state, an essential preliminary requirement for terminal
differentiation of many cell types (for reviews, see references
44 and 91). A critical role of
pRb in the control of differentiation and survival of several cell
lineages, such as neurons, lens fiber cells, cells from the cerebellar
cortex, and muscle and hematopoietic cells, is clearly indicated by the phenotype of the Rb-deficient mouse (53, 54, 74, 119). Furthermore, pRb enhances the activities of transcription factors such
as MyoD and C/EBPs in promoting muscle and adipocyte terminal differentiation, respectively (14, 15, 38, 77).
The G1 checkpoint regulatory pathway also responds to
stressful situations and DNA damage. The p53 protein, which is
activated by different types of DNA damage, functions by arresting the
cell cycle in G1 to allow repair to take place (for
reviews, see references 4 and
56). p53 effects G1 arrest mainly by
inducing transcription of p21CIP1/WAF1, which inhibits
CDK's activity, thus preventing pRb phosphorylation (12, 24, 27,
112, 115). Alternatively, if the growth arrest program fails, p53
can activate an apoptotic program in the cell carrying the DNA damage
(4). Recently, the antiproliferative activity of p53 has
also been implicated in a G2/M-phase checkpoint that
controls the entry into mitosis (3).
In this context, the gene PC3, isolated by us (9)
and by others with the alternative names BTG2 (92) and TIS21
(32), plays a role. PC3 is in fact endowed with
antiproliferative activity and is induced by p53 (72, 92).
We originally isolated PC3 while studying the onset of neuronal
differentiation, induced in the rat PC12 cell line by nerve growth
factor within its first hour of activity (9, 108). The time
window chosen for our analysis of gene induction corresponds to the
period of transition between mitosis and growth arrest that serves as a
prelude to differentiation (36, 37, 95). The
antiproliferative properties displayed by PC3 are consistent with such
timing and are peculiar among the immediate-early genes induced by
nerve growth factor. Furthermore, PC3 was found to be a marker for
neuronal cell birthday (47). In fact, its mRNA expression
during embryonic development of the central nervous system is
restricted to the neuroblast undergoing the last proliferation before
differentiating into postmitotic neuron (47). This led us to
hypothesize that PC3 is involved in the growth arrest of the neuronal
precursors (47). However, the expression of PC3 during
development and in the adult animal is not limited to the nervous
system (9, 47). Accordingly, PC3 displayed an
antiproliferative effect in different cell types, such as fibroblasts
and PC12 cells (72). Such an antiproliferative effect was
afterwards confirmed by the work of Rouault et al. (92) for
the human counterpart of the PC3 gene, i.e., BTG2. Interestingly, the same group also showed that BTG2/PC3 is induced by
p53 and that embryonic stem cells in which BTG2/PC3 had been ablated,
underwent apoptosis following DNA damage because of failure in growth
arrest (92). These observations raise the question whether
PC3 may promote p53-induced cell cycle arrest, similarly to
p21CIP1/WAF1, the prototype inhibitor of CDKs. In this
regard, it has been recently pointed out that the ability of p53 to
arrest the cell cycle in G1 is only partially dependent on
the induction of p21CIP1/WAF1 (24).
After the cloning of PC3, other novel related antiproliferative genes
were isolated, namely, BTG1 (94), TOB (64), and ANA (118). These genes share 60, 40, and 35% sequence
homology with PC3, respectively. Interestingly, the homology
of Tob to the entire BTG1 and PC3 molecules is limited to its
amino-terminal domain, whereas its carboxyl-terminal domain interacts
with the mitogenic receptor p185erbB2
(64). Since no homology to known functional motifs is
evident in the cDNA-deduced proteins of these genes, it appears likely that PC3, BTG1, and Tob belong to a novel functional class of cell
cycle regulators, but the question about their specific molecular function remains open. In this regard, some suggestions came from a
recent report which showed that TIS21/BTG2 interacts with a protein-arginine N-methyltransferase (Prmt1) by positively
modulating its activity (58). Prmt1, in turn, has been found
to bind the interferon receptors and to be required for
interferon-mediated growth inhibition (2). A further
interaction was observed between BTG2 and the mCAF1 gene, i.e., the
mouse homolog of the yeast CAF/POP2 gene (93).
This latter gene is part of the yeast CCR4 multisubunit complex, which
is required for the transcriptional regulation of several genes
(59, 60).
This report describes our attempts to shed light on the molecular
mechanisms by which PC3 impinges on cell cycle activity. We observed
that the inhibition of cell cycle progression by PC3 requires
functional pRb, and we found the existence of a mutually exclusive
interaction between PC3 and cyclin D1. In fact, the latter blocked the
PC3 effects on the cell cycle, whereas PC3 inhibited cyclin D1 expression.
 |
MATERIALS AND METHODS |
Cell culture, cell lines, and transfections.
NIH 3T3 and
Rb
/
3T3 cells and cyclin D1+/+ and cyclin
D1
/
mouse embryo fibroblasts (MEFs) were cultured in
Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf
serum (HyClone, Logan, Utah) in a humidified atmosphere of 5%
CO2 at 37°C.
Transfection of the plasmids was performed by the liposome technique
using the Lipofectamine reagent (Life Technologies, Gaithersburg, Md.)
as per the manufacturer's instructions. The indicated amount of DNA
(see figure legends), diluted in Optimem containing Lipofectamine (5 or
30 µl for 35- or 90-mm-diameter dishes, respectively), was added to
the cultures, left to incubate for 5 h, and then replaced with
normal DMEM. In the experiments aimed at defining the influence of PC3
on the phosphorylation state of pRb in NIH 3T3 cells and to carry out
cell sorting, the calcium phosphate procedure was used (34).
To the cell cultures were added the indicated amounts of DNA in calcium
phosphate solution (0.5 ml for a 60-mm-diameter dish). Cells were
exposed to the DNA precipitates for 20 h, washed twice with
phosphate-buffered saline (PBS), and then placed in their medium for an
additional 40 h. At the end of this period, cell cultures were
used for the procedures indicated.
Plasmids, PC3 expression vectors, and mutants.
The
expression vector pSCT was from B. Schäfer (33), who
obtained it by adding an artificial polylinker to the vector pSCT GAL
556X (96). pSCT-
-Gal was produced by inserting, in the BamHI site of the pSCT vector, the Escherichia
coli
-galactosidase (
-Gal) gene, excised from the vector
pCMV
(Clontech, Palo Alto, Calif.) as a NotI fragment,
whose ends were previously ligated to BamHI linkers. Human
pRb was expressed by the construct pCMV-pRB1, obtained by D. Livingston
(85) by inserting Rb cDNA into the pCMVneoBam vector
(6). The different constructs expressing cyclins
(pRcCMV-cycA, pRcCMV-cycB1, pRcCMV-cycB2, pRcCMV-cycD1, pRcCMV-cycD3, and pRcCMV-cycE; obtained by R. Weinberg [see reference 45]) and CDKs (CMVcdc2, pRcCMV-CDK2, and
pRcCMV-CDK4; obtained by E. Harlow [see reference
110] and by D. Livingston [see reference 29]) were all in cytomegalovirus (CMV)
promoter-driven plasmids. The expression vectors for human
p16INK4a (pXp16 [99]) and mouse
p27Kip1 (pCMX-p27) were gifts of D. Beach and J. Massaguè, respectively.
pSCT-PC3 was constructed by cloning into the pSCT vector the coding
region of PC3 cDNA (nucleotides 65 to 541, with the stop
codon),
amplified by PCR using primers that incorporated 5'
XbaI
and
3'
HindIII sites, and confirmed by sequencing. The
pSCT-PC3
constructs having a deletion internal to the coding region
were
generated by cloning in the pSCT vector two fragments amplified
by
PCR corresponding to the PC3 regions upstream and downstream
of the
deleted region, joined by a
PstI site in frame. The PCR
primers used were as follows: (a) mutant PC3

50-68;
5'CTCGAG
TCTAGAGCACCGGGCCCGCCACC
ATGAGCCACGGGAAGAGA3'
(PC3-PCR3, upstream sense primer containing a flanking 5'
XbaI
site [underlined] and the PC3 initiator codon
[underlined]), 5'CGCTGCAG
ATGATCGGTCAGTGCGTC3'
(downstream antisense primer complementary to PC3 sequence
corresponding
to amino acids [aa] 44 to 49 [underlined] and flanked
by a 3'
PstI site),
5'GGCTGCAG
CGCATCAACCACAAGATG3' (upstream sense
primer
complementary to PC3 sequence corresponding to aa 69 to 74 [underlined]
and flanked by a 3'
PstI site), and
5'GGAAGATCTATCGAT
AAGCTTGAATTCTCCTCT
CTAGCTGGAGAC3'
(PC3-PCR4, downstream antisense primer containing a flanking 5'
HindIII site [underlined] and the PC3 termination
codon [CTA in
the antisense strand, underlined]); and (b) mutant
PC3

105-123;
PC3-PCR3 primer,
5'CGCTGCAG
GACCCACAGGGTCAGCT3' (downstream
antisense
primer complementary to PC3 sequence corresponding to aa 99 to
104 [underlined] and flanked by a 3'
PstI site),
5'GGCTGCAG
GAGGAGGCGCCGGTGGC3'
(upstream sense
primer complementary to PC3 sequence corresponding
to aa 124 to 129 [underlined] and flanked by a 3'
PstI site),
and a
PC3-PCR4 primer. The pSCT-PC3 S147N mutant, bearing a point
mutation at
nucleotide 504 that mutates serine 147 to asparagine,
was produced by
cloning in the pSCT vector the insert amplified
by PCR with primers
that incorporated 5'
XbaI and 3'
SalI sites:
5 ' GAG
TC TAGAGAAT TCGCACCGGGCCCGCCACC
ATGAGCCACGGGAAGAGA3'
(upstream
sense primer containing flanking 5'
XbaI and
EcoRI sites [underlined]
and the PC3 initiator codon
[underlined]) and
5'CGAT
GTCGACC TAGC
TGGAGACAG TCATCACG TAGTTC T TCGATGGA
T TGC TCCT3'
(downstream antisense
primer containing a flanking 5'
SalI site [underlined], the PC3
termination codon [CTA in
the antisense strand, 3' to
SalI site],
and the mutated
nucleotide [underlined]). The corresponding construct
pGEX-PC3 S147N
was obtained by restricting pSCT-PC3 S147N in
SalI,
blunting
and adding
EcoRI linkers, and then subcloning the insert
excised by
EcoRI from pSCT-PC3 S147N in frame in the
EcoRI site
of the pGEX-2T vector. All the constructs
obtained were checked
by sequencing. The production of a protein was
verified by immunoblotting
and by immunofluorescence staining with the
anti-PC3 A3H polyclonal
antibody (
72), by which no
differences in the efficiency of
expression of the different constructs
were
detected.
The retroviral vector pBABE puro, a Moloney murine leukemia virus-based
vector carrying the puromycin resistance gene (
75),
was used
for infection of cell cultures. To obtain the pBABE puro-PC3
construct,
the PC3 coding region was subcloned into the
BamHI
site of
pBABE puro, after amplification by PCR using the primers
5'GAGAGATCTGCACCGGGCCCGCCACCATGAGCCACGGGAAGAGA3' as upstream
sense
primer (carrying a
BglII site) and PC3-PCR4 as
downstream antisense
primer (see above). The construct was confirmed by
sequencing.
Flow cytometry assays and cell sorting.
NIH 3T3 or
Rb
/
3T3 cells cotransfected with pSCT-PC3 or pXp16 and
with the CD20 cDNA (pCMVCD20; see reference 122)
were washed in PBS-EDTA (5 mM) and then incubated in PBS-EDTA (5 mM)
for 10 min at 37°C, harvested, and pelleted. The cell number at the
moment of harvesting was about 106 cells in a
90-mm-diameter dish. The cell pellet was then resuspended in DMEM,
centrifuged, and resuspended again in 100 µl of DMEM containing
fluorescein isothiocyanate (FITC)-conjugated mouse monoclonal anti-CD20
antibody (Caltag Laboratories, San Francisco, Calif.) to a final
concentration of 40 µg/ml. Cells were incubated for 1 h at 4°C
and then pelleted and washed once in DMEM, to be finally resuspended in PBS.
Then, the cell suspension either was analyzed for cell cycle phase
distribution or was sorted for Western blot analysis and
for reverse
transcriptase PCR (RT-PCR) analysis, using an EPICS
541 flow cytometer
(Coulter Electronics, Inc.). For cell cycle
analysis, the CD20-stained
cells were fixed in 70% ethanol and
stained with propidium iodide (50 µg/ml; Sigma Chemical Co.) in
PBS containing RNase A (75 kU/ml; Sigma
Chemical Co.). Two-color
flow cytometry was performed, simultaneously
measuring FITC (green
channel) and propidium iodide (red channel)
fluorescence intensities.
The total population was gated on scatter
parameters to remove
cell debris. The gates to analyze cell cycle
distribution of CD20-PC3-expressing
cells were established by measuring
background levels of FITC
fluorescence, by use of vector-transfected
cells incubated with
a nonspecific immunoglobulin G FITC-conjugated
antibody (Caltag
Laboratories). DNA histograms were analyzed by a
suitable mathematical
model (
20) to estimate the percentage
of cells in the various
compartments of the cell cycle. For Western
blot analysis or for
RT-PCR analysis, transfected cells were sorted on
the basis of
the FITC-CD20 positivity and, immediately thereafter,
lysed in
Laemmli buffer with protease inhibitors or homogenized in 4 M
guanidine thiocyanate followed by extraction with phenol-chloroform
(
18), respectively. An aliquot of the Laemmli lysate was
analyzed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE),
whereas an aliquot of total RNA was used for RT-PCR
analysis.
Immunofluorescence staining and antibodies.
Transfected
cells, grown on polylysine-coated coverslips, were washed three times
with PBS and fixed for 20 min at room temperature in PBS containing
3.75% paraformaldehyde. The coverslips were then washed three times in
PBS and incubated for 2 min in 0.1 M glycine-PBS. Permeabilization was
performed with 0.1% Triton X-100 in PBS for 6 min at room temperature.
After a PBS wash, the cells were incubated for 60 min at room
temperature with one primary antibody, or two where indicated, diluted
in PBS. A3H rabbit polyclonal antibody (obtained using the whole PC3
protein as immunogen and affinity purified as described in reference
72) was diluted 1:50, anti-
-Gal rabbit polyclonal
antibody (Chemicon International, Inc., Temecula, Calif.) was diluted
1:50, and antibromodeoxyuridine (BrdU) mouse monoclonal antibody
(Amersham, Little Chalfont, England) was used undiluted, whereas
affinity-purified rabbit polyclonal antibodies anti-cyclin A (C19;
Santa Cruz Biotechnology, Heidelberg, Germany) and anti-cyclin E (M-20;
Santa Cruz Biotechnology), as well as anti-cyclin D1 mouse monoclonal
antibody 72-13G specific for rodent cyclin D1 (Santa Cruz
Biotechnology; see reference 66), were used at a
final concentration of 2 µg/ml. After three washes in PBS, the cells
were incubated for 30 min at room temperature with the secondary
antibody(ies), either FITC conjugated (Myles-Yeda, Rehovot, Israel) or
TRITC (tetramethylrhodamine isothiocyanate) conjugated (Sigma
Chemicals), and then washed three times with PBS. Cells were finally
mounted with PBS-glycerol (3:1). The immunofluorescence assay was
performed on a Leitz Dialux 22 microscope.
DNA synthesis assays were performed by adding 50 µM BrdU to the
culture medium 24 to 18 h before fixation. To detect BrdU,
DNA
denaturation was obtained by adding 50 mM NaOH for 10 s after
permeabilization with 0.1% Triton X-100 and was followed by three
PBS
washes. BrdU was detected by undiluted anti-BrdU monoclonal
antibody
(Amersham RPN 202) added together with the other primary
antibody as
described above, followed by FITC-conjugated goat
antibody to mouse
immunoglobulin G (Sigma F9006). To detect nuclei,
cells were incubated
at the end of the immunofluorescence staining
procedure for 2 min in
Hoechst 33258 dye diluted in PBS at 1 µg/ml
(Sigma), washed twice in
PBS, and mounted as described
above.
Immunoblotting analysis and antibodies.
Transfected cell
cultures (after cell sorting where indicated) were lysed into Laemmli
buffer (125 mM Tris-HCl [pH 6.8], 10% glycerol, 2.1% SDS)
containing 0.5 M
-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 µg of leupeptin per ml, and 10 µg of aprotinin per ml and heated for 5 min at 100°C. An aliquot was analyzed by
SDS-10% PAGE. After electrophoresis, proteins were
electrophoretically transferred to nitrocellulose (12 to 16 h at
65 mA in 24 mM Tris-HCl [pH 8.3]-166 mM glycine-20% methanol). The
filters were then soaked for 2 h in blocking buffer (TBS [10 mM
Tris HCl (pH 8), 150 mM NaCl]-0.05% Tween-5% powdered milk) and
then incubated in the same buffer for 2 h with the first antibody.
This latter was one of the following: the anti-PC3 affinity-purified
rabbit polyclonal A3H antibody (diluted 1:1,000); the affinity-purified
rabbit polyclonal antibody anti-cyclin A (sc-596), anti-cyclin E
(sc-481), anti-cdc2 (sc-53), anti-CDK2 (sc-163), or anti-CDK4 (sc-260);
the mouse monoclonal antibody anti-cyclin D1 72-13G specific for rodent cyclin D1 (all from Santa Cruz Biotechnology, diluted 1:200); and the
mouse monoclonal antibody anti-
-actin (clone AC-15, diluted 1:5,000;
Sigma Chemical). After three washes in TBS with 0.05% Tween, the
filter was incubated in blocking buffer containing the second antibody
(either goat anti-rabbit or goat anti-mouse horseradish
peroxidase-conjugated antibody; Pierce, Rockford, Ill.). After three
washes in TBS with 0.05% Tween, detection of the second antibody was
performed by chemiluminescent assay. Anti-pRb immunoblotting was
performed with the G3-245 monoclonal antibody (Pharmingen, San Diego,
Calif.; diluted to a final concentration of 1 µg/ml) used as
described above, with the only differences being that SDS-PAGE had 7%
polyacrylamide and blocking buffer contained 0.4% gelatin in place of
powdered milk. The intensity of the bands of the immunoblots was
quantified by an EPA 3000 densitometer (Sanwatsusho, Tokyo, Japan) in
the linear range of the film. The intensity values of the sample were
normalized to the corresponding values of
-actin.
RNA extraction and RT-PCR assay.
Total cellular RNA was
obtained from sorted cells according to the procedure of Chomczynski
and Sacchi (18) (see above) and was analyzed by
semiquantitative RT-PCR as previously described (72). Four
micrograms of total RNA was treated with DNase (RQ1; Promega; 2 U) and
then denatured at 75°C for 5 min and added to a total reaction volume
of 50 µl containing 1× RT buffer (10 mM Tris-HCl [pH 8.8], 50 mM
KCl, 0.1% Triton X-100), 5 mM MgCl2, 0.5 mM (each)
deoxynucleoside triphosphate, 1 U of RNasin (Promega), and 600 pmol of
random hexamer primers. Moloney murine leukemia virus RT (200 U;
Promega) was added to one-half reaction volume (25 µl) and incubated
for 2 h at 37°C (the remaining reaction volume without RT was
kept to be used as a control in PCR amplifications for possible
contamination of the sample with genomic DNA). RT reaction mixtures
were stored at
20°C and then used for PCR amplification. Two
microliters of each RT reaction mixture was amplified in a 100-µl PCR
mixture containing 1× PCR buffer (10 mM Tris-HCl [pH 9] at 25°C,
50 mM KCl, 0.1% Triton X-100), 0.2 mM (each) deoxynucleoside triphosphate, 1.5 mM MgCl2, 20 pmol of each primer (see
below), and 2 U of Taq polymerase (Promega). The number of
cycles was designed so as to maintain the reactions of amplification in
exponential phase (20 cycles for
-actin and 35 cycles for all the
other templates). Coamplification of
-actin mRNA gave a measure of
the efficiency of the reaction and of the starting RNA amount in each
sample, since
-actin is constitutively expressed in the cell lines
used. Amplification profiles were the following: denaturation at 95°C for 5 min during the first cycle or at 94°C for 1 min in the
remaining cycles, primer annealing at 50°C (for
-actin, cyclin A,
and PC3; at 52°C for cyclins D1 and E) for 1 min, and primer
extension at 72°C for 1.5 min. About 1/10 of the PCR sample was
electrophoresed on a 1.2% agarose gel, blotted onto a nylon filter,
and hybridized to 32P-labeled specific oligonucleotides
(whose sequence was internal to the region amplified by PCR): (a)
cyclin A (5'-CAGAGTGTGAAGATGCCCTGG-3'), (b) cyclin D1
(5'-CCATGCTCAAGACGGAGGAGA-3'), (c) cyclin E
(5'-GGCGAGGATGAGAGCAGTTCT-3'), (d) PC3
(5'-CCGTAGGTTTCCTCACCAGTC-3'), and (e)
-actin
(5'-CAGCTGAGAGGGAAATCGTGC-3'). The relative product amounts
were quantitated by analysis with a Molecular Dynamics 400A
PhosphorImager system. The PCR primers used were as follows: (a) cyclin
A, 5' (5'-TGCTCCTCTTAAGGACCTT-3') and 3'
(5'-TCAGAACCTGCTTCTTGGA-3'); (b) cyclin D1, 5'
(5'-ACACCAATCTCCTCAACGA-3') and 3'
(5'-TAGCAGGAGAGGAAGTTGT-3'); (c) cyclin E, 5'
(5'-GAAAATCAGACCACCCAGA-3') and 3'
(5'-ATACAAAGCAGAAGCAGCG-3'); (d) PC3, 5'
(5'-ATGAGCCACGGGAAGAGA-3') and 3' (5'-CCTGAAGTTC
TCAGCTCT-3') (this latter primer is reverse complementary to the
pSCT polylinker in the region 3' of the cloning site of PC3, and thus
the PC3-amplified product derives only from the PC3 exogenous
transcript); and (e)
-actin, 5' (5'-TTGAGACCTTCAACACCC-3') and 3' (5'-GCAGCTCATAGCTCTTCT-3'). All the
oligonucleotides except those for PC3 were from mouse cDNA sequences.
Reporter gene assay.
NIH 3T3 cell cultures were transfected
with the indicated PC3 or E2F-1 expression constructs. The variations
in the amounts of expression vectors were completely compensated for by
addition of the corresponding empty DNA plasmid vectors. Transfection
of the expression construct cDNAs was performed in parallel with the
positive-control simian virus 40 promoter-driven pGL2 control plasmid
(Promega). Luciferase activity of each sample
(Li) was corrected for differences in
transfection by normalization, measuring the amount of plasmid DNA
present in each extract of the transfected cells
(Di), as determined by dot blot hybridization
according to a previously described procedure (1). Plasmid
DNA was visualized using as a probe a 3-kb
BamHI-SmaI fragment from the noncoding region of
vector pGL2, to avoid possible interactions with RNA. The formula used
was luciferase activity normalized = Li × Dm/Di, where Dm is
the average value for each experiment. The fold activity was then
obtained by dividing each normalized value of luciferase activity by
the average number of normalized luciferase units of the corresponding
control culture.
Metabolic labeling and immunoprecipitation.
NIH 3T3 cultures
transfected with Flag-tagged cyclin D1 construct (kindly provided by C. Sherr [26]) were washed twice in DMEM without
methionine, preincubated in the same medium for an hour, and then
labeled by incubation in methionine-free DMEM containing Pro-mix35S (0.15 mCi of [35S]methionine per
ml) for 2 h. Afterwards, cultures were washed twice in DMEM with
an excess of cold methionine, incubated in the same medium for the
indicated time periods, and lysed by 30 min of incubation at 4°C in
ice-cold lysis buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, and 150 mM
NaCl, containing 1% Triton X-100, 5 µg of leupeptin per ml, 5 µg
of aprotinin per ml, and 1 mM PMSF). After clearing by centrifugation
at 10,000 × g for 15 min, extracts were assayed for protein
concentration (10); 500-µg aliquots were then precleared
using a rabbit preimmune serum and protein G-Sepharose (Amersham
Pharmacia Biotech) for 1 h at 4°C. After centrifugation at
12,000 × g, the supernatants were incubated with
protein G-Sepharose with the anti-Flag M2 mouse monoclonal antibody
(Sigma; F3165; 3 µg per sample) for 2 h at 4°C. The
immunocomplexes were washed three times in lysis buffer and then
resuspended in Laemmli buffer containing protease inhibitors, heat
denatured, and run on SDS-polyacrylamide gels.
Production and purification of GST fusion proteins.
The
vector pGEX-2T-PC3 was obtained by subcloning in frame into pGEX-2T the
coding region of PC3, excised as a 5' BamHI-3' EcoRI PCR-amplified fragment from the vector pRSETA-PC3, in
which it had been previously cloned. The restriction reaction for the site BamHI was partial, given the existence of a
BamHI site internal to PC3. The construct was checked by
sequence analysis. Human pGEX-p21 and pGEX-p16 were from Y. Xiong.
pGEX-PC3 S147N was obtained as described above. The fusion proteins,
after lysis of the bacterial pellet in PBS with 0.5% NP-40, were
purified through glutathione S-transferase (GST)-Sepharose
beads (Pharmacia) and eluted per the manufacturer's instructions. The
proteins were stored at
80°C until use, either bound to
GST-Sepharose beads (for in vitro binding assays) or in elution buffer
(for in vitro kinase assays; 30 mM reduced glutathione, 60 mM HEPES
[pH 7.5], 30 µg of leupeptin per ml, 1 mM PMSF) at a concentration
of about 0.3 µg/µl at
80°C until use.
In vitro binding assays.
Expression and purification of GST
fusion proteins were performed as described above. Mouse pCMV-cdc2
(110), human pRcCMV-CDK2 and pRcCMV-CDK4 (29),
and human pBSK-glob-CDK6 (68) were transcribed and
translated in vitro using 35 µl of nuclease-treated rabbit reticulocyte lysate (Promega) as described elsewhere (41).
The programmed lysates (1.5 µl) were incubated with GST, GST-PC3, GST-p16, or GST-p21 beads (20 µl, carrying about 15 µg of bound protein) for 2 h at 4°C. The beads were washed five times with 20 volumes of NET-N buffer (20 mM Tris-HCl [pH 8], 100 mM NaCl, 1 mM
EDTA, 0.5% Nonidet P-40, 0.5% nonfat dry milk containing 10 µg of
leupeptin per ml, 1 mM PMSF) and then mixed with 1 volume of 2× SDS
loading buffer. Bound proteins were analyzed by SDS-PAGE.
Production of cyclins and CDKs in insect cells.
Baculoviruses expressing His-tagged cyclin A, His-tagged cyclin B1,
hemagglutinin-tagged cdc2, and hemagglutinin-tagged CDK2 were provided
by D. Morgan (25), while cyclin D1 and CDK4 were provided by
C. Sherr (49). In the preparation of insect lysates (essentially as described in reference 115),
2.5 × 106 Sf9 cells were infected with the indicated
cyclin and/or CDK viruses at a multiplicity of infection of 10. After
40 h, cells were lysed in 0.4 ml of kinase buffer (see below) by
five passages through a 26-gauge needle and used for kinase assays. The
cell lysates were then cleared of insoluble material by two
centrifugations at 10,000 × g and stored at
80°C
or directly used for kinase assays.
Retroviral infections.
High-titered retroviral supernatants
(about 1 × 106 to 5 × 106 virus/ml)
were generated by transient transfection with calcium phosphate of
either pBABE puro vector as a control or pBABE puro-PC3, in the
helper-free packaging cell line BOSC23, according to a procedure
described elsewhere (80). The supernatants were then used to
infect NIH 3T3 cells according to a protocol described elsewhere
(111). Briefly, cell cultures (4 × 105
cells for each 90-mm-diameter dish) were infected for 5 h and then
replated and exposed for 48 h to puromycin (2 µg/ml). This procedure allowed us to obtain a pure culture of cells expressing the
retroviral constructs, given that all noninfected cells detached from
the plate. The cultures at the moment of harvesting were subconfluent.
Cells were divided into aliquots, either in lysis buffer for kinase
assays (used immediately; see below) and Western blotting or in PBS for
cell cycle profile analysis (used after fixation).
Kinase assays.
Kinase assays were performed basically as
described by Toyoshima and Hunter (109). For the assays of
CDK activities in vitro using the baculovirus system, to the lysate of
Sf9 cells (in kinase buffer: 50 mM HEPES [pH 7.4], 10 mM
MgCl2, 2.5 mM EGTA, 1 mM dithiothreitol [DTT], 10 mM
-glycerophosphate, 0.1 mM Na3VO4, 1 mM NaF,
1 mM PMSF, 10 µg of leupeptin per ml, 5 µg of aprotinin per ml)
coinfected with CDKs and cyclins (2 to 16 µl) was added either
GST-PC3, GST-p21, or GST-p16 (5 to 1,600 ng, as indicated), and the
mixtures were incubated at 30°C for 20 min. Reactions were started by
adding 250 ng of GST-Rb (769-921) fusion protein (Santa Cruz
Biotechnology) as substrate, 25 µM ATP, and 5 µCi of
[
-32P]ATP (6,000 Ci/mmol; Amersham), and reaction
mixtures were incubated for 10 min at 30°C. Differences in the
volumes of baculovirus lysates were compensated for by addition of
wild-type baculovirus lysate, in order to attain a final reaction
volume of 20 µl. Reactions were then terminated by adding 200 µl of
stop buffer (50 mM Tris HCl [pH 8.0], 150 mM NaCl, 20 mM EDTA, 1 mM
EGTA, 10% glycerol), also containing glutathione-Sepharose beads
(Pharmacia) in order to recover GST-pRb, and incubating the mixture for
1 h at 4°C. The GST-Rb protein bound to glutathione-Sepharose
beads was then washed twice in stop buffer, eluted by addition of
sample buffer, and analyzed by SDS-10% PAGE. 32P-labeled
proteins were detected by autoradiography. For analysis of the
phosphorylation of PC3 by cyclin A-CDK2, the substrates used were
either 800 ng of GST-PC3 S147N, GST-PC3, or GST or 250 ng of GST-Rb.
For the assays of CDK activities in vivo on retrovirus-transduced NIH
3T3 cells, infected cultures were lysed by resuspension
in lysis buffer
(50 mM HEPES [pH 7.5], 200 mM NaCl, 1 mM EDTA,
2.5 mM EGTA, 1 mM DTT,
0.1% Tween 20, 10% glycerol, 0.1 mM sodium
orthovanadate, 1 mM NaF, 1 mM PMSF, 10 µg of leupeptin per ml,
5 µg of aprotinin per ml, 10 mM

-glycerophosphate) for 30 min
at 4°C, followed by four cycles of
5 s of sonication at low power
and clearing by centrifugation at
14,000 rpm for 5 min at 4°C.
Supernatants were assayed for protein
concentration as described
elsewhere (
10). Protein samples
of 0.5 mg (CDK2 assay) or 2
mg (CDK4 assay) were then precleared with
rabbit immunoglobulin
G and then immunoprecipitated for 2 to 4 h
at 4°C with protein
A-Sepharose beads (Amersham Pharmacia Biotech)
precoated with
saturating amounts of the appropriate antibody (5 µg
of either
sc-163 or sc-260, respectively; anti-CDK2 or anti-CDK4 from
Santa
Cruz; 1 h of preincubation at 4°C). Immunoprecipitated
proteins
on beads were washed twice with 1 ml of lysis buffer and twice
with 1 ml of wash buffer (50 mM HEPES [pH 7.5], 1 mM DTT, 10 mM
MgCl
2, plus the protease inhibitors as described above).
The beads
were resuspended in 50 µl of kinase buffer (see above)
containing
2 µg of GST-pRb (769-921) fusion protein (Santa Cruz
Biotechnology,
Inc.), 20 µM ATP, and 10 µCi of
[

-
32P]ATP (NEN Dupont, Boston, Mass.; 6,000 Ci/mmol).
After incubation
for 30 min at 30°C, the samples were boiled in 2×
Laemmli buffer,
separated by SDS-PAGE, and transferred to a
nitrocellulose filter.
Phosphorylated proteins were visualized and
quantitated by densitometry
using a Molecular Dynamics 400A
PhosphorImager
system.
Colony formation assay.
The colony formation assay was used
to measure the growth inhibition by the PC3 mutants and was performed
on NIH 3T3 cells according to the procedure previously described
(72). NIH 3T3 cells (2.3 × 105) were
plated into 60-mm-diameter dishes and after 24 h transfected by
the Lipofectamine procedure with pSCT-PC3 (3.8 µg), either wild type
or mutated, or with the empty vector pSCT (3.8 µg), together with the
vector carrying the neomycin resistance gene (pcDNA3; 0.5 µg). After
48 h, two aliquots of each culture were split into 90-mm-diameter
dishes (2 × 105 and 1 × 105 cells)
and grown in medium containing G418 (0.5 mg/ml), to allow resistant
cells to form colonies. A third aliquot (6 × 105
cells) was lysed and used for Western blotting, to measure the expression of the PC3 construct used. The cutoff point for colony size
was >20 cells/colony. Percentages of growth inhibition were calculated
with the formula pi = ci × 100/vi, where ci is
the number of colonies in the dish transfected in experiment
(i) with the indicated mutant, and vi
is the number of colonies in the dish transfected in the same
experiment (i) with the empty vector. Statistical analysis
was performed on the original raw number of colonies, comparing the
ci with the vi values of
all the experiments by Student's t test.
 |
RESULTS |
PC3 overexpression leads to pRb hypophosphorylation.
We have
previously shown that PC3, when overexpressed, inhibits proliferation,
leading to an impairment of the G1/S transition, concomitantly with dephosphorylation of pRb (72). Since the growth-inhibitory activity of pRb is regulated by phosphorylation (13, 16), these findings suggested that PC3 exerts its
antiproliferative activity by preventing pRb phosphorylation. Given
that our observations were for NIH 3T3 cell clones stably expressing
exogenous PC3, in which secondary mutational events might have
occurred during the selection procedure, we sought to evaluate
the effect of PC3 on pRb phosphorylation in transiently transfected
cells. Therefore, asynchronously growing NIH 3T3 mouse fibroblasts,
which do not express detectable levels of endogenous PC3
(72), were cotransfected with expression vectors for pRb and
PC3. As a positive control, the pRb expression construct was
alternatively cotransfected with the dominant interfering Ras mutant
RasAsn17 (Fig. 1A). This
mutant induces disruption of Ras function, resulting in G1
cell cycle arrest and pRb dephosphorylation (30, 81). Transfected cells were harvested 60 h posttransfection, and cell lysates were analyzed for pRb expression and phosphorylation state by
Western blotting. We observed that the ectopic expression of pRb alone
was detected as a single band of 115,000 in Mr,
corresponding to the hyperphosphorylated (inactive) form (13,
16), while coexpression of pRb with PC3 led to the appearance
also of the 105,000-Mr band, corresponding to
the hypophosphorylated (active) form of pRb (Fig. 1A). In the presence
of RasAsn17, pRb was almost totally detected as a
105,000-Mr singlet.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Induction of pRb dephosphorylation by PC3 and its
reversal by cyclins. (A) Ectopic expression of PC3 leads to
dephosphorylation of pRb. NIH 3T3 cells (1.3 × 105)
were seeded onto 60-mm-diameter dishes. After 24 h, cells were
transfected with the human Rb expression plasmid pCMVpRb (4.5 µg)
together with the pSCT (VEC), pSCT-PC3 (PC3), or
pRSVRasAsn17 (Ras N17) expression vector (4.5 µg each),
as indicated. Control cells without transfected plasmids were also
analyzed (NT). After 60 h, cells were lysed in Laemmli buffer and
pRb was detected by Western blotting using the G3-245 monoclonal
antibody. (B) Reversal by cyclins of the PC3-mediated pRb
dephosphorylation. NIH 3T3 cells (1.3 × 105) were
seeded onto 60-mm-diameter dishes. After 24 h, cells were
transfected with pCMVpRb (4.5 µg) together with expression vectors
for PC3, cyclins, or cyclin-dependent kinases (4.5 µg each), as
indicated. In transfections where Rb or PC3 expression constructs were
absent, a corresponding amount of the empty vectors (4.5 µg of each)
was used. Equal amounts of cell lysates were analyzed for pRb and PC3
expression by immunoblotting. Protein loading was verified by -actin
detection.
|
|
The phosphorylation state of pRb depends on the activity of the
cyclin-CDK complexes, whose activity, in turn, depends on
the cyclin
levels (
50,
66). Therefore, we sought to assess
if the
effects of PC3 seen on pRb phosphorylation could be influenced
by
coexpression of cyclins (Fig.
1B). We observed that all the
cyclins
tested, namely, cyclins D1, E, and A, led to almost complete
disappearance of the hypophosphorylated form of pRb elicited by
PC3
(Fig.
1B). In contrast, CDK4 and CDK2 alone did not counteract
the
effect of PC3 on pRb dephosphorylation (Fig.
1B). These results
strongly suggest that the PC3-dependent appearance of the
hypophosphorylated,
active form of pRb could be responsible for the
cell cycle impairment
by
PC3.
PC3 arrests G1/S progression depending on the presence
of Rb.
If the mechanism by which PC3 inhibits cell growth is by
counteracting pRb phosphorylation, then its ability to induce cell cycle arrest would be lost in cells lacking functional pRb. To ascertain this possibility, we examined the effect of PC3 on cell cycle
progression, specifically from the G1 to the S phase, in NIH 3T3 compared to Rb
/
3T3 cells. These latter cells
lack the gene for Rb but remain responsive to signals that restrain
proliferation independently from Rb (81). The two cell lines
were transiently transfected with PC3 or, alternatively, with a
-Gal
expression construct as a negative control, and the DNA synthesis was
determined by means of BrdU incorporation. The PC3- or the
-Gal-expressing cells were identified by immunofluorescence
staining, either with the anti-PC3 affinity-purified polyclonal
antibody A3H (72) or with an anti-
-Gal rabbit polyclonal
antibody, while the cells that entered into S phase were identified by
staining with an anti-BrdU antibody (Fig.
2A to
L, showing a representative experiment). We observed that expression of
PC3 led to inhibition of BrdU incorporation in NIH 3T3 cells (Fig. 2D
to F), compared to control cultures (Fig. 2A to C). Such inhibition was
significant, as clearly indicated by the frequency values for BrdU
incorporation (Fig. 2M). In contrast, no significant effect was
produced by PC3 on BrdU incorporation in Rb
/
3T3 cells
(Fig. 2J to M). The same result was seen in primary Rb+/+
and Rb
/
MEFs, transiently transfected with PC3 (data
not shown). These results indicate that PC3 arrests the progression
toward the S phase in an Rb-dependent manner.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Rb-dependent inhibition of S-phase entry by PC3.
(A to L) Representative immunofluorescence photomicrographs of BrdU
incorporation in NIH 3T3 (A to F) and Rb / (G to L)
cells transfected with PC3. NIH 3T3 and Rb / 3T3 cells
(0.8 × 105) were seeded onto coverslips in
35-mm-diameter dishes. After 24 h, cells were transfected with the
expression vector pSCT- -Gal or pSCT-PC3 (1.5 µg each). DNA
synthesis assays were performed by adding 50 µM BrdU to the culture
medium 40 h after transfection. After 18 to 20 h, cells were
fixed, permeabilized, and stained. -Gal and PC3 proteins were
revealed using anti- -Gal (A and G) or anti-PC3 (i.e., A3H [D and
J]) polyclonal antibodies followed by incubation with goat anti-rabbit
TRITC-conjugated antibody. BrdU was visualized by anti-BrdU monoclonal
antibody (corresponding photomicrographs C, F, I, and L) followed by
goat anti-mouse FITC-conjugated antibody. Nuclei were detected by
Hoechst 33258 dye (corresponding photomicrographs B, E, H, and K).
Arrows indicate the positions of nuclei that did not incorporate BrdU.
Bar, 30 µm. (M) Percentage of BrdU-incorporating cells (NIH 3T3 or
Rb / 3T3, as indicated) after transfection with pSCT-PC3
(filled bars) or control pSCT- -Gal (open bars). Values are
calculated as the percentages of cells positive for BrdU, detected
between cells positive for -Gal and those positive for PC3, whose
total number within each experiment was assumed to be 100%. Means ± SEM are from three independent experiments (a representative field
is shown in A to L). The number of cells counted for each group is
indicated at the top of each bar. *, P = 0.0000
versus any other group (Student's t test). (N) Flow
cytometry analysis of PC3 (filled bars) or p16 (open bars) effects on
cell cycle profile in NIH 3T3 and Rb / 3T3 cells. NIH
3T3 or Rb / 3T3 cells (3 × 105) were
seeded onto 90-mm-diameter culture dishes; after 24 h, cells were
transfected either with the pSCT empty plasmid (8.5 µg), with
pSCT-PC3 (8.5 µg), or with pXp16 plasmid (8.5 µg), together with a
plasmid encoding the CD20 cell surface marker (pCMVCD20, 3 µg). After
60 h, transfected cells were identified by staining with an
FITC-conjugated anti-CD20 antibody, and their cell cycle distribution
was measured by analyzing the DNA content after staining with propidium
iodide, using two-color flow cytometry. Data from three independent
experiments are shown as means ± SEM of the changes in the
percentages of cells in G0/G1 or S cycle phase,
compared to the corresponding value of the control transfection with
the empty vector pSCT. (O) Effects of PC3 on cell cycle profile of
Rb / 3T3 cells upon readdition of Rb.
Rb / 3T3 cells were transfected with pCMVpRb (0.5 µg)
or its empty vector. To each of these two treatments was added either
pSCT-PC3 (7.5 µg, filled bars) or the pSCT empty plasmid (7.5 µg,
open bars). The plasmid encoding the CD20 cell surface marker
(pCMVCD20, 3 µg) was used in all transfections. Shown are the changes
in the percentages of cells in G0/G1 or S cycle
phase induced by addition of pRb (compared for each group to the
corresponding value of the control transfection in the absence of pRb),
with or without PC3 as indicated. Data are means ± SEM from three
independent experiments.
|
|
As a further analysis of this point, we sought to measure the cell
cycle profile of NIH 3T3 and Rb
/
3T3 cells expressing
ectopic PC3. To this end, we cotransfected
the pSCT-PC3 expression
construct with the cell surface marker
CD20 (
105) cloned
into an expression vector (
122) and analyzed
the cell cycle
profile of transfected cells by means of two-color
flow cytometry (Fig.
2N). The expression of PC3 in NIH 3T3 cells
induced a significant
percent increase of the cell population
in the G
1 phase,
accompanied by a complementary decrease of the
S phase, while no
significant effect was seen in the PC3-expressing
Rb
/
3T3 cells (Fig.
2N, filled bars). No evident changes were observed
in
the G
2/M-phase cell population (data not shown).
Furthermore,
ectopic expression of the pRb-dependent CDK inhibitor
p16
INK4a gave the same effects on the cell cycle profile as
seen with
PC3, i.e., a significant increase of
G
0/G
1 and decrease of S phase
only in NIH 3T3
cells (Fig.
2N, open bars). Thus, PC3, similar
to p16
INK4a,
caused an Rb-dependent impairment of G
1-S transition. Our
Rb
/
3T3 cell clone was, however, fully responsive to
the CDK inhibitor
p27
Kip1, transfected as expression vector
pCMX-p27 ([26.2 ± 0.53]% increase
of cells in
G
0/G
1 phase and [

16.8 ± 2.97]%
decrease of cells
in S phase, expressed as changes in percentage ± standard errors
of the mean [SEM]). Given that p27
Kip1
acts through a pRb-independent pathway (
81), this confirmed
that the clone did not undergo mutational changes in the course
of our
experimentation, remaining responsive to Rb-independent
stimuli. We
also checked whether in Rb
/
3T3 cells the inhibitory
effect of PC3 on G
1-S progression could
be reinstated after
reintroduction of pRb by transfection (Fig.
2O). In fact, the percent
changes in the cell populations in G
1 or S phases induced
by PC3 cotransfected with exogenous pRb (filled
bars, Fig.
2O) attained
about the same level seen in NIH 3T3 cells
transfected with PC3 alone,
if the basal effect of exogenous pRb
is subtracted (open bars, Fig.
2O).
Cyclin D1 expression reverses the PC3-induced cell cycle
block.
As a whole, the above results indicate that PC3 impairs
G1-to-S-phase progression by means of an active pRb, also
given the ability of cyclin-CDKs to reverse the PC3-induced
dephosphorylation of pRb (Fig. 1B).
To further elucidate this aspect of the mechanism by which PC3 blocks
cell cycle progression, we examined whether overexpression
of cyclins
could overcome the inhibitory effect of PC3 on G
1/S
progression. To this aim, NIH 3T3 cells were transiently transfected
with PC3 in either the presence or the absence of cyclins and
CDKs, and
the entry of cells into S phase was monitored by means
of BrdU
incorporation (Fig.
3). While cyclins A,
D3, E, B1, and
B2 only partially counteracted the impairment of DNA
synthesis
elicited by PC3 (with an increase of BrdU incorporation
ranging
from 16 up to 25 to 40% of the basal level), cyclin D1 led to
a significant (80%) recovery of the basal level (86% when cyclin
D1
was coexpressed with CDK4). These data point to cyclin D1 as
an
essential component in the pathway(s) responsible for the PC3
inhibitory activity on the cell cycle. Generally, coexpression
of CDKs
with cyclins and PC3 led to a recovery of BrdU incorporation
that was
very similar to that brought about by cyclins alone.
This is consistent
with the previous observation that CDK2 and
CDK4 alone did not modify
the PC3-dependent hypophosphorylation
of pRb (Fig.
1B).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of cyclin D1 rescues the PC3-dependent
G1 arrest. NIH 3T3 cells (0.8 × 105) were
seeded onto 35-mm-diameter dishes. After 24 h, cells were
transfected with the expression vector pSCT-PC3 (PC3, 0.4 µg, filled
bars) or pSCT- -Gal (GAL, 0.4 µg, open bars), together with the
indicated cyclins (0.8 µg) and CDKs (0.8 µg). In transfections
where the CDK or the cyclin was absent, a corresponding amount (0.8 µg) of the empty CMV vector was cotransfected. Detection of
transfected cells expressing PC3 or -Gal and analysis of their DNA
synthesis by measuring BrdU incorporation were performed as described
in the Fig. 2A legend. At least 90 cells were scored for each
experiment. The results are means ± SEM of at least three
independent experiments. ***, P = 0.0000 versus
GAL; **, P < 0.0001 versus GAL; *, P < 0.001 versus GAL; N.S., P > 0.05 versus GAL
(Student's t test).
|
|
The ectopic expression of PC3 down-regulates cyclin D1 levels.
The observation that cyclin D1 was able to rescue the
cell-growth-inhibitory effect of PC3, taken together with the
well-established requirement for cyclin D1 in G1
progression (7), suggested that the cell cycle block imposed
by PC3 could be consequent to a reduction of cyclin D1 levels.
Thus, we wished to evaluate the effects of ectopic PC3 on the
endogenous levels of cyclins and CDKs, by immunoblotting. Given
that
the cells which took up and expressed the transiently transfected
PC3
were not more than 10 to 20% in our experimental conditions,
to
improve the detection of protein levels the population of cells
successfully transfected was enriched up to 90% by flow cytometry,
using the cotransfected CD20 antigen as a marker protein. It turned
out
that cyclin D1 indeed was reduced by PC3 expression, in both
NIH 3T3
and Rb
/
3T3 cells (Fig.
4), about threefold, as judged by
densitometry
scanning. The other cyclins and CDKs analyzed did not show
significant
changes in their levels, except for a slight reduction of
cyclin
E in Rb
/
3T3 cells. As expected, the levels of
the different cyclins in
control transfections were similar for both
NIH 3T3 and Rb
/
3T3 cells (
43,
61).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of cyclin D1 expression by PC3 in NIH 3T3 and
Rb / cells. NIH 3T3 and Rb / 3T3 cells
(3 × 105) were seeded onto 90-mm-diameter culture
dishes. After 24 h, cells were transfected with either pSCT empty
plasmid (VEC; 21 µg for each dish, total of seven dishes for each
cell line) or pSCT-PC3 (21 µg for each dish, total of seven dishes
for each cell line), together with a plasmid encoding the CD20 cell
surface marker (pCMVCD20, 3 µg). Sixty hours after, extracts from
transfected cells isolated by CD20-specific cell sorting were subjected
to immunoblotting with antibodies specific for the cyclin and CDK
proteins indicated.
|
|
As an independent assessment, we verified by immunofluorescence
staining the expression of cyclin D1 and cyclin A in cells
transfected
with pSCT-PC3 or with the control vector pSCT-

-Gal
(Fig.
5A to
L). Cells expressing ectopic PC3 were detected by
using the anti-PC3
antibody A3H (
72). Again, it was observed
that in both NIH
3T3 and Rb
/
3T3 cells expressing ectopic PC3 the cyclin
D1 nuclear immunostaining
was detectable at a frequency significantly
lower (fivefold) than
that in cells expressing ectopic

-Gal (Fig.
5A
to L and M, showing
the frequency values for cyclin D1 nuclear
staining). On the other
hand, cyclin A expression in both NIH 3T3 and
Rb
/
3T3 cells transfected with PC3 remained the same as
in control
cultures transfected with

-Gal (Fig.
5N).

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of cyclin D1 nuclear immunofluorescence
staining by ectopic PC3 in NIH 3T3 and Rb / cells. (A to
L) Representative immunofluorescence photomicrographs of cyclin D1
expression in NIH 3T3 (A to F) and Rb / 3T3 (G to L)
cells transfected with PC3 (or control -Gal). NIH 3T3 or
Rb / 3T3 cells (0.8 × 105) were seeded
onto coverslips in 35-mm-diameter dishes and transfected with the
expression vector pSCT- -Gal or pSCT-PC3 (1.5 µg each). After
60 h, cells were fixed, permeabilized, and stained. -Gal and
PC3 proteins were detected with anti- -Gal (A and G) or anti-PC3 (D
and J) polyclonal antibodies, followed by goat anti-rabbit
TRITC-conjugated antibody. Nuclei were stained by Hoechst 33258 dye
(corresponding photomicrographs B, H, E, and K). Cyclin D1 was
visualized by anti-cyclin D1 mouse monoclonal antibody, followed by
goat anti-mouse FITC-conjugated antibody (corresponding
photomicrographs C, I, F, and L). Arrows indicate the positions of nuclei negative for cyclin D1 staining.
Bar, 40 µm. (M) Percentage of NIH 3T3 and Rb / 3T3
cells positive for cyclin D1 immunofluorescence staining after
transfection with pSCT- -Gal (open bars) or pSCT-PC3 (filled bars).
Values are calculated as the percentages of cells positive for cyclin
D1 nuclear staining, detected between cells positive for -Gal and
those positive for PC3, whose total number within each experiment was
assumed to be 100%. Means ± SEM of three independent
experiments, performed as described above for panels A to L, which are
a representative field, are shown. *, P = 0.0000
versus the corresponding control (Student's t test). The
number of cells counted for each group is indicated at the top of each
bar. (N) Percentage of cyclin A-positive cells by immunofluorescence
staining after transfection with pSCT- -Gal (open bars) or pSCT-PC3
(filled bars). Transfection and detection of PC3 and -Gal were
performed as described for panels A to L. However, in order to
distinguish the reactivity to the rabbit polyclonal anti-cyclin A
antibody from that to either anti-PC3 (A3H) or anti- -Gal (all rabbit
polyclonal antibodies), cells were incubated first with anti-cyclin A
and then with a mouse anti-rabbit antibody, washed, and fixed.
Incubation with A3H (or anti- -Gal) followed. Anti-cyclin A and
anti-PC3 (or anti- -Gal) antibodies were detected by goat anti-mouse
FITC-conjugated and goat anti-rabbit TRITC-conjugated antibodies,
respectively. Values are the means ± SEM of three independent
experiments. The number of cells counted for each group is indicated at
the top of each bar.
|
|
PC3 down-regulates the transcription of the cyclin D1 gene.
The above findings raised the question whether the reduction of cyclin
D1 protein levels elicited by PC3 was a consequence of down-regulation
of cyclin D1 transcription. To this aim, we analyzed the cyclin D1, A,
and E mRNA levels in PC3-expressing cells by semiquantitative RT-PCR.
Cells expressing exogenous PC3 were enriched as previously indicated by
selecting the cell population expressing the CD20 marker cotransfected
with PC3. We observed that cyclin D1 mRNA levels were significantly
reduced by PC3, about 2.5- and 3-fold, compared to the levels of NIH
3T3 and Rb
/
3T3 control cells, respectively (Fig.
6A and B). The mRNA levels of cyclin E
appeared to be not significantly decreased in NIH 3T3 cells and to be
slightly increased by PC3 in Rb
/
3T3 cells (1.4-fold),
whereas those of cyclin A were not significantly increased in both cell
types (1.2-fold [Fig. 6A and B]). Thus, to assess the existence of
transcriptional regulation by PC3, we analyzed the effect of PC3 on the
activity of the cloned cyclin D1 promoter, transiently transfected into
NIH 3T3 cells. We used the construct prCD1-1810, which contains 1,810 nucleotides 5' to the transcription start in front of the luciferase
reporter gene in the vector pGL2 (see reference
117). The activity of the cyclin D1 promoter in
cells cotransfected with PC3 was compared to that of cells
cotransfected with the empty vector. As a control of the efficiency of
transfection, we measured the amount of plasmid DNA present in each
cell extract by dot blot hybridization, according to a previously
described procedure (1). We observed that PC3 reduced the
activity of cyclin D1 promoter up to threefold, with a
concentration-dependent effect (Fig. 6C). A similar effect on the
cyclin D1 promoter was also observed for E2F-1, known to inhibit the
cyclin D1 promoter (113), used as an internal experimental control.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 6.
Inhibition of cyclin D1 transcription by PC3. (A)
Inhibition of cyclin D1 mRNA levels in NIH 3T3 and Rb /
3T3 cells by PC3. Cells (3 × 105) were seeded onto
90-mm-diameter culture dishes and transfected with either pSCT empty
plasmid or pSCT-PC3 (21 µg each) together with a plasmid encoding the
CD20 cell surface marker (pCMVCD20, 3 µg), as described for Fig. 4.
Sixty hours after, cells were isolated by CD20-specific cell sorting
(obtaining 3 × 105 to 5 × 105
cells), and total RNA was extracted. The specific mRNA species
indicated were visualized by RT-PCR analysis using specific primers.
Equal amounts of RT-PCR products amplified from NIH 3T3 or
Rb / 3T3 sorted cells, transfected with either pSCT-PC3
or the empty vector, were electrophoresed, blotted on a filter, and
hybridized to probes for cyclins A, E, and D1; PC3; and -actin. RT
"+" or " " indicates the products of amplification performed
in parallel on two aliquots of each RNA starting sample preincubated or
not with RT, respectively, in order to check the presence of DNA
contamination. Control amplifications using as template the cDNA
corresponding to each mRNA species gave a signal of the expected size
(data not shown). (B) Relative levels of the mRNAs, as means ± SEM of three independent experiments, of which a representative one is
shown in panel A. Values were obtained by measuring Southern blot
densities of the PCR product of each experiment with a PhosphorImager
system and were represented as ratios of the density observed in
pC3-transfected cells to the corresponding one in pCST-transfected
cells (assumed to be 1; see control bars). Values were then corrected
for the corresponding -actin relative expression, according to the
following formula: relative sample density = sample density in
PC3-transfected cells × 100/sample density in vector-transfected
cells/( -actin density in PC3-transfected cells × 100/ -actin
density in vector-transfected cells). Black bars, NIH 3T3 cells; grey
bars, Rb / 3T3 cells. (C) Inhibitory effect of PC3 on
cyclin D1 promoter activity. NIH 3T3 cells (105) seeded
onto 35-mm-diameter culture dishes were transfected after 24 h
with either pSCT-PC3 or CMV-E2F-1 or the corresponding empty plasmids.
Forty-eight hours after transfections, cell lysates were collected and
assayed for luciferase activity. The fold decrease in luciferase
activity was calculated relative to the level of control samples
(transfected with the empty vectors), which were set to the unit. The
bars represent the average fold activities ± SEM of three
independent experiments performed in duplicate. The luciferase
activities were measured in luciferase units per microgram of protein
normalized to the amount of plasmid DNA present in each extract (black
or grey bars). The ratio of transfected expression vector to reporter
plasmid is shown on the abscissa. The amount of reporter used was 0.5 µg, while the highest amount of pSCT-PC3 and CMV-E2F-1 was 1.5 µg
(corresponding to a molar ratio of expression vector to reporter of 4.5 and 3.0, respectively).
|
|
A further analysis was performed to verify whether PC3, in addition to
its effects on cyclin D1 transcription, could also
affect the stability
of cyclin D1 protein. To this aim, we measured
the half-life of
Flag-tagged cyclin D1, cotransfected in NIH 3T3
cells with either
pSCT-PC3 or pSCT control vector. Cells were
metabolically labeled with
[
35S]methionine, and the lysates were immunoprecipitated
with an
antibody to Flag (Fig.
7A). We
observed that PC3 did not produce
significant differences in the
turnover kinetics of Flag-tagged
cyclin D1 protein, given its half-life
of 23.3 ± 5 and 21.5 ±
4 min in the absence and the
presence of PC3, respectively (average
values ± SEM obtained by
linear regression analysis of the data
of four independent experiments,
shown in Fig.
7B).

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 7.
The half-life of Flag-tagged cyclin D1 protein is not
changed by PC3. (A) Forty-five hours after cotransfection of NIH 3T3
cultures (2.3 × 105 cells in 60-mm-diameter dishes)
with Flag-tagged cyclin D1 (2.15 µg) and either pSCT- -Gal or
pSCT-PC3 (2.15 µg each), cells were metabolically labeled for 2 h with [35S]methionine. Cells were washed with medium
containing an excess of unlabeled methionine, collected, and lysed at
the indicated times. Cell lysates containing equal amounts of proteins
were then immunoprecipitated using the M2 monoclonal antibody against
the Flag epitope. A control transfected with pSCT vector without
Flag-tagged cyclin D1 is shown in lane 1. Shown are results of a
representative experiment. (B) Graphic representation of Flag-tagged
cyclin D1 expression. The data at individual time points are the
amounts of 35S-labeled Flag-tagged cyclin D1 protein as
measured by a PhosphorImager system and are the means ± SEM of
four independent experiments. The half-lives of Flag-tagged cyclin D1
protein were calculated for each experiment by linear regression
analysis of the density values at the different time points,
transformed by common logarithm.
|
|
Cell cycle blocking activity of PC3 mutants.
A comparison of
the protein sequences of the PC3/BTG/Tob gene family shows
the existence of conserved regions with higher homology. By comparing,
through the algorithm Align, the protein sequences of rat PC3
(72), human PC3 (whose cDNA, isolated by us with EMBL
accession no. Y09943, corresponds to BTG2 [see reference
92]), Tob (64), and BTG1
(94), we identified two conserved regions that correspond,
in the PC3 protein, to residues 50 to 68 and 105 to 123 (Fig.
8A).
We reasoned that such regions, given the common ability of these genes to inhibit proliferation, might
play a role in that effect. To analyze this possibility, we produced
two PC3 mutants with an internal deletion, comprising either residues
50 to 68 or 105 to 123 (pSCT-PC3
50-68 and pSCT-PC3
105-123,
respectively). Furthermore, the PC3 protein contains a sequence motif
known as the consensus site for phosphorylation by cdc2 and/or CDK2
(46). Therefore, we produced a third mutant, pSCT-PC3 S147N,
whose serine 147, which belongs to the phosphorylation motif mentioned,
was replaced with asparagine (Fig. 8A). We found that cyclin A-CDK2, expressed in baculovirus, was able to phosphorylate the wild-type PC3 molecule but did not phosphorylate the mutant pSCT-PC3 S147N (Fig. 9), indicating that
indeed PC3 is phosphorylated by cyclin A-CDK2 at the consensus aa 147 (while PC3 did not appear to be a substrate either of cyclin B1-cdc2 or
of cyclin D1-CDK4 [data not shown]).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8.
Effects of the ectopic expression of wild-type and
mutant PC3 constructs on cell growth arrest and cyclin D1 expression.
(A) Schematic representation of PC3 mutants; the hatched boxes inside
the PC3 sequence represent the regions conserved among the different
members of the PC3 family. (B, C, and D) NIH 3T3 cells were transfected
with the indicated pSCT-PC3 construct (either wild type or mutant; 3.8 µg) or with the empty vector pSCT (3.8 µg). The vector carrying the
neomycin resistance gene (pcDNA3, 0.5 µg) was included in each
transfection. The transfected cultures were then split into three
fractions 48 h after transfection, two for the colony formation
assay (2 × 105 and 1 × 105 cells
[B]) and a second (6 × 105 cells) for protein
expression analysis by Western blotting (C and D). (B) For the colony
formation assay, the colonies resistant to G418 after 2 weeks of
selection, arising from each transfected construct, were counted and
expressed as percentages of the number of resistant colonies formed by
transfection of the empty vector. Calculations are means ± SEM
from four independent experiments. VEC, vector-cotransfected cells,
considered 100% of colony formation. *, P < 0.05
versus VEC control group (Student's t test); **,
P < 0.01 versus VEC control group (Student's
t test). (C and D) Equal amounts of cell lysates were used
for Western blot analysis; (C) representative experiment analyzing the
PC3 and -actin protein levels; (D) means ± SEM of protein
expression levels as judged by densitometry analysis of the four
independent experiments, after normalization to the corresponding
-actin expression level (unity = the expression of PC3
wild-type protein for each experiment). (E) Immunofluorescence
photomicrographs showing NIH 3T3 cells expressing either wild-type or
mutated PC3, as indicated. Detection was done by the anti-PC3 antibody.
The lower panels show nuclear staining, using Hoechst 33258 dye. Bar,
25 µm. (F) Percentage of NIH 3T3 cells positive for cyclin D1
immunofluorescence staining after transfection with pSCT- -Gal,
pSCT-PC3, pSCT-PC3 50-68, pSCT-PC3 105-123, or pSCT-S147N
mutants (1.5 µg each). Transfections, as well as detection of
proteins (PC3 [wild type and mutated], -Gal, and cyclin D1), were
performed as described for Fig. 5A to L. Values are the means ± SEM of four independent experiments. *, P < 0.05
versus -Gal control group (Student's t test); N.S.,
P > 0.05 versus -Gal control group (Student's
t test). The number of cells counted for each group is
indicated at the top of each bar. w.t. and W.T., wild type.
|
|

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 9.
Phosphorylation of PC3 at aa 147 by cyclin A-CDK2.
Lysates of Sf9 cells coinfected with either CDK2 and cyclin A or
wild-type baculovirus lysates were assayed in 20-µl reaction mixtures
for GST-PC3 S147N, GST-PC3, GST, or GST-Rb phosphorylation by measuring
incorporation of 32P. Samples were analyzed by SDS-PAGE.
Shown is the autoradiograph from the area of the gel containing the
substrate proteins. W.T., wild type.
|
|
The ability of the PC3 mutants to inhibit cell proliferation was then
analyzed by colony formation assay. This revealed that
growth
inhibition was lost for the

50-68 mutant, which even presented
a
slight paradoxical stimulatory effect, whereas for the

105-123
mutant the ability to inhibit growth, although still significant,
was
severely reduced. The mutation of aa 147 led only to a slight
impairment of the growth inhibition of PC3 (Fig.
8B). In parallel
with
the colony formation assays, the expression of the PC3 mutated
proteins
was analyzed by Western blotting and was shown to be
equivalent to that
of the wild-type PC3, indicating that the effects
on growth were not
due to differences in the expression of the
PC3 mutants (Fig.
8C and
statistical analysis of the expression
in Fig.
8D). The intracellular
localization of the mutated PC3
proteins did not differ from that of
wild-type PC3, being apparently
cytoplasmic, as judged from
immunostaining with the antibody A3H
(Fig.
8E).
We have previously observed that ectopic expression of PC3
concomitantly induces down-regulation of cyclin D1 levels and
G
1 arrest, suggesting that these two events are correlated.
To verify
this possibility, we checked the ability of the PC3 mutants
analyzed
for their effects on growth to affect cyclin D1 levels. To
this
aim, the expression of cyclin D1 was assessed by
immunofluorescence
staining in cells transfected either with pSCT-PC3,
pSCT-PC3

50-68,
pSCT-PC3

105-123, or pSCT-PC3 S147N or with the
control vector
pSCT-

-Gal (Fig.
8F). It was shown that the mutants
negatively
affected the frequency of cyclin D1 expression in the
following
order of potency: PC3 wild type > PC3 S147N > PC3

105-123 > PC3

50-68 (Fig.
8F).
As a whole, these data suggested the existence of a correlation between
the inhibition of proliferation and the reduction
of cyclin D1
expression elicited by
PC3.
Exclusivity of the cyclin D1 pathway for PC3.
A further
question raised by these findings, pointing to a negative regulatory
control of cyclin D1 levels exerted by PC3 in correlation with
inhibition of G1-S progression, concerned the exclusivity
of such control, in regard to the possible involvement of other cell
cycle pathways different from cyclin D1. To this aim, we verified the
ability of PC3 to inhibit S-phase progression in primary MEF cells
explanted from an animal ablated of the cyclin D1 gene, by measuring
BrdU incorporation. Cyclin D1+/+ and cyclin
D1
/
MEF cells, transiently transfected with the PC3 or
the control
-Gal expression constructs, were identified for their
expression by immunofluorescence staining with the anti-PC3 or
anti-
-Gal polyclonal antibodies and monitored for BrdU incorporation
by double labeling with the BrdU monoclonal antibody (Fig.
10). We observed that expression of PC3
led to inhibition of BrdU incorporation in both cell types, although to
different extents, i.e., about 45% inhibition in cyclin
D1+/+ cells and 23% inhibition in cyclin
D1
/
cells, compared to control cultures, being
statistically significant only in the former cell type (Fig. 10).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 10.
Assessment of the inhibition of G1-S
progression by PC3 in cyclin D1 / cells. About 0.8 × 105 cyclin D1+/+ and cyclin
D1 / MEF cells were seeded onto coverslips in
35-mm-diameter dishes and transfected after 24 h with the
expression vector pSCT- -Gal or pSCT-PC3 (1.5 µg each). DNA
synthesis assays were performed by adding 50 µM BrdU to the culture
medium 36 h after transfection. After 24 h, cells were fixed,
permeabilized, and stained. -Gal and PC3 proteins were revealed with
the polyclonal antibodies anti- -Gal and anti-PC3, respectively,
followed by goat anti-rabbit TRITC-conjugated antibody, whereas BrdU
was visualized by anti-BrdU monoclonal antibody followed by goat
anti-mouse FITC-conjugated antibody, as described for Fig. 2. The
percentages of BrdU-incorporating cells shown are means ± SEM of
three independent experiments. The number of cells counted for each
group is indicated at the top of each bar. *, P < 0.001 versus control group (Student's t test).
|
|
PC3 indirectly inhibits CDK2 and CDK4 activity.
The strong
impairment of cyclin D1 levels by PC3 can by itself fully account for
the pRb-dependent cell cycle arrest induced by PC3, given that
phosphorylation of pRb by cyclin D1-CDK4 complexes is the prerequisite
for G1 progression (for reviews, see references 70, 101, and 102). We wished to
verify this point by analyzing the effect of PC3 on the activity in
vivo of CDK4, and CDK2 as well, in NIH 3T3 cells. The generation of a
large population of pure PC3-expressing cells, necessary for the kinase
assays, was obtained by expressing PC3 through retroviral infection.
The retroviral vector pBABE puro, in which the complete coding region
of PC3 cDNA was cloned, was used to generate the high-titered
retroviral supernatants employed to infect NIH 3T3 cultures, according
to a procedure described elsewhere (80). These cultures
offered an additional system in which to verify our previous findings. In fact, in the course of our analyses we observed that cell cultures infected with the PC3 retrovirus presented a high expression of PC3
concomitant with a reduced expression of cyclin D1 protein and mRNA,
accompanied by an increase of the cell population in G1
phase and a decrease of cells in S phase (Fig.
11A and data not shown), as already
seen in PC3-expressing cells sorted by flow cytometry from transiently
transfected cultures. In cultures infected with the PC3 retrovirus, we
then observed a decrease, with respect to the control group, of both
CDK4- and CDK2-mediated Rb kinase activities, the effect on CDK2 being
less evident but well reproducible (Fig. 11B).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 11.
Effect of PC3 on the protein kinase activities of
cyclins-CDKs in vivo. (A) Characterization by Western blotting of NIH
3T3 cultures infected with retrovirus carrying the PC3 coding region or
with empty vector (from supernatants of BOSC23 cells transfected with
the pBABE puro-PC3 or pBABE puro vector, respectively). Equal amounts
of proteins were loaded. (B) In vivo activity of CDK2 and CDK4 in NIH
3T3 cells infected with the PC3 retrovirus or with the empty
retrovirus, as indicated. Equal amounts of proteins, from NIH 3T3
lysates of cultures infected with PC3 retrovirus or empty retrovirus,
were immunoprecipitated with normal rabbit serum (NRS) or with
anti-CDK2 and anti-CDK4 antibodies and then assayed for GST-Rb
phosphorylation in 50-µl reaction mixtures by measuring incorporation
of 32P. Samples were loaded in SDS-PAGE gels and
transferred by electrophoresis to a nitrocellulose filter. This was
analyzed for the presence of phosphorylated GST-Rb by a PhosphorImager
(upper panels). The immunoprecipitated samples were checked for the
presence of equal amounts of CDK2 and CDK4 proteins by Western blot
analysis of the nitrocellulose filter (lower panels). INF., infected;
I.P., immunoprecipitation.
|
|
A further analysis that we performed concerned the possibility of a
direct inhibition of CDK activities by PC3. This latter,
implying a
cell cycle arrest by PC3 occurring also independently
from its effect
on cyclin D1 transcription, was considered on
account of the
interaction seen between PC3 and CDKs, by means
of a GST pull-down
analysis using in vitro-translated CDKs. In
fact, we found that, while
p21
CIP1/WAF1 and p16
INK4a showed the expected
associations with cdc2 and CDK2 (Fig.
12A
and B) (see also references
42 and
121) and with CDK4 and
CDK6
(Fig.
12C and D) (see also references
40 and
116), respectively,
PC3 was shown to be
associated with cdc2 to an extent higher than
that of
p21
CIP1/WAF1 (Fig.
12A) and also, although weakly,
with CDK4 (Fig.
12C). Thereafter,
we tested whether PC3 could inhibit
the pRb kinasing activity
of different cyclins-CDKs expressed in Sf9
insect cells, using
a GST-Rb fusion protein as substrate. Purified
GST-PC3 was compared
either to purified GST-p21
CIP1/WAF1,
for the ability to inhibit cyclin B1-cdc2 and cyclin A-CDK2,
or to
purified GST-p16, for the ability to inhibit cyclin D1-CDK4
(Fig.
13). Purified GST was used as negative
control. This choice
was in agreement with the observation that
p21
CIP1/WAF1, although able to inhibit the activity
of several CDKs (
115),
is, however, a more efficient
inhibitor of cyclin B-cdc2 and cyclin
A- and E-CDK2 activities than of
cyclin D-CDK4 (
42,
121), while
p16
INK4a
preferentially inhibits CDK4 and CDK6 (
86,
99). It turned
out that while p21
CIP1/WAF1 and p16
INK4a dose
dependently inhibited the corresponding cyclins-CDKs, PC3
did not show
significant effects (Fig.
13). Therefore, under the
conditions used, we
can rule out a direct inhibitory effect of
PC3 on the activity of the
CDKs analyzed.

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 12.
In vitro interactions of PC3 with CDKs. Shown is
binding of GST, GST-PC3, and GST-p21 or GST-p16 to cdc2 (A), CDK2 (B),
CDK4 (C), or CDK6 (D). Equal amounts of
[35S]methionine-labeled CDKs (shown in the left lanes of
each panel) were incubated with GST-PC3, GST-p21, or GST-p16, as
indicated. Bound proteins were eluted and analyzed by SDS-PAGE (6%
polyacrylamide for cdc2, 9% polyacrylamide for CDK2 and CDK6, and 12%
polyacrylamide for CDK4) and autoradiography. Numbers at left of each
panel are molecular masses in kilodaltons.
|
|

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 13.
Effect of PC3 on the in vitro protein kinase activities
of cyclin B1-cdc2, cyclin A-CDK2, and cyclin D1-CDK4. Lysates of Sf9
cells containing the indicated combination of cyclin-CDK and in the
presence of increasing amounts (in nanograms) of GST-p21, GST-p16,
GST-PC3, or GST were assayed in 20-µl reaction mixtures for GST-Rb
phosphorylation by measuring incorporation of 32P. Samples
were analyzed by SDS-PAGE. Shown is the autoradiograph from the area of
the gel containing the GST-Rb protein. cdc2, CDK2, and CDK4 denote
lysates from Sf9 cells infected with the CDK baculovirus alone as a
control.
|
|
 |
DISCUSSION |
We show in this report that the gene PC3
inhibits S-phase entry in an Rb-dependent manner and that this effect
is correlated with its ability to inhibit cyclin D1 expression.
The PC3-mediated arrest of G1/S progression is Rb
dependent.
PC3 induces an evident inhibition of cell cycle
progression from G1 to S phase, as judged by the severe
impairment of DNA synthesis observed in cycling cells expressing
ectopic PC3. Accordingly, flow cytometry analysis of cell cultures
transfected with PC3 shows that the population of cells in S phase
undergoes a significant decrease, while that of cells in G1
shows a parallel increase. The impairment of G1/S
transition by PC3 observed in this report confirms and extends our
previous observations made with clones stably expressing PC3
(72). Furthermore, our analyses of Rb
/
cells
indicate that the inhibition of S-phase entry by PC3 requires the
presence of pRb, the key molecule responsible for growth arrest and
accumulation of cells in G1 in response to
antiproliferative signals (for reviews, see references
44 and 114). In fact, in
Rb
/
cells PC3 fails to arrest DNA synthesis, as seen by
BrdU incorporation, and to alter the population of cells in S phase,
according to the cell cycle profile analysis by flow cytometry. Such
findings agree with our observation that the PC3-dependent block of
S-phase entry is rescued by coexpression of cyclin D1, whose activity is necessary for G1-to-S progression in an Rb-dependent
manner (61, 107).
It is worthwhile to point out that the impairment of G
1/S
transition is an effect shared by PC3 with another p53-induced gene,
p21
CIP1/WAF1. Earlier observations indicated that,
following DNA damage, MEFs
lacking p21
CIP1/WAF1 show a
partial defect in G
1 arrest that is less severe than that
of p53-defective fibroblasts, thus making plausible the idea that
other
p53-dependent G
1 arrest pathways exist (
24).
Additionally, it has been observed that the G
2 arrest that
occurs following DNA damage is not detected in embryonic stem cells
ablated of PC3/BTG2, thus suggesting that PC3 might also be implicated
in the p53-mediated G
2 arrest (
92). However, it
was observed
that PC3/BTG2
/
cells presented a marked
increase in cell death, and it was not
possible to define if the loss
of G
2/M arrest resulted from the
absence of a specific
G
2 block, ongoing apoptosis, or loss of
other factors
(
92). Nonetheless, a possibility to be considered
is that
PC3 could inhibit cell cycle progression also at checkpoints
different
from G
1/S, by other, additional Rb-dependent or
Rb-independent
pathways.
Correlation between down-regulation of cyclin D1 levels and cell
cycle impairment by PC3.
The inhibition of the G1-S
transition by PC3 is accompanied by down-regulation of cyclin D1
levels. Given the necessity of cyclin D1 for G1 progression
(7, 87, 107), the cyclin D1 decrease effected by PC3 might
in itself be sufficient to explain the PC3-induced cell cycle arrest.
In fact, the formation of an active cyclin D1-CDK4 complex depends on
de novo synthesis of D1 protein (66). Furthermore, the
impairment in the ability of PC3 to lower cyclin D1 levels, seen in
consequence of mutations of the PC3 molecule, correlates with the
extent of impairment in growth arrest. This indicates that inhibition
of proliferation and down-regulation of cyclin D1 levels by PC3 are
events significantly connected. Remarkably, the fact that PC3
significantly inhibits cyclin D1 expression also in cells lacking pRb
indicates that such an effect is genuinely dependent on PC3 and is not
secondary to other effects consequent to the Rb-dependent cell cycle
arrest in G1. In second place, it follows that the
signaling pathway between PC3 and cyclin D1 in Rb
/
3T3
cells is intact.
Conversely, cyclin D1 is able to rescue the PC3-dependent
G
1 arrest, evidence pointing to cyclin D1 as a target for
the PC3
inhibition of the cell cycle. Furthermore, the ability of PC3
to impair cyclin D1 expression, as well as the ability of cyclin
D1 to
reverse the cell cycle block by PC3, appears to be preferential,
since
the level of cyclin A is unaffected by PC3, while that of
cyclin E is
only slightly reduced in 3T3 Rb
/
cells, and the
G
1 arrest elicited by PC3 is not reversed by these
cyclins.
As a whole, this indicates a significant functional correlation between
PC3 and cyclin D1, which can be placed upstream of
pRb. Given that pRb
is the sole critical substrate of CDKs regulated
by D-type cyclins,
this makes somewhat selective the functional
correlation between PC3
and, downstream,
pRb.
Nonetheless, it should be considered that the rescue performed by
cyclin D1 of the PC3-dependent impairment in S-phase entry
did not
attain 100% and, more important, that the inhibition by
PC3 of
G
1-S progression is detectable, even though only partially,
in cyclin D1
/
MEF cells also. These points, in our
view, suggest that the cyclin
D1 pathway, although preferential for the
PC3-dependent effect
on G
1-S progression, is not
exclusive.
Many pieces of evidence point to the existence of a homeostatic network
regulating pRb activity, centered on cyclin D1. Synthesis
and
accumulation of cyclin D1, triggered by growth factors or
by molecules
activated along their pathways, e.g., ras (
31,
71,
81), lead
to inactivation of pRb by CDK4-dependent phosphorylation
(for reviews,
see references
101 and
114) and
thus to the release
of molecules that trigger the cell cycle, such as
E2F-1 (
52,
97). At the end of G
1/S transition, a
down-regulation of cyclin
D1 levels follows, in consequence of at least
two events triggered
by pRb inactivation, i.e., an increase of free
E2F-1 molecules,
which leads to repression of cyclin D1 transcription
(
113), and
the increase of p16
INK4a, which leads
to displacement of cyclin D1 from CDK4 and to its
degradation
(
106). Thus, phosphorylated, inactive pRb exerts
negative
control on cyclin D1 levels. These remain low until pRb
is made active
again at the end of mitosis by dephosphorylation.
Then, active pRb
leads to accumulation of cyclin D1 (
76) and,
consequently,
to CDK4-dependent phosphorylation of pRb, with a
negative feedback loop
on its activity. Thus, the down-regulation
by PC3 of cyclin D1
expression should not only negatively influence
cyclin D1-CDK4 activity
but also have other effects predictable
from the context mentioned
above (e.g., on p16
INK4a or E2F
levels).
Regarding the mechanisms by which PC3 down-regulates cyclin D1 levels,
our data clearly show that PC3 negatively influences
cyclin D1
transcription and does not affect the stability of cyclin
D1 protein.
In fact, the decreases of the levels of cyclin D1
transcript and
protein caused by PC3 were quantitatively similar,
and they were also
accompanied by inhibition of cyclin D1 promoter
activity, indicating
that PC3 can repress cyclin D1 gene transcription,
which accounts for
the decrease of cyclin D1 protein. Thus, our
data suggest that PC3
acts, either directly or indirectly, as
a transcriptional regulator.
This idea is in agreement with the
recent observation that PC3/BTG2
binds the mouse homolog of the
yeast protein yCAF1 (
93).
This gene, together with the yeast
cell-cycle-regulated protein kinase
DBF2, the NOT proteins, and
other yet-unidentified proteins, is part of
the yeast transcriptional
regulatory complex CCR4, which plays an
important general transcriptional
role in diverse cellular processes
(
59,
60). It is interesting
that mutations of yeast CCR4,
CAF1, and DBF2 lead to a delayed
exit from late mitosis (
60)
and that mutations of yCAF1 are
able to suppress defects in DNA repair
(
98).
The observations of the subcellular localization of PC3 (as determined
by immunofluorescence staining of transfected cells,
in this report and
in reference
72) clearly show its presence
in the
cytoplasm but also leave open the possibility of a nuclear
localization. In the latter case, the participation of PC3 in
a
transcriptional complex could occur also in the
nucleus.
Our data also show that PC3 can associate with CDK4 in vitro. However,
assuming that this observation can be reproduced in
vivo, it appears
unlikely that the binding of PC3 to CDK4 might
displace the cyclin D1
protein, thus inducing its degradation
(as for instance seen with
p16
INK4a [
106]), since PC3 was unable to
directly inhibit pRb phosphorylation
by cyclin D1-CDK4 and to influence
cyclin D1 protein stability.
Rather, we see that PC3 behaves as an
indirect CDK inhibitor,
as judged from the detection of reduced
activity of CDK4 and CDK2
in PC3-expressing cells. While the inhibition
of CDK4 may well
be consequent to the PC3-dependent reduction of cyclin
D1 levels,
the effect on CDK2 is less obvious, given that no evident
effect
of PC3 on the levels of cyclins E and A, cofactors of CDK2, was
seen for NIH 3T3 cells. However, it has been shown that the activity
of
CDK2 can be inhibited by a decrease of cyclin D1-CDK4 complexes.
In
fact, a reduction of cyclin D1 would lead to a lower fraction
of cyclin
D1-CDK4 complexes available to bind the CDK inhibitor
p27 and
consequently to a larger number of active p27 molecules
able to inhibit
CDK2 activity (
89).
Recently, a report appeared showing that exogenous TIS21/PC3, stably
expressed in the tumor 293 cell line, induced G
1 arrest
accompanied by a decrease of cyclin E protein levels and CDK2
activity
(
57). It is worth noting that these cells lack cyclin
D1 and
have both nonfunctional pRb and nonfunctional p53, due
to the
expression of adenovirus type 5 E1A and E1B transforming
proteins,
respectively (
35,
73). In this regard, previous
reports
suggested that in systems with inactive pRb, such as tumor
cells,
S-phase progression can be regulated by cyclin E in place
of cyclin D
(
55) and that cyclin E expression can overcome a
pRb-dependent block of the cell cycle (
5,
62), thus
suggesting
that cyclin E might induce cell cycle progression through
pathways
independent from and downstream of pRb. Importantly, we
observed
that in 3T3 Rb
/
cells PC3 led to a decrease
also of cyclin E protein, although
considerably less pronounced than
that of cyclin D1 (Fig.
4).
Given that we found cyclin E to be
ineffective in rescuing the
inhibition of G
1 progression by
PC3 in NIH 3T3 cells carrying
an active pRb gene and that in our cell
system the cycle arrest
induced by PC3 depended biunivocally on the
presence of pRb, a
hypothesis that might account for our data and for
those of Lim
et al. (
57) is that PC3 induces the arrest of
the cell cycle
through at least two pathways, involving cyclin D1 and
cyclin
E. The latter could become evident when there is impairment of
pRb function and, possibly, of other cell cycle regulators such
as, for
instance, p53. Further analyses will certainly be necessary
for a
thorough understanding of this
point.
PC3-dependent hypophosphorylation of pRb and its reversal by
cyclins.
The PC3-dependent dephosphorylation of pRb in NIH 3T3
cells is a clear indication that PC3 influences the activity of pRb.
However, PC3 does not lead to complete disappearance of the
phosphorylated pRb forms. This fact should be the result of concomitant
phosphorylation of pRb by CDKs different from CDK4, whose regulatory
cyclins are not down-regulated by PC3. This possibility is suggested
by
the observation that not only cyclin D1 but also cyclins E
and A
prevent the PC3-dependent impairment of pRb phosphorylation.
Noteworthily, this fact is in apparent contrast to the quite exclusive
functional correlation seen between PC3 and cyclin D1, i.e., the
rescue
by cyclin D1 of the G
1/S impairment exerted by PC3 and
the
PC3-dependent down-regulation of cyclin D1 levels. In fact,
the
position of the pRb residue undergoing phosphorylation is
more
critical, in terms of impairment of pRb's antiproliferative
activity,
than the total number of phosphorylated residues. In
particular, for a
complete inactivation of pRb by CDK2 and cdc2
in S phase, a preliminary
phosphorylation in G
1/S by CDK4 is required
(
19,
63,
88). Thus, the complete conversion by cyclins A
and E (and their
associated CDK2 and cdc2 kinases) of the PC3-dependent
dephosphorylated
form of pRb into a phosphorylated one, seen in
a denaturing gel, should
result in a pRb still active in growth
arrest. In agreement, cyclins A
and E led to a nonsignificant
rescue of the PC3-dependent inhibition of
proliferation. All together,
these data indicate that the final target
of PC3 is
pRb.
Functional domains of PC3.
Colony formation assay data for PC3
mutants point to a functional role in cell proliferation for the region
corresponding to aa 50 to 68 (which we term here GR, for growth
regulatory), namely, the more amino terminal of the two conserved
regions existing within the PC3/BTG/Tob family. In fact, deletion of GR
(mutant PC3
50-68) led to a complete impairment of the
growth-inhibitory properties of PC3 and to almost complete loss of the
ability to inhibit cyclin D1. On the other hand, deletion of the
conserved domain spanning aa 105 to 123 partially reduced the
inhibitory effect on growth and on cyclin D1 expression by PC3.
Therefore, it is possible that the GR domain plays a direct role in
conferring on the PC3 molecule its antiproliferative properties.
Alternative and not mutually exclusive hypotheses are that the GR motif
has a role ancillary to that of other domains and that it requires the
cooperation of other regions of the molecule, as would be true if its
function were concerned with the conservation of the proper
conformation of the molecule, e.g., through intramolecular interactions
with the aa 105 to 123 region, given the presence of a cysteine in both domains.
The observation that PC3 is phosphorylated by CDK2 suggests that the
effect of growth inhibition exerted by the PC3 molecule
might be
regulated in a cell-cycle-dependent fashion. However,
we have observed
that the inhibition of colony formation by the
phosphorylation-defective mutant of PC3 is only slightly lower
than
that of the wild-type molecule. We can also tentatively exclude
an
effect of the phosphorylation by CDK2 on the stability or the
intracellular localization of the PC3 protein, since mutant pSCT-PC3
S147N appears to be expressed to the same extent as the wild-type
molecule, with no apparent differences in the intracellular pattern.
We
cannot exclude the phosphorylation of other sites by other
kinases as a
requirement to bring an effect into evidence, but
presently, the
functional role of the CDK2-dependent phosphorylation
of PC3 remains to
be
defined.
Physiological role of the G1 arrest by PC3.
The
model for PC3 activity presented here, proposing that PC3 activity
induces G1 arrest by targeting pRb function through cyclin
D1 down-regulation, raises questions about the functional rationale for
such activity. So far, the expression of PC3/TIS21/BTG2 has been shown
to increase at the onset of neuronal differentiation in cell lines and
in vivo (9, 47), at the onset of and during neuronal
apoptosis (67), or following DNA damage through a
p53-dependent mechanism (92). Evidence has been presented
for a role of PC3/TIS21/BTG2 in the growth arrest of the neuroblast
preceding its differentiation into postmitotic neuron (47,
48) and in cell survival after genotoxic damage (92).
The cellular condition of DNA damage is associated with a decrease of
cyclin D1 levels (79, 83, 100). In fact, it has been shown
previously that a decrease of cyclin D1 induced by antisense cDNA
accelerates DNA repair (79). In this regard, it is known
that cyclin D1 associates directly with the proliferating cell nuclear
antigen (PCNA) (116), i.e., the auxiliary factor of DNA
polymerases
and
, required for DNA replication and repair
(11, 84, 104), and that a down-regulation of cyclin D1 is
necessary for PCNA relocation and DNA repair synthesis (79).
It is therefore interesting to hypothesize that PC3 might play a role
in DNA damage through an effect on cyclin D1 levels, in an Rb-dependent
fashion. Regarding the process of neuronal differentiation, PC3 and pRb
are expressed during development mainly in areas where embryonic cells
proliferate and eventually differentiate (47, 54).
Furthermore, it has been shown that animals ablated of the Rb gene by
targeting die in utero, displaying major defects in neuronal
differentiation. In fact, neuroblasts continue to proliferate without
arrest, until they undergo massive apoptosis (54). Very
similar defects were detected in skeletal muscle differentiation
(119). It is also very suggestive that PC3 expression occurs
in vivo in the period when dephosphorylation of pRb is observed
(54), thus mirroring our data in vitro. However, pRb
expression continues in the adult neuron, while PC3 is completely shut
off. Shown in Fig. 14 is a working
model summarizing PC3 action.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 14.
A working model of PC3 activity. PC3, by modulating
cyclin D1 levels, leads to dephosphorylation of pRb and consequent
growth arrest. PC3 is normally not expressed in proliferating cells but
is induced in response to diverse growth arrest stimuli (e.g., terminal
differentiation and DNA damage). The dashed lines indicate pathways not
experimentally implicated in this report. phosph., phosphorylation;
cyc, cyclin.
|
|
We should also consider that the above model for the action of PC3
presents some incongruities. In fact, while PC3 expression
is directly
induced by p53 (
92), it has been observed that exogenous
expression of p53 induces cyclin D1 levels (
17,
23). Such
an
increase of cyclin D1 levels by p53 has been shown to be mediated
by
p21 and to be necessary for G
1 arrest, possibly as a
consequence
of the binding to PCNA (
17,
23). Thus, a
conflict with our
model appears evident in regard to the p53 action,
which increases
cyclin D1 levels and at the same time induces PC3,
which in turn
should effect a reduction of cyclin D1 levels. Indeed, we
have
observed that activation of p53 in the mouse BALB/c cell line
Val
5 containing the temperature-sensitive mutant p53
Val135,
kindly provided by C. Schneider and G. Del Sal (
23), induced
p21 and cyclin D1 expression as expected but did not induce either
PC3
protein or mRNA (data not shown). This suggests that the induction
of
PC3 by p53 is somewhat dependent on the cell system used. Furthermore,
DNA damage induces PC3/BTG2 and p53 levels (
92,
120;
D. Guardavaccaro
and F. Tirone, unpublished data) and reduces cyclin D1
levels
(
79,
83,
100), but this latter effect has also been
shown
to occur in the absence of p53 (
100). Therefore, this
experimental
evidence indicates that further studies are necessary to
assess
the possibility of PC3 being a mediator of G
1
inhibition by
p53.
 |
ACKNOWLEDGMENTS |
We are grateful to J. A. DeCaprio for the gift of
Rb
/
3T3 cells; to R. Weinberg for primary
Rb+/+ and Rb
/
MEFs and for the gift of
pRcCMV-cycA, pRcCMV-cycD1, pRcCMV-cycD3, and pRcCMV-cycE;
to P. Sicinski and R. Weinberg for the gift of primary cyclin
D1+/+ and cyclin D1
/
MEFs; to L. Zhu and E. Harlow for the gift of pCMV-CD20 and of CMVcdc2 constructs; to M. Ewen
and D. M. Livingston for the gift of pRcCMV-CDK2 and pRcCMV-CDK4;
to K. Poliak, D. Morgan, and C. Sherr for the gift of baculoviruses
expressing cyclin A, cyclin B1, cdc2, CDK2, cyclin D1, and CDK4; to C. Sherr for the gift of the Flag-cyclin D1 construct; and to D. Beach and
J. Massaguè for the gifts of pXp16 and pCMX-p27, respectively. We
thank L. Baron for outstanding technical assistance. We are all very
grateful to Francesca de Santa for her qualified help with the in vivo kinase experiments, given in a critical moment.
We gratefully acknowledge the support of F.T. by Donazione Bianchi and
the help of A. Cesari who made it possible. This work was also carried
out under a research contract with N.E.F.A.C., Pomezia, Italy, within
the Neurobiological Systems National Research Plan of the Ministero
dell' Università e della Ricerca Scientifica e Tecnologica.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Istituto di
Neurobiologia, Consiglio Nazionale delle Ricerche, Viale Carlo Marx 15, 00156 Rome, Italy. Phone: (06) 86895963. Fax: (06) 86090370. E-mail: tirone{at}mercury.itbm.rm.cnr.it.
Present address: Howard Hughes Medical Institute, Department of
Pathology, New York University Medical Center, Kaplan Comprehensive Cancer Center, New York, NY 10016.
 |
REFERENCES |
| 1.
|
Abken, H., and B. Reifenrath.
1992.
A procedure to standardize CAT reporter gene assay.
Nucleic Acids Res.
20:3527[Free Full Text].
|
| 2.
|
Abramovich, C.,
B. Yakobson,
J. Chebath, and M. Revel.
1997.
A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor.
EMBO J.
16:260-266[CrossRef][Medline].
|
| 3.
|
Agarwal, M. L.,
A. Agarwal,
W. R. Taylor, and G. R. Stark.
1995.
p53 controls both the G2/M and the G1 cell cycle checkpoints and mediates reversible growth arrest in human fibroblasts.
Proc. Natl. Acad. Sci. USA
92:8493-8497[Abstract/Free Full Text].
|
| 4.
|
Agarwal, M. L.,
W. R. Taylor,
M. V. Chernow,
O. B. Chernova, and G. R. Stark.
1998.
The p53 network.
J. Biol. Chem.
273:1-4[Free Full Text].
|
| 5.
|
Alevizopoulos, K.,
J. Vlach,
S. Hennecke, and B. Amati.
1997.
Cyclin E and c-Myc promote cell proliferation in the presence of p16INK4a and of hypophosphorylated retinoblastoma family proteins.
EMBO J.
16:5322-5333[CrossRef][Medline].
|
| 6.
|
Baker, S. J.,
S. Markowitz,
E. R. Fearon,
J. K. Willson, and B. Vogelstein.
1990.
Suppression of human colorectal carcinoma cell growth by wild-type p53.
Science
249:912-915[Abstract/Free Full Text].
|
| 7.
|
Baldin, V.,
J. Lukas,
M. J. Marcote,
M. Pagano, and G. Draetta.
1993.
Cyclin D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev.
7:812-821[Abstract/Free Full Text].
|
| 8.
|
Bartek, J.,
J. Bartkova, and J. Lukas.
1996.
The retinoblastoma protein pathway and the restriction point.
Curr. Opin. Cell Biol.
8:805-814[CrossRef][Medline].
|
| 9.
|
Bradbury, A.,
R. Possenti,
E. M. Shooter, and F. Tirone.
1991.
Molecular cloning of PC3, a putatively secreted protein whose mRNA is induced by nerve growth factor and depolarization.
Proc. Natl. Acad. Sci. USA
88:3353-3357[Abstract/Free Full Text].
|
| 10.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 11.
|
Bravo, R.,
R. Frank,
P. A. Blundell, and H. Macdonald-Bravo.
1987.
Cyclin/PCNA is the auxiliary protein of DNA polymerase-delta.
Nature
326:515-517[CrossRef][Medline].
|
| 12.
|
Brugarolas, J.,
C. Chandrasekaran,
J. I. Gordon,
D. Beach,
T. Jacks, and G. J. Hannon.
1995.
Radiation-induced cell cycle arrest compromised by p21 deficiency.
Nature
377:552-557[CrossRef][Medline].
|
| 13.
|
Buchkovich, K.,
L. A. Duffy, and E. Harlow.
1989.
The retinoblastoma protein is phosphorylated during specific phases of the cell cycle.
Cell
58:1097-1105[CrossRef][Medline].
|
| 14.
|
Caruso, M.,
F. Martelli,
A. Giordano, and A. Felsani.
1993.
Regulation of MyoD gene transcription and protein function by the transforming domains of the adenovirus E1A oncoprotein.
Oncogene
8:267-278[Medline].
|
| 15.
|
Chen, P.-L.,
D. J. Riley,
Y. Chen, and W.-H. Lee.
1996.
Retinoblastoma protein positively regulates terminal adipocyte differentiation through direct interaction with C/EBPs.
Genes Dev.
10:2794-2804[Abstract/Free Full Text].
|
| 16.
|
Chen, P.-L.,
P. Scully,
J.-Y. Shew,
J. Y. J. Wang, and W.-H. Lee.
1989.
Phosphorylation of the retinoblastoma gene product is modulated during the cell cycle and cellular differentiation.
Cell
58:1193-1198[CrossRef][Medline].
|
| 17.
|
Chen, X.,
J. Bargonetti, and C. Prives.
1995.
p53, through p21 (WAF1/CIP1), induces cyclin D1 synthesis.
Cancer Res.
55:4257-4263[Abstract/Free Full Text].
|
| 18.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 19.
|
Connell-Crowley, L.,
J. W. Harper, and D. W. Goodrich.
1997.
Cyclin D1/Cdk4 regulates retinoblastoma protein-mediated cell cycle arrest by site-specific phosphorylation.
Mol. Biol. Cell
8:287-301[Abstract].
|
| 20.
|
Dean, P. N.,
J. W. Gray, and F. A. Dolbeare.
1982.
The analysis and interpretation of DNA distributions measured by flow cytometry.
Cytometry
3:188-195[CrossRef][Medline].
|
| 21.
|
DeCaprio, J. A.,
J. W. Ludlow,
D. Lynch,
Y. Furukawa,
J. Griffin,
H. Piwnica-Worms,
C. M. Huang, and D. M. Livingston.
1989.
The product of the retinoblastoma susceptibility gene has properties of a cell cycle regulatory element.
Cell
58:1085-1095[CrossRef][Medline].
|
| 22.
|
Del Sal, G.,
M. Loda, and M. Pagano.
1996.
Cell cycle and cancer: critical events at the G1 restriction point.
Crit. Rev. Oncog.
7:127-142[Medline].
|
| 23.
|
Del Sal, G.,
M. Murphy,
E. Ruaro,
D. Lazarevic,
A. J. Levine, and C. Schneider.
1996.
Cyclin D1 and p21/waf1 are both involved in p53 growth suppression.
Oncogene
12:177-185[Medline].
|
| 24.
|
Deng, C.,
P. Zhang,
J. W. Harper,
S. J. Elledge, and P. Leder.
1995.
Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control.
Cell
82:675-684[CrossRef][Medline].
|
| 25.
|
Desai, D.,
Y. Gu, and D. O. Morgan.
1992.
Activation of human cyclin-dependent kinases in vitro.
Mol. Biol. Cell
3:571-582[Abstract].
|
| 26.
|
Diehl, J. A.,
F. Zindy, and C. J. Sherr.
1997.
Inhibition of cyclin D1 phosphorylation on threonine-286 prevents its rapid degradation via the ubiquitin-proteasome pathway.
Genes Dev.
11:957-972[Abstract/Free Full Text].
|
| 27.
|
El-Deiry, W. S.,
T. Tokino,
V. E. Velculescu,
D. B. Levy,
R. Parsons,
J. M. Trent,
D. Lin,
W. E. Mercer,
K. W. Kinzler, and B. Vogelstein.
1993.
WAF1, a potential mediator of p53 tumor suppression.
Cell
75:817-825[CrossRef][Medline].
|
| 28.
|
Elledge, S. J.,
R. Richman,
F. L. Hall,
R. T. Williams,
N. Lodgson, and J. W. Harper.
1992.
CDK2 encodes a 33-kDa cyclin A-associated protein kinase and is expressed before CDC2 in the cell cycle.
Proc. Natl. Acad. Sci. USA
89:2907-2911[Abstract/Free Full Text].
|
| 29.
|
Ewen, M. E.,
H. K. Sluss,
L. L. Whitehouse, and D. M. Livingston.
1993.
TGF inhibition of Cdk4 synthesis is linked to cell cycle arrest.
Cell
74:1009-1020[CrossRef][Medline].
|
| 30.
|
Feig, L. A., and G. M. Cooper.
1988.
Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP.
Mol. Cell. Biol.
8:3235-3243[Abstract/Free Full Text].
|
| 31.
|
Filmus, J.,
A. I. Robles,
W. Shi,
M. J. Wong,
L. L. Colombo, and C. J. Conti.
1994.
Induction of cyclin D1 overexpression by activated ras.
Oncogene
9:3627-3633[Medline].
|
| 32.
|
Fletcher, B. S.,
R. W. Lim,
B. C. Varnum,
D. A. Kujubu,
R. A. Koski, and H. R. Herschman.
1991.
Structure and expression of TIS21, a primary response gene induced by growth factors and tumor promoters.
J. Biol. Chem.
266:14511-14518[Abstract/Free Full Text].
|
| 33.
|
Genini, M.,
P. Schwalbe,
F. A. Scholl,
A. Remppis,
M. G. Mattei, and B. W. Schäfer.
1997.
Subtractive cloning and characterization of DRAL, a novel LIM-domain protein down-regulated in rhabdomyosarcoma.
DNA Cell Biol.
16:433-442[Medline].
|
| 34.
|
Graham, F. L., and A. J. Vander Eb.
1973.
A new technique for the assay of infectivity of human adenovirus DNA.
Virology
52:456-467[CrossRef][Medline].
|
| 35.
|
Graham, F. L.,
J. Smiley,
W. C. Russell, and R. Nairn.
1977.
Characteristics of a human cell line transformed by DNA from human adenovirus type 5.
J. Gen. Virol.
36:59-74[Abstract/Free Full Text].
|
| 36.
|
Greene, L. A.
1978.
Nerve growth factor prevents the death and stimulates the neuronal differentiation of clonal PC12 pheochromocytoma cells in serum-free medium.
J. Cell Biol.
78:747-755[Abstract/Free Full Text].
|
| 37.
|
Greene, L. A., and A. S. Tischler.
1976.
Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor.
Proc. Natl. Acad. Sci. USA
73:2424-2428[Abstract/Free Full Text].
|
| 38.
|
Gu, W.,
J. W. Schneider,
G. Condorelli,
S. Kaushal,
V. Mahdavi, and B. Nadal-Ginard.
1993.
Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation.
Cell
72:309-324[CrossRef][Medline].
|
| 39.
|
Gu, Y.,
C. W. Turck, and D. O. Morgan.
1993.
Inhibition of CDK2 activity in vivo by an associated 20K regulatory subunit.
Nature
366:707-710[CrossRef][Medline].
|
| 40.
|
Guan, K.-L.,
C. W. Jenkins,
Y. Li,
M. A. Nichols,
X. Wu,
C. L. O'Keefe,
A. G. Matera, and Y. Xiong.
1994.
Growth suppression by p18, a p16INK4/MTS1- and p14INK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function.
Genes Dev.
8:2939-2952[Abstract/Free Full Text].
|
| 41.
|
Guardavaccaro, D.,
A. Montagnoli,
M. T. Ciotti,
L. Lotti,
C. Di Lazzaro,
M.-R. Torrisi,
A. Gatti, and F. Tirone.
1994.
Nerve growth factor regulates the sub-cellular localization of the nerve growth factor-inducible protein PC4 in PC12 cells.
J. Neurosci. Res.
37:660-674[CrossRef][Medline].
|
| 42.
|
Harper, J. W.,
G. R. Adami,
N. Wei,
K. Keyomarsi, and S. J. Elledge.
1993.
The p21 cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases.
Cell
75:805-816[CrossRef][Medline].
|
| 43.
|
Herrera, R. E.,
V. P. Sah,
B. O. Williams,
T. P. Mäkelä,
R. A. Weinberg, and T. Jacks.
1996.
Altered cell cycle kinetics, gene expression, and G1 restriction point regulation in Rb-deficient fibroblasts.
Mol. Cell. Biol.
16:2402-2407[Abstract].
|
| 44.
|
Herwig, S., and M. Strauss.
1997.
The retinoblastoma protein: a master regulator of cell cycle, differentiation and apoptosis.
Eur. J. Biochem.
246:581-601[Medline].
|
| 45.
|
Hinds, P. W.,
S. Mittnacht,
V. Dulic,
A. Arnold,
S. I. Reed, and A. Weinberg.
1992.
Regulation of retinoblastoma protein functions by ectopic expression of human cyclins.
Cell
70:993-1006[CrossRef][Medline].
|
| 46.
|
Holmes, J., and M. J. Solomon.
1996.
A predictive scale for evaluating cyclin-dependent kinase substrates.
J. Biol. Chem.
271:25240-25246[Abstract/Free Full Text].
|
| 47.
|
Iacopetti, P.,
G. Barsacchi,
F. Tirone,
L. Maffei, and F. Cremisi.
1994.
Developmental expression of PC3 gene is correlated with neuronal cell birthday.
Mech. Dev.
47:127-137[CrossRef][Medline].
|
| 48.
|
Iacopetti, P.,
M. Michelini,
I. Stuckmann,
B. Oback,
E. Aaku-Saraste, and W. B. Huttner.
1999.
Expression of the antiproliferative gene TIS21 at the onset of neurogenesis identifies single neuroepithelial cells that switch from proliferative to neuron-generating division.
Proc. Natl. Acad. Sci. USA
96:4639-4644[Abstract/Free Full Text].
|
| 49.
|
Kato, J.,
H. Matsushime,
S. W. Hiebert,
M. E. Ewen, and C. J. Sherr.
1993.
Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4.
Genes Dev.
7:331-342[Free Full Text].
|
| 50.
|
Koff, A.,
M. Ohtsuki,
K. Polyak,
J. M. Roberts, and J. Massaguè.
1993.
Negative regulation of G1 in mammalian cells: inhibition of cyclin E-dependent kinase by TGF- .
Science
260:536-538[Abstract/Free Full Text].
|
| 51.
|
Kouzarides, T.
1995.
Transcriptional control by the retinoblastoma protein.
Semin. Cancer Biol.
6:91-98[CrossRef][Medline].
|
| 52.
|
LaThangue, N. B.
1994.
DRTF1/E2F: an expanding family of heterodimeric transcription factors implicated in cell cycle control.
Trends Biochem. Sci.
19:108-114[CrossRef][Medline].
|
| 53.
|
Lee, E. Y.-H. P.,
C.-Y. Chang,
N. Hu,
J. Wang,
C.-C. Lai,
K. Herrup,
W.-H. Lee, and A. Bradley.
1992.
Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis.
Nature
359:288-294[CrossRef][Medline].
|
| 54.
|
Lee, E. Y.-H. P.,
N. Hu,
S.-S. F. Yuan,
L. A. Cox,
A. Bradley,
W.-H. Lee, and K. Herrup.
1994.
Dual roles of the retinoblastoma protein in cell cycle regulation and neuron differentiation.
Genes Dev.
8:2008-2021[Abstract/Free Full Text].
|
| 55.
|
Leone, G.,
J. DeGregori,
R. Sears,
L. Jakoi, and J. R. Nevins.
1997.
Myc and Ras collaborate in inducing accumulation of active cyclin E/Cdk2 and E2F.
Nature
387:422-426[CrossRef][Medline].
|
| 56.
|
Levine, A. J.
1997.
p53, the cellular gatekeeper for growth and division.
Cell
88:323-331[CrossRef][Medline].
|
| 57.
|
Lim, I. K.,
M. S. Lee,
M. S. Ryu,
T. J. Park,
H. Fujiki,
H. Eguchi, and W. K. Paik.
1998.
Induction of growth inhibition of 293 cells by downregulation of the cyclin E and cyclin-dependent kinase 4 proteins due to overexpression of TIS21.
Mol. Carcinog.
23:25-35[CrossRef][Medline].
|
| 58.
|
Lin, W. J.,
J. D. Gary,
M. C. Yang,
S. Clarke, and H. R. Herschman.
1996.
The mammalian immediate-early TIS21 protein and the leukemia-associated BTG1 protein interact with a protein-arginine N-methyltransferase.
J. Biol. Chem.
271:15034-15044[Abstract/Free Full Text].
|
| 59.
|
Liu, H. Y.,
V. Badarinarayana,
D. C. Audino,
J. Rappsilber,
M. Mann, and C. L. Denis.
1998.
The NOT proteins are part of the CCR4 transcriptional complex and affect gene expression both positively and negatively.
EMBO J.
17:1096-1106[CrossRef][Medline].
|
| 60.
|
Liu, H. Y.,
J. H. Toyn,
Y. C. Chiang,
M. P. Draper,
L. H. Johnston, and C. L. Denis.
1997.
DBF2, a cell cycle-regulated protein kinase, is physically and functionally associated with the CCR4 transcriptional regulatory complex.
EMBO J.
16:5289-5298[CrossRef][Medline].
|
| 61.
|
Lukas, J.,
J. Bartkova,
M. Rohde,
M. Strauss, and J. Bartek.
1995.
Cyclin D1 is dispensable for G1 control in retinoblastoma gene-deficient cells independently of cdk4 activity.
Mol. Cell. Biol.
15:2600-2611[Abstract].
|
| 62.
|
Lukas, J.,
T. Herzinger,
K. Hansen,
M. C. Moroni,
D. Resnitzky,
K. Helin,
S. I. Reed, and J. Bartek.
1997.
Cyclin E-induced S phase without activation of the pRb/E2F pathway.
Genes Dev.
11:1479-1492[Abstract/Free Full Text].
|
| 63.
|
Lundberg, A. S., and R. A. Weinberg.
1998.
Functional inactivation of the retinoblastoma protein requires sequential modification by at least two distinct cyclin-cdk complexes.
Mol. Cell. Biol.
18:753-761[Abstract/Free Full Text].
|
| 64.
|
Matsuda, S.,
J. Kawamura-Tsuzuku,
M. Oshugi,
M. Yoshida,
M. Emi,
Y. Nakamura,
M. Onda,
Y. Yoshida,
A. Nishiyama, and T. Yamamoto.
1996.
Tob, a novel protein that interacts with p185erbB2, is associated with antiproliferative activity.
Oncogene
12:705-713[Medline].
|
| 65.
|
Matsushime, H.,
M. E. Ewen,
D. K. Strom,
J.-Y. Kato,
S. K. Hanks,
M. F. Roussel, and C. J. Sherr.
1992.
Identification and properties of an atypical catalytic subunit (p34PKSJ3/CDK4) for mammalian D-type G1 cyclins.
Cell
71:323-334[CrossRef][Medline].
|
| 66.
|
Matsushime, H.,
D. E. Quelle,
S. A. Shurtleff,
M. Shibuya,
C. J. Sherr, and J.-Y. Kato.
1994.
D-type cyclin-dependent kinase activity in mammalian cells.
Mol. Cell. Biol.
14:2066-2076[Abstract/Free Full Text].
|
| 67.
|
Mesner, P. W.,
T. R. Winters, and S. H. Green.
1992.
NGF withdrawal-induced cell death in neuronal PC12 cells resembles that in sympathetic neurons.
J. Cell Biol.
119:1669-1680[Abstract/Free Full Text].
|
| 68.
|
Meyerson, M.,
G. H. Enders,
C.-L. Wu,
L.-K. Su,
C. Gorka,
C. Nelson,
E. Harlow, and L.-H. Tsai.
1991.
A family of human cdc2-related protein kinases.
EMBO J.
11:2909-2917[Medline].
|
| 69.
|
Meyerson, M., and E. Harlow.
1994.
Identification of G1 kinase activity for cdk6, a novel cyclin D1 partner.
Mol. Cell. Biol.
14:2077-2086[Abstract/Free Full Text].
|
| 70.
|
Mittnacht, S.
1998.
Control of pRB phosphorylation.
Curr. Opin. Genet. Dev.
8:21-27[CrossRef][Medline].
|
| 71.
|
Mittnacht, S.,
H. Paterson,
M. F. Olson, and C. J. Marshall.
1997.
Ras signalling is required for the inactivation of the tumour suppressor pRb cell-cycle control protein.
Curr. Biol.
7:219-221[CrossRef][Medline].
|
| 72.
|
Montagnoli, A.,
D. Guardavaccaro,
G. Starace, and F. Tirone.
1996.
Overexpression of the nerve growth factor-inducible PC3 immediate early gene is associated to inhibition of cell proliferation.
Cell Growth Differ.
7:1327-1336[Abstract].
|
| 73.
|
Moran, E.
1993.
Interaction of adenoviral proteins with pRB and p53.
FASEB J.
7:880-885[Abstract].
|
| 74.
|
Morgenbesser, S. D.,
B. O. Williams,
T. Jacks, and R. A. DePinho.
1994.
p53-dependent apoptosis produced by Rb-deficiency in the developing mouse lens.
Nature
371:72-74[CrossRef][Medline].
|
| 75.
|
Morgenstern, J. P., and H. Land.
1990.
Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.
Nucleic Acids Res.
18:3587-3596[Abstract/Free Full Text].
|
| 76.
|
Müller, H.,
J. Lukas,
A. Schneider,
P. Warthoe,
J. Bartek,
M. Eilers, and M. Strauss.
1994.
Cyclin D1 expression is regulated by the retinoblastoma protein.
Proc. Natl. Acad. Sci. USA
91:2945-2949[Abstract/Free Full Text].
|
| 77.
|
Novitch, B. G.,
G. J. Mulligan,
T. Jacks, and A. B. Lassar.
1996.
Skeletal muscle cells lacking the retinoblastoma protein display defects in muscle gene expression and accumulate in S and G2 phases of the cell cycle.
J. Cell Biol.
135:441-456[Abstract/Free Full Text].
|
| 78.
|
Pagano, M.,
R. Pepperkok,
F. Verde,
W. Ansorge, and G. F. Draetta.
1992.
Cyclin A is required at two points in human cell cycle.
EMBO J.
11:961-971[Medline].
|
| 79.
|
Pagano, M.,
A. M. Theodoras,
S. W. Tam, and G. F. Draetta.
1994.
Cyclin D1-mediated inhibition of repair and replicative DNA synthesis in human fibroblasts.
Genes Dev.
8:1627-1639[Abstract/Free Full Text].
|
| 80.
|
Pear, W. S.,
G. P. Nolan,
M. L. Scott, and D. Baltimore.
1993.
Production of high-titer helper-free retroviruses by transient transfection.
Proc. Natl. Acad. Sci. USA
90:8392-8396[Abstract/Free Full Text].
|
| 81.
|
Peeper, D. S.,
T. M. Upton,
M. H. Ladha,
E. Neuman,
J. Zalvide,
R. Bernards,
J. A. DeCaprio, and M. Ewen.
1997.
Ras signalling linked to the cell cycle machinery by the retinoblastoma protein.
Nature
386:177-181[CrossRef][Medline].
|
| 82.
|
Pines, J., and T. Hunter.
1989.
Isolation of human cyclin cDNA: evidence for cyclin mRNA and protein regulation in the cell cycle and for interaction with p34cdc2.
Cell
58:833-846[CrossRef][Medline].
|
| 83.
|
Poon, R. Y.,
H. Toyoshima, and T. Hunter.
1995.
Redistribution of the CDK inhibitor p27 between different cyclin-CDK complexes in the mouse fibroblast cell cycle and in cells arrested with lovastatin or ultraviolet irradiation.
Mol. Biol. Cell
6:1197-1213[Abstract].
|
| 84.
|
Prelich, G.,
C.-K. Tan,
M. Kostura,
M. B. Mathews,
A. G. So,
K. M. Downey, and B. Stillman.
1987.
Functional identity of proliferating cell nuclear antigen and a DNA polymerase-delta auxiliary protein.
Nature
326:517-520[CrossRef][Medline].
|
| 85.
|
Qin, X.-Q.,
T. Chittenden,
D. Livingston, and W. G. Kaelin.
1992.
Identification of a growth suppression domain within the retinoblastoma gene product.
Genes Dev.
6:953-964[Abstract/Free Full Text].
|
| 86.
|
Quelle, D. E.,
R. A. Ashmun,
G. J. Hannon,
P. A. Rehberger,
D. Trono,
K. H. Richter,
C. Walker,
D. Beach,
C. J. Sherr, and M. Serrano.
1995.
Cloning and characterization of murine p16INK4a and p15INK4b genes.
Oncogene
11:635-645[Medline].
|
| 87.
|
Quelle, D. E.,
R. A. Ashmun,
S. A. Shurtleff,
J.-Y. Kato,
D. Bar-Sagi,
M. F. Roussel, and C. J. Sherr.
1993.
Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts.
Genes Dev.
7:1559-1571[Abstract/Free Full Text].
|
| 88.
|
Resnitzky, D., and S. I. Reed.
1995.
Different roles for cyclin D1 and E in regulation of the G1-to-S transition.
Mol. Cell. Biol.
15:3463-3469[Abstract].
|
| 89.
|
Reynisdòttir, I.,
K. Polyak,
A. Iavarone, and J. Massaguè.
1995.
Kip/Cip and Ink4 Cdk inhibitor cooperate to induce cell cycle arrest in response to TGF- .
Genes Dev.
9:1831-1845[Abstract/Free Full Text].
|
| 90.
|
Riabowol, K.,
G. Draetta,
L. Brizuela,
D. Vandre, and D. Beach.
1989.
The cdc2 kinase is a nuclear protein that is essential for mitosis in mammalian cells.
Cell
57:393-401[CrossRef][Medline].
|
| 91.
|
Riley, D. J.,
E. Y.-H. P. Lee, and W.-H. Lee.
1994.
The retinoblastoma protein: more than a tumor suppressor.
Annu. Rev. Cell Biol.
10:1-29[CrossRef].
|
| 92.
|
Rouault, J.-P.,
N. Falette,
F. Guéhenneux,
C. Guillot,
R. Rimokh,
Q. Wang,
C. Berthet,
C. Moyret-Lalle,
P. Savatier,
B. Pain,
P. Shaw,
R. Berger,
J. Samarut,
J.-P. Magaud,
M. Ozturk,
C. Samarut, and A. Puisieux.
1996.
Identification of BTG2, an antiproliferative p53-dependent component of the DNA damage cellular response pathway.
Nat. Genet.
14:482-486[CrossRef][Medline].
|
| 93.
|
Rouault, J.-P.,
D. Prevot,
C. Berthet,
A. M. Birot,
M. Billaud,
J.-P. Magaud, and L. Corbo.
1998.
Interaction of BTG1 and p53-regulated BTG2 gene products with mCaf1, the murine homolog of a component of the yeast CCR4 transcriptional regulatory complex.
J. Biol. Chem.
273:22563-22569[Abstract/Free Full Text].
|
| 94.
|
Rouault, J.-P.,
R. Rimokh,
C. Tessa,
G. Paranhos,
M. Ffrench,
L. Duret,
M. Garoccio,
D. Germain,
J. Samarut, and J.-P. Magaud.
1992.
BTG1, a member of a new family of antiproliferative genes.
EMBO J.
11:1663-1670[Medline].
|
| 95.
|
Rudkin, B. B.,
P. Lazarovici,
B.-Z. Levi,
Y. Abe,
K. Fujita, and G. Guroff.
1989.
Cell cycle-specific action of nerve growth factor in PC12 cells: differentiation without proliferation.
EMBO J.
8:3319-3325[Medline].
|
| 96.
|
Rusconi, S.,
Y. Severne,
O. Georgiev,
I. Galli, and S. Wieland.
1990.
A novel expression assay to study transcriptional activators.
Gene
89:211-221[CrossRef][Medline].
|
| 97.
|
Sanchez, I., and B. D. Dynlacht.
1996.
Transcriptional control of the cell cycle.
Curr. Opin. Cell Biol.
8:318-324[CrossRef][Medline].
|
| 98.
|
Schild, D.
1995.
Suppression of a new allele of the yeast RAD52 gene by overexpression of RAD51, mutations in srs2 and ccr4, or mating-type heterozygosity.
Genetics
140:115-127[Abstract].
|
| 99.
|
Serrano, M.,
G. J. Hannon, and D. Beach.
1993.
A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4.
Nature
366:704-707[CrossRef][Medline].
|
| 100.
|
Shapiro, G. I.,
C. D. Edwards,
M. E. Ewen, and B. J. Rollins.
1998.
p16INK4A participates in a G1 arrest checkpoint in response to DNA damage.
Mol. Cell. Biol.
18:378-387[Abstract/Free Full Text].
|
| 101.
|
Sherr, C. J.
1995.
D-type cyclins.
Trends Biochem. Sci.
20:187-190[CrossRef][Medline].
|
| 102.
|
Sherr, C. J.
1996.
Cancer cell cycles.
Science
274:1672-1677[Abstract/Free Full Text].
|
| 103.
|
Sherr, C. J., and J. M. Roberts.
1995.
Inhibitors of mammalian G1 cyclin-dependent kinases.
Genes Dev.
9:1149-1163[Free Full Text].
|
| 104.
|
Shivji, M. K. K.,
M. K. Kenny, and R. D. Wood.
1992.
Proliferating cell nuclear antigen is required for DNA excision repair.
Cell
69:367-374[CrossRef][Medline].
|
| 105.
|
Stamenkovic, I., and B. Seed.
1988.
Analysis of two cDNA clones encoding the B lymphocyte antigen CD20 (B1, Bp35), a type III integral membrane protein.
J. Exp. Med.
167:1975-1980[Abstract/Free Full Text].
|
| 106.
|
Tam, S. W.,
J. W. Shay, and M. Pagano.
1994.
Differential expression and cell cycle regulation of the cyclin-dependent kinase 4 inhibitor p16Ink4.
Cancer Res.
54:5816-5820[Abstract/Free Full Text].
|
| 107.
|
Tam, S. W.,
A. M. Theodoras,
J. W. Shay,
G. F. Draetta, and M. Pagano.
1994.
Differential expression and regulation of cyclin D1 protein in normal and tumor human cells: association with Cdk4 is required for cyclin D1 function in G1 progression.
Oncogene
9:2663-2674[Medline].
|
| 108.
|
Tirone, F., and E. M. Shooter.
1989.
Early gene regulation by nerve growth factor: induction of an interferon related gene.
Proc. Natl. Acad. Sci. USA
86:2088-2092[Abstract/Free Full Text].
|
| 109.
|
Toyoshima, H., and T. Hunter.
1994.
p27, a novel inhibitor of G1 cyclin-CDK protein kinase activity, is related to p21.
Cell
78:67-74[CrossRef][Medline].
|
| 110.
|
Van den Heuvel, S., and E. Harlow.
1993.
Distinct roles for cyclin-dependent kinases in cell cycle control.
Science
262:2050-2054[Abstract/Free Full Text].
|
| 111.
|
Vlach, J.,
S. Hennecke,
K. Alevizopoulos,
D. Conti, and B. Amati.
1996.
Growth arrest by the cyclin-dependent kinase inhibitor p27Kip1 is abrogated by c-Myc.
EMBO J.
15:6595-6604[Medline].
|
| 112.
|
Waldman, T.,
K. W. Kinzler, and B. Vogelstein.
1995.
p21 is necessary for the p53-mediated G1 arrest in human cancer cells.
Cancer Res.
55:5187-5190[Abstract/Free Full Text].
|
| 113.
|
Watanabe, G.,
C. Albanese,
R. J. Lee,
A. Reutens,
G. Vairo,
B. Henglein, and R. G. Pestell.
1998.
Inhibition of cyclin D1 kinase activity is associated with E2F-mediated inhibition of cyclin D1 promoter activity through E2F and Sp1.
Mol. Cell. Biol.
18:3212-3222[Abstract/Free Full Text].
|
| 114.
|
Weinberg, R. A.
1995.
The retinoblastoma protein and cell cycle control.
Cell
81:323-330[CrossRef][Medline].
|
| 115.
|
Xiong, Y.,
G. J. Hannon,
H. Zhang,
D. Casso,
R. Kobayashi, and D. Beach.
1993.
p21 is a universal inhibitor of cyclin kinases.
Nature
366:701-704[CrossRef][Medline].
|
| 116.
|
Xiong, Y.,
H. Zhang, and D. Beach.
1992.
D-type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA.
Cell
71:505-514[CrossRef][Medline].
|
| 117.
|
Yan, G. Z., and E. B. Ziff.
1997.
Nerve growth factor induces transcription of the p21 WAF1/CIP1 and cyclin D1 genes in PC12 cells by activating the SP1 transcription factor.
J. Neurosci.
17:6122-6132[Abstract/Free Full Text].
|
| 118.
|
Yoshida, Y.,
S. Matsuda,
N. Ikematsu,
J. Kawamura-Tsuzuku,
J. Inazawa,
H. Umemori, and T. Yamamoto.
1998.
ANA, a novel member of Tob/BTG1 family, is expressed in the ventricular zone of the developing central nervous system.
Oncogene
16:2687-2693[CrossRef][Medline].
|
| 119.
|
Zacksenhaus, E.,
Z. Jiang,
D. Chung,
J. D. Marth,
R. A. Phillips, and B. L. Gallie.
1996.
pRb controls proliferation, differentiation, and death of skeletal muscle cells and other lineages during embryogenesis.
Genes Dev.
10:3051-3064[Abstract/Free Full Text].
|
| 120.
|
Zhan, Q.,
F. Carrier, and A. J. Fornace, Jr.
1993.
Induction of cellular p53 activity by DNA-damaging agents and growth arrest.
Mol. Cell. Biol.
13:4242-4250[Abstract/Free Full Text].
|
| 121.
|
Zhang, H.,
G. J. Hannon, and D. Beach.
1994.
p21-containing cyclin kinases exist in both active and inactive states.
Genes Dev.
8:1750-1758[Abstract/Free Full Text].
|
| 122.
|
Zhu, L.,
S. van den Heuvel,
K. Helin,
A. Fattaey,
M. Ewen,
D. Livingston,
N. Dyson, and E. Harlow.
1993.
Inhibition of cell proliferation by p107, a relative of the retinoblastoma protein.
Genes Dev.
7:1111-1125[Abstract/Free Full Text].
|
Molecular and Cellular Biology, March 2000, p. 1797-1815, Vol. 20, No. 5
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Attardo, A., Fabel, K., Krebs, J., Haubensak, W., Huttner, W. B., Kempermann, G.
(2009). Tis21 Expression Marks Not Only Populations of Neurogenic Precursor Cells but Also New Postmitotic Neurons in Adult Hippocampal Neurogenesis. Cereb Cortex
0: bhp100v1-bhp100
[Abstract]
[Full Text]
-
Yang, X., Morita, M., Wang, H., Suzuki, T., Yang, W., Luo, Y., Zhao, C., Yu, Y., Bartlam, M., Yamamoto, T., Rao, Z.
(2008). Crystal structures of human BTG2 and mouse TIS21 involved in suppression of CAF1 deadenylase activity. Nucleic Acids Res
36: 6872-6881
[Abstract]
[Full Text]
-
Kim, B. C., Ryu, M. S., Oh, S. P., Lim, I. K.
(2008). TIS21/BTG2 Negatively Regulates Estradiol-Stimulated Expansion of Hematopoietic Stem Cells by Derepressing Akt Phosphorylation and Inhibiting mTOR Signal Transduction. Stem Cells
26: 2339-2348
[Abstract]
[Full Text]
-
Schug, T. T., Berry, D. C., Toshkov, I. A., Cheng, L., Nikitin, A. Y., Noy, N.
(2008). Overcoming retinoic acid-resistance of mammary carcinomas by diverting retinoic acid from PPAR{beta}/{delta} to RAR. Proc. Natl. Acad. Sci. USA
105: 7546-7551
[Abstract]
[Full Text]
-
Manukyan, A., Zhang, J., Thippeswamy, U., Yang, J., Zavala, N., Mudannayake, M. P., Asmussen, M., Schneider, C., Schneider, B. L.
(2008). Ccr4 Alters Cell Size in Yeast by Modulating the Timing of CLN1 and CLN2 Expression. Genetics
179: 345-357
[Abstract]
[Full Text]
-
Farioli-Vecchioli, S., Tanori, M., Micheli, L., Mancuso, M., Leonardi, L., Saran, A., Ciotti, M. T., Ferretti, E., Gulino, A., Pazzaglia, S., Tirone, F.
(2007). Inhibition of medulloblastoma tumorigenesis by the antiproliferative and pro-differentiative gene PC3. FASEB J.
21: 2215-2225
[Abstract]
[Full Text]
-
Donato, L. J., Suh, J. H., Noy, N.
(2007). Suppression of Mammary Carcinoma Cell Growth by Retinoic Acid: the Cell Cycle Control Gene Btg2 Is a Direct Target for Retinoic Acid Receptor Signaling. Cancer Res.
67: 609-615
[Abstract]
[Full Text]
-
Georgopoulou, N., Hurel, C., Politis, P. K., Gaitanou, M., Matsas, R., Thomaidou, D.
(2006). BM88 Is a Dual Function Molecule Inducing Cell Cycle Exit and Neuronal Differentiation of Neuroblastoma Cells via Cyclin D1 Down-regulation and Retinoblastoma Protein Hypophosphorylation. J. Biol. Chem.
281: 33606-33620
[Abstract]
[Full Text]
-
Kawakubo, H., Brachtel, E., Hayashida, T., Yeo, G., Kish, J., Muzikansky, A., Walden, P. D., Maheswaran, S.
(2006). Loss of B-cell translocation gene-2 in estrogen receptor-positive breast carcinoma is associated with tumor grade and overexpression of cyclin d1 protein.. Cancer Res.
66: 7075-7082
[Abstract]
[Full Text]
-
Passeri, D., Marcucci, A., Rizzo, G., Billi, M., Panigada, M., Leonardi, L., Tirone, F., Grignani, F.
(2006). Btg2 enhances retinoic Acid-induced differentiation by modulating histone h4 methylation and acetylation.. Mol. Cell. Biol.
26: 5023-5032
[Abstract]
[Full Text]
-
Pacary, E., Legros, H., Valable, S., Duchatelle, P., Lecocq, M., Petit, E., Nicole, O., Bernaudin, M.
(2006). Synergistic effects of CoCl2 and ROCK inhibition on mesenchymal stem cell differentiation into neuron-like cells. J. Cell Sci.
119: 2667-2678
[Abstract]
[Full Text]
-
Rahmani, Z.
(2006). APRO4 negatively regulates Src tyrosine kinase activity in PC12 cells. J. Cell Sci.
119: 646-658
[Abstract]
[Full Text]
-
Boiko, A. D., Porteous, S., Razorenova, O. V., Krivokrysenko, V. I., Williams, B. R., Gudkov, A. V.
(2006). A systematic search for downstream mediators of tumor suppressor function of p53 reveals a major role of BTG2 in suppression of Ras-induced transformation. Genes Dev.
20: 236-252
[Abstract]
[Full Text]
-
Hong, J. W., Ryu, M. S., Lim, I. K.
(2005). Phosphorylation of Serine 147 of tis21/BTG2/pc3 by p-Erk1/2 Induces Pin-1 Binding in Cytoplasm and Cell Death. J. Biol. Chem.
280: 21256-21263
[Abstract]
[Full Text]
-
Micheli, L., Leonardi, L., Conti, F., Buanne, P., Canu, N., Caruso, M., Tirone, F.
(2005). PC4 Coactivates MyoD by Relieving the Histone Deacetylase 4-Mediated Inhibition of Myocyte Enhancer Factor 2C. Mol. Cell. Biol.
25: 2242-2259
[Abstract]
[Full Text]
-
Park, S., Lee, Y. J., Lee, H.-J., Seki, T., Hong, K.-H., Park, J., Beppu, H., Lim, I. K., Yoon, J.-W., Li, E., Kim, S.-J., Oh, S. P.
(2004). B-Cell Translocation Gene 2 (Btg2) Regulates Vertebral Patterning by Modulating Bone Morphogenetic Protein/Smad Signaling. Mol. Cell. Biol.
24: 10256-10262
[Abstract]
[Full Text]
-
Berthet, C., Morera, A.-M., Asensio, M.-J., Chauvin, M.-A., Morel, A.-P., Dijoud, F., Magaud, J.-P., Durand, P., Rouault, J.-P.
(2004). CCR4-Associated Factor CAF1 Is an Essential Factor for Spermatogenesis. Mol. Cell. Biol.
24: 5808-5820
[Abstract]
[Full Text]
-
Harnett, M. M.
(2004). CD40: A Growing Cytoplasmic Tale. Sci Signal
2004: pe25-pe25
[Abstract]
[Full Text]
-
Canzoniere, D., Farioli-Vecchioli, S., Conti, F., Ciotti, M. T., Tata, A. M., Augusti-Tocco, G., Mattei, E., Lakshmana, M. K., Krizhanovsky, V., Reeves, S. A., Giovannoni, R., Castano, F., Servadio, A., Ben-Arie, N., Tirone, F.
(2004). Dual Control of Neurogenesis by PC3 through Cell Cycle Inhibition and Induction of Math1. J. Neurosci.
24: 3355-3369
[Abstract]
[Full Text]
-
Struckmann, K., Schraml, P., Simon, R., Elmenhorst, K., Mirlacher, M., Kononen, J., Moch, H.
(2004). Impaired Expression of the Cell Cycle Regulator BTG2 Is Common in Clear Cell Renal Cell Carcinoma. Cancer Res.
64: 1632-1638
[Abstract]
[Full Text]
-
Chen, J.-G., Yang, C.-P. H., Cammer, M., Band Horwitz, S.
(2003). Gene Expression and Mitotic Exit Induced by Microtubule-Stabilizing Drugs. Cancer Res.
63: 7891-7899
[Abstract]
[Full Text]
-
Yanaka, N., Imai, Y., Kawai, E., Akatsuka, H., Wakimoto, K., Nogusa, Y., Kato, N., Chiba, H., Kotani, E., Omori, K., Sakurai, N.
(2003). Novel Membrane Protein Containing Glycerophosphodiester Phosphodiesterase Motif Is Transiently Expressed during Osteoblast Differentiation. J. Biol. Chem.
278: 43595-43602
[Abstract]
[Full Text]
-
Burns, K. H., Owens, G. E., Ogbonna, S. C., Nilson, J. H., Matzuk, M. M.
(2003). Expression Profiling Analyses of Gonadotropin Responses and Tumor Development in the Absence of Inhibins. Endocrinology
144: 4492-4507
[Abstract]
[Full Text]
-
Rylski, M., Welch, J. J., Chen, Y.-Y., Letting, D. L., Diehl, J. A., Chodosh, L. A., Blobel, G. A., Weiss, M. J.
(2003). GATA-1-Mediated Proliferation Arrest during Erythroid Maturation. Mol. Cell. Biol.
23: 5031-5042
[Abstract]
[Full Text]
-
Morel, A.-P., Sentis, S., Bianchin, C., Le Romancer, M., Jonard, L., Rostan, M.-C., Rimokh, R., Corbo, L.
(2003). BTG2 antiproliferative protein interacts with the human CCR4 complex existing in vivo in three cell-cycle-regulated forms. J. Cell Sci.
116: 2929-2936
[Abstract]
[Full Text]
-
Rocha, S., Martin, A. M., Meek, D. W., Perkins, N. D.
(2003). p53 Represses Cyclin D1 Transcription through Down Regulation of Bcl-3 and Inducing Increased Association of the p52 NF-{kappa}B Subunit with Histone Deacetylase 1. Mol. Cell. Biol.
23: 4713-4727
[Abstract]
[Full Text]
-
Yoshida, Y., Nakamura, T., Komoda, M., Satoh, H., Suzuki, T., Tsuzuku, J. K., Miyasaka, T., Yoshida, E. H., Umemori, H., Kunisaki, R. K., Tani, K., Ishii, S., Mori, S., Suganuma, M., Noda, T., Yamamoto, T.
(2003). Mice lacking a transcriptional corepressor Tob are predisposed to cancer. Genes Dev.
17: 1201-1206
[Abstract]
[Full Text]
-
Qi, H., Aguiar, D. J., Williams, S. M., La Pean, A., Pan, W., Verfaillie, C. M.
(2003). Identification of genes responsible for osteoblast differentiation from human mesodermal progenitor cells. Proc. Natl. Acad. Sci. USA
100: 3305-3310
[Abstract]
[Full Text]
-
Satake, H., Chen, H. Y., Varki, A.
(2003). Genes Modulated by Expression of GD3 Synthase in Chinese Hamster Ovary Cells. EVIDENCE THAT THE Tis21 GENE IS INVOLVED IN THE INDUCTION OF GD3 9-O-ACETYLATION. J. Biol. Chem.
278: 7942-7948
[Abstract]
[Full Text]
-
Chen, Y.-W., Nader, G. A, Baar, K. R, Fedele, M. J, Hoffman, E. P, Esser, K. A
(2002). Response of rat muscle to acute resistance exercise defined by transcriptional and translational profiling. J. Physiol.
545: 27-41
[Abstract]
[Full Text]
-
Maekawa, M., Nishida, E., Tanoue, T.
(2002). Identification of the Anti-proliferative Protein Tob as a MAPK Substrate. J. Biol. Chem.
277: 37783-37787
[Abstract]
[Full Text]
-
Su, A. I., Guidotti, L. G., Pezacki, J. P., Chisari, F. V., Schultz, P. G.
(2002). Gene expression during the priming phase of liver regeneration after partial hepatectomy in mice. Proc. Natl. Acad. Sci. USA
99: 11181-11186
[Abstract]
[Full Text]
-
Flores-Morales, A., Gullberg, H., Fernandez, L., Stahlberg, N., Lee, N. H., Vennstrom, B., Norstedt, G.
(2002). Patterns of Liver Gene Expression Governed by TR{beta}. Mol. Endocrinol.
16: 1257-1268
[Abstract]
[Full Text]
-
Houldsworth, J., Heath, S. C., Bosl, G. J., Studer, L., Chaganti, R. S. K.
(2002). Expression Profiling of Lineage Differentiation in Pluripotential Human Embryonal Carcinoma Cells. Cell Growth Differ.
13: 257-264
[Abstract]
[Full Text]
-
Suzuki, T., K-Tsuzuku, J., Ajima, R., Nakamura, T., Yoshida, Y., Yamamoto, T.
(2002). Phosphorylation of three regulatory serines of Tob by Erk1 and Erk2 is required for Ras-mediated cell proliferation and transformation. Genes Dev.
16: 1356-1370
[Abstract]
[Full Text]
-
Schwarze, S. R., DePrimo, S. E., Grabert, L. M., Fu, V. X., Brooks, J. D., Jarrard, D. F.
(2002). Novel Pathways Associated with Bypassing Cellular Senescence in Human Prostate Epithelial Cells. J. Biol. Chem.
277: 14877-14883
[Abstract]
[Full Text]
-
Dadgostar, H., Zarnegar, B., Hoffmann, A., Qin, X.-F., Truong, U., Rao, G., Baltimore, D., Cheng, G.
(2002). Cooperation of multiple signaling pathways in CD40-regulated gene expression in B lymphocytes. Proc. Natl. Acad. Sci. USA
99: 1497-1502
[Abstract]
[Full Text]
-
Ehrlich, M., Buchanan, K. L., Tsien, F., Jiang, G., Sun, B., Uicker, W., Weemaes, C. M.R., Smeets, D., Sperling, K., Belohradsky, B. H., Tommerup, N., Misek, D. E., Rouillard, J.-M., Kuick, R., Hanash, S. M.
(2001). DNA methyltransferase 3B mutations linked to the ICF syndrome cause dysregulation of lymphogenesis genes. Hum Mol Genet
10: 2917-2931
[Abstract]
[Full Text]
-
Ficazzola, M. A., Fraiman, M., Gitlin, J., Woo, K., Melamed, J., Rubin, M. A., Walden, P. D.
(2001). Antiproliferative B cell translocation gene 2 protein is down-regulated post-transcriptionally as an early event in prostate carcinogenesis. Carcinogenesis
22: 1271-1279
[Abstract]
[Full Text]
-
Prevot, D., Morel, A.-P., Voeltzel, T., Rostan, M.-C., Rimokh, R., Magaud, J.-P., Corbo, L.
(2001). Relationships of the Antiproliferative Proteins BTG1 and BTG2 with CAF1, the Human Homolog of a Component of the Yeast CCR4 Transcriptional Complex. INVOLVEMENT IN ESTROGEN RECEPTOR alpha SIGNALING PATHWAY. J. Biol. Chem.
276: 9640-9648
[Abstract]
[Full Text]