INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The interplay among the multiple nuclear factor-DNA complexes formed at the enhancers (enhanceosomes) and their cis-linked promoters (polymerase II [pol II] preinitiation complexes) is essential for the regulation of many eukaryotic genes (reviewed in references 6 and 9). Several modes of actions have been proposed for the enhanceosome function. Some enhanceosomes, such as the locus control region (LCR) of the human -globin locus (reviewed in references 16, 20, and 22) may set up and/or maintain an active chromatin state of a gene or locus domain, thus allowing the formation of active pol II preinitiation complex. On the other hand, enhanceosomes could also facilitate the assembly of active pol II preinitiation complex by direct interaction with, or recruitment of, coactivators and different basal transcription factors (reference 6 and references therein).

HS-40 is an element located at 40 kb upstream of the human -globin locus (Fig. 1). Genetic and molecular data have indicated that it is essential for transcriptional regulation of the human embryonic - and adult -globin promoters during erythroid development (21). Most of the -globin gene cluster maintains an open chromatin structure in both erythroid and nonerythroid cells, possibly due to the transcription of certain ubiquitous genes (54). Further remodeling and modification of the chromatin structure must occur in erythroid cells, however, since several new HS sites appear, including those at the HS-40 element and the promoter regions of the - and -globin genes (54, 59). These latter sites apparently result from erythroid lineage-specific binding of nuclear factors to the above transcriptional regulatory elements, as demonstrated by previous genomic footprint analysis of HS-40 (50, 60) and of the -globin upstream promoters (47).

View larger version (19K): [in this window] [in a new window]   FIG. 1.   (A) Physical map of the human -like globin gene locus. A 110-bp region containing the HS-40 element is blown up below the cluster map. The different factor-binding motifs, as mapped previously (for references, see text), are indicated. (B) Nucleotide sequences of wild-type and mutant motifs of HS-40. The wild-type sequences are shown in full, with the central binding sites for nuclear factors indicated with thick letters. The mutated bases of the lower strands are indicated by the downward arrows.

HS-40 acts as a classical enhancer in transient transfection assays (44, 46, 60), and it confers appropriate developmental control of the human -globin promoter activity in transgenic mice (19, 23, 45, 56). In vitro and in vivo binding studies have shown that the HS-40 enhanceosome consists mainly of six DNA sequence motifs that are bound with nuclear factors in an erythroid lineage-specific manner: two NF-E2/AP1 motifs (5'-NA and 3'-NA), three GATA-1 motifs (b, c, and d), and a GT motif (26, 50, 60) (Fig. 1A). Of these, the NF-E2/AP1 motifs could be recognized by the erythroid-enriched factor NF-E2, the ubiquitous AP1, the homodimers of small Maf family, or other proteins such as Nrf1, Nrf2, Nrf3, Bach1, and Bach2 (reviewed in references 7, 30, and 39). The GATA-1 motif is recognized by the erythroid-enriched factor GATA-1 (26, 52). Sp1 is the predominant protein binding to the GT motif in vitro (12, 26). Relatively little is known regarding proteins or factors bound in the outer layer of the HS-40 enhanceosome. It has been shown though that NF-E2 can associate with one of the transcription coactivators (CREB-binding protein) (11), the general transcription factors (1), a class of WW domain-containing proteins including the ubiquitin ligase Rsp5 (17, 38), and a novel transcription corepressor (N. R. Gavva, P. Daftari, L.-P. Yang, and C.-K. J. Shen, unpublished data). Also, GATA-1 factor can interact with Sp1 (36) as well as with an erythroid-specific coactivator, FOG (53).

With the use of site-directed mutagenesis and transient transfection, we have previously shown that HS-40 motifs 5'-NA, 3'-NA, GT, and GATA-1(c), but not GATA-1(b) or GATA-1(d), positively regulate the erythroid-specific enhancer function of HS-40 on the expression of both - and -globin promoters in human embryonic/fetal erythroid cell line K562 (47, 61). Furthermore, competitive factor binding at the 3'-NA motif appears to modulate the function of HS-40 as a negative regulatory element for human -globin promoter expression during the embryonic-to-fetal development (23, 47, 61). In particular, a 1-bp mutation in the 3'-NA motif, which was expected to abolish NF-E2 binding but not that of AP1 (see Discussion), converts HS-40 to a potent erythroid-specific enhancer for the expression of human -globin promoter in fetal and adult erythroid cells (23, 61).

To further understand the molecular basis of the regulatory function of HS-40 during erythroid development, we have analyzed the interplay of four factor-binding motifs in the assembly of the HS-40 enhanceosome. In particular, we examined whether individual factor-DNA complexes within HS-40 interact with each other to form the molecular switch. That is, is there a hierarchy so that pivotal binding at one motif is prerequisite for factor-DNA complex formation at the other motifs? Because of its involvement in the developmental stage specificity of the -globin gene expression, the 3'-NA motif is the main focus of this study. In particular, we designed experiments to further clarify the possible involvement of several nuclear factors in the competitive binding at the 3'-NA motif and consequently the developmental function of HS-40 in erythroid cells.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Plasmids. All recombinant DNA work was done according to standard procedures (48). Construction of the plasmids for stable DNA transfection of K562 cells has been described previously (60, 61). Briefly, a promoterless human growth hormone (AGH)-containing plasmid (p0GH; Nichols Institute) was used to generate plasmid pB-590GH, which contains a DNA fragment extending from 574 to +21 of the human 1-globin gene cloned at immediately 5' of the hGH gene in p0GH. The wild type HS-40 and different mutant HS-40 fragments generated by site-directed mutagenesis (Fig. 1B) were individually cloned upstream of the 1-globin promoter in pB-590GH. Only plasmids containing HS-40 in the genomic orientation relative to the 1-globin promoter were used for stable transfection. Plasmid pRSV-MafK for transient transfection of COS-7 cells was constructed by first release of the MafK cDNA insert from p18 containing pMT2 (57) with EcoRI digestion. The fragment was then cloned into a HindIII/NotI-cut and blunt-ended pRSV-c-jun vector (3) to generate pRSV-MafK. To express recombinant MafK in Escherichia coli, the MafK cDNA was cloned into the EcoRI site of pGEX-4-T2 (Pharmacia Biotech) to create pGEX-MafK. For in vitro transcription and translation, the MafK cDNA was cloned into the EcoRI site of pBluescript II SK (Stratagene).

Stable DNA transfection of K562 cells. Human erythroid K562 cells were cultured under 5% CO₂ in RPMI 1640 medium containing 10% fetal bovine serum, 50 µg of streptomycin per ml, and 5 U of penicillin per µl (GIBCO). For stable integration experiments, cells were harvested at densities of approximately 10⁶ cells/ml. A total of 0.5 × 10⁷ cells were pelleted and resuspended in 0.4 ml of RPMI 1640 medium containing 15 µg of test plasmids, 1 µg of pUC9 neo^k (a gift from T. Ley), and 35 µg of carrier salmon sperm DNA. DNA samples were electroporated into the cells with Bio-Rad Gene Pulser. Pools of stable integrants were obtained after growth for 2 weeks under selection with the drug G418 (600 µg/ml).

In vivo footprinting. The status of nuclear factor binding in the living K562 cells was investigated by dimethyl sulfate (DMS) cleavage in vivo and ligation-mediated PCR (LMPCR) as described previously (40, 43, 60). The endogenous HS-40 was analyzed with primer set E (413 [5'-TCAGGCTTTGCCCCTGAAGC-3'], 295 [5'-AGGCTTTGCCCTGAAGCCTGGCTGT-3'], and 403 [5'-GGCTGTGAACACTTTGGGCATGG-3']); the genomic footprints of the transfected HS-40 were analyzed with the primer set EA (528 [5'-AAGAATTTCTGCGCAGAGCC-3'], 295 [5'-AGGTTTGCCCTGAAGCCTGGCTGT-3'], and 403 [5'-GGCTGTGAACACTTTGGGCATGG-3']).

Transient DNA transfection. For transfection of the COS-7 cell line, the cells were grown in Dulbecco modified Eagle medium-10% fetal calf serum and transfected at 60% confluency in 10-cm-diameter dishes. The DNA constructs were introduced as a calcium phosphate coprecipitate consisting of 30 µg of pRSV-MafK. pRSV was used for control transfections. Sixteen hours after addition of the calcium phosphate DNA precipitate, the medium was changed and cells were incubated for an additional 48 h before whole cell extract preparation.

EMSA. Proteins used for electrophoretic mobility shift assay (EMSA) were prepared in the following ways. Whole cell extracts from K562 and COS-7 were prepared as described elsewhere (27). K562 nuclear extracts were prepared as described by Dignam (14). Extract preparation was done in the presence of phenylmethylsulfonyl fluoride, leupeptin, aprotinin, and pepstatin. To prepare glutathione S-transferase (GST) fusion proteins, E. coli BL21 cells were transformed with pGEX-MafK or pGEX-4-T2 (control) and grown to an optical density at 600 nm of 0.7; fusion protein was induced for 6 h with isopropyl--D-thiogalactopyranoside (0.1 mM). Crude lysates were prepared by mild sonication of the bacteria on ice, using short bursts. Extracts were cleared by centrifugation (12,000 × g), and the supernatants were stored at 80°C and used directly for EMSA. Proteins were also generated by in vitro transcription and translation using a TNT kit (Promega). Samples were incubated at 30°C for 90 min before DNA-binding activity was measured by EMSA.

Competitive binding EMSA. To analyze complex formation at 15°C as a function of time (Fig. 7A and B), whole cell extract (35 µg) was incubated with labeled probe (1.4 µCi, approximately 35 ng) at 15°C in a total volume of 130 µl. Aliquots (20 µl) of the binding reaction were loaded onto an already running polyacrylamide gel after 0, 1, 2, 4, 8, and 16 min of reaction. The binding conditions were modified so that as the binding reaction approaches equilibrium, the concentrations of the free probe were still approximately 90% of the total probe initially added, as required for a valid kinetic analysis (35). The complexes were quantified with a PhosphorImager. To evaluate the relative affinities (Fig. 7C and D), unlabeled competitor DNA oligonucleotides (5- to 80-fold, approximately 2.5 to 40 ng) were mixed with the radiolabeled oligomer prior to addition of the extract. To assess the stabilities of the complexes (Fig. 7E and F), whole cell extract (140 µg) was first incubated with labeled DNA (140,000 cpm, approximately 3.5 ng) for 15 min at room temperature. A 1,000-fold molar excess of 3'-NA oligonucleotide as the competitor (approximately 3.5 µg) was added, and aliquots of the binding reaction were loaded onto a continuously running gel after further incubation at 15°C for different time periods.

Chromatin immunoprecipitation. The procedures and conditions for formaldehyde fixation in vivo, sonication, and immunoprecipitation of chromatin were as described by Orlando and Paro (42). The preparation and use of anti-NF-E2 and anti-c-Jun antibodies for chromatin precipitation and PCR analysis were as described in detail elsewhere (13). Fixed and sonicated chromatin fragments from K562 and HeLa cells were immunoprecipitated with anti-NF-E2, anti-c-Jun, or preimmune sera. DNA samples in the precipitates and the supernatants were purified, and the cross-links were removed. PCR analysis was then carried out with DNA primers specific for different genomic regions. The primers for the HS-40 and -actin regions were 5'-AGCACATCTGCCCAAGCCA-3'/5'-TCAGGCTTTGCCCCTGAAGC-3' and 5'-ATCTGGCACCACACCTTCTACAATGAGCTGCG - 3' / 5' - CGTCATACTCCTGCTTGCTGATCCACATCTGC - 3', respectively.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Positive regulatory roles of HS-40 enhancer motifs for human -globin promoter activity in stably integrated K562 cells. Among the six DNA motifs of HS-40 that are bound with nuclear factors in a developmental stage- and erythroid lineage-specific manner (50, 60) (Fig. 1), at least four [5'-NA, 3'-NA, GT, and GATA-1(c)] contribute positively to the erythroid-specific activation of the human -globin promoter in K562 cells, as suggested by transient transfection analysis (47, 61). Five plasmid constructs, each containing a different mutant HS-40 linked to the human -globin-GH hybrid gene, have been stably integrated into K562 cells. As shown by the GH assay (Table 1), all mutations caused significant decrease of the -globin promoter activity, by approximately 50 to 90%, compared to the wild-type constructs. The similarity between the present stable integration assay and the previous transient transfection analysis suggests that after integration into a chromosomal environment, the above four DNA motifs still contribute in concert to the erythroid-specific enhancer function of HS-40.

Functional roles of individual factor-binding motifs in the assembly of the HS-40 enhanceosome. The genomic footprinting techniques were applied to investigate the contribution of the individual factor-binding motifs to the assembly of HS-40 enhanceosome. The transfected pools contain cells with a wide range in copy numbers of the integrated transgenes. Since multiple copies of integrated plasmids could titrate out limited amounts of certain nuclear factors, we first selected for cells with low copy numbers of the transgenes. A few clones for each of the five transfected mutant plasmids were isolated. Their expression levels of the transgenes relative to the wild type are also listed in Table 1. For each mutant construct, cells from two different clones with two copies of integrated plasmids (Table 1) were treated with DMS and subjected to LMPCR analysis. The choice of the copy number is somewhat arbitrary, because that is the lowest number of plasmid integration we could obtain for each of the five different mutant constructs used for transfection. It should be noted here that a similar approach has been used to investigate nuclear factor binding of other transcriptional regulatory elements, for example, the HLA-DRA promoter (58).

View larger version (93K): [in this window] [in a new window]   FIG. 2.   In vivo DMS footprints of wild-type and mutant HS-40 in stably integrated K562 cells. Representative autoradiographs of the analysis of the upper strand of HS-40 by DMS protection assay and LMPCR are shown. Locations of the motifs are indicated by brackets on the left. Numbers on the right correlate with those used in Fig. 1A and reference 61. Protected and hyperreactive residues are denoted by open and closed circles, respectively, on the right of each panel. The large open and closed circles are used when the extents of protection and the relative hypersensitivities, respectively, in vivo (K lanes) are greater than 50% compared to the purified DNA controls (N lanes). The small circle indicate those that are 25% greater than the controls. Also, only those residues consistently showing differences from the controls are indicated. Certain nucleotides, such as residue 175, occasionally did not exhibit an obvious difference (e.g., lanes 1 and 2 in panel C) but did in other sets of the experiments. (A) Footprint of the endogenous (END) HS-40 region; (B) wild type; (C to G) plasmids with HS-40 mutations corresponding to those listed in Fig. 1B. Cell clones with the same copy number of integrated plasmids (Table 1) exhibit similar footprints (data not shown).

View larger version (30K): [in this window] [in a new window]   FIG. 3.   Summary of the genomic footprint analysis of HS-40. The top map depicts the factor-binding patterns in vivo of the endogenous HS-40 and the transfected wild-type HS-40, which are indistinguishable. Positions of the mutated base pairs in the different mutant HS-40 motifs are indicated by "x." Motifs occupied in vivo, as reflected by the genomic footprint analysis of Fig. 2, are covered with different symbols representing the factors bound at the motifs. The random-shaped symbols at the mutated 5'-NA and 3'-NA motifs indicate altered factor binding at these motifs (see text for more details).

NF-E2 recognizes the 3'-NA(II) motif but with a lower binding activity. EMSA was first used to analyze the effect of the 1-bp mutation NA(II) on nuclear factor-DNA interaction at the 3'-NA motif. The binding reactions were carried out with K562 whole cell extract (Fig. 4A), using oligonucleotides containing the 3'-NA and 3'-NA(II) sequences. Binding of NF-E2 to both of these sequences could be detected, although the intensity of the complex formed at the mutant 3'-NA(II) sequence appears to be weaker (compare lanes 1 and 4 in Fig. 4A). Both NF-E2-DNA complexes could be removed by anti-p45 (lanes 3 and 6) but not by the preimmune serum (lanes 2 and 5). The two motifs could also bind AP1 (Fig. 4A). The authenticity of the AP1-DNA complex was also confirmed with anti-c-Jun (Fig. 4B).

View larger version (29K): [in this window] [in a new window]   FIG. 4.   EMSA of 3'-NA and 3'-NA(II) oligonucleotides in K562 extracts. For panels A and B, the whole cell extract was used either directly (lanes 1, 4, 7, and 9) or preincubated with preimmune (PI) serum (lanes 2 and 5), anti-p45 antiserum (lanes 3 and 6), and anti-c-Jun antiserum (lanes 8 and 10); for panel C, K562 nuclear extract was used instead. NF-E2 and AP1 indicate the NF-E2-DNA and AP1-DNA complexes, respectively; a and b are complexes of unknown identities.

View larger version (47K): [in this window] [in a new window]   FIG. 5.   NF-E2/AP1 binding sites and their 5'-G/T mutations. Oligonucleotides are shown double stranded, and the restriction sites at their ends are boxed. The 5'-G/T mutations in HS-2mut (41) PDBG-mut (37), and 3'-NA(II) (26) as well as the one nucleotide in 5'-NA not corresponding to the NF-E2 consensus sequence are shown in bold. Sequences corresponding to the NF-E2 consensus are boxed, while the AP1 consensus motif in each oligonucleotide is underlined. For comparison, the upper strands of the consensus motifs for NF-E2 (2), Maf (28), and AP1 (28) binding are shown.

View larger version (45K): [in this window] [in a new window]   FIG. 6.   EMSA of 3'-NA-, 3'-NA(II)-, and 5'-NA-containing oligonucleotides with in vitro-translated MafK. The assay was carried out with unprogrammed reticulocyte lysate (u.p.; lanes 1, 4, and 7) or with in vitro-translated MafK (lanes 2, 3, 5, 6, and 8 to 11). EMSA was also carried out with the use of preimmune (PI) serum (lane 10), anti-MafK (lanes 3, 6, and 9), or anti-p45 (lane 11). S1 and S2 indicate the gel positions of the putative supershifted complexes. The identity of band a is not known.

The lower binding activity of NF-E2 to 3'-NA(II) is due to decreased complex stability. First, we performed a series of EMSA to analyze the time required for the binding of NF-E2 or AP1 to 3'-NA or 3'-NA(II) (Fig. 7A and B). Formation of the NF-E2/3'-NA complex closely paralleled that of NF-E2/3'-NA(II), in that binding of NF-E2 to either oligonucleotide was rapid and reached a steady state within 10 min (Fig. 7A). As expected, the binding of AP1 to the two oligonucleotides also appeared to be similar (Fig. 7B). The molecular basis of the apparently weaker affinity of NF-E2 to bind 3'-NA(II) than 3'-NA (Fig. 4A) was further exploited by competitive EMSA. A labeled 3'-NA oligonucleotide was mixed with increasing concentrations of unlabeled 3'-NA or 3'-NA(II) oligonucleotide prior to the addition of K562 whole cell extract. Protein binding to the labeled 3'-NA oligonucleotide was then quantified by EMSA (Fig. 7C and D). As shown in Fig. 7C, it takes less of the 3'-NA oligonucleotide to compete for binding of NF-E2 to the labeled 3'-NA oligonucleotide. Based on the molar excess of unlabeled oligonucleotides required to reduce protein binding to the labeled probe by 50%, the relative affinity of NF-E2 binding was estimated to be approximately twofold higher for 3'-NA than for 3'-NA(II) (Fig. 7C). With the same analysis, no difference in the relative binding affinities of AP1 to the two sequences could be detected (Fig. 7D). Varying the time (10 to 30 min) and temperature (room temperature and 15°C) of preincubation did not significantly change the twofold ratio of relative NF-E2 binding affinities to 3'-NA and 3'-NA(II) (data not shown).

View larger version (20K): [in this window] [in a new window]   FIG. 7.   (A and B) Time courses for the binding reactions of NF-E2 (A) or AP1 (B) with DNA oligonucleotides containing the 3'-NA or 3'-NA(II) motif; (C and D) relative binding affinities of NF-E2 (C) or AP1 (D) with oligonucleotides containing either of the two motifs; (E and F) dissociation rates of complexes formed between NF-E2 (E) or AP1 (F) and the oligonucleotides containing 3'-NA or 3'-NA(II). The time point at which 50% of the displaceable complexes were removed is defined as the apparent t1/2. Under the experimental conditions used, the amounts of the displaceable NF-E2-DNA complexes were approximately 20 and 80% for the 3'-NA and 3'-NA (II) motifs, respectively. Longer incubation for up to 128 min gave similar results (data not shown). Each data point is the average of two to five independent experiments; standard deviations are indicated by error bars.

The GCTA mutation disrupts MafK binding in vitro and in vivo. The effect of the GCTA mutation on the binding of MafK to 3'-NA motif was also analyzed by EMSA (Fig. 8). Since little MafK complex forms in K562 extract (Fig. 4A), we first used crude extract from E. coli cells expressing a GST-MafK fusion protein. As shown in Fig. 8A, GST-MafK, presumably a homodimer (25), binds 3'-NA but not 3'-NA(II). A similar conclusion was reached with the use of whole cell extract from COS-7 cells transiently transfected with MafK expression plasmid. In Fig. 8B, only the 3'-NA oligonucleotide exhibited an intense band in EMSA (lane 6), which could be removed by anti-MafK (lane 7) but not by preimmune serum (data not shown).

View larger version (37K): [in this window] [in a new window]   FIG. 8.   MafK binding in vitro to 3'-NA and 3'-NA(II). (A) EMSA of 3'-NA- or 3'-NA(II)-containing oligonucleotides in crude extracts of E. coli expressing GST (lanes 1 and 3) or GST-MafK fusion protein (lanes 2 and 4). (B) EMSA of oligonucleotides in cell extracts prepared from COS-7 cells transfected with pRSV vector (lanes 5 and 8) or with pRSV-MafK (lanes 6, 7, 9, and 10). For samples loaded in lanes 7 and 10, the extract was incubated with anti-p18 prior to use.

View this table: [in this window] [in a new window]   TABLE 2.   Effect of MafK overexpression on the 1 globin promoter activities in K562 cellsa

NF-E2, but not AP1, is bound to HS-40 in vivo on HS-40 chromatin. The in vitro binding studies of Fig. 4 and 6 to 8 indicate that 3'-NA(II) is refractory to MafK binding but still can interact with NF-E2 or AP1, although the NF-E2-DNA complex is destabilized. To further examine whether AP1 or NF-E2 is involved in the regulatory function of HS-40, we performed chromatin immunoprecipitation reactions (13, 42). The notion is that stable binding in vivo on chromatin at specific DNA motifs appears to be a prerequisite for the functioning of sequence-specific DNA-binding transcription factors.

View larger version (49K): [in this window] [in a new window]   FIG. 9.   PCR analysis of the c-jun promoter, HS-40 region, and actin gene region in chromatin immunoprecipitates. PCRs were carried out with different DNA samples as the templates and analyzed by ethidium bromide-agarose gel electrophoresis. Lanes 1 to 3, serial dilutions of preimmune supernatant DNA from the immunoprecipitation. Numbers above the lanes indicate fold dilution. Lanes 4 to 6, anti-c-Jun, preimmune, and anti-NF-E2 precipitate (ppt).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

In this study, we analyzed the contributions of four individual nuclear factor-binding motifs to the assembly of the erythroid-specific enhanceosome HS-40 and investigated the identities of nuclear factors that compete for binding at the 3'-NA motif and regulate the developmental function of HS-40. Since the same set of factor-binding motifs, NA, GT, and GATA-1, are also responsible for the functions of the four HS sites within the -globin LCR, our data provide comprehensive information regarding of enhanceosome assembly of the human globin gene switch system. However, it should be noted that our discussion below of the regulatory model in Fig. 10 is based mainly on factor-DNA binding studies in vitro and in cell lines, and one should be cautious about extrapolating the findings to the in vivo situation.

View larger version (24K): [in this window] [in a new window]   FIG. 10.   Models of developmental regulation of the human -globin locus by HS-40 enhanceosome. (A and B) The switch from - to -globin gene expression involves changes of the composition and conformation of the HS-40 enhanceosome. It is proposed that the specific GCTA mutation in 3'-NA motif reverses the structure and function of HS-40-A to HS-40-E (see text for more details). (C) Three alternative schemes of competitive factor binding at the 3'-NA motif of HS-40.The data supporting and refuting each scheme are discussed in the text.

Functional and structural synergism of factor-binding motifs within HS-40. Individual nuclear factor-DNA complexes within HS-40 together contribute to the architecture and functions of the enhanceosome. Consistent with previous transient transfection studies (47, 61), mutations in each of the four HS-40 motifs all significantly lowered the activity of the cis-linked -globin promoter, by 50 to 90%, in stably integrated K562 cells (Table 1). This functional synergism most likely results from the cooperative contributions of these motifs in the assembly of a wild-type HS-40 enhanceosome. However, this cooperativity is not completely reflected by the genomic footprint analysis (Fig. 3). For instance, the HS-40 footprints of the constructs with the 5'-NA, 3'-NA(II), or GATA-1(c) mutation are not significantly different from the wild type. It should be noted, however, that different factors could bind to the same sequence motif and yet exhibit similar genomic footprints (see below). Furthermore, other architectural alterations, as the result of a mutation, could occur in the outer layer of the multiple protein-DNA complex and not affect the genomic footprints.

Competitive factor binding at the 3'-NA motif of HS-40: a refined model of human -globin gene regulation. Among the three mutations that did not significantly alter the HS-40 footprints in vivo, 3'-NA(II) (Fig. 2E) is particularly noteworthy. As already mentioned, this mutation confers HS-40 the capability to efficiently reactivate the silenced human -globin promoter at the adult stage. A model was then proposed for the developmental regulation of the human -globin gene expression (23). It stated that competitive factor binding at the 3'-NA motif of the HS-40 modulates the stage specificity of the enhancer function. In particular, dominant binding of HS-40 in adult erythroid cells by NF-E2 at the 3'-NA motif allows the formation of a specific conformation of the HS-40 enhanceosome. This complex (HS-40-A [Fig. 10A and B) could efficiently interact with and activate the -globin promoter but not that of -globin (passive repression). In the embryonic erythroid environment, on the other hand, NF-E2 binding to 3'-NA is somehow limited or inhibited, and binding of another factor such as AP1 to this motif converts HS-40 to a conformationally different enhancer, HS-40-E, preferentially activating the -globin promoter (Fig. 10A and B).