Previous Article | Next Article 
Molecular and Cellular Biology, March 2000, p. 2075-2086, Vol. 20, No. 6
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The ETO Protein Disrupted in t(8;21)-Associated Acute Myeloid
Leukemia Is a Corepressor for the Promyelocytic Leukemia Zinc
Finger Protein
Ari M.
Melnick,1
Jennifer J.
Westendorf,2
Adam
Polinger,3
Graeme W.
Carlile,3
Sally
Arai,1,4
Helen J.
Ball,3
Bart
Lutterbach,2
Scott W.
Hiebert,2 and
Jonathan
D.
Licht1,3,5,*
Department of
Medicine,1 The Derald H. Ruttenberg
Cancer Center,3 and Department of
Biochemistry and Molecular Biology,5 Mount Sinai
School of Medicine, New York, New York 10029; Department of
Biochemistry, Vanderbilt University School of Medicine, Nashville,
Tennessee 372322; and Oncology
Center, Johns Hopkins University, Baltimore, Maryland
212184
Received 27 October 1999/Returned for modification 23 November
1999/Accepted 20 December 1999
 |
ABSTRACT |
The ETO protein was originally identified by its fusion to the
AML-1 transcription factor in translocation (8;21) associated with the
M2 form of acute myeloid leukemia (AML). The resulting AML-1-ETO
fusion is an aberrant transcriptional regulator due to the ability of
ETO, which does not bind DNA itself, to recruit the transcriptional
corepressors N-CoR, SMRT, and Sin3A and histone deacetylases. The
promyelocytic leukemia zinc finger (PLZF) protein is a
sequence-specific DNA-binding transcriptional factor fused to retinoic
acid receptor
in acute promyelocytic leukemia associated with the
(11;17)(q23;q21) translocation. PLZF also mediates transcriptional repression through the actions of corepressors and histone
deacetylases. We found that ETO is one of the corepressors recruited by
PLZF. The PLZF and ETO proteins associate in vivo and in vitro, and ETO
can potentiate transcriptional repression by PLZF. The N-terminal portion of ETO forms complexes with PLZF, while the C-terminal region,
which was shown to bind to N-CoR and SMRT, is required for the ability
of ETO to augment transcriptional repression by PLZF. The second
repression domain (RD2) of PLZF, not the POZ/BTB domain, is necessary
to bind to ETO. Corepression by ETO was completely abrogated by histone
deacetylase inhibitors. This identifies ETO as a cofactor for a
sequence-specific transcription factor and indicates that, like
other corepressors, it functions through the action of histone deactylase.
 |
INTRODUCTION |
Myeloid and hematopoietic cell
development is a complex process regulated by an extensive network of
transcription factors (reviewed in references 58 and
61). These proteins coordinate the sequential
expression of gene products which results in progressive stages of
progenitor cell commitment and differentiation (14, 57, 59).
In hematological malignancies, transcription factors are often
disrupted by chromosomal translocations and fused to genes encoding
other transcriptional regulators (42, 51, 52). The resulting
aberrant factors are oncoproteins that yield altered transcriptional
patterns leading to the development of leukemia (54, 61).
One such event disrupts ETO (for eight-Twenty One), a protein
identified as part of a fusion product resulting from the translocation (8;21) found in 50% of patients with the M2 variant of acute
myelogenous leukemia (AML) (see reference 48 and
references within). Translocation (8;21) fuses ETO to AML-1, a critical
regulator of hematopoiesis (36) that activates a number of
myeloid genes, including those coding for
granulocyte/macrophage-colony-stimulating factor (CSF), macrophage-CSF, and myeloperoxidase (61) through recruitment of the CREB binding protein (CBP) or p300 and other histone acetyl transferases to the promoters of these genes (31). In
contrast, the AML-1-ETO oncoprotein is a dominant-negative form of
AML-1 which represses the promoters of genes normally activated by
AML-1 (16, 17, 44, 46). This model is highly supported by
the similar phenotypes of AML-1 knockout mice and heterozygous
AML-1/ETO knockin mice (49, 66), which include a severe
block in hematopoiesis at the fetal liver stage and fatal hemorrhages
within the central nervous system. At the molecular level, the
dominant-negative effect of AML-1-ETO is due to the ability of the ETO
moiety of the fusion protein to associate with the corepressors N-CoR,
SMRT, and Sin3A, as well as histone deacetylases 1 and 2 (HDAC1 and -2)
(17, 44, 62). Despite its ability to interact with other corepressors and HDAC, ETO itself was not previously identified as a
corepressor for any sequence-specific transcription factor.
The promyelocytic leukemia zinc finger (PLZF) protein is fused to the
retinoic acid receptor
(RAR
) in the retinoic acid-resistant t(11;17)(q23;q21) variant of acute promyelocytic leukemia (APL) (6, 19, 38). As in the case of t(8;21), this translocation yields an aberrant transcription factor. While RAR
activates key
genes required for normal myelopoiesis, PLZF-RAR
represses expression of such genes in a dominant-negative manner (7, 9, 40,
45). We showed that PLZF was a sequence-specific DNA binding
transcriptional repressor (2, 37, 67). This is due to the
ability of the PLZF moiety to attract corepressor molecules, such as
N-CoR, Sin3A, and SMRT, as well as HDAC1 (8, 20, 22, 25,
41). This interaction is, at least in part, mediated through the
N-terminal POZ/BTB (poxvirus and zinc finger/Broad Complex,
tramtrack, Bric a Brac) domain of PLZF
(25) and indicates that PLZF may repress transcription by
altering chromatin conformation. In its basal state, RAR
also
recruits N-CoR, SMRT, and HDACs to its target promoters, thus keeping
them repressed in the absence of ligand. In the presence of the ligand
all-trans retinoic acid (ATRA), corepressors are released
and coactivators are recruited, resulting in transactivation of RAR
target genes (5, 23, 26). However, in APL, the association
of the PLZF portion of PLZF/RAR
with corepressors and HDACs
prohibits activation of RAR
targets, even in the presence of high
doses of ATRA (18, 20).
PLZF is expressed in CD34+ myeloid progenitor cells and is
down-regulated during differentiation of myeloid cell lines
(53). In addition, PLZF causes growth suppression,
differentiation blocking and cell cycle delay and/or arrest in myeloid
cell lines (56, 67). These findings suggest that the
transcriptional repression mediated by PLZF needs to be switched off
for cells to differentiate and proliferate. The identity of potential
PLZF targets, including cyclin A and the interleukin 3 receptor alpha
(IL-3R
) chain, supports this hypothesis (45). Like PLZF,
ETO is expressed in CD34+ cells and several leukemic cell
lines (10, 12) and is down-regulated as hematopoietic
progenitors mature (12). However, in contrast to PLZF, ETO
was not found to bind to a specific DNA sequence (11, 35,
44). The facts that ETO can function as a powerful transcriptional repressor when fused to AML-1 and that it associates with corepressors suggest that it may normally act as a cofactor for
certain sequence-specific DNA binding repressors. In light of this
notion, we demonstrated that ETO interacts with PLZF in vivo and in
vitro through specific domains of the two proteins. Coexpression of ETO
with PLZF augments the ability of PLZF to repress transcription through
its cognate binding site. This effect was abrogated by sodium butyrate
and trichostatin A (TSA), inhibitors of HDACs. Our results suggest
that, like the N-CoR and SMRT corepressors, ETO amplifies the
transcriptional effects of PLZF by enhancing recruitment of HDACs to
target promoters.
 |
MATERIALS AND METHODS |
DNA constructs.
PLZF and PLZF deletion mutants were
expressed in mammalian cells by utilizing either the pSG5 (Stratagene,
La Jolla, Calif.) or pCDNA3.1+myc/his (Invitrogen, Carlsbad, Calif.)
expression vectors. PLZF
POZ/BTB lacks the first 120 N-terminal amino acids of PLZF and was described previously
(9). The PLZF
RD2 deletion mutant was created
by cutting pSG5 and pCDNA-PLZF with XcmI endonuclease (New
England Biolabs, Beverly, Mass.), thus deleting sequences between
positions 596 and 939 of the PLZF cDNA. The resulting large fragment of
PLZF was religated in the presence of an excess of the linker
oligonucleotides 5' GAGAGTGCCGAGCAGGTGCCACCCCCAGCT 3' and
3' CTCTCACGGCTCGTCCACGGTGGGGGTCGA 5'. This resulted in a
PLZF sequence lacking amino acids 199 to 313. A plasmid containing the
full PLZF POZ/BTB domain (amino acids 1 to 137) was generated by PCR
(28) with an N-terminal primer containing a BamHI
site (5' CGCGGATCCGTATGGATCTGACAAAAATG 3') and a C-terminal
primer containing an SfiI site and an XbaI site
(5' TCACTCTAGAGCGGCCATGGTGGCCTCCGTGTCATT 3'). The resulting
PCR products were ligated into the PCR II vector and then subcloned
into the pBXG1 GAL4(1-147) mammalian expression vector (39)
and the pAS2-1 and pACTII yeast two-hybrid vectors (Clontech, Palo
Alto, Calif.). All constructs used in this study were confirmed by
automated sequencing (Utah State University Biotechnology Center,
Logan). The GAL4-PLZF1-400 and GAL4-RD2 fusion construct
and expression vectors for ETO deletion mutants were described
previously (37, 43). Expression of all of these proteins was
confirmed by immunoblotting as described below.
Immunoprecipitation and immunoblotting.
To detect
protein-protein interactions between full-length overexpressed PLZF and
ETO (see Fig. 1 and 5), COS-7 cells were transfected, lysed, and
subjected to immunoprecipitation with anti-ETO or anti-PLZF antibodies
as described previously (44). To detect interaction between
ETO and PLZF
POZ/BTB or PLZF
RD2, 293T
cells were plated at approximately 6 × 105 cells per
well in a six-well dish. After 24 h, each well was transfected
with 0.75 µg of expression constructs and 0.75 µg of carrier
plasmid DNA by using Superfect (Qiagen, Valencia, Calif.). After
48 h, the cells were harvested for immunoprecipitation and lysed
in 0.5% Triton buffer for immunoprecipitation (21). ETO Ab-1 antibody (Oncogene Research, Cambridge, Mass.) was covalently linked to protein A-agarose beads at a ratio of 1 mg/ml. After 1 h
of incubation, the beads were washed twice with 0.2 M sodium borate (pH
9.0) and once with 0.2 M triethanolamine (pH 8.5) (Sigma, St. Louis,
Mo.). The beads were incubated for 1 h with 40 mM
dimethylpimelimidate (pH 8.5) (Sigma), followed by one wash with
triethanolamine and two with 0.2 M sodium borate (pH 8.2). The beads
were next blocked with mouse immunoglobulin G (Dako, Carpinteria,
Calif.) for 1 h, washed, and then added to lysates of transfected
293T cells for 3 h at 4°C. The precipitated proteins were
released by boiling in sodium dodecyl sulfate (SDS) loading buffer,
separated by electrophoresis through an SDS-12% polyacrylamide gel,
and transferred to an Immobilon P membrane (Millipore, Bedford, Mass.).
Immunoblotting was performed with a 1-µg/ml concentration of
monoclonal PLZF antibody (40) or a 2.5-µg/ml concentration
ETO AB-1 antibody and a 1:7,500 concentration of horseradish
peroxidase-conjugated antimouse or antirabbit secondary antibody (Roche
Molecular Biochemicals, Indianapolis, Ind.) and developed with the ECL
enhanced chemiluminescence system (Amersham Pharmacia, Buckinghamshire,
United Kingdom). Lysates from the same cells were immunoblotted with
PLZF or ETO Ab-1 antibodies as described above to confirm expression of
ETO and PLZF deletion mutants. To detect interaction between ETO and or
GAL4-PLZF fusion proteins, cells transfected as described above were
lysed and subjected to immunoprecipitation with polyclonal
anti-GAL4-DNA binding domain (DBD) antibodies (Zymed, San Francisco,
Calif.), with the resulting proteins subjected to electrophoresis and
immunoblotting with anti-ETO antibodies as described above.
Coimmunoprecipitation of endogenous PLZF and ETO was performed with
human erythroleukemia (HEL) cells. Approximately 6 × 107 cells were lysed in 0.5% Triton buffer for each
experiment and incubated with either 2.5 µg of rabbit polyclonal ETO
antibody Ab-1, PLZF monoclonal antibody, or irrelevant anti-GAL4
polyclonal antibody (Clontech, Palo Alto, Calif.) for 2 h at
4°C. This was followed by the addition of 30 µl of protein
A-conjugated agarose bead slurry (Roche Molecular Biochemicals,
Indianapolis, Ind.), which was incubated overnight at 4°C. The
precipitated proteins were resolved through an SDS-12% polyacrylamide
gel, transferred to an Immobilon P membrane, and blotted with PLZF
monoclonal antibody or polyclonal ETO Ab-1 antibody as described above.
Direct immunoblotting was performed with 100 µg of protein lysate
from HEL and EML (gift of S. Tsai, Mount Sinai School of Medicine)
cells or 1/5 (20 µl) of the lysate from transfected 293 T cells. All
lysates were submitted to SDS-polyacrylamide (12%) gel electrophoresis
(PAGE), transferred to Immobilon P, and blotted with either 1 µg of
PLZF monoclonal antibody per ml, 4 µg of our ETO rabbit polyclonal
antibody per ml (44), or 2.5 µg of ETO Ab-1 antibody per ml.
Yeast two-hybrid assay.
The PJ69-4A strain of S. cerevisiae (29) was transformed with plasmids encoding
the GAL4 DNA binding domain [GAL4(DBD)] linked to ETO or ETO mutants,
or the GAL4 acidic activation domain (GAL4-AD) linked to PLZF or the
PLZF-POZ/BTB domain. The yeast cells were then grown on media lacking
leucine (Leu), tryptophan (Trp), and adenine (Ade). To control for
transformation efficiency, an aliquot of the same yeast was also grown
on Leu
Trp
media as well. Yeast colonies
were counted and then selected in duplicate for liquid
-galactosidase assays according to the manufacturer's protocol
(Clontech). Results were normalized relative to the level of
-galactosidase generated by the self-association of PLZF. Positive
controls included transformation of yeast with a full-length GAL4
plasmid or transformation with a p53-GAL4(DBD) plasmid and a vector
encoding simian virus 40 (SV40) large T antigen fused to the GAL4-AD
(Clontech). The same p53 and T antigen plasmids were used as negative
controls for binding to PLZF and ETO. Immunoblots were performed to
confirm expression of noninteracting proteins.
Protein affinity chromatography.
Sequences encoding amino
acids 1 to 114, 217 to 385, 339 to 499, or 494 to 559 of ETO were
cloned into the pGEX4T-3 glutathione S-transferase (GST)
vector (Pharmacia Biotech AB, Uppsala, Sweden). These constructs were
then transformed into Escherichia coli strain DH5
. Single
colonies were expanded, and GST fusion proteins were induced,
extracted, and collected on glutathione-agarose beads as described
previously (1). Full-length PLZF protein was produced by
coupled in vitro transcription-translation in the presence of
[35S]methionine (1,175 Ci/mmol) (New England Nuclear,
Boston, Mass.) from pSG5-PLZF by using T7 RNA polymerase (TNT; Promega,
Madison, Wis.). Protein affinity chromatography was performed as
previously described (15). The bound proteins were separated
by SDS-PAGE (12% polyacrylamide), and the gel was fixed, soaked in
sodium salicylate, dried, and subjected to autofluorography at
80°C. Subsequently, the same gel was rehydrated and stained with
Coomassie blue to detect expression of the GST fusion proteins.
Transfection assays.
To determine the transcriptional
effects of the GAL4 fusion constructs, we used a reporter containing
five GAL4 binding sites linked 5' to the herpes virus thymidine kinase
(tk) promoter and the firefly luciferase gene
(GAL4-tk-Luc) (gift of P. Traber, University of
Pennsylvania). To assay the transcriptional effects of native PLZF, a
reporter gene containing four high-affinity PLZF sites found in the
IL-3R
chain promoter were linked 5' to the tk-luciferase
reporter (IL3R-tk-Luc) (2). Several experiments were performed with a reporter containing a large fragment of the
cyclin A promoter, which contains two binding sites for PLZF (67). A tk-luciferase construct lacking specific
binding sites was used as a negative control, and all experiments
contained the renilla tk-luciferase plasmid as an internal
control. Cells were plated in 12-well tissue culture dishes at a
density of 2 × 105 per well or in 6-well dishes at a
density of 4 × 105 per well, and after 24 h,
transient transfections were performed with Lipofectamine (Gibco BRL,
Rockville, Md.) or Superfect with the combinations and quantities of
plasmids noted in the figure legends. Transcriptional activity was
determined by dual luciferase assays (Promega, Madison, Wis.), with
activity measured with an MLX microtiter plate luminometer (Dynex
Technologies, Chantilly, Va.). Experiments were performed in duplicate
from 3 to 10 times, and the duplicate luciferase activities were
normalized to those of the internal control and averaged. These results
are presented as the fold repression of normalized luciferase activity
in the presence of PLZF and/or ETO expression vectors compared to
normalized luciferase activity in the presence of empty expression
vectors. For inhibition of HDAC, 293T cells were transfected as
described above in the presence of 200 nM TSA (Sigma) or 1 mM sodium
butyrate (gift of Sam Waxman, Mount Sinai School of Medicine). Exposure to each drug was maintained throughout the 48-h culture period.
 |
RESULTS |
PLZF interacts in vivo with ETO.
Because ETO and PLZF are
expressed in early myeloid cells and can be associated with complexes
that contain HDACs, we determined whether ETO and PLZF could physically
interact. COS-7 cells were transiently transfected with expression
vectors for both proteins. The cell lysates were then
immunoprecipitated with a monoclonal PLZF antibody and immunoblotted
with a polyclonal ETO antibody (Fig. 1A).
Overexpressed ETO is visualized as a dual band of 77 and 80 kDa in COS
and 293T cells, which may represent posttranslationally modified
species or degradation products. ETO was observed only in
immunoprecipitates from lysates containing both ETO and PLZF, but not
in lysates lacking either PLZF, ETO, or both proteins. No
coimmunoprecipitation of ETO was seen when an irrelevant antibody was
used as a negative control. The ETO-PLZF interaction was also studied
in the context of the yeast two-hybrid system. GAL4-AD-PLZF was used as
a "prey" construct to avoid any false-positive results conferred by
the ability of GAL4(DBD)-PLZF to mildly activate transcription (data
not shown). Yeast transformed with both the ETO bait and the PLZF prey
grew in adenine-deficient media, indicating a protein-protein
interaction in vivo. To confirm this interaction, the yeast cells were
expanded, lysed, and subjected to a solution
-galactosidase assay.
These studies showed a strong interaction between ETO and PLZF, similar
to the self-association of PLZF (Fig. 1B). When ETO or PLZF was
transformed alone, yeast cells did not grow on adenine-deficient media
and yeast cells from leucine- and tryptophan-deficient media, harboring
only ETO or PLZF, did not express
-galactosidase.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
The PLZF protein associates with the ETO gene product in
mammalian and yeast cells. (A) Lysates from transiently transfected
COS-7 cells were immunoprecipitated (IP) with PLZF antibody, and the
bound proteins were immunoblotted with PLZF or ETO antibodies as
indicated. Lanes: 1, mock-transfected cells; 2, ETO-transfected cells;
3, PLZF-transfected cells; 4, lysates from cells transfected with both
PLZF and ETO. (B) Yeast two-hybrid experiments, in which
-galactosidase assays were performed to detect an interaction
between ETO and PLZF. The results are normalized to the interaction
between PLZF bait and prey (lane 2). Lanes: 1, full-length GAL4 as a
positive control; 3, interaction of ETO fused to the GAL4(DBD) with
PLZF fused to the GAL4-AD; 4, lack of interaction between ETO and the
SV40 T antigen. (Because there was no growth on Ade
Leu Try media, there were no colonies to
assay for -galactosidase activity.) (C) Endogenous PLZF and ETO
proteins physically interact. Lanes: 1, immunoblot of ETO from lysates
of transfected 293T cells; 2, immunoblot of endogenous ETO in HEL
cells; 3, immunoblot of PLZF from lysates of transfected 293T cells; 4, immunoblot of PLZF after immunoprecipitation from HEL cells with PLZF
antibodies; 5, immunoprecipitation of HEL cell lysates with a
polyclonal ETO antibody Ab-1 and immunoblotting with PLZF monoclonal
antibody; 6, immunoprecipitation of HEL lysates with an irrelevant
antibody directed against the GAL4(DBD) and immunoblotting with PLZF
monoclonal antibody.
|
|
To establish the potential physiological relevance of this interaction,
we determined whether the endogenous PLZF and ETO
proteins, expressed
in hematopoietic cells, could associate. ETO
and PLZF are coexpressed
in several hematopoietic cell lines,
including HEL and EML (Fig.
1C,
lanes 2 and 4, and data not shown).
While the presence of ETO was well
documented in the HEL cell
line (
10,
35,
47), PLZF was not
previously known to be expressed
by these cells, nor was either protein
previously shown in the
multipotent EML cell line. PLZF was expressed
at low levels in
HEL cells, requiring prior immunoprecipitation of
lysate derived
from 6 × 10
7 cells with monoclonal
antibody to concentrate the available gene
product prior to
immunoblotting (Fig.
1C, lane 4). Immunoprecipitation
of the same
amount of lysate with an ETO polyclonal antibody coprecipitated
a
modest, but readily detectable portion of the available PLZF
as
compared to the amount of PLZF detected by immunoprecipitation
blot
assay for PLZF (Fig.
1C, lanes 4 and 5). An irrelevant rabbit
antibody
to the GAL4 (DBD) did not precipitate PLZF (Fig.
1C,
lane
6).
ETO potentiates transcriptional repression mediated by PLZF.
Having established that ETO and PLZF can form a complex in vivo, we
determined whether the proteins could cooperate to mediate transcriptional repression. PLZF, driven by the SV40 promoter and
enhancer was coexpressed in 293T cells or NIH 3T3 cells along with a
reporter containing four copies of a high-affinity PLZF binding site
found in the IL-3R promoter (IL3R-tk-Luc) (Fig.
2A) (2). PLZF specifically
repressed this reporter two- to threefold, as we reported previously
(Fig. 2B) (2). When ETO was cotransfected with PLZF, there
was an up to 30-fold enhancement of transcriptional repression (Fig.
2B, lanes 5 to 8). This effect was not seen when PLZF and ETO were
transfected together with a tk-Luc reporter plasmid lacking
PLZF binding sites (Fig. 2B, lanes 1 to 4). Enhancement of repression
by ETO was also observed when PLZF was expressed from the
cytomegalovirus (CMV) promoter (Fig. 2C). In this experiment, expression of PLZF led to 2.5-fold repression of the promoter, and
expression of ETO had a less than 2-fold effect. Together the proteins
repressed the IL3-tk-Luc reporter nearly sevenfold. These
results were not cell-type specific, since they could be reproduced in
3T3 cells (data not shown). When increasing amounts of ETO were
introduced into the cells, there was progressive transcriptional repression, suggesting a cooperative effect between the two proteins. In contrast, increasing doses of ETO alone had relatively little effect
on the reporter (Fig. 2D).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2.
ETO enhances transcriptional repression mediated by
PLZF. (A) Schematic representation of a reporter plasmid containing
four binding sites for PLZF from the IL-3R chain promoter and a
reporter plasmid containing five multimerized GAL4 operators. (B and C)
Repression by PLZF through its cognate binding site. Transient
transfection assays performed in duplicate in 293 T cells. Results are
expressed as fold repression of luciferase expression from the reporter
gene in the presence of PLZF and ETO compared to luciferase activity in
the presence of parental expression vectors. (B) Lanes 1 to 4, 293T
cells in six-well dishes were transfected with the tk-Luc
reporter (100 ng) without PLZF binding sites and with pSG5 (800 ng
[lane 1]), pSG5 (800 ng) plus CMV-ETO (400 ng) (lane 2), pSG5-PLZF
(800 ng [lane 3]), and pSG5-PLZF (800 ng) plus CMV-ETO (400 ng) (lane
4). Lanes 5 to 8 contained IL3R-tk-Luc reporter with similar
effectors as lanes 1 to 4. (C) 293T cells in 12-well dishes were
transfected in duplicate with the IL3R-tk-Luc reporter (50 ng) and pCDNA (800 ng) plus pCMV (300 ng) (lane 1), pCDNA-PLZF (800 ng)
plus pCMV (300 ng) (lane 2), pCDNA (800 ng) plus pCMV-ETO (300 ng)
(lane 3), and pCDNA-PLZF (800 ng) plus pCMV-ETO (300 ng) (lane 4). (D)
Dose-dependent corepression by ETO. 293T cells in six-well dishes were
transfected in duplicate with the IL3R-tk-Luc reporter (100 ng) and pSG5 alone (400 ng [lane 1]) or pSG5 (400 ng) plus 200 ng
(lane 2), 400 ng (lane 3) and 1,600 ng (lane 4) of pCMV ETO. Lanes: 5, pSG5-PLZF (400 ng); 6 to 8, pSG5-PLZF (400 ng) plus 200 ng (lane 6),
400 ng (lane 7), and 1,600 ng (lane 8) of ETO. (E) ETO enhances
transcriptional repression by a Gal4-PLZF1-400 fusion
protein. 293T cells were transfected with the Gal4-tk-Luc
reporter (100 ng) and Gal(1-147) (400 ng [lane 1]) or Gal(1-147)
(400 ng) plus CMV-ETO (400 ng) (lane 2). Lanes 3 and 4:
Gal-PLZF1-400 (400 ng [lane 3]) and
Gal-PLZF1-400 (400 ng) plus CMV-ETO (400 ng) (lane 4).
|
|
Based on the current model of PLZF function, the nine C-terminal zinc
fingers bind specific target promoters, while more N-terminal
repression domains can recruit corepressors and HDACs (
45).
Therefore a GAL4-PLZF fusion containing amino acids 1 to 400 (lacking
the C-terminal zinc fingers) was tested for its ability to cooperate
with ETO. In concordance with the results observed with wild-type
PLZF,
GAL4- PLZF
1-400 repressed transcription of a reporter
containing five GAL4 operators
four- to fivefold (Fig.
2A). In the
presence of ETO, nearly 15-fold
repression was observed (Fig.
2E). ETO
only had a modest, approximately
twofold repressive effect on its own
in the absence of GAL4-PLZF
1-400. Furthermore, there was
no significant effect of ETO and GAL4-PLZF
1-400 on a
reporter lacking GAL4 sites (data not shown). These results
indicate
that the N terminus of PLZF, bound to a specific promoter
sequence, is
sufficient to functionally interact with the ETO
corepressor.
Mapping of ETO sequences required for binding to PLZF.
Previous work on the transcriptional properties of ETO indicated that
its ability to repress transcription when fused to AML-1 was largely
due to its ability to bind the N-CoR and SMRT corepressors through a
C-terminal zinc finger-like motif known as the MYND (Myeloid, nervy,
DEAF) domain (17, 43, 44, 63). ETO can also bind the Sin3A
corepressor, mainly through a region between amino acids 217 and 387 (B. Lutterbach and S. W. Hiebert, unpublished data). ETO contains
three other motifs conserved within members of the ETO family of
proteins, including a TAF110 homology domain
(13), a hydrophobic heptad repeat (HR) domain which mediates
homo- and heterodimerization (30, 43), and the Nervy
homology domain 3 (Ner), a conserved domain of unknown function
(43). ETO mutants lacking each of the conserved domains (ETO-
MYND, ETO-
Ner,
ETO-
HR, and ETO-
TAF110) and a mutant
containing amino acids 1 to 345 (and therefore lacking the MYND, Ner,
and HR domains) were fused to the GAL4(DBD) and used as baits in the
yeast two-hybrid system. These were cotransformed into yeast with a
PLZF-AD prey plasmid. Each one of the ETO mutants interacted with PLZF
as determined by the growth of yeast colonies on deficient media and by
activation of
-galactosidase expression (Fig.
3A). ETO did not interact with a control
prey of the SV40 T antigen, and PLZF did not interact with a control
bait of p53 (data not shown). This indicted that the N terminus of ETO
including amino acids 1 to 345 was sufficient for interaction with PLZF and that the TAF110 homology domain between ETO residues 125 and 196 was not required for the interaction. To further define the region of
interaction between ETO and PLZF, we performed protein affinity
chromatography using GST-ETO fusion proteins. Glutathione-agarose beads
were coated with GST-ETO1-114,
GST-ETO217-387, GST-ETO339-499,
GST-ETO494-559, or GST itself and incubated with
[35S]methionine-labeled, in vitro-translated PLZF. PLZF
was specifically retained only on beads containing a central fragment
of ETO, including amino acids 217 to 387 (Fig. 3B). All of the GST-ETO
fusion proteins were produced to a comparable extent, as indicated by
staining with Coomassie blue (Fig. 3C). Together these data suggest
that the minimal region of ETO required to interact with PLZF is
localized to a central region of the protein between amino acids 217 and 345. This region is distinct from the C-terminal sequences required for interaction of ETO with N-CoR and SMRT, but similar to the sequences required for interaction with Sin3A.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
Mapping the region of ETO required for interaction with
PLZF. (A) Yeast two-hybrid assays were performed with wild-type and
mutant forms of ETO fused to the GAL4(DBD) as bait and full-length PLZF
fused to the GAL4-AD as prey. The diagrams to the left depict the ETO
mutants used. The results are expressed as -galactosidase activity
normalized to the positive control of PLZF self-association averaged
from three to six experiments. Lanes: 1, GAL4-positive control. 2, PLZF
self-association; 3, ETO plus PLZF; 4, ETO MYND plus
PLZF; 5, ETO Ner plus PLZF; 6, ETO HHR plus
PLZF; 7, ETO TAF110 plus PLZF; 8, ETO1-345
plus PLZF. (B) GST-ETO fusion proteins were produced in E. coli and allowed to bind to glutathione-conjugated beads. The
protein-coated beads were allowed to bind to
[35S]methionine-labeled in vitro-translated PLZF. The top
panel shows a fluorogram of radiolabeled PLZF retained by the
glutathione beads. Lanes: 1, naked beads; 2, GST-coated beads; 3 to 6, beads coated with the indicated GST-ETO fusion proteins; 7, reticulocyte lysate (10% of input). (C) Coomassie blue staining of the
same gel as in panel B to demonstrate expression of the GST fusion
proteins.
|
|
A second repression domain, but not the POZ/BTB domain, is
essential for interaction of PLZF with ETO.
Previous
structure-function analysis of the PLZF protein revealed the presence
of two repression domains (37). The first corresponds to the
N-terminal evolutionarily conserved POZ/BTB domain between residues 1 and 120, and the second (RD2), located between amino acids 200 and 300, does not resemble any other known repression domains. When fused to the
GAL4(DBD), both domains mediate transcriptional repression
(37). The N-terminal POZ/BTB domain of PLZF is an
interaction site for the N-CoR and SMRT corepressors, but the protein
partners of RD2 have not yet been characterized (20, 27).
Deletion of either the POZ domain or RD2 blocks the ability of PLZF to
repress transcription from its cognate binding site (see Fig. 5A).
Therefore we determined which one of these domains interacted with ETO
(Fig. 4A). COS-7 cells were transiently
transfected with the PLZF
POZ/BTB or the
PLZF
RD2 mutant and wild-type ETO. Cell lysates were
immunoprecipitated with PLZF monoclonal antibody and then blotted with
an ETO polyclonal antibody (Fig. 4B). Full-length PLZF was readily
coprecipitated with ETO. PLZF
POZ/BTB could also be
coprecipitated with ETO, but to a lesser extent than wild-type PLZF,
while PLZF
RD2 did not complex with ETO. This indicated
that the second repression domain of PLZF was required for interaction
with ETO in vivo and that the POZ/BTB domain contributes to, but is not
absolutely required for, the interaction. In a complementary,
reciprocal experiment, 293T cells were transfected with
PLZF
POZ/BTB or PLZF
RD2 and ETO, followed
by immunoprecipitation with ETO and immunoblotting with PLZF
antibody. Again, wild-type PLZF exhibited the strongest interaction
with ETO, while relatively less PLZF
POZ/BTB could
be coprecipitated with ETO. No complex could be demonstrated between
PLZF
RD2 and ETO (Fig. 4C). Expression of PLZF deletion
mutants and ETO was confirmed in all of these experiments by
immunoblotting the cell lysates with the appropriate antibodies (Fig.
4B and C). We next determined which domain of PLZF was sufficient for
interaction with ETO. The 293T cell line was transfected with the
GAL4-PLZF1-400, GAL4-POZ, or GAL4-RD2 expression vector,
and the resulting lysates were subjected to immunoprecipitation with an
antibody directed to the GAL4(DBD) and blotted with ETO antisera.
GAL4-PLZF1-400, containing both repression domains of
PLZF, coprecipitated a significant amount of ETO (Fig. 4D). GAL4-RD2
was sufficient to form a complex with ETO, but precipitated less ETO
than the longer PLZF fusion protein. In contrast, GAL4-POZ was unable
to form a complex with ETO in this assay. The inability of the POZ
domain to form a complex with ETO was confirmed in a two-hybrid
experiment in which yeast cells were transformed with a GAL(AD)-POZ/BTB
prey vector along with GAL4(DBD) bait vectors encoding ETO or
full-length PLZF (Fig. 4E). As previously established, PLZF interacted
with both itself and ETO. However, yeast cells expressing the PLZF POZ/BTB prey and ETO bait were unable to grow in Leu
Trp
Ade
media, and
-galactosidase levels
from yeast grown in Leu
Trp
media,
harboring ETO and the POZ/BTB domain, were at background levels (data
not shown). Expression of the GAL-POZ fusion product was confirmed by
immunoblotting (data not shown). Taken together, these experiments
indicate that RD2 of PLZF is required for interaction with ETO and
that, on its own, the POZ domain of PLZF does not interact with ETO.
However, the POZ domain, when present along with RD2, strengthens the
interaction between PLZF and ETO.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 4.
The second repression domain of PLZF is required for
interaction with ETO. (A) Diagram of PLZF deletion mutants used in
coimmunoprecipitation (IP) and reporter assays (Fig. 6).
PLZF- POZ/BTB lacks the 100 N-terminal amino acids, and
PLZF- RD2 lacks amino acids 199 to 313. (B) COS-7 cells
were cotransfected with plasmids encoding PLZF,
PLZF- RD2, or PLZF- POZ/BTB. The lysates
were subjected to immunoprecipitation with anti-PLZF monoclonal
antibody, and the bound proteins were immunoblotted with anti-ETO or
anti-PLZF antibodies as indicated. Also shown are immunoblots of the
same lysates for PLZF and ETO demonstrating expression of both
proteins. (C) 293T cells were transfected with ETO and PLZF,
PLZF- RD2, or PLZF- POZ/BTB. Lysates were
immunoprecipitated with ETO polyclonal antibody and blotted with PLZF
monoclonal antibody. Direct immunoblots of the same lysates for PLZF
and ETO are shown. (D) 293T cells were transfected with
GAL4-PLZF1-400, GAL4-POZ, or GAL4-RD2 and ETO expression
vectors. Lysates were immunoprecipitated with anti-GAL4(DBD) polyclonal
antibody and blotted with ETO antibody. (E) Two-hybrid interaction
between PLZF and ETO. Yeast cells were transformed with vectors
encoding GAL4(DBD) full-length PLZF bait, GAL4-POZ/BTB bait, or ETO
bait as indicated and a PLZF-AD or POZ/BTB-AD prey. Yeast colonies
growing in Leu Trp Ade media
were expanded and assayed for -galactosidase activity. GAL4 was
included as a positive control for activation, and the activity
generated by self-association of PLZF was set to 1.
|
|
The repression domains of both ETO and PLZF are required for their
ability to functionally cooperate.
Having defined the protein
sequences required for interaction between ETO and PLZF, we determined
whether the same sequences were required for functional
interaction and augmentation of transcriptional repression by PLZF.
First, we found that PLZF
POZ/BTB and
PLZF
RD2 were severely deficient for transcriptional
repression of the IL3R-tk-Luc reporter compared to wild-type
PLZF (Fig. 5A).
Furthermore, both mutants were
defective in their ability to cooperate with ETO (Fig. 5A). This
correlates with the fact that strong interaction between PLZF and ETO
requires the presence of the critical RD2 domain plus the POZ domain.
Given the contrast between the lack of a direct interaction of the PLZF
POZ domain and ETO, but the requirement of the POZ/BTB domain of PLZF
for the ability of ETO to augment repression by PLZF, we further
analyzed the functional relationship between the POZ/BTB domain and
ETO. Transcriptional repression of the GAL4-tk-Luc reporter
by the POZ domain of PLZF fused to GAL4 (GAL4-POZ) was augmented in a
dose-dependent manner by coexpression of ETO (Fig. 5B), in a manner
similar to that observed for full-length PLZF. Therefore, even though
ETO could not be shown to bind to the POZ/BTB domain, it was still able to interact functionally with this repression domain. This could be
mediated via bridging factors, such as SMRT and N-CoR, present in
mammalian cells.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
Identification of sequences with PLZF and ETO
required for functional interaction. (A) The presence of both PLZF
repression domains is required for functional interaction with ETO. In
lanes 1 to 4, 293T cells were cotransfected with the
IL3R-tk-Luc reporter (100 ng) and 400 ng of the pCDNA
expression vector or pCDNA vector containing sequences encoding
wild-type PLZF, PLZF- POZ/BTB, or
PLZF- RD2. In lanes 5 to 8, the same reporter vector was
coexpressed along with wild-type or mutant PLZF expression vector and
400 ng of ETO expression vector. (B) ETO potentiates transcriptional
repression by the PLZF POZ/BTB domain. 293T cells were cotransfected in
duplicate with the GAL4-tk-Luc reporter (100 ng), 400 ng of
the GAL4(1-147) or GAL4-POZ/BTB expression vector, and increasing
amounts of ETO (100, 400, and 800 ng, respectively). Repression of the
GAL4-tk-Luc reporter was measured relative to expression of
luciferase directed by the reporter in the presence of GAL4(1-147).
(C) C-terminal domains of ETO are required to enhance repression by
PLZF. In lanes 1 to 5, wild-type and or mutant ETO expression vectors
(400 ng) were cotransfected into 293T cells along with the PLZF
expression vector and IL3R-tk-Luc reporter (100 ng). Lanes:
1, PLZF; 2, PLZF plus ETO; 3, PLZF plus
ETO( HR,Ner,MYND); 4, PLZF plus ETO(1-322);
5, PLZF plus ETO(1-322) plus wild-type ETO. In lanes 6 to
10, the GAL4-tk-Luc reporter (100 ng) was cotransfected with
a vector encoding GAL4-POZ/BTB and wild-type or mutant ETO. Lanes: 6, GAL-POZ/BTB alone; 7, GAL4-POZ/BTB plus ETO; 8, GAL4-POZ/BTB plus
ETO ( HR,Ner,MYND); 9, GAL4-POZ/BTB plus
ETO(1-322); 10, GAL4-POZ/BTB plus ETO(1-322)
plus wild-type ETO. (D) ETO enhances repression by the second
repression domain of PLZF. The GAL4-tk-Luc reporter (100 ng)
was cotransfected in 293T cells along with a GAL4-RD2 (PLZF200-300)
vector and an expression vector for wild-type ETO or
ETO(1-322). All data represent the average of two to six
individual transfection experiments performed in duplicate.
|
|
We next determined the functional consequences of deleting the
conserved regions of ETO on transcriptional cooperation between
PLZF and ETO. ETO
1-322 and ETO
HHR,Ner,MYND
were both defective in their ability to enhance repression of
the
IL3R-
tk-Luc reporter mediated by PLZF (Fig.
5C, lanes 1 to
4). This supports an important role for the N-CoR and SMRT corepressors
in ETO-PLZF repression, since these deletion mutants can still
interact
with PLZF, but have had the C-terminal binding sites
required for
interaction with N-CoR and SMRT deleted. When wild-type
ETO was
cotransfected with ETO
HHR,Ner,MYND, enhancement of
repression was restored (Fig.
5C, lane 5), indicating
that these
mutants did not act in a dominant-negative manner to
inhibit repression
by PLZF or cooperation with ETO. Similar results
were obtained in an
analysis performed with the GAL4-POZ/BTB fusion
protein on the
GAL4-
tk-Luc reporter (Fig.
5C, lanes 6 to 10).
ETO mutants
lacking C-terminal sequences associated with corepressor
binding were
unable to cooperate with the POZ/BTB repression domain.
This supports
the notion that the POZ domain of PLZF can functionally
interact with
ETO through a bridging interaction with N-CoR and/or
SMRT. Finally, the
ability of the RD2 domain to functionally interact
with ETO was tested.
A GAL4-RD2 fusion containing PLZF amino acids
200 to 300 was an
extremely efficient transcriptional repressor
of
GAL4-
tk-Luc, fivefold more powerful than the GAL4-POZ fusion
protein (Fig.
5D). The RD2 domain was also potentiated by ETO,
and
again, this was dependent on the C-terminal sequences of ETO
required
for interaction with N-CoR and SMRT. Hence, although
only RD2 of PLZF
appears to be required to form a complex with
ETO, both repression
domains of PLZF can be affected by
ETO.
Inhibitors of HDACs antagonize the repression effect mediated by
ETO and PLZF.
To determine whether the cooperative effect by ETO
and PLZF was mediated through an HDAC-dependent mechanism, the
IL3R-tk-Luc reporter was cotransfected with PLZF and ETO in
the presence or absence of TSA and sodium butyrate (4, 68),
both inhibitors of HDAC. The inhibitors completely abrogated
transcriptional repression by both PLZF and the PLZF-ETO combination
(Fig. 6). The effect was less evident
when lower doses of inhibitor were used (data not shown). This strongly
suggests that the cooperative transcriptional effect mediated by the
combination of ETO and PLZF is mediated through the recruitment of HDAC
activity to target promoters.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6.
ETO modulation of repression by PLZF depends on the
action of HDACs. 293T cells were cotransfected with the
IL3R-tk-Luc reporter (100 ng), PLZF expression vector (100 ng), and ETO expression vector (200 ng) as indicated in the presence or
absence of sodium butyrate at a concentration of 1 mM (A) or TSA at a
concentration of 200 nM (B). In lanes 1 and 3 of both panels, fold
repression by PLZF and ETO was measured relative to the expression of
luciferase in the presence of the parental pCDNA vector in the absence
of HDAC inhibitors. In lanes 2 and 4 of both panels, fold
repression was calculated relative to luciferase expression in the
presence of pCDNA and HDAC inhibitors.
|
|
 |
DISCUSSION |
Recent reports indicate that deacetylation of nucleosomal histones
represents a major mechanism of transcriptional repression (34,
50, 65). Nucleosomes deprived of acetyl groups may have altered
interactions with DNA and other proteins that may hinder access of the
RNA polymerase II transcriptional machinery to target gene sequences
(50). This fundamental mechanism has come under increased
scrutiny with the discovery that several leukemogenic chimeric
transcription factors are aberrant transcriptional repressors (17,
44, 45, 62). Prominent among these fusion products are the
AML-1/ETO fusion generated in t(8;21) M2 leukemia and the RAR
fusion
proteins of M3, APL. Among these partners of RAR
, PLZF stands out as
a transcriptional repressor, usually expressed in myeloid progenitor
cells. In t(11;17)-associated APL, PLZF-RAR
attracts an
HDAC-corepressor complex to RAR
target promoters, resulting in a
leukemia refractory to ATRA (18, 20, 41). ETO, a protein
whose exact role in cellular physiology remains uncertain, in a similar
manner inappropriately forces a repressor to the promoters of complex
AML-1 targets in t(8;21)-associated AML (43, 46).
We showed, for the first time, that ETO can associate with a
sequence-specific DNA binding protein, namely PLZF. This indicates that, like N-CoR, SMRT, and Sin3A, ETO can be considered a
transcriptional corepressor. This finding is particularly significant,
since this interaction may be a marker for a repressor complex active
in early myeloid cells, which disappears as cells differentiate. Expression of PLZF was shown to mediate growth suppression, inhibition of myeloid differentiation, and cell cycle arrest (56, 67). Such effects may be mediated by the ability of PLZF to repress target
genes, such as those coding for cyclin A2 and the IL-3R
chain,
through the actions of complexes which contain ETO, other corepressors,
and HDACs. Thus, further characterization of the transcriptional
complex containing ETO and PLZF may contribute to understanding the
role of transcriptional repression in myeloid progenitor cells. These
statements are supported by several lines of evidence. (i) Both ETO and
PLZF are expressed in CD34+ progenitor cells, but decrease
as myeloid cells differentiate (12, 53; A. M. Melnick, G. Carlile, and J. D. Licht, unpublished data). (ii)
Endogenous coexpressed ETO and PLZF interact in vivo, as shown by
coimmunoprecipitation in a hematopoietic cell line. (iii) In contrast
to PLZF, ETO is unable to bind specifically to DNA (11, 35, 44,
45). (iv) PLZF and ETO bind to a similar group of corepressor and
HDAC proteins (8, 17, 18, 20, 41, 44, 62). (v) ETO strongly
and consistently potentiates transcriptional repression mediated by
PLZF. (vi) The transcriptional repression mediated by PLZF plus ETO is
abrogated by treatment with HDAC inhibitors.
It should be emphasized that, in this report, we indicated that the
endogenous ETO and PLZF proteins can interact. In contrast, although
N-CoR, SMRT, and Sin3A were shown to interact with PLZF in vitro
(8, 18, 20, 22, 25, 41, 64) and overexpressed PLZF-RAR
and PLZF were found to interact with these corepressor molecules in
immunoprecipitation experiments (8, 18, 22, 41), no
experiments have yet been published indicating endogenous PLZF
interacts with any of these corepressors. Although
coimmunoprecipitations of overexpressed protein and yeast two-hybrid
assays indicated a strong and consistent interaction between ETO and
PLZF, similar studies of the native proteins in HEL cells indicate that
only about 10% of endogenous PLZF coprecipitates with ETO (Fig. 1C). This finding may have several explanations. First, not all repressive complexes containing PLZF may require or contain ETO. Second, ETO may
target other proteins to mediate repression. Furthermore, ETO may serve
in other roles besides transcription. ETO binds to poly(G) RNA and can
be localized in the nucleolus, consistent with a role for ETO in RNA
metabolism (11). PLZF may have other functions as well. PLZF
can colocalize with the PML protein of t(15;17)-associated APL
(32, 55) in the nuclear body structure. Therefore, PLZF may
be involved in PML-mediated processes such as apoptosis and control of
mRNA transport and translation (3, 24, 45). Finally, the
interaction between ETO and PLZF may depend on posttranscriptional
modifications, which may change depending on the cell cycle, stage of
differentiation, and cell growth conditions. Indeed, both ETO and PLZF
proteins interact with regulatory kinases and are subject to
phosphorylation (2, 12, 33, 60).
ETO consistently potentiated transcriptional repression mediated by
native PLZF as well as the PLZF repression domains fused to a
heterologous DBD. At least part of this transcriptional function is
dependent on the ability of PLZF to associate with the same corepressors and HDACs as ETO (8, 18, 20, 41). The
potentiation of transcriptional repression by ETO can be further
enhanced by coexpression of the N-CoR or SMRT corepressors and HDACs,
indicating a combinatorial effect in which all of these proteins
functionally interact (data not shown). Finally, the transcriptional
repression mediated by ETO and PLZF is blocked by TSA and sodium
butyrate, indicating that the enhancement of PLZF repression mediated
by ETO is dependent on HDAC activity. This suggests that ETO enhances the ability of PLZF to recruit a transcriptional repression complex which functions, at least in part, through histone deacetylation (Fig.
7A).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 7.
Model of interaction between ETO and PLZF. (A) PLZF
binds to specific sequences in its target promoters through its zinc
finger (ZF) domains. PLZF then recruits ETO through sequences in the
second repression domain of PLZF (residues 200 to 300), binding to
sequences of ETO localized between amino acids 217 and 345. Both PLZF
and ETO are able to bind to N-CoR, SMRT, Sin3A, and HDACs, resulting in
a multiprotein complex able to mediate nucleosomal modifications and
transcriptional repression. ETO binds to N-CoR and SMRT through its
C-terminal MYND domain. The PLZF-POZ/BTB domain stabilizes the
interaction, though does not bind directly to ETO, possibly through
interaction with N-CoR and/or SMRT. The effect of ETO may be to either
stabilize the complex or to help recruit HDACs and/or
as-yet-unidentified additional proteins, augmenting transcriptional
repression. (B) GAL4-POZ/BTB recruits N-CoR and SMRT, which then bind
to ETO. This results in an N-CoR-SMRT bridge (not present in yeast)
between POZ/BTB and ETO. ETO also interacts with HDACs and Sin3A.
Augmentation of repression would then occur as described for panel A.
|
|
The POZ/BTB domain of PLZF mediates homodimerization, transcriptional
repression, and heterologous protein-protein interactions, including
those with corepressors (8, 20, 45). ETO does not associate
with the PLZF-POZ/BTB domain in yeast and cannot form a stable complex
with this domain in mammalian cells. Furthermore, ETO can still bind to
PLZF with the POZ/BTB domain deleted. Despite this fact, ETO still
could enhance repression mediated by the POZ/BTB domain of PLZF. This
paradox can be solved by hypothesizing that ETO is able to mediate this
effect indirectly, through interaction with the N-CoR and SMRT or Sin3A
corepressors, all of which can interact with the POZ/BTB domain (Fig.
7B). ETO fails to enhance transcription of PLZF mutants with either the
POZ/BTB domain or the second repression domain deleted, and PLZF with
the POZ/BTB domain deleted exhibited diminished binding of ETO. It
therefore seems likely that the POZ/BTB domain is important for
stabilizing a multiprotein complex containing ETO. The second
repression domain of PLZF was absolutely required for interaction with
ETO. This was intriguing, given that the mechanism of action of this
domain of PLZF had not previously been characterized. A PLZF deletion mutant lacking the RD2 was severely deficient for transcriptional repression and was not significantly potentiated by ETO (Fig. 6A),
while ETO was able to augment repression mediated by the second
repression domain of PLZF fused to GAL4 (Fig. 6C). Together, this
information indicates that there are multiple sites for corepressor interaction in the PLZF protein. The binding of N-CoR, SMRT, and Sin3A
to the N-terminal POZ/BTB domain of PLZF and ETO to the more C-terminal
repression domain may lead to the formation of a multiprotein
repression complex, stabilized by multiple cross-protein contacts (Fig.
7A).
Surprisingly, none of the four conserved domains of ETO were required
to associate with PLZF, while a previously poorly characterized, central region of ETO was sufficient to complex with PLZF.
Interestingly, the Sin3A corepressor binds to ETO through similar
sequences (B. Lutterbach and S. W. Hiebert, unpublished data). The
functional relationship between Sin3A, ETO, and PLZF is underscored by
the fact that ETO and Sin3A (44), ETO and PLZF (Fig. 1C),
and PLZF and Sin3A (A. M. Melnick, G. Carlile, and J. D. Licht, unpublished data) can be coimmunoprecipitated in HEL cells.
Although our yeast two-hybrid (Fig. 1B) and protein affinity
chromatography studies (Fig. 4C) could indicate a direct interaction
between PLZF and ETO, it remains a strong possibility that Sin3A could
act as a bridging factor between these proteins, since Sin3A is present in yeast and Sin3A can be detected in reticulocyte lysates (B. Lutterbach and S. W. Hiebert, unpublished data). It must be
emphasized that the N-terminal half of ETO alone, despite its ability
to bind to both PLZF and Sin3A, was unable to mediate corepression, suggesting that the participation of Sin3A is not sufficient for repression by ETO. The ability of ETO to augment repression by PLZF
required C-terminal sequences of ETO. This suggests a model in which
the central portion of ETO forms complexes with PLZF, while the
C-terminal region binds to the N-CoR and SMRT corepressors, which in
turn can bind to the POZ/BTB domain of PLZF. The resulting collection
of proteins recruit HDACs and mediate transcriptional repression (Fig.
7A).
Given the fact that ETO and PLZF physically and functionally interact,
how is this relationship disrupted in leukemia? If for example, the
AML-1-ETO oncoprotein interacts with wild-type PLZF in myeloid
progenitor cells, would this affect PLZF-mediated repression?
Alternatively, does ETO participate in the repression of RAR
target
genes? In fact, our preliminary results indicate that AML-1-ETO is a
dominant-negative inhibitor of PLZF repression. Hence in
t(8;21)-associated AML, not only might AML-1 target genes be aberrantly
repressed, but PLZF targets associated with control of cell growth
might be derepressed as well. In the case of APL, our initial data
indicate that ETO can potentiate repression of reporter genes
containing RAR binding sites in the absence of retinoic acid. Whether
PLZF-RAR
might affect some other essential function of ETO or
sequester ETO, making it unavailable for use by other transcriptional
repressors or other cellular processes, is uncertain. ETO and PLZF may
represent components of a functional repression complex present in
myeloid cells. Disruption of this complex could represent a common
pathway of malignant transformation. A fuller understanding of other
components of this complex will lead to the identification of
mechanisms of transcriptional repression and hence offer new
opportunities for therapeutic intervention in leukemia.
 |
ACKNOWLEDGMENTS |
This work was supported by NIH grants CA 59936 (J.D.L.) and CA
64140 (S.W.H.) and American Cancer Society Award DHP 160 (J.D.L.). J.D.L. is a scholar of the Leukemia Society of America. A.M.M. is
supported a Physician-Scientist Award (K08 CA73762). J.J.W. is
supported by NRSA F32-CA77167. B.L. is a fellow of the Leukemia Society
of America.
We thank Kathy Borden and Sam Waxman for review of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Box 1130, Mount
Sinai School of Medicine, One Gustave L. Levy Place, New York, NY
10029. Phone: (212) 659-5487. Fax: (212) 849-2523. E-mail:
jonathan.licht{at}mssm.edu.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1989.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 2.
|
Ball, H. J.,
A. Melnick,
R. Shaknovich,
R. A. Kohanski, and J. D. Licht.
1999.
The promyelocytic leukemia zinc finger (PLZF) protein binds DNA in a high molecular weight complex associated with cdc2 kinase.
Nucleic Acids Res.
27:4106-4113[Abstract/Free Full Text].
|
| 3.
|
Borden, K. L. B.,
E. J. CampbellDwyer,
G. W. Carlile,
M. Djavani, and M. S. Salvato.
1998.
Two RING finger proteins, the oncoprotein PML and the arenavirus Z protein, colocalize with the nuclear fraction of the ribosomal P proteins.
J. Virol.
72:3819-3826[Abstract/Free Full Text].
|
| 4.
|
Candido, E. P.,
R. Reeves, and J. R. Davie.
1978.
Sodium butyrate inhibits histone deacetylation in cultured cells.
Cell
14:105-113[CrossRef][Medline].
|
| 5.
|
Chen, J. D., and R. M. Evans.
1995.
A transcriptional co-repressor that interacts with nuclear hormone receptors.
Nature
377:454-457[CrossRef][Medline].
|
| 6.
|
Chen, Z.,
N. J. Brand,
A. Chen,
S. J. Chen,
J. H. Tong,
Z. Y. Wang,
S. Waxman, and A. Zelent.
1993.
Fusion between a novel Kruppel-like zinc finger gene and the retinoic acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute promyelocytic leukaemia.
EMBO J.
12:1161-1167[Medline].
|
| 7.
|
Chen, Z.,
F. Guidez,
P. Rousselot,
A. Agadir,
S. J. Chen,
Z. Y. Wang,
L. Degos,
A. Zelent,
S. Waxman, and C. Chomienne.
1994.
PLZF-RAR alpha fusion proteins generated from the variant t(11;17)(q23;q21) translocation in acute promyelocytic leukemia inhibit ligand-dependent transactivation of wild-type retinoic acid receptors.
Proc. Natl. Acad. Sci. USA
91:1178-1182[Abstract/Free Full Text].
|
| 8.
|
David, G.,
L. Alland,
S. H. Hong,
C. W. Wong,
R. A. DePinho, and A. Dejean.
1998.
Histone deacetylase associated with mSin3A mediates repression by the acute promyelocytic leukemia-associated PLZF protein.
Oncogene
16:2549-2556[CrossRef][Medline].
|
| 9.
|
Dong, S.,
J. Zhu,
A. Reid,
P. Strutt,
F. Guidez,
H. J. Zhong,
Z. Y. Wang,
J. Licht,
S. Waxman,
C. Chomienne,
Z. Chen,
A. Zelent, and S. J. Chen.
1996.
Amino-terminal protein-protein interaction motif (POZ-domain) is responsible for activities of the promyelocytic leukemia zinc finger-retinoic acid receptor-alpha fusion protein.
Proc. Natl. Acad. Sci. USA
93:3624-3629[Abstract/Free Full Text].
|
| 10.
|
Era, T.,
N. Asou,
T. Kunisada,
H. Yamasaki,
H. Asou,
N. Kamada,
S. Nishikawa,
K. Yamaguchi, and K. Takatsuki.
1995.
Identification of two transcripts of AML1/ETO-fused gene in t(8;21) leukemic cells and expression of wild-type ETO gene in hematopoietic cells.
Genes Chromosomes Cancer
13:25-33[Medline].
|
| 11.
|
Erickson, P.,
R. Lasher, and H. Drabkin.
1997.
ETO, a partner in the t(821) acute myelogenous leukemia chimeric protein, binds to homopolymeric RNA and has a nucleolar localization.
Blood
90:60a.
|
| 12.
|
Erickson, P. F.,
G. Dessev,
R. S. Lasher,
G. Philips,
M. Robinson, and H. A. Drabkin.
1996.
ETO and AML1 phosphoproteins are expressed in CD34+ hematopoietic progenitors: implications for t(8;21) leukemogenesis and monitoring residual disease.
Blood
88:1813-1823[Abstract/Free Full Text].
|
| 13.
|
Erickson, P. F.,
M. Robinson,
G. Owens, and H. A. Drabkin.
1994.
The ETO portion of acute myeloid leukemia t(8;21) fusion transcript encodes a highly evolutionarily conserved, putative transcription factor.
Cancer Res.
54:1782-1786[Abstract/Free Full Text].
|
| 14.
|
Evans, T.
1997.
Developmental biology of hematopoiesis.
Hematol.-Oncol. Clin. N. Am.
11:1115-1147[CrossRef][Medline].
|
| 15.
|
Fenrick, R.,
J. M. Amann,
B. Lutterbach,
L. Wang,
J. J. Westendorf,
J. R. Downing, and S. W. Hiebert.
1999.
Both TEL and AML-1 contribute repression domains to the t(12;21) fusion protein.
Mol. Cell. Biol.
19:6566-6574[Abstract/Free Full Text].
|
| 16.
|
Frank, R.,
J. Zhang,
H. Uchida,
S. Meyers,
S. W. Hiebert, and S. D. Nimer.
1995.
The AML1/ETO fusion protein blocks transactivation of the GM-CSF promoter by AML1B.
Oncogene
11:2667-2674[Medline].
|
| 17.
|
Gelmetti, V.,
J. Zhang,
M. Fanelli,
S. Minucci,
P. G. Pelicci, and M. A. Lazar.
1998.
Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO.
Mol. Cell. Biol.
18:7185-7191[Abstract/Free Full Text].
|
| 18.
|
Grignani, F.,
S. De Matteis,
C. Nervi,
L. Tomassoni,
V. Gelmetti,
M. Cioce,
M. Fanelli,
M. Ruthardt,
F. F. Ferrara,
I. Zamir,
C. Seiser,
F. Grignani,
M. A. Lazar,
S. Minucci, and P. G. Pelicci.
1998.
Fusion proteins of the retinoic acid receptor-alpha recruit histone deacetylase in promyelocytic leukaemia.
Nature
391:815-818[CrossRef][Medline].
|
| 19.
|
Guidez, F.,
W. Huang,
J. H. Tong,
C. Dubois,
N. Balitrand,
S. Waxman,
J. L. Michaux,
P. Martiat,
L. Degos,
Z. Chen, et al.
1994.
Poor response to all-trans retinoic acid therapy in a t(11;17) PLZF/RAR alpha patient.
Leukemia
8:312-317[Medline].
|
| 20.
|
Guidez, F.,
S. Ivins,
J. Zhu,
M. Soderstrom,
S. Waxman, and A. Zelent.
1998.
Reduced retinoic acid-sensitivities of nuclear receptor corepressor binding to PML- and PLZF-RARalpha underlie molecular pathogenesis and treatment of acute promyelocytic leukemia.
Blood
91:2634-2642[Abstract/Free Full Text].
|
| 21.
|
Harlow, E., and D. Lane.
1999.
Using antibodies: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
He, L.-Z.,
F. Guidez,
C. Triboli,
D. Peruzzi,
M. Ruthardt,
A. Zelent, and P. P. Pandolfi.
1998.
Distinct interactions of PML-RARa and PLZF-RAR with co-repressors determine differential responses to RA in APL.
Nat. Genet.
18:126-135[CrossRef][Medline].
|
| 23.
|
Heinzel, T.,
R. M. Lavinsky,
T. M. Mullen,
M. Soderstrom,
C. D. Laherty,
J. Torchia,
W. M. Yang,
G. Brard,
S. D. Ngo,
J. R. Davie,
E. Seto,
R. N. Eisenman,
D. W. Rose,
C. K. Glass, and M. G. Rosenfeld.
1997.
A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression.
Nature
387:43-48[CrossRef][Medline].
|
| 24.
|
Hess, J. L., and S. J. Korsemeyer.
1998.
Life, death and nuclear spots.
Nat. Genet.
20:220-222[CrossRef][Medline].
|
| 25.
|
Hong, S. H.,
G. David,
C. W. Wong,
A. Dejean, and M. L. Privalsky.
1997.
SMRT corepressor interacts with PLZF and with the PML-retinoic acid receptor alpha (RARalpha) and PLZF-RARalpha oncoproteins associated with acute promyelocytic leukemia.
Proc. Natl. Acad. Sci. USA
94:9028-9033[Abstract/Free Full Text].
|
| 26.
|
Horlein, A. J.,
A. M. Naar,
T. Heinzel,
J. Torchia,
B. Gloss,
R. Kurokawa,
A. Ryan,
Y. Kamei,
M. Soderstrom,
C. K. Glass, and M. G. Rosenfeld.
1995.
Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor corepressor.
Nature
377:397-404[CrossRef][Medline].
|
| 27.
|
Huynh, K. D., and V. J. Bardwell.
1998.
The BCL-6 POZ domain and other POZ domains interact with the co-repressors N-CoR and SMRT.
Oncogene
17:2473-2484[CrossRef][Medline].
|
| 28.
|
Innis, M. A.,
D. H. Gelfand,
J. J. Sninsky, and T. J. White.
1990.
PCR protocols: a guide to methods and applications.
Academic Press, Inc., San Diego, Calif.
|
| 29.
|
James, P.,
J. Halladay, and E. A. Craig.
1996.
Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast.
Genetics
144:1425-1436[Abstract].
|
| 30.
|
Kitabayashi, I.,
K. Ida,
F. Morohoshi,
A. Yokoyama,
N. Mitsuhashi,
K. Shimizu,
N. Nomura,
Y. Hayashi, and M. Ohki.
1998.
The AML1-MTG8 leukemic fusion protein forms a complex with a novel member of the MTG8(ETO/CDR) family, MTGR1.
Mol. Cell. Biol.
18:846-858[Abstract/Free Full Text].
|
| 31.
|
Kitabayashi, I.,
A. Yokoyama,
K. Shimizu, and M. Ohki.
1998.
Interaction and functional cooperation of the leukemia-associated factors AML1 and p300 in myeloid cell differentiation.
EMBO J.
17:2994-3004[CrossRef][Medline].
|
| 32.
|
Koken, M. H. M.,
A. Reid,
F. Quignon,
M. K. Chelbi-Alix,
J. M. Davies,
J. H. S. Kabarowski,
J. Zhu,
S. Dong,
S. Chen,
Z. Chen,
C. C. Tan,
J. Licht,
S. Waxman,
H. de The, and A. Zelent.
1997.
Leukemia-associated retinoic acid receptor alpha fusion partners, PML and PLZF, heterodimerize and colocalize to nuclear bodies.
Proc. Natl. Acad. Sci. USA
94:10255-10260[Abstract/Free Full Text].
|
| 33.
|
Komori, A.,
E. Sueoka,
H. Fujiki,
M. Ishii, and T. Kozu.
1999.
Association of MTG8 (ETO/CDR), a leukemia-related protein, with serine/threonine protein kinases and heat shock protein HSP90 in human hematopoietic cell lines.
Jpn. J. Cancer Res.
90:60-68[CrossRef][Medline].
|
| 34.
|
Kornberg, R. D., and Y. Lorch.
1999.
Chromatin-modifying and -remodeling complexes.
Curr. Opin. Genet. Dev.
9:148-151[CrossRef][Medline].
|
| 35.
|
Kozu, T.,
A. Komori,
E. Sueoka,
H. Fujiki,
Y. Kaneko,
T. Matsui,
T. Uehara,
Y. Seino, and M. Ishii.
1997.
Significance of MTG8 in leukemogenesis.
Leukemia
11(Suppl. 3):297-298.
|
| 36.
|
Lenny, N.,
J. J. Westendorf, and S. W. Hiebert.
1997.
Transcriptional regulation during myelopoiesis.
Mol. Biol. Rep.
24:157-168[CrossRef][Medline].
|
| 37.
|
Li, J. Y.,
M. A. English,
H. J. Ball,
P. L. Yeyati,
S. Waxman, and J. D. Licht.
1997.
Sequence-specific DNA binding and transcriptional regulation by the promyelocytic leukemia zinc finger protein.
J. Biol. Chem.
272:22447-22455[Abstract/Free Full Text].
|
| 38.
|
Licht, J. D.,
C. Chomienne,
A. Goy,
A. Chen,
A. A. Scott,
D. R. Head,
J. L. Michaux,
Y. Wu,
A. DeBlasio,
W. H. Miller, Jr.,
A. D. Zelenetz,
C. L. Wilman,
Z. Chen,
S.-J. Chen,
A. Zelent,
E. Macintyre,
A. Veil,
J. Cortes,
H. Kantarjian, and S. Waxman.
1995.
Clinical and molecular characterization of a rare syndrome of acute promyelocytic leukemia associated with translocation (11;17).
Blood
85:1083-1094[Abstract/Free Full Text].
|
| 39.
|
Licht, J. D.,
M. Ro,
M. A. English,
M. Grossel, and U. Hansen.
1993.
Selective repression of transcriptional activators at a distance by the Drosophila Krüppel protein.
Proc. Natl. Acad. Sci. USA
90:11361-11365[Abstract/Free Full Text].
|
| 40.
|
Licht, J. D.,
R. Shaknovich,
M. A. English,
A. Melnick,
J. Y. Li,
J. C. Reddy,
S. Dong,
S. J. Chen,
A. Zelent, and S. Waxman.
1996.
Reduced and altered DNA-binding and transcriptional properties of the PLZF-retinoic acid receptor-alpha chimera generated in t(11;17)-associated acute promyelocytic leukemia.
Oncogene
12:323-336[Medline].
|
| 41.
|
Lin, R. J.,
L. Nagy,
S. Inoue,
W. Shao,
W. H. Miller, Jr., and R. M. Evans.
1998.
Role of the histone deacetylase complex in acute promyelocytic leukaemia.
Nature
391:811-814[CrossRef][Medline].
|
| 42.
|
Look, A. T.
1997.
Oncogenic transcription factors in the human acute leukemias.
Science
278:1059-1064[Abstract/Free Full Text].
|
| 43.
|
Lutterbach, B.,
D. Sun,
J. Schuetz, and S. W. Hiebert.
1998.
The MYND motif is required for repression of basal transcription from the multidrug resistance 1 promoter by the t(8;21) fusion protein.
Mol. Cell. Biol.
18:3604-3611[Abstract/Free Full Text].
|
| 44.
|
Lutterbach, B.,
J. J. Westendorf,
B. Linggi,
A. Patten,
M. Moniwa,
J. R. Davie,
K. D. Huynh,
V. J. Bardwell,
R. M. Lavinsky,
M. G. Rosenfeld,
C. Glass,
E. Seto, and S. W. Hiebert.
1998.
ETO, a target of t(8;21) in acute leukemia, interacts with the N-CoR and mSin3 corepressors.
Mol. Cell. Biol.
18:7176-7184[Abstract/Free Full Text].
|
| 45.
|
Melnick, A., and J. Licht.
1999.
Deconstructing a disease: RAR , its fusion partners and their roles in the pathogenesis of acute promyelocytic leukemia.
Blood
93:3167-3215[Free Full Text].
|
| 46.
|
Meyers, S.,
N. Lenny, and S. W. Hiebert.
1995.
The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation.
Mol. Cell. Biol.
15:1974-1982[Abstract].
|
| 47.
|
Miyoshi, H.,
T. Kozu,
K. Shimizu,
K. Enomoto,
N. Maseki,
Y. Kaneko,
N. Kamada, and M. Ohki.
1993.
The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript.
EMBO J.
12:2715-2721[Medline].
|
| 48.
|
Nucifora, G., and J. D. Rowley.
1995.
AML1 and the 8;21 and 3;21 translocations in acute and chronic myeloid leukemia.
Blood
86:1-14[Free Full Text].
|
| 49.
|
Okuda, T.,
J. van Deursen,
S. W. Hiebert,
G. Grosveld, and J. R. Downing.
1996.
AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis.
Cell
84:321-330[CrossRef][Medline].
|
| 50.
|
Pazin, M., and J. Kadonaga.
1997.
What's up and down with histone deacetylation and transcription.
Cell
89:325-328[CrossRef][Medline].
|
| 51.
|
Rabbits, T.
1994.
Chromosomal translocations in human cancer.
Cell
372:143-149.
|
| 52.
|
Rabbits, T. H.
1991.
Translocations, master genes and differences between the origins of acute and chronic leukemias.
Cell
67:641-644[CrossRef][Medline].
|
| 53.
|
Reid, A.,
A. Gould,
N. Brand,
M. Cook,
P. Strutt,
J. Li,
J. Licht,
S. Waxman,
R. Krumlauf, and A. Zelent.
1995.
Leukemia translocation gene, PLZF, is expressed with a speckled nuclear pattern in early hematopoietic progenitors.
Blood
86:4544-4552[Abstract/Free Full Text].
|
| 54.
|
Rowley, J. D.
1998.
The critical role of chromosome translocations in human leukemias.
Annu. Rev. Genet.
32:495-519[CrossRef][Medline].
|
| 55.
|
Ruthardt, M.,
A. Orleth,
L. Tomassoni,
E. Puccetti,
D. Riganelli,
M. Alcalay,
R. Mannucci,
I. Nicoletti,
F. Grignani,
M. Fagioli, and P. G. Pelicci.
1998.
The acute promyelocytic leukaemia specific PML and PLZF proteins localize to adjacent and functionally distinct nuclear bodies.
Oncogene
16:1945-1953[CrossRef][Medline].
|
| 56.
|
Shaknovich, R.,
P. L. Yeyati,
S. Ivins,
A. Melnick,
C. Lempert,
S. Waxman,
A. Zelent, and J. D. Licht.
1998.
The promyelocytic leukemia zinc finger protein affects myeloid cell growth, differentiation, and apoptosis.
Mol. Cell. Biol.
18:5533-5545[Abstract/Free Full Text].
|
| 57.
|
Shivdasani, R. A.
1997.
Stem cell transcription factors.
Hematol. Oncol. Clin. N. Am.
11:1199-1206[CrossRef][Medline].
|
| 58.
|
Shivdasani, R. A., and S. H. Orkin.
1996.
The transcriptional control of hematopoiesis.
Blood
87:4025-4039[Free Full Text].
|
| 59.
|
Sieweke, M. H., and T. Graf.
1998.
A transcription factor party during blood cell differentiation.
Curr. Opin. Genet. Dev.
8:545-551[CrossRef][Medline].
|
| 60.
|
Sueoka, E.,
N. Sueoka,
S. Okabe,
A. Komori,
M. Suganuma,
T. Kozu, and H. Fujiki.
1998.
Tumourigenicity of MTG8, a leukaemia-related gene, in concert with v-Ha-ras gene in BALB/3T3 cells.
Br. J. Haematol.
101:737-742[CrossRef][Medline].
|
| 61.
|
Tenen, D.,
R. Hromas,
J. Licht, and D. Zhang.
1997.
Transcription factors, normal myeloid development and leukemia.
Blood
90:489-519[Free Full Text].
|
| 62.
|
Wang, J.,
T. Hoshino,
R. L. Redner,
S. Kajigaya, and J. M. Liu.
1998.
ETO, fusion partner in t(8;21) acute myeloid leukemia, represses transcription by interaction with the human N-CoR/mSin3/HDAC1 complex.
Proc. Natl. Acad. Sci. USA
95:10860-10865[Abstract/Free Full Text].
|
| 63.
|
Westendorf, J. J.,
C. M. Yamamoto,
N. Lenny,
J. R. Downing,
M. E. Selsted, and S. W. Hiebert.
1998.
The t(8;21) fusion product, AML-1-ETO, associates with C/EBP- , inhibits C/EBP- -dependent transcription, and blocks granulocytic differentiation.
Mol. Cell. Biol.
18:322-333[Abstract/Free Full Text].
|
| 64.
|
Wong, C. W., and M. L. Privalsky.
1998.
Components of the SMRT corepressor complex exhibit distinctive interactions with the POZ domain oncoproteins PLZF, PLZF-RARalpha, and BCL-6.
J. Biol. Chem.
273:27695-27702[Abstract/Free Full Text].
|
| 65.
|
Xu, L.,
C. K. Glass, and M. G. Rosenfeld.
1999.
Coactivator and corepressor complexes in nuclear receptor function.
Curr. Opin. Genet. Dev.
9:140-147[CrossRef][Medline].
|
| 66.
|
Yergeau, D. A.,
C. J. Hetherington,
Q. Wang,
P. Zhang,
A. H. Sharpe,
M. Binder,
M. Marin-Padilla,
D. G. Tenen,
N. A. Speck, and D. E. Zhang.
1997.
Embryonic lethality and impairment of haematopoiesis in mice heterozygous for an AML1-ETO fusion gene.
Nat. Genet.
15:303-306[CrossRef][Medline].
|
| 67.
|
Yeyati, P. L.,
R. Shaknovich,
S. Boterashvili,
J. Li,
H. J. Ball,
S. Waxman,
K. Nason-Burchenal,
E. Dmitrovsky,
A. Zelent, and J. D. Licht.
1999.
Leukemia translocation protein PLZF inhibits cell growth and expression of cyclin A.
Oncogene
18:925-934[CrossRef][Medline].
|
| 68.
|
Yoshida, M.,
S. Horinouchi, and T. Beppu.
1995.
Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function.
Bioessays
17:423-430[CrossRef][Medline].
|
Molecular and Cellular Biology, March 2000, p. 2075-2086, Vol. 20, No. 6
0270-7306/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chyla, B. J., Moreno-Miralles, I., Steapleton, M. A., Thompson, M. A., Bhaskara, S., Engel, M., Hiebert, S. W.
(2008). Deletion of Mtg16, a Target of t(16;21), Alters Hematopoietic Progenitor Cell Proliferation and Lineage Allocation. Mol. Cell. Biol.
28: 6234-6247
[Abstract]
[Full Text]
-
Kumar, R., Cheney, K. M., McKirdy, R., Neilsen, P. M., Schulz, R. B., Lee, J., Cohen, J., Booker, G. W., Callen, D. F.
(2008). CBFA2T3-ZNF652 Corepressor Complex Regulates Transcription of the E-box Gene HEB. J. Biol. Chem.
283: 19026-19038
[Abstract]
[Full Text]
-
Salat, D., Liefke, R., Wiedenmann, J., Borggrefe, T., Oswald, F.
(2008). ETO, but Not Leukemogenic Fusion Protein AML1/ETO, Augments RBP-J{kappa}/SHARP-Mediated Repression of Notch Target Genes. Mol. Cell. Biol.
28: 3502-3512
[Abstract]
[Full Text]
-
Moore, A. C., Amann, J. M., Williams, C. S., Tahinci, E., Farmer, T. E., Martinez, J. A., Yang, G., Luce, K. S., Lee, E., Hiebert, S. W.
(2008). Myeloid Translocation Gene Family Members Associate with T-Cell Factors (TCFs) and Influence TCF-Dependent Transcription. Mol. Cell. Biol.
28: 977-987
[Abstract]
[Full Text]
-
Costoya, J. A.
(2007). Functional analysis of the role of POK transcriptional repressors. Brief Funct Genomic Proteomic
0: elm002v1-11
[Abstract]
[Full Text]
-
Kumar, R., Manning, J., Spendlove, H. E., Kremmidiotis, G., McKirdy, R., Lee, J., Millband, D. N., Cheney, K. M., Stampfer, M. R., Dwivedi, P. P., Morris, H. A., Callen, D. F.
(2006). ZNF652, A Novel Zinc Finger Protein, Interacts with the Putative Breast Tumor Suppressor CBFA2T3 to Repress Transcription. Mol Cancer Res
4: 655-665
[Abstract]
[Full Text]
-
Brosens, J J, Gellersen, B
(2006). Death or survival - progesterone-dependent cell fate decisions in the human endometrial stroma.. J Mol Endocrinol
36: 389-398
[Abstract]
[Full Text]
-
Schuh, A. H., Tipping, A. J., Clark, A. J., Hamlett, I., Guyot, B., Iborra, F. J., Rodriguez, P., Strouboulis, J., Enver, T., Vyas, P., Porcher, C.
(2005). ETO-2 Associates with SCL in Erythroid Cells and Megakaryocytes and Provides Repressor Functions in Erythropoiesis. Mol. Cell. Biol.
25: 10235-10250
[Abstract]
[Full Text]
-
Kim, T.-A., Jiang, S., Seng, S., Cha, K., Avraham, H. K., Avraham, S.
(2005). The BTB domain of the nuclear matrix protein NRP/B is required for neurite outgrowth. J. Cell Sci.
118: 5537-5548
[Abstract]
[Full Text]
-
Sasai, N., Matsuda, E., Sarashina, E., Ishida, Y., Kawaichi, M.
(2005). Identification of a novel BTB-zinc finger transcriptional repressor, CIBZ, that interacts with CtBP corepressor. GENES CELLS
10: 871-885
[Abstract]
[Full Text]
-
Guidez, F., Howell, L., Isalan, M., Cebrat, M., Alani, R. M., Ivins, S., Hormaeche, I., McConnell, M. J., Pierce, S., Cole, P. A., Licht, J., Zelent, A.
(2005). Histone Acetyltransferase Activity of p300 Is Required for Transcriptional Repression by the Promyelocytic Leukemia Zinc Finger Protein. Mol. Cell. Biol.
25: 5552-5566
[Abstract]
[Full Text]
-
Melnick, A. M., Adelson, K., Licht, J. D.
(2005). The Theoretical Basis of Transcriptional Therapy of Cancer: Can It Be Put Into Practice?. JCO
23: 3957-3970
[Abstract]
[Full Text]
-
Mulloy, J. C., Jankovic, V., Wunderlich, M., Delwel, R., Cammenga, J., Krejci, O., Zhao, H., Valk, P. J. M., Lowenberg, B., Nimer, S. D.
(2005). AML1-ETO fusion protein up-regulates TRKA mRNA expression in human CD34+ cells, allowing nerve growth factor-induced expansion. Proc. Natl. Acad. Sci. USA
102: 4016-4021
[Abstract]
[Full Text]
-
Lausen, J., Cho, S., Liu, S., Werner, M. H.
(2004). The Nuclear Receptor Co-repressor (N-CoR) Utilizes Repression Domains I and III for Interaction and Co-repression with ETO. J. Biol. Chem.
279: 49281-49288
[Abstract]
[Full Text]
-
Takahashi, S., McConnell, M. J., Harigae, H., Kaku, M., Sasaki, T., Melnick, A. M., Licht, J. D.
(2004). The Flt3 internal tandem duplication mutant inhibits the function of transcriptional repressors by blocking interactions with SMRT. Blood
103: 4650-4658
[Abstract]
[Full Text]
-
Parrado, A., Robledo, M., Moya-Quiles, M. R., Marin, L. A., Chomienne, C., Padua, R. A., Alvarez-Lopez, M. R.
(2004). The promyelocytic leukemia zinc finger protein down-regulates apoptosis and expression of the proapoptotic BID protein in lymphocytes. Proc. Natl. Acad. Sci. USA
101: 1898-1903
[Abstract]
[Full Text]
-
Erkeland, S. J., Valkhof, M., Heijmans-Antonissen, C., van Hoven-Beijen, A., Delwel, R., Hermans, M. H. A., Touw, I. P.
(2004). Large-Scale Identification of Disease Genes Involved in Acute Myeloid Leukemia. J. Virol.
78: 1971-1980
[Abstract]
[Full Text]
-
Chevallier, N., Corcoran, C. M., Lennon, C., Hyjek, E., Chadburn, A., Bardwell, V. J., Licht, J. D., Melnick, A.
(2004). ETO protein of t(8;21) AML is a corepressor for Bcl-6 B-cell lymphoma oncoprotein. Blood
103: 1454-1463
[Abstract]
[Full Text]
-
Kang, S. I., Chang, W.-J., Cho, S.-G., Kim, I. Y.
(2003). Modification of Promyelocytic Leukemia Zinc Finger Protein (PLZF) by SUMO-1 Conjugation Regulates Its Transcriptional Repressor Activity. J. Biol. Chem.
278: 51479-51483
[Abstract]
[Full Text]
-
McConnell, M. J., Chevallier, N., Berkofsky-Fessler, W., Giltnane, J. M., Malani, R. B., Staudt, L. M., Licht, J. D.
(2003). Growth Suppression by Acute Promyelocytic Leukemia-Associated Protein PLZF Is Mediated by Repression of c-myc Expression. Mol. Cell. Biol.
23: 9375-9388
[Abstract]
[Full Text]
-
Fahnenstich, J., Nandy, A., Milde-Langosch, K., Schneider-Merck, T., Walther, N., Gellersen, B.
(2003). Promyelocytic leukaemia zinc finger protein (PLZF) is a glucocorticoid- and progesterone-induced transcription factor in human endometrial stromal cells and myometrial smooth muscle cells. Mol Hum Reprod
9: 611-623
[Abstract]
[Full Text]
-
Kalev-Zylinska, M. L., Horsfield, J. A., Flores, M. V. C., Postlethwait, J. H., Vitas, M. R., Baas, A. M., Crosier, P. S., Crosier, K. E.
(2003). Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development
129: 2015-2030
[Abstract]
[Full Text]
-
McLoughlin, P., Ehler, E., Carlile, G., Licht, J. D., Schafer, B. W.
(2002). The LIM-only Protein DRAL/FHL2 Interacts with and Is a Corepressor for the Promyelocytic Leukemia Zinc Finger Protein. J. Biol. Chem.
277: 37045-37053
[Abstract]
[Full Text]
-
Hug, B. A., Lee, S. Y. D., Kinsler, E. L., Zhang, J., Lazar, M. A.
(2002). Cooperative Function of Aml1-ETO Corepressor Recruitment Domains in the Expansion of Primary Bone Marrow Cells. Cancer Res.
62: 2906-2912
[Abstract]
[Full Text]
-
Alland, L., David, G., Shen-Li, H., Potes, J., Muhle, R., Lee, H.-C., Hou, H. Jr., Chen, K., DePinho, R. A.
(2002). Identification of Mammalian Sds3 as an Integral Component of the Sin3/Histone Deacetylase Corepressor Complex. Mol. Cell. Biol.
22: 2743-2750
[Abstract]
[Full Text]
-
Melnick, A., Carlile, G., Ahmad, K. F., Kiang, C.-L., Corcoran, C., Bardwell, V., Prive, G. G., Licht, J. D.
(2002). Critical Residues within the BTB Domain of PLZF and Bcl-6 Modulate Interaction with Corepressors. Mol. Cell. Biol.
22: 1804-1818
[Abstract]
[Full Text]
-
Ward, J. O., McConnell, M. J., Carlile, G. W., Pandolfi, P. P., Licht, J. D., Freedman, L. P.
(2001). The acute promyelocytic leukemia-associated protein, promyelocytic leukemia zinc finger, regulates 1,25-dihydroxyvitamin D3-induced monocytic differentiation of U937 cells through a physical interaction with vitamin D3 receptor. Blood
98: 3290-3300
[Abstract]
[Full Text]
-
Amann, J. M., Nip, J., Strom, D. K., Lutterbach, B., Harada, H., Lenny, N., Downing, J. R., Meyers, S., Hiebert, S. W.
(2001). ETO, a Target of t(8;21) in Acute Leukemia, Makes Distinct Contacts with Multiple Histone Deacetylases and Binds mSin3A through Its Oligomerization Domain. Mol. Cell. Biol.
21: 6470-6483
[Abstract]
[Full Text]
-
Burel, S. A., Harakawa, N., Zhou, L., Pabst, T., Tenen, D. G., Zhang, D.-E.
(2001). Dichotomy of AML1-ETO Functions: Growth Arrest versus Block of Differentiation. Mol. Cell. Biol.
21: 5577-5590
[Abstract]
[Full Text]
-
Zhang, J., Hug, B. A., Huang, E. Y., Chen, C. W., Gelmetti, V., Maccarana, M., Minucci, S., Pelicci, P. G., Lazar, M. A.
(2001). Oligomerization of ETO Is Obligatory for Corepressor Interaction. Mol. Cell. Biol.
21: 156-163
[Abstract]
[Full Text]
-
Melnick, A., Carlile, G. W., McConnell, M. J., Polinger, A., Hiebert, S. W., Licht, J. D.
(2000). AML-1/ETO fusion protein is a dominant negative inhibitor of transcriptional repression by the promyelocytic leukemia zinc finger protein. Blood
96: 3939-3947
[Abstract]
[Full Text]
-
Melnick, A., Ahmad, K. F., Arai, S., Polinger, A., Ball, H., Borden, K. L., Carlile, G. W., Prive, G. G., Licht, J. D.
(2000). In-Depth Mutational Analysis of the Promyelocytic Leukemia Zinc Finger BTB/POZ Domain Reveals Motifs and Residues Required for Biological and Transcriptional Functions. Mol. Cell. Biol.
20: 6550-6567
[Abstract]
[Full Text]
-
Nakase, K., Ishimaru, F., Avitahl, N., Dansako, H., Matsuo, K., Fujii, K., Sezaki, N., Nakayama, H., Yano, T., Fukuda, S., Imajoh, K., Takeuchi, M., Miyata, A., Hara, M., Yasukawa, M., Takahashi, I., Taguchi, H., Matsue, K., Nakao, S., Niho, Y., Takenaka, K., Shinagawa, K., Ikeda, K., Niiya, K., Harada, M.
(2000). Dominant Negative Isoform of the Ikaros Gene in Patients with Adult B-Cell Acute Lymphoblastic Leukemia. Cancer Res.
60: 4062-4065
[Abstract]
[Full Text]
-
Hildebrand, D., Tiefenbach, J., Heinzel, T., Grez, M., Maurer, A. B.
(2001). Multiple Regions of ETO Cooperate in Transcriptional Repression. J. Biol. Chem.
276: 9889-9895
[Abstract]
[Full Text]